Feature: Producing a gff3 view of a scaffold's annotations In order to view scaffold annotations A user can use the "gff" command to generate gff3 view of scaffold annotations @disable-bundler Scenario: Getting the man page for the scaffold gff view Given I create a new genomer project When I run `genomer man view gff` Then the exit status should be 0 And the output should contain a valid man page And the output should contain "GENOMER-VIEW-GFF(1)" @disable-bundler Scenario: A single annotation on a single contig Given I successfully run `genomer init project` And I cd to "project" And I write to "assembly/scaffold.yml" with: """ --- - sequence: source: contig1 """ And I write to "assembly/sequence.fna" with: """ >contig1 AAAAATTTTTGGGGGCCCCC """ And I write to "assembly/annotations.gff" with: """ ##gff-version 3 contig1 . gene 1 3 . + 1 . """ And I append to "Gemfile" with: """ gem 'genomer-plugin-view', :path => '../../../' """ When I run `genomer view gff --identifier=genome` Then the exit status should be 0 And the output should contain: """ ##gff-version 3 genome . gene 1 3 . + 1 . """ @disable-bundler Scenario: Two annotations on a single contig Given I successfully run `genomer init project` And I cd to "project" And I write to "assembly/scaffold.yml" with: """ --- - sequence: source: contig1 """ And I write to "assembly/sequence.fna" with: """ >contig1 AAAAATTTTTGGGGGCCCCC """ And I write to "assembly/annotations.gff" with: """ ##gff-version 3 contig1 . gene 1 3 . + 1 . contig1 . gene 4 6 . + 1 . """ And I append to "Gemfile" with: """ gem 'genomer-plugin-view', :path => '../../../' """ When I run `genomer view gff --identifier=genome` Then the exit status should be 0 And the output should contain: """ ##gff-version 3 genome . gene 1 3 . + 1 . genome . gene 4 6 . + 1 . """ @disable-bundler Scenario: Reseting locus tag numbering at the scaffold origin Given I successfully run `genomer init project` And I cd to "project" And I write to "assembly/scaffold.yml" with: """ --- - sequence: source: contig1 """ And I write to "assembly/sequence.fna" with: """ >contig1 AAAAATTTTTGGGGGCCCCC """ And I write to "assembly/annotations.gff" with: """ ##gff-version 3 contig1 . gene 1 3 . + 1 ID=gene1 contig1 . gene 4 6 . + 1 ID=gene2 """ And I append to "Gemfile" with: """ gem 'genomer-plugin-view', :path => '../../../' """ When I run `genomer view gff --identifier=genome --reset_locus_numbering` Then the exit status should be 0 And the output should contain: """ ##gff-version 3 genome . gene 1 3 . + 1 ID=000001 genome . gene 4 6 . + 1 ID=000002 """ @disable-bundler Scenario: Reseting locus tag numbering at specified start value Given I successfully run `genomer init project` And I cd to "project" And I write to "assembly/scaffold.yml" with: """ --- - sequence: source: contig1 """ And I write to "assembly/sequence.fna" with: """ >contig1 AAAAATTTTTGGGGGCCCCC """ And I write to "assembly/annotations.gff" with: """ ##gff-version 3 contig1 . gene 1 3 . + 1 ID=gene1 contig1 . gene 4 6 . + 1 ID=gene2 """ And I append to "Gemfile" with: """ gem 'genomer-plugin-view', :path => '../../../' """ When I run `genomer view gff --identifier=genome --reset_locus_numbering=5` Then the exit status should be 0 And the output should contain: """ ##gff-version 3 genome . gene 1 3 . + 1 ID=000005 genome . gene 4 6 . + 1 ID=000006 """ @disable-bundler Scenario: Reseting locus tag at the scaffold origin with unordered annotations Given I successfully run `genomer init project` And I cd to "project" And I write to "assembly/scaffold.yml" with: """ --- - sequence: source: contig1 """ And I write to "assembly/sequence.fna" with: """ >contig1 AAAAATTTTTGGGGGCCCCC """ And I write to "assembly/annotations.gff" with: """ ##gff-version 3 contig1 . gene 10 12 . + 1 ID=gene4 contig1 . gene 4 6 . + 1 ID=gene2 contig1 . gene 1 3 . + 1 ID=gene1 contig1 . gene 7 9 . + 1 ID=gene3 """ And I append to "Gemfile" with: """ gem 'genomer-plugin-view', :path => '../../../' """ When I run `genomer view gff --identifier=genome --reset_locus_numbering` Then the exit status should be 0 And the output should contain: """ ##gff-version 3 genome . gene 1 3 . + 1 ID=000001 genome . gene 4 6 . + 1 ID=000002 genome . gene 7 9 . + 1 ID=000003 genome . gene 10 12 . + 1 ID=000004 """ @disable-bundler Scenario: Adding a prefix to annotation locus tags Given I successfully run `genomer init project` And I cd to "project" And I write to "assembly/scaffold.yml" with: """ --- - sequence: source: contig1 """ And I write to "assembly/sequence.fna" with: """ >contig1 AAAAATTTTTGGGGGCCCCC """ And I write to "assembly/annotations.gff" with: """ ##gff-version 3 contig1 . gene 1 3 . + 1 ID=gene1 contig1 . gene 4 6 . + 1 ID=gene2 """ And I append to "Gemfile" with: """ gem 'genomer-plugin-view', :path => '../../../' """ When I run `genomer view gff --identifier=genome --prefix=pre_` Then the exit status should be 0 And the output should contain: """ ##gff-version 3 genome . gene 1 3 . + 1 ID=pre_gene1 genome . gene 4 6 . + 1 ID=pre_gene2 """