test_nocache_gff3.rtest in bio-gff3-0.8.6

- old
+ new

@@ -1,6 +1,7 @@
- INFO bio-gff3: ---- Digest DB and store data in mRNA Hash <>
+ INFO bio-gff3: Memory used BaseLine RAM 10M, VMEM 14M
+ INFO bio-gff3: ---- Digest DB and store data in mRNA Hash (NoCache) <>
  INFO bio-gff3: Added transcript with component ID Transcript:trans-1 <>
  INFO bio-gff3: Adding exon <Transcript:trans-1> <>
  INFO bio-gff3: Adding exon <Transcript:trans-1> <>
  INFO bio-gff3: Adding exon <Transcript:trans-1> <>
  INFO bio-gff3: Adding CDS <Transcript:trans-1> <>
@@ -8,35 +9,30 @@
  INFO bio-gff3: Adding CDS <Transcript:trans-1> <>
  INFO bio-gff3: Added transcript with component ID Transcript:trans-2 <>
  INFO bio-gff3: Adding exon <Transcript:trans-2> <>
  INFO bio-gff3: Adding exon <Transcript:trans-2> <>
  INFO bio-gff3: Adding exon <Transcript:trans-2> <>
- WARN bio-gff3: Record with unknown ID.	.	.	.	.	.	.	.	.
  WARN bio-gff3: Container <Component> has no ID, so using sequence name instead <Contig2 1 2000>
  INFO bio-gff3: Added Component with component ID Contig2 1 2000 <>
  WARN bio-gff3: Container <Component> has no ID, so using sequence name instead <Contig2 2001 5000>
  INFO bio-gff3: Added Component with component ID Contig2 2001 5000 <>
  WARN bio-gff3: Container <Component> has no ID, so using sequence name instead <Contig2 5001 20000>
  INFO bio-gff3: Added Component with component ID Contig2 5001 20000 <>
  WARN bio-gff3: Container <Component> has no ID, so using sequence name instead <Contig2 2001 37450>
  INFO bio-gff3: Added Component with component ID Contig2 2001 37450 <>
  INFO bio-gff3: Added transcript with component ID Transcript:trans-3 <>
  INFO bio-gff3: Added transcript with component ID Transcript:trans-4 <>
- WARN bio-gff3: Record with unknown ID.	.	.	.	.	.	.	.	.
- WARN bio-gff3: Record with unknown ID.	.	.	.	.	.	.	.	.
  INFO bio-gff3: Added Component with component ID Clone:AL12345.2 <>
  INFO bio-gff3: Adding mRNA <mRNA:trans-8> <>
  INFO bio-gff3: Adding CDS <mRNA:trans-8> <>
  INFO bio-gff3: Adding CDS <mRNA:trans-8> <>
  INFO bio-gff3: Adding CDS <mRNA:trans-8> <>
- WARN bio-gff3: Record with unknown ID.	.	.	.	.	.	.	.	.
  INFO bio-gff3: Added Component with component ID Clone:ABC123 <>
  INFO bio-gff3: Added gene with component ID Misc:thing1 <>
  INFO bio-gff3: Adding gene <Misc:thing1> <>
  INFO bio-gff3: Adding mRNA <Misc:thing2> <>
  INFO bio-gff3: Adding CDS <Misc:thing3> <>
- WARN bio-gff3: Record with unknown ID.	.	.	.	.	.	.	.	.
  INFO bio-gff3: Added contig with component ID test01 <>
  INFO bio-gff3: Added gene with component ID gene01 <>
  INFO bio-gff3: Adding gene <gene01> <>
  INFO bio-gff3: Adding mRNA <mrna01short> <>
  INFO bio-gff3: Adding mRNA <mrna01> <>
@@ -61,5 +57,6 @@
 >cds1 Sequence:test01_1:400 (164:190, 192:200)
 TGGCGACTATCGGTCGAAGTTAAGACATTCATGGGC
  INFO bio-gff3: find_component: Matched seqname <test01>
 >cds2 Sequence:test01_1:400 (192:200)
 TTCATGGGC
+ INFO bio-gff3: Memory used Done RAM 10M, VMEM 14M