Sha256: ebe8212102c1d9a6e6603e00e0390e34e56c28062705333c047f7e33d15ab1d4
Contents?: true
Size: 1.48 KB
Versions: 16
Compression:
Stored size: 1.48 KB
Contents
require_relative "SNP" require 'bio-samtools' module Bio::PolyploidTools class SNPSequenceException < RuntimeError end class SNPSequence < SNP attr_accessor :sequence_original #Format: #snp name,chromsome from contig,microarray sequence #BS00068396_51,2AS,CGAAGCGATCCTACTACATTGCGTTCCTTTCCCACTCCCAGGTCCCCCTA[T/C]ATGCAGGATCTTGATTAGTCGTGTGAACAACTGAAATTTGAGCGCCACAA def self.parse(reg_str) reg_str.chomp! snp = SNPSequence.new arr = reg_str.split(",") if arr.size == 3 snp.gene, snp.chromosome, snp.sequence_original = reg_str.split(",") elsif arr.size == 2 snp.gene, snp.sequence_original = arr else throw SNPSequenceException.new "Need two or three fields to parse, and got #{arr.size} in #{reg_str}" end #snp.position = snp.position.to_i #snp.original.upcase! #snp.snp.upcase! snp.chromosome. strip! snp.parse_sequence_snp snp end def parse_sequence_snp pos = 0 match_data = /(?<pre>\w*)\[(?<org>[ACGT])\/(?<snp>[ACGT])\](?<pos>\w*)/.match(sequence_original.strip) if match_data @position = Regexp.last_match(:pre).size + 1 @original = Regexp.last_match(:org) @snp = Regexp.last_match(:snp) amb_base = Bio::NucleicAcid.to_IUAPC("#{@original}#{@snp}") @template_sequence = "#{Regexp.last_match(:pre)}#{amb_base}#{Regexp.last_match(:pos)}" end end end end
Version data entries
16 entries across 16 versions & 1 rubygems