Feature: Producing cds annotation view from a scaffold In order to submit CDS genome annotations A user can use the "table" command with --generate_encoded_features to generate the genbank annotation table format with CDS @disable-bundler Scenario: A CDS entry with no attributes Given I successfully run `genomer init project` And I cd to "project" And I write to "assembly/scaffold.yml" with: """ --- - sequence: source: contig1 """ And I write to "assembly/sequence.fna" with: """ >contig1 AAAAATTTTTGGGGGCCCCC """ And I write to "assembly/annotations.gff" with: """ ##gff-version 3 contig1 . gene 1 3 . + 1 . """ And I append to "Gemfile" with: """ gem 'genomer-plugin-view', :path => '../../../' """ When I run `genomer view table --identifier=genome --generate_encoded_features` Then the exit status should be 0 And the output should contain: """ >Feature genome annotation_table 1 3 gene 1 3 CDS """ @disable-bundler Scenario: A CDS entry with a prefixed ID Given I successfully run `genomer init project` And I cd to "project" And I write to "assembly/scaffold.yml" with: """ --- - sequence: source: contig1 """ And I write to "assembly/sequence.fna" with: """ >contig1 AAAAATTTTTGGGGGCCCCC """ And I write to "assembly/annotations.gff" with: """ ##gff-version 3 contig1 . gene 1 3 . - 1 ID=gene1 """ And I append to "Gemfile" with: """ gem 'genomer-plugin-view', :path => '../../../' """ When I run `genomer view table --identifier=genome --generate_encoded_features=pre_` Then the exit status should be 0 And the output should contain: """ >Feature genome annotation_table 3 1 gene locus_tag gene1 3 1 CDS protein_id pre_gene1 """ @disable-bundler Scenario: A CDS entry with a Name attribute Given I successfully run `genomer init project` And I cd to "project" And I write to "assembly/scaffold.yml" with: """ --- - sequence: source: contig1 """ And I write to "assembly/sequence.fna" with: """ >contig1 AAAAATTTTTGGGGGCCCCC """ And I write to "assembly/annotations.gff" with: """ ##gff-version 3 contig1 . gene 4 6 . + 1 ID=gene2;Name=defg """ And I append to "Gemfile" with: """ gem 'genomer-plugin-view', :path => '../../../' """ When I run `genomer view table --identifier=genome --generate_encoded_features` Then the exit status should be 0 And the output should contain: """ >Feature genome annotation_table 4 6 gene locus_tag gene2 gene defg 4 6 CDS protein_id gene2 product Defg """ @disable-bundler Scenario: A CDS entry with a product attribute Given I successfully run `genomer init project` And I cd to "project" And I write to "assembly/scaffold.yml" with: """ --- - sequence: source: contig1 """ And I write to "assembly/sequence.fna" with: """ >contig1 AAAAATTTTTGGGGGCCCCC """ And I write to "assembly/annotations.gff" with: """ ##gff-version 3 contig1 . gene 4 6 . + 1 ID=gene2;product=defg """ And I append to "Gemfile" with: """ gem 'genomer-plugin-view', :path => '../../../' """ When I run `genomer view table --identifier=genome --generate_encoded_features` Then the exit status should be 0 And the output should contain: """ >Feature genome annotation_table 4 6 gene locus_tag gene2 4 6 CDS protein_id gene2 product defg """ @disable-bundler Scenario: A CDS entry with Name and product attributes Given I successfully run `genomer init project` And I cd to "project" And I write to "assembly/scaffold.yml" with: """ --- - sequence: source: contig1 """ And I write to "assembly/sequence.fna" with: """ >contig1 AAAAATTTTTGGGGGCCCCC """ And I write to "assembly/annotations.gff" with: """ ##gff-version 3 contig1 . gene 4 6 . + 1 ID=gene2;Name=defg;product=xyz """ And I append to "Gemfile" with: """ gem 'genomer-plugin-view', :path => '../../../' """ When I run `genomer view table --identifier=genome --generate_encoded_features` Then the exit status should be 0 And the output should contain: """ >Feature genome annotation_table 4 6 gene locus_tag gene2 gene defg 4 6 CDS protein_id gene2 product Defg function xyz """ @disable-bundler Scenario: A CDS entry with product and function attributes Given I successfully run `genomer init project` And I cd to "project" And I write to "assembly/scaffold.yml" with: """ --- - sequence: source: contig1 """ And I write to "assembly/sequence.fna" with: """ >contig1 AAAAATTTTTGGGGGCCCCC """ And I write to "assembly/annotations.gff" with: """ ##gff-version 3 contig1 . gene 4 6 . + 1 ID=gene2;product=defg;function=xyz """ And I append to "Gemfile" with: """ gem 'genomer-plugin-view', :path => '../../../' """ When I run `genomer view table --identifier=genome --generate_encoded_features` Then the exit status should be 0 And the output should contain: """ >Feature genome annotation_table 4 6 gene locus_tag gene2 4 6 CDS protein_id gene2 product defg function xyz """ @disable-bundler Scenario: A CDS entry with Name, product and function attributes Given I successfully run `genomer init project` And I cd to "project" And I write to "assembly/scaffold.yml" with: """ --- - sequence: source: contig1 """ And I write to "assembly/sequence.fna" with: """ >contig1 AAAAATTTTTGGGGGCCCCC """ And I write to "assembly/annotations.gff" with: """ ##gff-version 3 contig1 . gene 4 6 . + 1 ID=gene2;Name=abcd;product=efgh;function=ijkl """ And I append to "Gemfile" with: """ gem 'genomer-plugin-view', :path => '../../../' """ When I run `genomer view table --identifier=genome --generate_encoded_features` Then the exit status should be 0 And the output should contain: """ >Feature genome annotation_table 4 6 gene locus_tag gene2 gene abcd 4 6 CDS protein_id gene2 product Abcd function efgh """ @disable-bundler Scenario: A CDS entry with ec_number and note attributes Given I successfully run `genomer init project` And I cd to "project" And I write to "assembly/scaffold.yml" with: """ --- - sequence: source: contig1 """ And I write to "assembly/sequence.fna" with: """ >contig1 AAAAATTTTTGGGGGCCCCC """ And I write to "assembly/annotations.gff" with: """ ##gff-version 3 contig1 . gene 1 3 . - 1 ID=gene1;ec_number=3.5.2.3;Note=my protein """ And I append to "Gemfile" with: """ gem 'genomer-plugin-view', :path => '../../../' """ When I run `genomer view table --identifier=genome --generate_encoded_features` Then the exit status should be 0 And the output should contain: """ >Feature genome annotation_table 3 1 gene locus_tag gene1 3 1 CDS protein_id gene1 EC_number 3.5.2.3 note my protein """ @disable-bundler Scenario: A CDS entry with a single DBxref attribute Given I successfully run `genomer init project` And I cd to "project" And I write to "assembly/scaffold.yml" with: """ --- - sequence: source: contig1 """ And I write to "assembly/sequence.fna" with: """ >contig1 AAAAATTTTTGGGGGCCCCC """ And I write to "assembly/annotations.gff" with: """ ##gff-version 3 contig1 . gene 1 3 . - 1 ID=gene1;DBxref=GO:000001 """ And I append to "Gemfile" with: """ gem 'genomer-plugin-view', :path => '../../../' """ When I run `genomer view table --identifier=genome --generate_encoded_features` Then the exit status should be 0 And the output should contain: """ >Feature genome annotation_table 3 1 gene locus_tag gene1 3 1 CDS protein_id gene1 db_xref GO:000001 """ @disable-bundler Scenario: A CDS entry with multiple DBxref attributes Given I successfully run `genomer init project` And I cd to "project" And I write to "assembly/scaffold.yml" with: """ --- - sequence: source: contig1 """ And I write to "assembly/sequence.fna" with: """ >contig1 AAAAATTTTTGGGGGCCCCC """ And I write to "assembly/annotations.gff" with: """ ##gff-version 3 contig1 . gene 1 3 . - 1 ID=gene1;DBxref=GO:000001;DBxref=InterPro:IPR000111 """ And I append to "Gemfile" with: """ gem 'genomer-plugin-view', :path => '../../../' """ When I run `genomer view table --identifier=genome --generate_encoded_features` Then the exit status should be 0 And the output should contain: """ >Feature genome annotation_table 3 1 gene locus_tag gene1 3 1 CDS protein_id gene1 db_xref GO:000001 db_xref InterPro:IPR000111 """