blastxmlparser is listed at http://biogems.info/ = bio-blastxmlparser blastxmlparser is a very fast big-data BLAST XML file parser, which can be used as command line utility, or as a Ruby library. Rather than loading everything in memory, XML is parsed by BLAST query (Iteration). Not only has this the advantage of low memory use, it also shows results early, and it may be faster when IO continues in parallel (disk read-ahead). Next to the API, blastxmlparser comes as a command line utility, which can be used to filter results and requires no understanding of Ruby. = Quick start gem install bio-blastxmlparser blastxmlparser --help (see Installation, below, if it does not work) == Performance XML parsing is expensive. blastxmlparser uses the fast Nokogiri C, or Java, XML parsers, based on libxml2. Basically, a DOM parser is used for subsections of a document. Tests show this is faster than a SAX parser with Ruby callbacks. To see why libxml2 based Nokogiri is fast, see http://www.rubyinside.com/ruby-xml-performance-benchmarks-1641.html and http://www.xml.com/lpt/a/1703. The parser is also designed with other optimizations, such as lazy evaluation, only creating objects when required, and (in a future version) parallelization. When parsing a full BLAST result usually only a few fields are used. By using XPath queries only the relevant fields are queried. Timings for parsing test/data/nt_example_blastn.m7 (file size 3.4Mb) bio-blastxmlparser + Nokogiri DOM (default) real 0m1.259s user 0m1.052s sys 0m0.144s bio-blastxmlparser + Nokogiri split DOM real 0m1.713s user 0m1.444s sys 0m0.160s BioRuby ReXML DOM parser real 1m14.548s user 1m13.065s sys 0m0.472s == Install gem install bio-blastxmlparser Important: the parser is written for Ruby >= 1.9. You can check with ruby -v gem env Nokogiri XML parser is required. To install it, the libxml2 libraries and headers need to be installed first, for example on Debian: apt-get install libxslt-dev libxml2-dev gem install bio-blastxmlparser for more installation on other platforms see http://nokogiri.org/tutorials/installing_nokogiri.html. == API (Ruby library) To loop through a BLAST result: >> require 'bio-blastxmlparser' >> fn = 'test/data/nt_example_blastn.m7' >> n = Bio::Blast::XmlIterator.new(fn).to_enum >> n.each do | iter | >> puts "Hits for " + iter.query_id >> iter.each do | hit | >> hit.each do | hsp | >> print hit.hit_id, "\t", hsp.evalue, "\n" if hsp.evalue < 0.001 >> end >> end >> end The next example parses XML using less memory by using a Ruby Iterator >> blast = Bio::Blast::XmlSplitterIterator.new(fn).to_enum >> iter = blast.next >> iter.iter_num => 1 >> iter.query_id => "lcl|1_0" Get the first hit >> hit = iter.hits.first >> hit.hit_num => 1 >> hit.hit_id => "lcl|I_74685" >> hit.hit_def => "[57809 - 57666] (REVERSE SENSE) " >> hit.accession => "I_74685" >> hit.len => 144 Get the parent info >> hit.parent.query_id => "lcl|1_0" Get the first Hsp >> hsp = hit.hsps.first >> hsp.hsp_num => 1 >> hsp.bit_score => 145.205 >> hsp.score => 73 >> hsp.evalue => 5.82208e-34 >> hsp.query_from => 28 >> hsp.query_to => 100 >> hsp.query_frame => 1 >> hsp.hit_frame => 1 >> hsp.identity => 73 >> hsp.positive => 73 >> hsp.align_len => 73 >> hsp.qseq => "AGTGAAGCTTCTAGATATTTGGCGGGTACCTCTAATTTTGCCTGCCTGCCAACCTATATGCTCCTGTGTTTAG" >> hsp.hseq => "AGTGAAGCTTCTAGATATTTGGCGGGTACCTCTAATTTTGCCTGCCTGCCAACCTATATGCTCCTGTGTTTAG" >> hsp.midline => "|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||" Unlike BioRuby, this module uses the actual element names in the XML definition, to avoid confusion (if anyone wants a translation, feel free to contribute an adaptor). It is also possible to use the XML element names as Strings, rather than methods. E.g. >> hsp.field("Hsp_bit-score") => "145.205" >> hsp["Hsp_bit-score"] => "145.205" Note that, when using the element names, the results are always String values. Fetch the next result (Iteration) >> iter2 = blast.next >> iter2.iter_num >> 2 >> iter2.query_id => "lcl|2_0" etc. etc. For more examples see the files in ./spec == Command line usage == Usage blastxmlparser [options] file(s) -p, --parser name Use full|split parser (default full) --output-fasta Output FASTA -n, --named fields Set named fields -e, --exec filter Execute filter --logger filename Log to file (default stderr) --trace options Set log level (default INFO, see bio-logger) -q, --quiet Run quietly -v, --verbose Run verbosely --debug Show debug messages -h, --help Show help and examples bioblastxmlparser filename(s) Use --help switch for more information == Examples Print result fields of iterations containing 'lcl', using a regex blastxmlparser -e 'iter.query_id=~/lcl/' test/data/nt_example_blastn.m7 Print fields where bit_score > 145 blastxmlparser -e 'hsp.bit_score>145' test/data/nt_example_blastn.m7 prints a tab delimited 1 1 lcl|1_0 lcl|I_74685 1 5.82208e-34 2 1 lcl|1_0 lcl|I_1 1 5.82208e-34 3 2 lcl|2_0 lcl|I_2 1 6.05436e-59 4 3 lcl|3_0 lcl|I_3 1 2.03876e-56 The second and third column show the BLAST iteration, and the others relate to the hits. As this is evaluated Ruby, it is also possible to use the XML element names directly blastxmlparser -e 'hsp["Hsp_bit-score"].to_i>145' test/data/nt_example_blastn.m7 And it is possible to print (non default) named fields where E-value < 0.001 and hit length > 100. E.g. blastxmlparser -n 'hsp.evalue,hsp.qseq' -e 'hsp.evalue<0.01 and hit.len>100' test/data/nt_example_blastn.m7 1 5.82208e-34 AGTGAAGCTTCTAGATATTTGGCGGGTACCTCTAATTTTGCCT... 2 5.82208e-34 AGTGAAGCTTCTAGATATTTGGCGGGTACCTCTAATTTTGCCT... 3 2.76378e-11 AATATGGTAGCTACAGAAACGGTAGTACACTCTTC 4 1.13373e-13 CTAAACACAGGAGCATATAGGTTGGCAGGCAGGCAAAAT 5 2.76378e-11 GAAGAGTGTACTACCGTTTCTGTAGCTACCATATT etc. etc. prints the evalue and qseq columns. To output FASTA use --output-fasta blastxmlparser --output-fasta -e 'hsp.evalue<0.01 and hit.len>100' test/data/nt_example_blastn.m7 which prints matching sequences, where the first field is the accession, followed by query iteration id, and hit_id. E.g. >I_74685 1|lcl|1_0 lcl|I_74685 [57809 - 57666] (REVERSE SENSE) AGTGAAGCTTCTAGATATTTGGCGGGTACCTCTAATTTTGCCTGCCTGCCAACCTATATGCTCCTGTGTTTAG >I_1 1|lcl|1_0 lcl|I_1 [477 - 884] AGTGAAGCTTCTAGATATTTGGCGGGTACCTCTAATTTTGCCTGCCTGCCAACCTATATGCTCCTGTGTTTAG etc. etc. To use the low-mem (iterated slower) version of the parser use blastxmlparser --parser split -n 'hsp.evalue,hsp.qseq' -e 'hsp.evalue<0.01 and hit.len>100' test/data/nt_example_blastn.m7 == URL The project lives at http://github.com/pjotrp/blastxmlparser. If you use this software, please cite http://dx.doi.org/10.1093/bioinformatics/btq475 == Copyright Copyright (c) 2011 Pjotr Prins under the MIT licence. See LICENSE.txt and http://www.opensource.org/licenses/mit-license.html for further details.