test_nocache_gff3.rtest in bio-gff3-0.9.0

- old
+ new

@@ -1,6 +1,5 @@
- INFO bio-gff3: Memory used BaseLine RAM 10M, VMEM 14M
  INFO bio-gff3: ---- Digest DB and store data in mRNA Hash (NoCache) <>
  INFO bio-gff3: Added transcript with component ID Transcript:trans-1 <>
  INFO bio-gff3: Adding exon <Transcript:trans-1> <>
  INFO bio-gff3: Adding exon <Transcript:trans-1> <>
  INFO bio-gff3: Adding exon <Transcript:trans-1> <>
@@ -56,7 +55,6 @@
  INFO bio-gff3: find_component: Matched seqname <test01>
 >cds1 Sequence:test01_1:400 (164:190, 192:200)
 TGGCGACTATCGGTCGAAGTTAAGACATTCATGGGC
  INFO bio-gff3: find_component: Matched seqname <test01>
 >cds2 Sequence:test01_1:400 (192:200)
-TTCATGGGC
- INFO bio-gff3: Memory used Done RAM 10M, VMEM 14M
+TTCATGGGC
\ No newline at end of file