# # test/unit/bio/sequence/test_common.rb - Unit test for Bio::Sequencce::Common # # Copyright:: Copyright (C) 2006-2008 # Mitsuteru C. Nakao , # Naohisa Goto # License:: The Ruby License # # $Id:$ # # loading helper routine for testing bioruby require 'pathname' load Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 3, 'bioruby_test_helper.rb')).cleanpath.to_s # libraries needed for the tests require 'test/unit' require 'bio/sequence' require 'bio/sequence/common' module Bio; module TestSequenceCommon class TSequence < String include Bio::Sequence::Common end class TestSequenceCommon < Test::Unit::TestCase def setup @obj = TSequence.new('atgcatgcatgcatgcaaaa') end def test_to_s assert_equal('atgcatgcatgcatgcaaaa', @obj.to_s) end def test_to_str assert_equal('atgcatgcatgcatgcaaaa', @obj.to_str) end def test_seq str = "atgcatgcatgcatgcaaaa" assert_equal(str, @obj.seq) end # <<(*arg) def test_push str = "atgcatgcatgcatgcaaaaA" assert_equal(str, @obj << "A") end # concat(*arg) def test_concat str = "atgcatgcatgcatgcaaaaA" assert_equal(str, @obj.concat("A")) end # +(*arg) def test_sum str = "atgcatgcatgcatgcaaaaatgcatgcatgcatgcaaaa" assert_equal(str, @obj + @obj) end # window_search(window_size, step_size = 1) def test_window_search @obj.window_search(4) do |subseq| assert_equal(20, @obj.size) end end #total(hash) def test_total hash = {'a' => 1, 'c' => 2, 'g' => 4, 't' => 3} assert_equal(44.0, @obj.total(hash)) end def test_composition composition = {"a"=>8, "c"=>4, "g"=>4, "t"=>4} assert_equal(composition, @obj.composition) end def test_splicing #(position) assert_equal("atgcatgc", @obj.splicing("join(1..4, 13..16)")) end end class TestSequenceCommonNormalize < Test::Unit::TestCase def test_no_normalize str = "atgcatgcatgcatgcaaaA" obj = TSequence.new(str) assert_equal("atgcatgcatgcatgcaaaA", obj) end def test_normalize_A str = "atgcatgcatgcatgcaaaA" seq = TSequence.new(str) assert_equal("atgcatgcatgcatgcaaaA", seq) obj = seq.normalize! assert_equal("atgcatgcatgcatgcaaaA", obj) end def test_normalize_a str = "atgcatgcatgcatgcaaa" seq = TSequence.new(str) assert_equal("atgcatgcatgcatgcaaa", seq) obj = seq.normalize! assert_equal("atgcatgcatgcatgcaaa", obj) end end class TestSequenceCommonRandomize < Test::Unit::TestCase def setup @str = "attcacgcctgctattcccgtcagcctgagcttgccgcgaagctgatgaaagatgttatc" @seq = TSequence.new(@str) @orig = TSequence.new(@str) end # test for Bio::Sequence::Common#randomize(hash = nil) def test_randomize rseqs = (0..2).collect { |i| @seq.randomize } # not breaking given seq? assert_equal(@orig, @seq) # same length? rseqs.each do |rseq| assert_equal(@orig.length, rseq.length) end # same composition? [ 'a', 'c', 'g', 't', 'n' ].each do |chr| count = @orig.count(chr) rseqs.each do |rseq| assert_equal(count, rseq.count(chr)) end end # randomized? (very simple check) assert(rseqs[0] != rseqs[1]) assert(rseqs[0] != rseqs[2]) assert(rseqs[1] != rseqs[2]) end # testing Bio::Sequence::Common#randomize() { |x| ... } def test_randomize_with_block composition = Hash.new(0) [ 'a', 'c', 'g', 't' ].each do |chr| composition[chr] = @seq.count(chr) end rseqs = (0..2).collect do |i| newcomposition = Hash.new(0) newseq = '' ret = @seq.randomize do |c| assert_kind_of(TSequence, c) newcomposition[c] += 1 newseq.concat c end # same length? assert_equal(@orig.length, newseq.length) # same composition? assert_equal(composition, newcomposition) # returned value is empty sequence? assert_equal(TSequence.new(''), ret) # not breaking given seq? assert_equal(@orig, @seq) newseq end # randomized? (very simple check) assert(rseqs[0] != rseqs[1]) assert(rseqs[0] != rseqs[2]) assert(rseqs[1] != rseqs[2]) end # testing Bio::Sequence::Common#randomize(hash) def test_randomize_with_hash hash = { 'a' => 20, 'c' => 19, 'g' => 18, 't' => 17 } hash.default = 0 len = 0 hash.each_value { |v| len += v } rseqs = (0..2).collect do |i| rseq = @seq.randomize(hash) # same length? assert_equal(len, rseq.length) # same composition? [ 'a', 'c', 'g', 't', 'n' ].each do |chr| assert_equal(hash[chr], rseq.count(chr)) end # returned value is instance of TSequence? assert_instance_of(TSequence, rseq) # not breaking given seq? assert_equal(@orig, @seq) rseq end # randomized? (very simple check) assert(rseqs[0] != rseqs[1]) assert(rseqs[0] != rseqs[2]) assert(rseqs[1] != rseqs[2]) end # testing Bio::Sequence::Common#randomize(hash) { |x| ... } def test_randomize_with_hash_block hash = { 'a' => 20, 'c' => 19, 'g' => 18, 't' => 17 } hash.default = 0 len = 0 hash.each_value { |v| len += v } rseqs = (0..2).collect do |i| newcomposition = Hash.new(0) newseq = '' ret = @seq.randomize(hash) do |c| #assert_kind_of(TSequence, c) assert_kind_of(String, c) newcomposition[c] += 1 newseq.concat c end # same length? assert_equal(len, newseq.length) # same composition? assert_equal(hash, newcomposition) # returned value is empty TSequence? assert_equal(TSequence.new(''), ret) # not breaking given seq? assert_equal(@orig, @seq) newseq end # randomized? (very simple check) assert(rseqs[0] != rseqs[1]) assert(rseqs[0] != rseqs[2]) assert(rseqs[1] != rseqs[2]) end def chi2(hist, f, k) chi2 = 0 (0...k).each do |i| chi2 += ((hist[i] - f) ** 2).quo(f) end chi2 end private :chi2 # chi-square test for distribution of chi2 values from # distribution of index('a') def randomize_equiprobability # Reference: http://www.geocities.jp/m_hiroi/light/pystat04.html seq = TSequence.new('ccccgggtta') # length must be 10 k = 10 hist = Array.new(k, 0) iter = 200 # F for index('a') f = iter.quo(seq.length).to_f # chi2 distribution, degree of freedom 9 # Reference: http://www.geocities.jp/m_hiroi/light/pystat04.html # Reference: http://keisan.casio.jp/has10/SpecExec.cgi # P = 0.9, 0.8, 0.7, ... 0.1, 0 chi2_table = [ 14.684, 12.242, 10.656, 9.414, 8.343, 7.357, 6.393, 5.380, 4.168, 0.000 ] chi2_hist = Array.new(k, 0) chi2_iter = 200 chi2_iter.times do hist.fill(0) iter.times { hist[yield(seq).index('a')] += 1 } chi2 = chi2(hist, f, k) idx = (0...(chi2_table.size)).find { |i| chi2 >= chi2_table[i] } chi2_hist[idx] += 1 end chi2_f = chi2_iter.quo(k).to_f chi2_chi2 = chi2(chi2_hist, chi2_f, k) #$stderr.puts chi2_chi2 ## chi-square test, freedom 9, significance level 5% #assert_operator(16.919, :>, chi2_chi2, "test of chi2 < 16.919 failed (#{chi2_chi2})") # chi-square test, freedom 9, significance level 1% assert_operator(21.666, :>, chi2_chi2, "test of chi2 < 21.666 failed (#{chi2_chi2})") end private :randomize_equiprobability def test_randomize_equiprobability randomize_equiprobability { |seq| seq.randomize } end def test_randomize_with_hash_equiprobability hash = { 'c' => 4, 'g' => 3, 't' => 2, 'a' => 1 } randomize_equiprobability { |seq| seq.randomize(hash) } end ## disabled because it takes too long time. #def test_randomize_with_block_equiprobability # randomize_equiprobability do |seq| # newseq = '' # seq.randomize do |c| # newseq.concat c # end # newseq # end #end ## disabled because it takes too long time. #def test_randomize_with_hash_block_equiprobability # hash = { 'c' => 4, 'g' => 3, 't' => 2, 'a' => 1 } # randomize_equiprobability do |seq| # newseq = '' # seq.randomize(hash) do |c| # newseq.concat c # end # newseq # end #end end class TestSequenceCommonSubseq < Test::Unit::TestCase #def subseq(s = 1, e = self.length) def test_to_s_returns_self_as_string s = "abcefghijklmnop" sequence = TSequence.new(s) assert_equal(s, sequence.to_s, "wrong value") assert_instance_of(String, sequence.to_s, "not a String") end def test_subseq_returns_RuntimeError_blank_sequence_default_end sequence = TSequence.new("") assert_raise(RuntimeError) { sequence.subseq(5) } end def test_subseq_returns_RuntimeError_start_less_than_one sequence = TSequence.new("blahblah") assert_raise(RuntimeError) { sequence.subseq(0) } end def test_subseq_returns_subsequence sequence = TSequence.new("hahasubhehe") assert_equal("sub", sequence.subseq(5,7)) end end # Test Sequence#window_wearch class TestSequenceCommonWindowSearch < Test::Unit::TestCase def test_window_search_with_width_3_default_step_no_residual sequence = TSequence.new("agtca") windows = [] returned_value = sequence.window_search(3) { |window| windows << window } assert_equal(["agt", "gtc", "tca"], windows, "windows wrong") assert_equal("", returned_value, "returned value wrong") end # added def test_window_search_with_width_3_step_two_with_residual sequence = TSequence.new("agtcat") windows = [] returned_value = sequence.window_search(3, 2) { |window| windows << window } assert_equal(["agt", "tca"], windows, "windows wrong") assert_equal("t", returned_value, "returned value wrong") end end end; end #module Bio; module TestSequenceCommon