tracks/fsharp/exercises/nucleotide-count/NucleotideCountTest.fs in trackler-2.2.1.64 vs tracks/fsharp/exercises/nucleotide-count/NucleotideCountTest.fs in trackler-2.2.1.65

@@ -9,48 +9,48 @@
 
 [<Fact>]
 let ``Empty strand`` () =
     let strand = ""
     let expected = 
-        [ ('A', 0)
-          ('C', 0)
-          ('G', 0)
+        [ ('A', 0);
+          ('C', 0);
+          ('G', 0);
           ('T', 0) ]
         |> Map.ofList
         |> Some
     nucleotideCounts strand |> should equal expected
 
 [<Fact(Skip = "Remove to run test")>]
 let ``Can count one nucleotide in single-character input`` () =
     let strand = "G"
     let expected = 
-        [ ('A', 0)
-          ('C', 0)
-          ('G', 1)
+        [ ('A', 0);
+          ('C', 0);
+          ('G', 1);
           ('T', 0) ]
         |> Map.ofList
         |> Some
     nucleotideCounts strand |> should equal expected
 
 [<Fact(Skip = "Remove to run test")>]
 let ``Strand with repeated nucleotide`` () =
     let strand = "GGGGGGG"
     let expected = 
-        [ ('A', 0)
-          ('C', 0)
-          ('G', 7)
+        [ ('A', 0);
+          ('C', 0);
+          ('G', 7);
           ('T', 0) ]
         |> Map.ofList
         |> Some
     nucleotideCounts strand |> should equal expected
 
 [<Fact(Skip = "Remove to run test")>]
 let ``Strand with multiple nucleotides`` () =
     let strand = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"
     let expected = 
-        [ ('A', 20)
-          ('C', 12)
-          ('G', 17)
+        [ ('A', 20);
+          ('C', 12);
+          ('G', 17);
           ('T', 21) ]
         |> Map.ofList
         |> Some
     nucleotideCounts strand |> should equal expected