Sha256: f87ae1e4f4110d370dca27fe7d332974ac0162713618411f389f62c6c7dcec70
Contents?: true
Size: 1.02 KB
Versions: 86
Compression:
Stored size: 1.02 KB
Contents
package dna
// Source: exercism/problem-specifications
// Commit: 879a096 nucleotide-count: Apply new "input" policy
// Problem Specifications Version: 1.3.0
// count all nucleotides in a strand
var testCases = []struct {
description string
strand string
expected Histogram
errorExpected bool
}{
{
description: "empty strand",
strand: "",
expected: Histogram{'A': 0, 'C': 0, 'G': 0, 'T': 0},
},
{
description: "can count one nucleotide in single-character input",
strand: "G",
expected: Histogram{'A': 0, 'C': 0, 'G': 1, 'T': 0},
},
{
description: "strand with repeated nucleotide",
strand: "GGGGGGG",
expected: Histogram{'A': 0, 'C': 0, 'G': 7, 'T': 0},
},
{
description: "strand with multiple nucleotides",
strand: "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC",
expected: Histogram{'A': 20, 'C': 12, 'G': 17, 'T': 21},
},
{
description: "strand with invalid nucleotides",
strand: "AGXXACT",
errorExpected: true,
},
}
Version data entries
86 entries across 86 versions & 1 rubygems