Sha256: b12280c0b72cd4c68fb5a70132e75470ab909142fb28ac6ca0cb85bba4d605b2
Contents?: true
Size: 1.01 KB
Versions: 5
Compression:
Stored size: 1.01 KB
Contents
Feature: Parsing unresolved regions
In order to include unresolved regions in a scaffold
A user can use scaffold-annotation-locator
to update annotation coordinates with respect to unresolved regions
Scenario: Annotations on two contigs separated by an unresolved region
Given a file named "scaf.yml" with:
"""
---
- sequence:
source: contig1
- unresolved:
length: 10
- sequence:
source: contig2
"""
Given a file named "seq.fna" with:
"""
> contig1
AAAAAGGGGGCCCCCTTTTT
> contig2
AAAAAGGGGGCCCCCTTTTT
"""
Given a file named "anno.gff" with:
"""
##gff-version 3
contig1 . CDS 1 6 . + 1 ID=gene1
contig2 . CDS 1 6 . + 1 ID=gene2
"""
When I relocate the annotations using "scaf.yml", "seq.fna" and "anno.gff"
Then the result should be:
"""
##gff-version 3
scaffold . CDS 1 6 . + 1 ID=gene1
scaffold . CDS 31 36 . + 1 ID=gene2
"""
Version data entries
5 entries across 5 versions & 1 rubygems