Sha256: ce48b0dd0442c1369c8e5a023645fc044a82b2fd8105556c73351dc2cf62582e
Contents?: true
Size: 1.55 KB
Versions: 35
Compression:
Stored size: 1.55 KB
Contents
// This file was auto-generated based on version 1.2.0 of the canonical data.
module NucleotideCountTest
open FsUnit.Xunit
open Xunit
open NucleotideCount
[<Fact>]
let ``Empty strand`` () =
let strand = ""
let expected =
[ ('A', 0);
('C', 0);
('G', 0);
('T', 0) ]
|> Map.ofList
|> Some
nucleotideCounts strand |> should equal expected
[<Fact(Skip = "Remove to run test")>]
let ``Can count one nucleotide in single-character input`` () =
let strand = "G"
let expected =
[ ('A', 0);
('C', 0);
('G', 1);
('T', 0) ]
|> Map.ofList
|> Some
nucleotideCounts strand |> should equal expected
[<Fact(Skip = "Remove to run test")>]
let ``Strand with repeated nucleotide`` () =
let strand = "GGGGGGG"
let expected =
[ ('A', 0);
('C', 0);
('G', 7);
('T', 0) ]
|> Map.ofList
|> Some
nucleotideCounts strand |> should equal expected
[<Fact(Skip = "Remove to run test")>]
let ``Strand with multiple nucleotides`` () =
let strand = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"
let expected =
[ ('A', 20);
('C', 12);
('G', 17);
('T', 21) ]
|> Map.ofList
|> Some
nucleotideCounts strand |> should equal expected
[<Fact(Skip = "Remove to run test")>]
let ``Strand with invalid nucleotides`` () =
let strand = "AGXXACT"
let expected = None
nucleotideCounts strand |> should equal expected
Version data entries
35 entries across 35 versions & 1 rubygems