# RSpec for BioRuby-GFF3-Plugin. Run with something like: # # rspec -I ../bioruby/lib/ spec/gffdb_spec.rb # # Copyright (C) 2010 Pjotr Prins # $: << "../lib" require 'bio-gff3' include Bio::GFFbrowser TEST_NON_IMPLEMENTED=false # GFF3 with included FASTA: TESTGFF1='test/data/gff/test.gff3' # GFF3 with external FASTA: TESTGFF1EXT='test/data/gff/test-ext-fasta.gff3' TESTGFF1FASTA='test/data/gff/test-ext-fasta.fa' def iterators_should_be_implemented if TEST_NON_IMPLEMENTED it "should implement each_gene" it "should implement each_mRNA" it "should implement each_exon" it "should implement each_exon_seq" it "should implement each_CDS" end it "should implement each_gene_seq" do h = {} ; @gff.each_gene_seq { | id, seq | h[id] = seq } h["gene01 Sequence:test01_1:400 (3:280)"].should == "GAAGATTTGTATGACTGATTTATCCTGGACAGGCATTGGTCAGATGTCTCCTTCCGTATCGTCGTTTAGTTGCAAATCCGAGTGTTCGGGGGTATTGCTATTTGCCACCTAGAAGCGCAACATGCCCAGCTTCACACACCATAGCGAACACGCCGCCCCGGTGGCGACTATCGGTCGAAGTTAAGACAATTCATGGGCGAAACGAGATAATGGGTACTGCACCCCTCGTCCTGTAGAGACGTCACAGCCAACGTGCCTTCTTATCTTGATACATTA" if h["gene01 Sequence:test01_1:400 (3:280)"] end it "should implement each_mRNA_seq" do h = {} ; @gff.each_mRNA_seq { | id, seq | h[id] = seq } h["mrna01short Sequence:test01_1:400 (3:14)"].should == "GAAGATTTGTAT" end it "should implement each_CDS_seq" do h = {} ; @gff.each_CDS_seq { | id, seq | h[id] = seq } h.keys.sort[0].should == "cds1 Sequence:test01_1:400 (164:190, 192:200)" h["cds_short Sequence:test01_1:400 (3:14)"].should == "GAAGATTTGTAT" end end describe GFF3, "GFF3 API (InMemory) with everything in memory" do before :all do # initialize gff3 = Bio::GFFbrowser::GFF3.new(TESTGFF1) @gff = gff3.assembler end iterators_should_be_implemented end describe GFF3, "GFF3 API with :cache_components => 1000, :cache_records => :cache_none" do before :all do # initialize gff3 = Bio::GFFbrowser::GFF3.new(TESTGFF1, :cache_components => :cache_none, :cache_records => :cache_lru) @gff = gff3.assembler end iterators_should_be_implemented end describe GFF3, "GFF3 API with :cache_components => 1000, :cache_records => 1000" do it "should implement real caching" # iterators_should_be_implemented end describe GFF3, "GFF3 API with :cache_records => :cache_none" do # iterators_should_be_implemented end describe GFF3, "GFF3 API (NoCache) with :cache_components => :cache_none, :cache_records => :cache_none" do before :all do # initialize gff3 = Bio::GFFbrowser::GFF3.new(TESTGFF1, :cache_components => :cache_none, :cache_records => :cache_none) @gff = gff3.assembler end iterators_should_be_implemented end describe GFF3, "GFF3 API (InMemory) with external FASTA" do before :all do gff3 = Bio::GFFbrowser::GFF3.new(TESTGFF1EXT, :parser => :line, :fasta_filename => TESTGFF1FASTA) @gff = gff3.assembler end it "should have a sequence list" do @gff.parse @gff.sequencelist["test02"].should_not == nil end iterators_should_be_implemented end describe GFF3, "GFF3 API (NoCache) with external FASTA" do before :all do gff3 = Bio::GFFbrowser::GFF3.new(TESTGFF1EXT, :fasta_filename => TESTGFF1FASTA, :cache_components => :cache_none, :cache_records => :cache_none) @gff = gff3.assembler end iterators_should_be_implemented end