# Copyright © 2004-2008 Brent Fulgham, 2005-2015 Isaac Gouy # # All rights reserved. # # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions are met: # # * Redistributions of source code must retain the above copyright notice, # this list of conditions and the following disclaimer. # # * Redistributions in binary form must reproduce the above copyright notice, # this list of conditions and the following disclaimer in the documentation # and/or other materials provided with the distribution. # # * Neither the name of "The Computer Language Benchmarks Game" nor the name # of "The Computer Language Shootout Benchmarks" nor the names of its # contributors may be used to endorse or promote products derived from this # software without specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" # AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE # IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE # DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE LIABLE # FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL # DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR # SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER # CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, # OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE # OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. # The Computer Language Benchmarks Game # http://benchmarksgame.alioth.debian.org/ # Contributed by Sokolov Yura # Modified by Joseph LaFata # http://benchmarksgame.alioth.debian.org/u32/program.php?test=fasta&lang=yarv&id=2 ALU = "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+ "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+ "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+ "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+ "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+ "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+ "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA" def make_repeat_fasta(src, n) l = src.length s = src * ((n / l) + 1) s.slice!(n, l) output = '' 0.step(s.length-1,60) {|x| output << s[x,60]; output << "\n"} output end def harness_input 100_000_000 end def harness_sample(input) make_repeat_fasta(ALU, input) end def harness_verify(output) output.length == 101666667 end require 'bench9000/harness'