Sha256: 8c421caeb94ff3a46da42307e67f8ad21ef02763793f2a695872651e2b203635
Contents?: true
Size: 774 Bytes
Versions: 19
Compression:
Stored size: 774 Bytes
Contents
@FAKE0011 Original version has lower case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order) ACGUACGUACGUACGUACGUACGUACGUACGUACGUACGUA + @ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefgh @FAKE0012 Original version has mixed case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order) gUcauAGcgUcauAGcgUcauAGcgUcauAGcgUcauAGcg + @ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefgh @FAKE0013 Original version has lower case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order) ucagucagucagucagucagucagucagucagucagucagu + @ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefgh @FAKE0014 Original version has mixed case ambiguous RNA with PHRED scores from 35 to 40 inclusive (cycled) gaucrywsmkhbvdnGAUCRYWSMKHBVDN + cdefghcdefghcdefghcdefghcdefgh
Version data entries
19 entries across 19 versions & 2 rubygems