require 'spec_helper' # Cause the test to fail if Capybara is not available exit! unless $capybara_available describe 'a browser', :js => true do sequence = 'ATCGATCAGCTACGATCAGCATCGACTAGCATCGACTACGA' sample_nucl_db = 'Sinvicta 2-2-3 cdna subset' # sample_prot_db = 'Sinvicta2-2-3.prot' before do Capybara.app = SequenceServer.init Capybara.javascript_driver = :selenium end it 'runs a simple blastn search' do visit '/' fill_in('sequence', with: sequence, wait: 5) check(sample_nucl_db) click_button('method') # switch to new window because link opens in new window page.driver.browser.switch_to.window(page.driver.browser.window_handles.last) page.should have_content('Query', wait: 5) end it 'properly controls blast button' do visit '/' fill_in('sequence', :with => sequence) page.evaluate_script("$('#method').is(':disabled')").should eq(true) check(sample_nucl_db) page.evaluate_script("$('#method').is(':disabled')").should eq(false) end it 'properly controls interaction with database listing' do visit '/' fill_in('sequence', :with => sequence) check(sample_nucl_db) page.evaluate_script("$('.protein .database').first().hasClass('disabled')") .should eq(true) end it 'shows a dropdown menu when other blast methods are available' do visit '/' fill_in('sequence', :with => sequence) check(sample_nucl_db) page.save_screenshot('screenshot.png') page.has_css?('button.dropdown-toggle').should eq(true) end end