{ "extnames": { "1C Enterprise": [ ".bsl", ".os" ], "ABAP": [ ".abap" ], "ABNF": [ ".abnf" ], "AGS Script": [ ".asc", ".ash" ], "AMPL": [ ".ampl", ".mod" ], "API Blueprint": [ ".apib" ], "APL": [ ".apl", ".dyalog" ], "ASN.1": [ ".asn" ], "ATS": [ ".dats", ".hats", ".sats" ], "ActionScript": [ ".as" ], "Adobe Font Metrics": [ ".afm" ], "Agda": [ ".agda" ], "Alloy": [ ".als" ], "AngelScript": [ ".as" ], "ApacheConf": [ ".vhost" ], "Apex": [ ".cls" ], "Apollo Guidance Computer": [ ".agc" ], "AppleScript": [ ".applescript" ], "AsciiDoc": [ ".adoc", ".asc", ".asciidoc" ], "AspectJ": [ ".aj" ], "Assembly": [ ".a51", ".asm", ".inc", ".nasm" ], "Asymptote": [ ".asy" ], "AutoHotkey": [ ".ahk" ], "Awk": [ ".awk" ], "Ballerina": [ ".bal" ], "BitBake": [ ".bb" ], "Blade": [ ".blade", ".php" ], "BlitzBasic": [ ".bb" ], "BlitzMax": [ ".bmx" ], "Bluespec": [ ".bsv" ], "Brainfuck": [ ".b", ".bf" ], "Brightscript": [ ".brs" ], "C": [ ".C", ".H", ".c", ".cats", ".h" ], "C#": [ ".cake", ".cs" ], "C++": [ ".cc", ".cp", ".cpp", ".h", ".hh", ".hpp", ".inc", ".inl", ".ino", ".ipp", ".re" ], "CLIPS": [ ".clp" ], "CMake": [ ".cmake", ".in" ], "COBOL": [ ".cbl", ".ccp", ".cob", ".cpy" ], "CSON": [ ".cson" ], "CSS": [ ".css" ], "CSV": [ ".csv" ], "CWeb": [ ".w" ], "Cabal Config": [ ".cabal" ], "CartoCSS": [ ".mss" ], "Ceylon": [ ".ceylon" ], "Chapel": [ ".chpl" ], "Charity": [ ".ch" ], "Cirru": [ ".cirru" ], "Clarion": [ ".clw" ], "Clean": [ ".dcl", ".icl" ], "Click": [ ".click" ], "Clojure": [ ".boot", ".cl2", ".clj", ".cljc", ".cljs", ".cljscm", ".cljx", ".hic", ".hl" ], "Closure Templates": [ ".soy" ], "CoNLL-U": [ ".conllu" ], "CoffeeScript": [ ".cake", ".cjsx", ".coffee" ], "ColdFusion": [ ".cfm" ], "ColdFusion CFC": [ ".cfc" ], "Common Lisp": [ ".cl", ".l", ".lisp", ".lsp", ".sexp" ], "Common Workflow Language": [ ".cwl" ], "Component Pascal": [ ".cp", ".cps" ], "Cool": [ ".cl" ], "Coq": [ ".v" ], "Creole": [ ".creole" ], "Crystal": [ ".cr" ], "Csound": [ ".orc" ], "Csound Document": [ ".csd" ], "Csound Score": [ ".sco" ], "Cuda": [ ".cu", ".cuh" ], "Cycript": [ ".cy" ], "D": [ ".d" ], "DIGITAL Command Language": [ ".com" ], "DM": [ ".dm" ], "DNS Zone": [ ".arpa", ".zone" ], "DTrace": [ ".d" ], "Dart": [ ".dart" ], "DataWeave": [ ".dwl" ], "Diff": [ ".patch" ], "Dogescript": [ ".djs" ], "E": [ ".E" ], "EBNF": [ ".ebnf" ], "ECL": [ ".ecl" ], "ECLiPSe": [ ".ecl" ], "EJS": [ ".ejs" ], "EML": [ ".eml" ], "EQ": [ ".eq" ], "Eagle": [ ".brd", ".sch" ], "Easybuild": [ ".eb" ], "Edje Data Collection": [ ".edc" ], "Eiffel": [ ".e" ], "Elm": [ ".elm" ], "Emacs Lisp": [ ".desktop", ".el" ], "EmberScript": [ ".em" ], "Erlang": [ ".erl", ".es", ".escript", ".src", ".xrl", ".yrl" ], "F#": [ ".fs" ], "FIGlet Font": [ ".flf" ], "FLUX": [ ".fx" ], "Fantom": [ ".fan" ], "Filebench WML": [ ".f" ], "Filterscript": [ ".fs" ], "Formatted": [ ".for", ".fs" ], "Forth": [ ".4TH", ".F", ".f", ".for", ".forth", ".fr", ".frt", ".fs", ".fth" ], "Fortran": [ ".F", ".f", ".for" ], "FreeMarker": [ ".ftl" ], "Frege": [ ".fr" ], "Fstar": [ ".fst" ], "G-code": [ ".g" ], "GAMS": [ ".gms" ], "GAP": [ ".g", ".gd", ".gi", ".tst" ], "GCC Machine Description": [ ".md" ], "GDB": [ ".gdb", ".gdbinit" ], "GDScript": [ ".gd" ], "GLSL": [ ".fp", ".frag", ".frg", ".fs", ".fsh", ".glsl", ".shader", ".tesc", ".tese", ".vrx", ".vsh" ], "GN": [ ".gn", ".gni" ], "Game Maker Language": [ ".gml" ], "Genie": [ ".gs" ], "Gerber Image": [ ".gbl", ".gbo", ".gbp", ".gbr", ".gbs", ".gko", ".gtl", ".gto", ".gtp", ".gts" ], "Git Config": [ ".gitconfig" ], "Glyph Bitmap Distribution Format": [ ".bdf" ], "Gnuplot": [ ".gnu", ".gp" ], "Go": [ ".go" ], "Golo": [ ".golo" ], "Gosu": [ ".gs", ".gst", ".gsx", ".vark" ], "Grace": [ ".grace" ], "Gradle": [ ".gradle" ], "Grammatical Framework": [ ".gf" ], "Graph Modeling Language": [ ".gml" ], "GraphQL": [ ".graphql" ], "Graphviz (DOT)": [ ".DOT", ".dot" ], "Groovy": [ ".grt", ".gtpl", ".gvy" ], "Groovy Server Pages": [ ".gsp" ], "HAProxy": [ ".cfg" ], "HCL": [ ".hcl", ".tf", ".tfvars", ".workflow" ], "HLSL": [ ".cginc", ".fx", ".hlsl" ], "HTML": [ ".hl", ".html", ".inc", ".st", ".xht" ], "HTML+Django": [ ".jinja2", ".njk" ], "HTML+ECR": [ ".ecr" ], "HTML+EEX": [ ".eex" ], "HTML+ERB": [ ".deface", ".erb" ], "HTML+Razor": [ ".cshtml", ".razor" ], "HXML": [ ".hxml" ], "Hack": [ ".hh", ".php" ], "Haml": [ ".deface", ".haml" ], "Handlebars": [ ".handlebars", ".hbs" ], "Haskell": [ ".hs" ], "HiveQL": [ ".q" ], "Hy": [ ".hy" ], "HyPhy": [ ".bf" ], "IDL": [ ".dlm", ".pro" ], "IGOR Pro": [ ".ipf" ], "INI": [ ".cfg", ".lektorproject", ".pro", ".properties" ], "Idris": [ ".idr" ], "Ignore List": [ ".gitignore" ], "Inform 7": [ ".i7x", ".ni" ], "Inno Setup": [ ".iss" ], "Ioke": [ ".ik" ], "Isabelle": [ ".thy" ], "J": [ ".ijs" ], "JFlex": [ ".flex", ".jflex" ], "JSON": [ ".JSON-tmLanguage", ".avsc", ".backup", ".geojson", ".gltf", ".har", ".ice", ".json", ".mcmeta", ".tfstate", ".topojson", ".webapp", ".webmanifest", ".yy", ".yyp" ], "JSON with Comments": [ ".sublime-build", ".sublime-commands", ".sublime-completions", ".sublime-keymap", ".sublime-macro", ".sublime-menu", ".sublime-mousemap", ".sublime-project", ".sublime-settings", ".sublime-theme" ], "JSON5": [ ".json5" ], "JSONLD": [ ".jsonld" ], "JSONiq": [ ".jq" ], "JSX": [ ".jsx" ], "Jasmin": [ ".j" ], "Java": [ ".java" ], "Java Properties": [ ".properties" ], "JavaScript": [ ".es", ".frag", ".gs", ".js", ".jsb", ".jscad", ".mjs", ".xsjs", ".xsjslib" ], "Jison": [ ".jison" ], "Jison Lex": [ ".jisonlex" ], "Jolie": [ ".iol", ".ol" ], "Jsonnet": [ ".jsonnet" ], "Julia": [ ".jl" ], "Jupyter Notebook": [ ".ipynb" ], "KRL": [ ".krl" ], "KiCad Layout": [ ".kicad_mod", ".kicad_pcb", ".kicad_wks" ], "KiCad Legacy Layout": [ ".brd" ], "KiCad Schematic": [ ".sch" ], "Kit": [ ".kit" ], "Kotlin": [ ".kt" ], "LFE": [ ".lfe" ], "LOLCODE": [ ".lol" ], "LSL": [ ".lsl", ".lslp" ], "LTspice Symbol": [ ".asy" ], "Lasso": [ ".las", ".lasso", ".lasso9", ".ldml" ], "Latte": [ ".latte" ], "Lean": [ ".hlean", ".lean" ], "Less": [ ".less" ], "Lex": [ ".l" ], "Limbo": [ ".b", ".m" ], "Linker Script": [ ".ld", ".lds", ".x" ], "Linux Kernel Module": [ ".mod" ], "Liquid": [ ".liquid" ], "Literate Agda": [ ".lagda" ], "Literate CoffeeScript": [ ".litcoffee" ], "LiveScript": [ ".ls" ], "Logos": [ ".x", ".xm" ], "Logtalk": [ ".lgt" ], "LookML": [ ".lkml", ".lookml" ], "LoomScript": [ ".ls" ], "Lua": [ ".fcgi", ".p8", ".pd_lua" ], "M": [ ".m" ], "M4": [ ".m4" ], "M4Sugar": [ ".m4" ], "MATLAB": [ ".m" ], "MAXScript": [ ".mcr", ".ms" ], "MQL4": [ ".mq4", ".mqh" ], "MQL5": [ ".mq5", ".mqh" ], "MTML": [ ".mtml" ], "MUF": [ ".m", ".muf" ], "Makefile": [ ".d", ".make" ], "Markdown": [ ".md", ".mdown", ".mdx", ".ronn", ".workbook" ], "Marko": [ ".marko" ], "Mask": [ ".mask" ], "Mathematica": [ ".m", ".mt", ".nb", ".wl", ".wlt" ], "Max": [ ".maxhelp", ".maxpat", ".mxt" ], "MediaWiki": [ ".mediawiki", ".wiki" ], "Mercury": [ ".m", ".moo" ], "Metal": [ ".metal" ], "Modelica": [ ".mo" ], "Modula-2": [ ".mod" ], "Modula-3": [ ".i3", ".ig", ".m3", ".mg" ], "Module Management System": [ ".mmk", ".mms" ], "Monkey": [ ".monkey", ".monkey2" ], "Moocode": [ ".moo" ], "MoonScript": [ ".moon" ], "NCL": [ ".ncl" ], "NL": [ ".nl" ], "NSIS": [ ".nsh", ".nsi" ], "Nearley": [ ".ne" ], "Nemerle": [ ".n" ], "NetLinx": [ ".axi", ".axs" ], "NetLinx+ERB": [ ".erb" ], "NetLogo": [ ".nlogo" ], "NewLisp": [ ".lisp", ".lsp", ".nl" ], "Nextflow": [ ".nf" ], "Nginx": [ ".vhost" ], "Nim": [ ".cfg", ".nim", ".nimble", ".nims" ], "Nit": [ ".nit" ], "Nix": [ ".nix" ], "Nu": [ ".nu" ], "OCaml": [ ".eliom", ".ml" ], "Objective-C": [ ".h", ".m" ], "Objective-C++": [ ".mm" ], "Objective-J": [ ".j" ], "Omgrofl": [ ".omgrofl" ], "Opa": [ ".opa" ], "Opal": [ ".opal" ], "OpenCL": [ ".cl" ], "OpenEdge ABL": [ ".cls", ".p", ".w" ], "OpenSCAD": [ ".scad" ], "Org": [ ".org" ], "Ox": [ ".ox", ".oxh", ".oxo" ], "Oxygene": [ ".oxygene" ], "Oz": [ ".oz" ], "P4": [ ".p4" ], "PHP": [ ".fcgi", ".inc", ".php", ".phps" ], "PLSQL": [ ".ddl", ".pck", ".pkb", ".pks", ".plsql", ".prc", ".sql" ], "PLpgSQL": [ ".pgsql", ".sql" ], "POV-Ray SDL": [ ".inc", ".pov" ], "Pan": [ ".pan" ], "Papyrus": [ ".psc" ], "Parrot Assembly": [ ".pasm" ], "Parrot Internal Representation": [ ".pir" ], "Pascal": [ ".dpr", ".inc", ".pascal", ".pp" ], "Pawn": [ ".inc", ".pwn" ], "Pep8": [ ".pep" ], "Perl": [ ".al", ".cgi", ".fcgi", ".pl", ".pm", ".t" ], "Perl 6": [ ".p6", ".pl", ".pm", ".pm6", ".t" ], "Pic": [ ".chem", ".pic" ], "Pickle": [ ".pkl" ], "PicoLisp": [ ".l" ], "PigLatin": [ ".pig" ], "Pike": [ ".pike", ".pmod" ], "Pod": [ ".pod" ], "Pod 6": [ ".pod" ], "PogoScript": [ ".pogo" ], "Pony": [ ".pony" ], "PostCSS": [ ".pcss" ], "PostScript": [ ".pfa", ".ps" ], "PowerBuilder": [ ".pbt", ".sra", ".sru", ".srw" ], "PowerShell": [ ".ps1", ".psd1", ".psm1" ], "Processing": [ ".pde" ], "Prolog": [ ".pl", ".pro", ".prolog", ".yap" ], "Propeller Spin": [ ".spin" ], "Protocol Buffer": [ ".proto" ], "Public Key": [ ".asc", ".pub" ], "Pug": [ ".jade", ".pug" ], "Puppet": [ ".pp" ], "PureBasic": [ ".pb", ".pbi" ], "PureScript": [ ".purs" ], "Python": [ ".bzl", ".cgi", ".fcgi", ".gypi", ".py", ".py3", ".pyde", ".pyi", ".pyp", ".rpy", ".spec" ], "QML": [ ".qbs" ], "QMake": [ ".pri", ".pro" ], "R": [ ".R", ".Rd", ".r", ".rsx" ], "RAML": [ ".raml" ], "RDoc": [ ".rdoc" ], "REXX": [ ".pprx", ".rexx" ], "RMarkdown": [ ".rmd" ], "RPC": [ ".x" ], "RPM Spec": [ ".spec" ], "RUNOFF": [ ".RNH", ".rnh", ".rno" ], "Racket": [ ".scrbl" ], "Ragel": [ ".rl" ], "Rascal": [ ".rsc" ], "Reason": [ ".re" ], "Rebol": [ ".r", ".r2", ".r3", ".reb", ".rebol" ], "Red": [ ".red", ".reds" ], "Regular Expression": [ ".regex", ".regexp" ], "Ren'Py": [ ".rpy" ], "RenderScript": [ ".rs", ".rsh" ], "Rich Text Format": [ ".rtf" ], "Ring": [ ".ring" ], "RobotFramework": [ ".robot" ], "Roff": [ ".1", ".1in", ".1m", ".1x", ".2", ".3", ".3in", ".3m", ".3p", ".3pm", ".3qt", ".3x", ".4", ".5", ".6", ".7", ".8", ".9", ".l", ".man", ".mdoc", ".ms", ".n", ".nr", ".rno", ".tmac" ], "Roff Manpage": [ ".1", ".1in", ".1m", ".1x", ".2", ".3", ".3in", ".3m", ".3p", ".3pm", ".3qt", ".3x", ".4", ".5", ".6", ".7", ".8", ".9", ".man", ".mdoc" ], "Ruby": [ ".fcgi", ".jbuilder", ".pluginspec", ".rabl", ".rake", ".rb", ".spec" ], "Rust": [ ".rs" ], "SAS": [ ".sas" ], "SCSS": [ ".scss" ], "SMT": [ ".smt", ".smt2" ], "SPARQL": [ ".sparql" ], "SQF": [ ".hqf", ".sqf" ], "SQL": [ ".cql", ".ddl", ".inc", ".mysql", ".prc", ".sql", ".tab", ".udf", ".viw" ], "SQLPL": [ ".db2", ".sql" ], "SRecode Template": [ ".srt" ], "STON": [ ".ston" ], "Sage": [ ".sagews" ], "SaltStack": [ ".sls" ], "Sass": [ ".sass" ], "Scala": [ ".kojo", ".sbt", ".sc" ], "Scaml": [ ".scaml" ], "Scheme": [ ".sch", ".sld", ".sls", ".sps" ], "Scilab": [ ".sce", ".sci", ".tst" ], "ShaderLab": [ ".shader" ], "Shell": [ ".bash", ".cgi", ".command", ".fcgi", ".sh", ".tool", ".zsh" ], "ShellSession": [ ".sh-session" ], "Shen": [ ".shen" ], "Slash": [ ".sl" ], "Slice": [ ".ice" ], "Slim": [ ".slim" ], "Smali": [ ".smali" ], "Smalltalk": [ ".cs", ".st" ], "SourcePawn": [ ".inc", ".sma", ".sp" ], "Squirrel": [ ".nut" ], "Stan": [ ".stan" ], "Standard ML": [ ".ML", ".fun", ".sig", ".sml" ], "Stata": [ ".ado", ".do", ".doh", ".ihlp", ".mata", ".matah", ".sthlp" ], "Stylus": [ ".styl" ], "SubRip Text": [ ".srt" ], "SugarSS": [ ".sss" ], "SuperCollider": [ ".sc", ".scd" ], "Swift": [ ".swift" ], "SystemVerilog": [ ".sv", ".svh", ".vh" ], "TI Program": [ ".txt" ], "TLA": [ ".tla" ], "TXL": [ ".txl" ], "Tcl": [ ".tm" ], "TeX": [ ".bbx", ".cbx", ".cls", ".lbx", ".toc" ], "Tea": [ ".tea" ], "Terra": [ ".t" ], "Text": [ ".fr", ".nb", ".ncl", ".no", ".txt" ], "Thrift": [ ".thrift" ], "Turing": [ ".t" ], "Turtle": [ ".ttl" ], "Type Language": [ ".tl" ], "TypeScript": [ ".ts", ".tsx" ], "Unity3D Asset": [ ".anim", ".asset", ".mat", ".meta", ".prefab" ], "Unix Assembly": [ ".ms", ".s" ], "Uno": [ ".uno" ], "UnrealScript": [ ".uc" ], "UrWeb": [ ".ur", ".urs" ], "VCL": [ ".vcl" ], "VHDL": [ ".vhd" ], "Verilog": [ ".v" ], "Vim script": [ ".vba", ".vim", ".vmb" ], "Visual Basic": [ ".cls", ".vb", ".vba", ".vbhtml" ], "Volt": [ ".volt" ], "Vue": [ ".vue" ], "Wavefront Material": [ ".mtl" ], "Wavefront Object": [ ".obj" ], "Web Ontology Language": [ ".owl" ], "WebAssembly": [ ".wast", ".wat" ], "WebIDL": [ ".webidl" ], "Windows Registry Entries": [ ".reg" ], "World of Warcraft Addon Data": [ ".toc" ], "X BitMap": [ ".xbm" ], "X PixMap": [ ".pm", ".xpm" ], "X10": [ ".x10" ], "XC": [ ".xc" ], "XML": [ ".adml", ".admx", ".ant", ".builds", ".ccproj", ".config", ".cscfg", ".csdef", ".csl", ".csproj", ".depproj", ".dist", ".filters", ".fsproj", ".fxml", ".gml", ".gmx", ".iml", ".ivy", ".jsproj", ".mdpolicy", ".mjml", ".mm", ".mod", ".natvis", ".ncl", ".ndproj", ".nproj", ".nuspec", ".odd", ".pkgproj", ".pluginspec", ".proj", ".props", ".resx", ".sch", ".sfproj", ".shproj", ".storyboard", ".targets", ".ts", ".tsx", ".ux", ".vbproj", ".vcxproj", ".vsixmanifest", ".vstemplate", ".wixproj", ".workflow", ".xib", ".xml", ".xspec" ], "XPages": [ ".metadata", ".xsp-config" ], "XProc": [ ".xpl" ], "XQuery": [ ".xqm" ], "XS": [ ".xs" ], "XSLT": [ ".xslt" ], "Xojo": [ ".xojo_code", ".xojo_menu", ".xojo_report", ".xojo_script", ".xojo_toolbar", ".xojo_window" ], "Xtend": [ ".xtend" ], "YAML": [ ".YAML-tmLanguage", ".mir", ".mysql", ".sublime-syntax", ".syntax", ".yml" ], "YANG": [ ".yang" ], "YARA": [ ".yar", ".yara" ], "YASnippet": [ ".yasnippet" ], "Yacc": [ ".yy" ], "ZAP": [ ".zap" ], "ZIL": [ ".zil" ], "Zephir": [ ".zep" ], "Zig": [ ".zig" ], "Zimpl": [ ".zmpl" ], "desktop": [ ".desktop" ], "eC": [ ".ec" ], "edn": [ ".edn" ], "fish": [ ".fish" ], "mcfunction": [ ".mcfunction" ], "nanorc": [ ".nanorc" ], "q": [ ".q" ], "reStructuredText": [ ".txt" ], "sed": [ ".sed" ], "wdl": [ ".wdl" ], "wisp": [ ".wisp" ], "xBase": [ ".ch", ".prg", ".prw" ] }, "interpreters": { "APL": [ "apl" ], "Awk": [ "awk" ], "C": [ "tcc" ], "Common Workflow Language": [ "cwl-runner" ], "Crystal": [ "crystal" ], "DTrace": [ "dtrace" ], "E": [ "rune" ], "Erlang": [ "escript" ], "Gnuplot": [ "gnuplot" ], "Groovy": [ "groovy" ], "Haskell": [ "runhaskell" ], "Hy": [ "hy" ], "Ioke": [ "ioke" ], "J": [ "jconsole" ], "JavaScript": [ "node" ], "Julia": [ "julia" ], "Lua": [ "lua" ], "Makefile": [ "make" ], "NewLisp": [ "newlisp" ], "Nextflow": [ "nextflow" ], "Nu": [ "nush" ], "OpenRC runscript": [ "openrc-run" ], "PHP": [ "php" ], "Parrot Assembly": [ "parrot" ], "Parrot Internal Representation": [ "parrot" ], "Pascal": [ "instantfpc" ], "Perl": [ "perl" ], "Perl 6": [ "perl6" ], "Pike": [ "pike" ], "PowerShell": [ "pwsh" ], "Prolog": [ "swipl" ], "Python": [ "python", "python2" ], "QMake": [ "qmake" ], "R": [ "Rscript" ], "Ruby": [ "jruby", "macruby", "rake", "rbx", "ruby" ], "Scala": [ "scala" ], "Shell": [ "bash", "sh", "zsh" ] }, "filenames": { "Alpine Abuild": [ "APKBUILD" ], "Ant Build System": [ "ant.xml", "build.xml" ], "ApacheConf": [ ".htaccess", "apache2.conf", "httpd.conf" ], "CMake": [ "CMakeLists.txt" ], "Cabal Config": [ "cabal.config", "cabal.project" ], "Cloud Firestore Security Rules": [ "firestore.rules" ], "Dockerfile": [ "Dockerfile" ], "EditorConfig": [ ".editorconfig" ], "Elixir": [ "mix.lock" ], "Emacs Lisp": [ ".abbrev_defs", ".gnus", ".spacemacs", ".viper", "Cask", "Project.ede", "_emacs", "abbrev_defs" ], "Erlang": [ "Emakefile", "rebar.config", "rebar.config.lock", "rebar.lock" ], "GN": [ ".gn" ], "Git Attributes": [ ".gitattributes" ], "Git Config": [ ".gitconfig", ".gitmodules" ], "Groovy": [ "Jenkinsfile" ], "INI": [ "buildozer.spec" ], "Ignore List": [ ".atomignore", ".babelignore", ".bzrignore", ".coffeelintignore", ".cvsignore", ".dockerignore", ".eslintignore", ".gitignore", ".nodemonignore", ".npmignore", ".prettierignore", ".stylelintignore", ".vscodeignore", "gitignore-global", "gitignore_global" ], "Isabelle ROOT": [ "ROOT" ], "JSON": [ ".arcconfig", ".htmlhintrc", ".tern-config", ".tern-project", ".watchmanconfig", "composer.lock", "mcmod.info" ], "JSON with Comments": [ ".babelrc", ".eslintrc.json", ".jscsrc", ".jshintrc", ".jslintrc", "jsconfig.json", "tsconfig.json" ], "KiCad Layout": [ "fp-lib-table" ], "Linker Script": [ "ld.script" ], "M4Sugar": [ "configure.ac" ], "Makefile": [ "BSDmakefile", "Kbuild", "Makefile", "Makefile.boot", "Makefile.frag", "Makefile.inc", "Makefile.wat", "makefile.sco", "mkfile" ], "Markdown": [ "contents.lr" ], "Maven POM": [ "pom.xml" ], "Meson": [ "meson.build", "meson_options.txt" ], "Nextflow": [ "nextflow.config" ], "Nginx": [ "nginx.conf" ], "Nim": [ "nim.cfg" ], "PHP": [ ".php", ".php_cs", ".php_cs.dist" ], "Perl": [ "Makefile.PL", "Rexfile", "ack", "cpanfile" ], "Python": [ ".gclient", "BUCK", "BUILD", "WORKSPACE" ], "Quake": [ "m3makefile", "m3overrides" ], "R": [ "expr-dist" ], "Ruby": [ ".irbrc", ".pryrc", "Appraisals", "Brewfile", "Capfile", "Dangerfile", "Deliverfile", "Fastfile", "Gemfile.lock", "Podfile", "Rakefile", "Snapfile" ], "Shell": [ ".bash_aliases", ".bash_logout", ".bash_profile", ".bashrc", ".cshrc", ".login", ".profile", ".zlogin", ".zlogout", ".zprofile", ".zshenv", ".zshrc", "9fs", "PKGBUILD", "bash_aliases", "bash_logout", "bash_profile", "bashrc", "cshrc", "gradlew", "login", "man", "profile", "zlogin", "zlogout", "zprofile", "zshenv", "zshrc" ], "TOML": [ "Cargo.lock", "Gopkg.lock" ], "Tcl": [ "owh", "starfield" ], "Text": [ "COPYING.regex", "LICENSE.mysql", "README.me", "README.mysql", "click.me", "delete.me", "keep.me", "read.me", "readme.1st", "test.me" ], "Vim script": [ ".gvimrc", ".nvimrc", ".vimrc", "_vimrc" ], "X Font Directory Index": [ "encodings.dir", "fonts.alias", "fonts.dir", "fonts.scale" ], "XCompose": [ "XCompose" ], "XML": [ ".cproject" ], "YAML": [ ".clang-format", ".clang-tidy", ".gemrc", "glide.lock" ], "nanorc": [ ".nanorc", "nanorc" ] }, "tokens_total": 1618980, "languages_total": 2150, "tokens": { "1C Enterprise": { "#": 2, ";": 205, "(": 189, ")": 186, ".": 275, "+": 19, "//": 10, "*": 1, "|": 88, "&": 12, "/": 1, "-": 7, "NULL": 5, "<": 5, "HTML": 2, "DOM": 2, "DOM.": 1, "HTML.": 2, "Null": 1, "XML": 11, "XML.": 7, "_": 9 }, "ABAP": { "*/**": 1, "*": 65, "The": 2, "MIT": 2, "License": 1, "(": 16, ")": 16, "Copyright": 1, "c": 4, "Ren": 1, "van": 1, "Mil": 1, "Permission": 1, "is": 5, "hereby": 1, "granted": 1, "free": 1, "of": 7, "charge": 1, "to": 11, "any": 1, "person": 1, "obtaining": 1, "a": 1, "copy": 2, "this": 2, "software": 1, "and": 5, "associated": 1, "documentation": 1, "files": 1, "the": 7, "deal": 1, "in": 2, "Software": 3, "without": 2, "restriction": 1, "including": 1, "limitation": 1, "rights": 1, "use": 1, "modify": 1, "merge": 1, "publish": 1, "distribute": 1, "sublicense": 1, "and/or": 1, "sell": 1, "copies": 2, "permit": 1, "persons": 1, "whom": 1, "furnished": 1, "do": 1, "so": 1, "subject": 1, "following": 1, "conditions": 1, "above": 1, "copyright": 1, "notice": 2, "permission": 1, "shall": 1, "be": 1, "included": 1, "all": 1, "or": 1, "substantial": 1, "portions": 1, "Software.": 1, "THE": 6, "SOFTWARE": 2, "IS": 1, "PROVIDED": 1, "WITHOUT": 1, "WARRANTY": 1, "OF": 4, "ANY": 2, "KIND": 1, "EXPRESS": 1, "OR": 7, "IMPLIED": 1, "INCLUDING": 1, "BUT": 1, "NOT": 1, "LIMITED": 1, "TO": 2, "WARRANTIES": 1, "MERCHANTABILITY": 1, "FITNESS": 1, "FOR": 2, "A": 1, "PARTICULAR": 1, "PURPOSE": 1, "AND": 1, "NONINFRINGEMENT.": 1, "IN": 4, "NO": 1, "EVENT": 1, "SHALL": 1, "AUTHORS": 1, "COPYRIGHT": 1, "HOLDERS": 1, "BE": 1, "LIABLE": 1, "CLAIM": 1, "DAMAGES": 1, "OTHER": 2, "LIABILITY": 1, "WHETHER": 1, "AN": 1, "ACTION": 1, "CONTRACT": 1, "TORT": 1, "OTHERWISE": 1, "ARISING": 1, "FROM": 1, "OUT": 1, "CONNECTION": 1, "WITH": 1, "USE": 1, "DEALINGS": 1, "SOFTWARE.": 1, "*/": 1, "-": 1352, "CLASS": 2, "CL_CSV_PARSER": 6, "DEFINITION": 1, "class": 2, "cl_csv_parser": 2, "definition": 1, "public": 3, "inheriting": 1, "from": 1, "cl_object": 1, "final": 1, "create": 1, ".": 20, "section.": 3, "type": 30, "pools": 2, "abap": 2, "methods": 4, "constructor": 2, "importing": 2, "delegate": 1, "ref": 2, "if_csv_parser_delegate": 2, "csvstring": 1, "string": 3, "separator": 1, "skip_first_line": 1, "abap_bool": 3, "parse": 1, "raising": 2, "cx_csv_parse_error": 5, "protected": 1, "private": 1, "constants": 1, "_textindicator": 1, "value": 5, "data": 16, "_delegate": 3, "_csvstring": 4, "_separator": 2, "_skip_first_line": 3, "_lines": 2, "returning": 5, "stringtab": 2, "_parse_line": 2, "line": 5, "endclass.": 2, "IMPLEMENTATION": 1, "implementation.": 1, "": 4, "+": 20, "|": 12, "Instance": 4, "Public": 2, "Method": 4, "CONSTRUCTOR": 1, "[": 8, "]": 6, "DELEGATE": 1, "TYPE": 7, "REF": 1, "IF_CSV_PARSER_DELEGATE": 1, "CSVSTRING": 1, "STRING": 2, "SEPARATOR": 1, "C": 1, "SKIP_FIRST_LINE": 1, "ABAP_BOOL": 1, "": 2, "method": 4, "constructor.": 1, "super": 1, "delegate.": 1, "csvstring.": 1, "separator.": 1, "skip_first_line.": 1, "endmethod.": 4, "PARSE": 1, "CX": 2, "CX_CSV_PARSE_ERROR": 2, "parse.": 1, "msg": 2, "string.": 7, "if": 9, "initial.": 3, "message": 6, "e002": 1, "csv": 3, "into": 8, "msg.": 6, "raise": 3, "exception": 3, "exporting": 3, "endif.": 9, "is_first_line": 3, "abap_true.": 4, "lines": 3, "standard": 3, "table": 4, "field": 1, "symbols": 1, "": 3, "loop": 1, "at": 2, "assigning": 1, "abap_true": 1, "abap_false.": 3, "continue.": 1, "values": 3, "values_found": 1, "endloop.": 1, "Private": 2, "_LINES": 1, "<->": 2, "RETURNING": 2, "STRINGTAB": 2, "SIGNATURE": 2, "_lines.": 1, "split": 1, "cl_abap_char_utilities": 1, "cr_lf": 1, "returning.": 1, "_PARSE_LINE": 1, "LINE": 1, "_parse_line.": 1, "csvvalue": 7, "csvvalues": 1, "char": 10, "c.": 1, "pos": 10, "i": 1, "len": 3, "i.": 2, "strlen": 1, "while": 2, "<": 5, "len.": 2, "_separator.": 2, "_textindicator.": 2, "text_ended": 5, "abap_bool.": 1, "else.": 6, "concatenate": 4, "csvvalue.": 5, "e003": 2, "endwhile.": 2, "nextpos": 4, "append": 2, "csvvalues.": 3, "clear": 1 }, "ABNF": { ";": 96, "Source": 1, "https": 1, "//github.com/toml": 1, "-": 216, "lang/toml": 1, "License": 1, "MIT": 1, "This": 1, "is": 1, "an": 1, "attempt": 1, "to": 2, "define": 1, "TOML": 2, "in": 4, "ABNF": 2, "according": 1, "the": 1, "grammar": 1, "defined": 2, "RFC": 2, "(": 19, "http": 1, "//www.ietf.org/rfc/rfc4234.txt": 1, ")": 19, ".": 3, "toml": 1, "expression": 3, "*": 7, "newline": 5, "ws": 23, "/": 67, "comment": 8, "keyval": 6, "[": 13, "]": 13, "table": 30, "Newline": 1, "%": 56, "x0A": 1, "LF": 1, "x0D.0A": 1, "CRLF": 1, "newlines": 5, "1*newline": 1, "Whitespace": 1, "x20": 6, "Space": 1, "x09": 4, "Horizontal": 1, "tab": 2, "Comment": 1, "start": 2, "symbol": 2, "x23": 2, "#": 1, "non": 4, "eol": 2, "*non": 1, "Key": 1, "Value": 1, "pairs": 1, "sep": 12, "x3D": 1, "key": 15, "val": 6, "unquoted": 2, "quoted": 2, "1*": 2, "ALPHA": 2, "DIGIT": 9, "x2D": 2, "x5F": 2, "A": 2, "Z": 2, "a": 2, "z": 2, "_": 2, "quotation": 8, "mark": 8, "1*basic": 1, "char": 9, "See": 1, "Basic": 3, "Strings": 1, "integer": 4, "float": 2, "string": 16, "boolean": 2, "date": 10, "time": 20, "array": 18, "inline": 13, "Table": 4, "std": 6, "Standard": 1, "open": 8, "x5B": 2, "Left": 1, "square": 4, "bracket": 4, "close": 8, "x5D": 4, "Right": 1, "x2E": 2, "Period": 1, "Array": 2, "x5B.5B": 1, "Double": 2, "left": 1, "x5D.5D": 1, "right": 1, "Integer": 1, "minus": 2, "plus": 2, "int": 4, "x2B": 1, "+": 10, "digit1": 2, "x31": 1, "underscore": 3, "Float": 1, "frac": 3, "exp": 3, "zero": 2, "prefixable": 2, "decimal": 2, "point": 2, "e": 3, "x65": 1, "x45": 1, "E": 1, "String": 5, "basic": 16, "ml": 20, "literal": 12, "*basic": 1, "x22": 2, "unescaped": 4, "escaped": 3, "escape": 3, "x5C": 2, "reverse": 1, "solidus": 2, "U": 9, "005C": 1, "x2F": 1, "x62": 1, "b": 1, "backspace": 1, "x66": 1, "f": 1, "form": 1, "feed": 2, "000C": 1, "x6E": 1, "n": 1, "line": 1, "000A": 1, "x72": 1, "r": 1, "carriage": 1, "return": 1, "000D": 1, "x74": 1, "t": 1, "x75": 1, "4HEXDIG": 1, "uXXXX": 1, "XXXX": 1, "x55": 1, "8HEXDIG": 1, "UXXXXXXXX": 1, "XXXXXXXX": 1, "5B": 2, "Multiline": 2, "delim": 6, "body": 4, "Literal": 2, "apostraphe": 6, "*literal": 1, "x27": 1, "x28": 1, "Boolean": 1, "true": 3, "false": 3, "x74.72.75.65": 1, "x66.61.6C.73.65": 1, "Datetime": 1, "as": 1, "fullyear": 2, "4DIGIT": 1, "month": 2, "2DIGIT": 5, "mday": 2, "based": 2, "on": 2, "month/year": 1, "hour": 3, "minute": 3, "second": 3, "leap": 1, "rules": 1, "secfrac": 2, "1*DIGIT": 1, "numoffset": 2, "offset": 2, "partial": 2, "full": 4, "values": 3, "x2C": 2, "Comma": 2, "Inline": 1, "x7B": 1, "{": 1, "x7D": 1, "}": 1, "keyvals": 5, "empty": 3, "Built": 1, "terms": 1, "reproduced": 1, "here": 1, "for": 1, "clarity": 1, "x41": 1, "5A": 1, "x61": 1, "7A": 1, "x30": 1, "HEXDIG": 1 }, "AGS Script": { "#define": 2, "DISTANCE": 25, "10000//": 1, "distance": 1, "player": 11, "walks": 1, "in": 1, "Tapping": 1, "mode": 6, "before": 1, "he": 1, "stops": 1, "enum": 2, "KeyboardMovement_Directions": 4, "{": 108, "eKeyboardMovement_Stop": 9, "eKeyboardMovement_DownLeft": 5, "eKeyboardMovement_Down": 5, "eKeyboardMovement_DownRight": 5, "eKeyboardMovement_Left": 5, "eKeyboardMovement_Right": 5, "eKeyboardMovement_UpLeft": 5, "eKeyboardMovement_Up": 5, "eKeyboardMovement_UpRight": 5, "}": 108, ";": 242, "int": 18, "KeyboardMovement_KeyDown": 5, "//": 60, "down": 9, "arrow": 8, "KeyboardMovement_KeyLeft": 5, "left": 4, "KeyboardMovement_KeyRight": 5, "right": 5, "KeyboardMovement_KeyUp": 5, "up": 4, "KeyboardMovement_KeyDownRight": 3, "PgDn": 2, "(": 296, "numpad": 8, ")": 296, "KeyboardMovement_KeyUpRight": 3, "PgUp": 2, "KeyboardMovement_KeyDownLeft": 3, "End": 2, "KeyboardMovement_KeyUpLeft": 3, "Home": 2, "KeyboardMovement_KeyStop": 3, "KeyboardMovement_Modes": 4, "KeyboardMovement_Mode": 4, "eKeyboardMovement_None": 2, "stores": 2, "current": 8, "keyboard": 2, "control": 2, "disabled": 1, "by": 1, "default": 1, "walking": 1, "direction": 20, "of": 6, "character": 9, "static": 2, "function": 53, "KeyboardMovement": 2, "SetMode": 2, "repeatedly_execute": 2, "-": 223, "if": 101, "IsGamePaused": 5, "true": 18, "||": 13, "eKeyboardMovement_Pressing": 2, "IsInterfaceEnabled": 3, "false": 26, "player.on": 2, "return": 8, "newdirection": 43, "declare": 4, "variable": 2, "storing": 4, "new": 17, "IsKeyPressed": 17, "&&": 9, "&": 4, "arrows": 4, "or": 4, "numeric": 2, "pad": 2, "held": 4, "set": 7, "to": 14, "Down": 2, "Right": 2, "else": 44, "none": 1, "the": 10, "above": 2, "it": 1, "stop": 7, "regardless": 1, "whether": 1, "some": 2, "are": 1, "is": 9, "different": 2, "from": 2, "player.StopMoving": 3, "Stop": 4, "command": 4, "movement": 2, "NOT": 2, "dx": 20, "dy": 20, "variables": 2, "walk": 4, "coordinates": 4, "player.WalkStraight": 2, "player.x": 2, "+": 7, "player.y": 2, "eNoBlock": 2, "update": 3, "on_key_press": 2, "keycode": 35, "eKeyboardMovement_Tapping": 3, "key": 2, "pressed": 2, "same": 1, "as": 3, "on_event": 1, "EventType": 1, "event": 2, "data": 1, "eEventLeaveRoom": 1, "initialize_control_panel": 2, "gPanel.Centre": 1, "gRestartYN.Centre": 1, "IsSpeechVoxAvailable": 3, "lblVoice.Visible": 1, "btnVoice.Visible": 1, "sldVoice.Visible": 1, "SetVoiceMode": 6, "eSpeechVoiceAndText": 4, "btnVoice.Text": 9, "System.SupportsGammaControl": 3, "sldGamma.Visible": 1, "lblGamma.Visible": 1, "//And": 1, "now": 1, "all": 3, "defaults": 1, "System.Volume": 5, "sldAudio.Value": 3, "SetGameSpeed": 3, "sldSpeed.Value": 3, "sldVoice.Value": 3, "SetSpeechVolume": 3, "System.Gamma": 3, "sldGamma.Value": 3, "game_start": 1, "KeyboardMovement.SetMode": 1, "repeatedly_execute_always": 1, "show_inventory_window": 3, "gInventory.Visible": 2, "mouse.Mode": 15, "eModeInteract": 3, "mouse.UseModeGraphic": 8, "eModePointer": 8, "show_save_game_dialog": 3, "gSaveGame.Visible": 3, "lstSaveGamesList.ItemCount": 3, "txtNewSaveName.Text": 5, "lstSaveGamesList.Items": 3, "[": 6, "]": 6, "gIconbar.Visible": 15, "show_restore_game_dialog": 3, "gRestoreGame.Visible": 3, "close_save_game_dialog": 4, "mouse.UseDefaultGraphic": 9, "close_restore_game_dialog": 4, "eKeyCode": 1, "eKeyEscape": 5, "gRestartYN.Visible": 6, "//Use": 1, "ESC": 1, "cancel": 1, "restart.": 1, "gPanel.Visible": 11, "eKeyReturn": 1, "RestartGame": 2, "eKeyCtrlQ": 1, "QuitGame": 3, "Ctrl": 5, "Q": 1, "eKeyF5": 1, "F5": 1, "eKeyF7": 1, "F7": 1, "eKeyF9": 1, "eKeyF12": 1, "SaveScreenShot": 1, "F12": 1, "eKeyTab": 1, "Tab": 1, "show": 2, "inventory": 3, "eModeWalkto": 2, "//Notice": 1, "this": 2, "alternate": 1, "way": 1, "indicate": 1, "keycodes.": 1, "eModeLookat": 1, "//Note": 1, "that": 1, "we": 1, "do": 1, "here": 1, "modes.": 1, "//If": 1, "you": 2, "want": 1, "something": 1, "happen": 1, "such": 1, "GUI": 2, "buttons": 1, "highlighting": 1, "eModeTalkto": 2, "//you": 1, "eModeUseinv": 3, "//But": 1, "will": 2, "give": 2, "standard": 1, "shortcuts": 1, "your": 1, "players": 1, "very": 1, "much": 1, "appreciate.": 1, "//if": 1, "eModePickup": 1, "eKeyCtrlS": 1, "Debug": 4, "S": 1, "eKeyCtrlV": 1, "V": 1, "version": 1, "eKeyCtrlA": 1, "A": 1, "walkable": 2, "areas": 1, "eKeyCtrlX": 1, "X": 1, "teleport": 1, "room": 1, "eKeyCtrlW": 1, "game.debug_mode": 1, "player.PlaceOnWalkableArea": 1, "//Ctrl": 1, "W": 1, "move": 1, "area": 1, "on_mouse_click": 1, "MouseButton": 27, "button": 33, "eMouseLeft": 4, "ProcessClick": 2, "mouse.x": 2, "mouse.y": 2, "eMouseRight": 1, "eMouseWheelSouth": 1, "mouse.SelectNextMode": 1, "eMouseMiddle": 1, "eMouseWheelNorth": 1, "player.ActiveInventory": 2, "null": 2, "//...and": 1, "has": 1, "a": 1, "selected": 1, "item": 1, "mouse": 1, "UseInv.": 1, "interface_click": 1, "interface": 1, "btnInvUp_Click": 1, "GUIControl": 31, "*control": 31, "invCustomInv.ScrollUp": 1, "btnInvDown_Click": 1, "invCustomInv.ScrollDown": 1, "btnInvOK_Click": 1, "btnInvSelect_Click": 1, "btnIconInv_Click": 1, "btnIconCurInv_Click": 1, "btnIconSave_Click": 2, "btnIconLoad_Click": 2, "btnIconExit_Click": 1, "btnIconAbout_Click": 1, "cEgo_Look": 1, "Display": 4, "cEgo_Interact": 1, "cEgo_Talk": 1, "//START": 1, "OF": 2, "CONTROL": 2, "PANEL": 2, "FUNCTIONS": 2, "btnSave_OnClick": 1, "Wait": 3, "btnIconSave": 1, "gControl_OnClick": 1, "*theGui": 1, "btnAbout_OnClick": 1, "btnQuit_OnClick": 1, "btnLoad_OnClick": 1, "btnIconLoad": 1, "btnResume_OnClick": 1, "sldAudio_OnChange": 1, "sldVoice_OnChange": 1, "btnVoice_OnClick": 1, "eSpeechVoiceOnly": 1, "eSpeechTextOnly": 1, "sldGamma_OnChange": 1, "btnDefault_OnClick": 1, "//END": 1, "dialog_request": 1, "param": 1, "sldSpeed_OnChange": 1, "btnRestart_OnClick": 1, "btnRestartYes_OnClick": 1, "btnRestartNo_OnClick": 1, "btnCancelSave_OnClick": 1, "btnSaveGame_OnClick": 2, "gameSlotToSaveInto": 3, "i": 5, "while": 1, "<": 1, "lstSaveGamesList.SaveGameSlots": 2, "SaveGameSlot": 1, "btnCancelRestore_OnClick": 1, "btnRestoreGame_OnClick": 1, "RestoreGameSlot": 1, "lstSaveGamesList_OnSelectionCh": 1, "lstSaveGamesList.SelectedIndex": 3, "txtNewSaveName_OnActivate": 1, "btnDeleteSave_OnClick": 1, "DeleteSaveSlot": 1, "KeyboardMovement_VERSION": 1, "struct": 1, "import": 1 }, "AMPL": { "set": 9, "I": 7, ";": 32, "param": 13, "Value": 3, "{": 23, "}": 23, "Weight": 3, "KnapsackBound": 3, "var": 4, "Take": 3, "binary": 1, "maximize": 2, "TotalValue": 1, "sum": 10, "i": 19, "in": 19, "[": 18, "]": 18, "*": 6, "s.t.": 1, "WeightLimit": 1, "<": 1, "data": 1, "num_beams": 2, "#": 6, "number": 3, "of": 6, "beams": 2, "num_rows": 2, "integer": 2, "rows": 2, "num_cols": 2, "columns": 2, "BEAMS": 7, "..": 3, "ROWS": 6, "COLUMNS": 6, "beam_values": 5, "tumor_values": 2, "critical_values": 2, "critical_max": 2, "tumor_min": 2, "X": 5, "tumor_area": 5, "k": 20, "h": 20, "critical_area": 5, "S": 3, "(": 8, ")": 8, "T": 3, "total_tumor_dosage": 1, "minimize": 3, "total_critical_dosage": 1, "total_tumor_slack": 1, "total_critical_slack": 1, "subject": 2, "to": 2, "tumor_limit": 1, "-": 1, "critical_limit": 1, "+": 1 }, "API Blueprint": { "FORMAT": 3, "1A": 3, "This": 7, "is": 6, "one": 2, "of": 4, "the": 16, "simplest": 1, "APIs": 1, "written": 1, "in": 6, "**API": 1, "Blueprint**.": 1, "One": 1, "plain": 1, "resource": 3, "combined": 1, "with": 3, "a": 8, "method": 1, "and": 6, "that": 3, "**Note": 1, "**": 1, "As": 1, "we": 1, "progress": 1, "through": 1, "examples": 1, "do": 1, "not": 1, "also": 1, "forget": 1, "to": 11, "view": 1, "[": 17, "Raw": 4, "]": 17, "(": 25, "https": 6, "//raw.github.com/apiaryio/api": 4, "-": 10, "blueprint/master/examples/01.": 2, "%": 17, "20Simplest": 2, "20API.md": 2, ")": 25, "code": 1, "see": 1, "what": 1, "really": 1, "going": 1, "on": 1, "API": 12, "Blueprint": 8, "as": 2, "opposed": 1, "just": 1, "seeing": 1, "output": 1, "Github": 1, "Markdown": 1, "parser.": 1, "Also": 1, "please": 1, "keep": 1, "mind": 1, "every": 1, "single": 1, "example": 5, "this": 2, "course": 1, "**real": 1, "Blueprint**": 1, "such": 1, "you": 2, "can": 2, "**parse**": 1, "it": 1, "parser": 1, "//github.com/apiaryio/drafter": 1, "or": 3, "its": 1, "bindings": 1, ".": 1, "##": 7, "+": 25, "Next": 2, "Resource": 2, "Actions": 1, "20Resource": 2, "20and": 1, "20Actions.md": 1, "Response": 5, "text/plain": 1, "Hello": 1, "World": 1, "demonstrates": 2, "how": 3, "describe": 1, "body": 2, "attributes": 2, "request": 1, "response": 1, "message.": 1, "In": 1, "case": 1, "description": 1, "complementary": 1, "duplicate": 1, "provided": 1, "JSON": 1, "section.": 1, "The": 1, "Advanced": 2, "Attributes": 3, "20Advanced": 3, "20Attributes.md": 3, "will": 2, "demonstrate": 1, "avoid": 1, "duplicates": 1, "reuse": 1, "descriptions.": 1, "Previous": 2, "Parameters": 4, "20Parameters.md": 1, "blueprint/master/examples/08.": 1, "Coupon": 2, "/coupons/": 1, "{": 7, "id": 6, "}": 7, "A": 3, "coupon": 4, "contains": 1, "information": 1, "about": 1, "percent": 1, "off": 2, "amount": 1, "discount": 2, "might": 1, "want": 1, "apply": 1, "customer.": 1, "###": 1, "Retrieve": 2, "GET": 3, "Retrieves": 1, "given": 1, "ID.": 1, "application/json": 3, "object": 1, "string": 4, "created": 1, "number": 4, "Time": 1, "stamp": 1, "percent_off": 1, "positive": 1, "integer": 1, "between": 1, "represents": 1, "apply.": 1, "redeem_by": 1, "Date": 1, "after": 1, "which": 1, "no": 1, "longer": 1, "be": 1, "redeemed": 1, "Body": 1, "null": 1, "action": 2, "fact": 1, "state": 3, "transition.": 1, "an": 1, "transition": 2, "another": 2, "resource.": 1, "Model": 1, "20Model.md": 1, "blueprint/master/examples/11.": 1, "20Action.md": 1, "status": 1, "priority": 1, "List": 1, "All": 1, "Tasks": 1, "false": 2, "true": 1, "Task": 2, "/task/": 2, "Delete": 1, "DELETE": 1 }, "APL": { "NameSpace": 1, "UT": 1, "sac": 2, "expect_orig": 3, "expect": 5, "NS": 4, "exception": 4, "nexpect_orig": 2, "nexpect": 3, "{": 29, "Z": 76, "}": 29, "Conf": 11, "run": 1, "Argument": 26, ";": 67, "PRE_test": 4, "POST_test": 4, "TEST_step": 6, "COVER_step": 4, "FromSpace": 9, "RSI": 1, "If": 22, "NC": 8, "has": 3, "PROFILE": 4, "EndIf": 21, "is_function": 2, "single_function_test_function": 2, "COVER_file": 4, "ElseIf": 5, "is_list_of_functions": 2, "list_of_functions_test_function": 2, "is_file": 2, "file_test_function": 2, "(": 56, "get_file_name": 2, ")": 55, "is_dir": 2, "test_files": 2, "test_files_in_dir": 2, "test_dir_function": 2, "generate_coverage_page": 2, "#.": 2, "CY": 2, "#.UT.appdir": 3, "SE.SALT.Load": 3, "TestName": 2, "run_ut": 4, "ListOfNames": 2, "t": 20, "TS": 15, "-": 7, "print_passed_crashed_failed": 3, "FilePath": 3, "FileNS": 3, "Functions": 3, "TestFunctions": 4, "FileNS.": 1, "NL": 1, "is_test": 2, "/Functions": 1, "0/": 2, "Else": 11, "Test_files": 3, "/": 9, "#.UT.run": 1, "separator": 3, "ProfileData": 7, "CoverResults": 7, "HTML": 3, "ToCover": 6, "retrieve_coverables": 2, "in": 4, "Representations": 2, "get_representation": 2, "generate_cover_result": 2, "[": 23, "]": 23, "generate_html": 2, "write_html_to_page": 2, "Something": 5, "nc": 10, "functions": 3, "strip": 2, "input": 2, "/input": 1, "Function": 4, "rep": 9, "CR": 2, "name": 8, "representation": 4, "Indices": 3, "lines": 4, "functionlines": 4, "covered_lines": 3, "+": 12, "/lines": 1, "Covered": 4, "Total": 4, "Percentage": 3, "CoverageText": 3, "ColorizedCode": 3, "Timestamp": 3, "Page": 16, "colorize_code_by_coverage": 2, "generate_timestamp_text": 2, "CoverResult": 9, "Colors": 8, "Ends": 8, "Code": 3, "UCS": 4, "/Z": 1, "YYMMDD": 3, "HHMMSS": 3, "/3": 2, "tie": 6, "filename": 6, "Trap": 2, "NTIE": 1, "NERASE": 1, "NCREATE": 2, "EndTrap": 2, "Simple_array": 2, "/Page": 1, "NAPPEND": 1, "attr": 3, "WG": 2, "CMD": 1, "NA": 1, "gfa": 1, "file": 1, "exists": 1, "Return": 1, "bit": 1, "SH": 1, "#.Files.Dir": 1, "ut_data": 6, "returned": 9, "crashed": 6, "pass": 6, "crash": 3, "fail": 5, "message": 5, "time": 10, "execute_function": 2, "determine_pass_crash_or_fail": 2, "determine_message": 2, "print_message_to_screen": 2, "function": 5, "reset_UT_globals": 2, "DM": 1, "FunctionName": 5, "wsIndex": 3, "Heading": 2, "ArrayRes": 4, "r": 3, "c": 2, "z": 3, "IO": 2, "failure_message": 3, "term_to_text": 3, "Term": 2, "Text": 4, "Rows": 3, "#.DISPLAY": 1, "Cause": 2, "hdr": 7, "exp": 7, "expterm": 7, "got": 7, "gotterm": 7, "#.UT.expect": 1, "align_and_join_message_parts": 2, "Parts": 2, "R1": 3, "C1": 2, "R2": 3, "C2": 3, "W": 7, "/C1": 1, "confparam": 4, "config": 4, "/config": 1, "EndNameSpace": 1, "You": 1, "can": 2, "try": 1, "this": 2, "at": 1, "http": 1, "//tryapl.org/": 1, "I": 2, "not": 1, "explain": 1, "how": 1, "much": 1, "suddenly": 1, "love": 1, "crypto": 1, "language": 1, "Starts": 2, "Middles": 2, "Qualifiers": 2, "Finishes": 2, "rf": 2, "erf": 2, "deepak": 2, "SHEBANG#!apl": 1, "NEWLINE": 2, "HEADERS": 3, "OFF": 1 }, "ASN.1": { "MyShopPurchaseOrders": 1, "DEFINITIONS": 1, "AUTOMATIC": 1, "TAGS": 1, "BEGIN": 1, "PurchaseOrder": 1, "SEQUENCE": 5, "{": 4, "dateOfOrder": 1, "DATE": 1, "customer": 1, "CustomerInfo": 2, "items": 1, "ListOfItems": 2, "}": 4, "companyName": 1, "VisibleString": 5, "(": 21, "SIZE": 7, ")": 21, "billingAddress": 1, "Address": 2, "contactPhone": 1, "NumericString": 2, "street": 1, "..": 3, "OPTIONAL": 1, "city": 1, "state": 1, "FROM": 1, "zipCode": 1, "|": 5, "OF": 1, "Item": 2, "itemCode": 1, "INTEGER": 4, "color": 1, "power": 1, "deliveryTime": 1, "quantity": 1, "unitPrice": 1, "REAL": 1, "isTaxable": 1, "BOOLEAN": 1, "END": 1 }, "ATS": { "//": 326, "#include": 12, "staload": 29, "UN": 4, "GMP": 1, "vtypedef": 5, "mpz": 2, "GMP.mpz_vt0ype": 1, "macdef": 4, "i2u": 8, "(": 868, "x": 119, ")": 869, "g1int2uint_int_uint": 1, "local": 14, "assume": 2, "intinf_vtype": 1, "i": 129, "int": 55, "HX": 2, "[": 47, "]": 47, "is": 1, "a": 63, "fake": 1, "l": 4, "addr": 1, "@": 1, "mfree_gc_v": 1, "|": 23, "ptr": 3, "in": 44, "implement": 101, "{": 272, "}": 271, "intinf_make_int": 1, "where": 26, "val": 167, "ptr_alloc": 15, "": 15, "GMP.mpz_init_set_int": 1, "x.2": 48, "intinf_make_uint": 1, "GMP.mpz_init_set_uint": 1, "intinf_make_lint": 1, "GMP.mpz_init_set_lint": 1, "intinf_make_ulint": 1, "GMP.mpz_init_set_ulint": 1, "intinf_free": 2, "let": 37, "pfat": 2, "pfgc": 2, "p": 3, "GMP.mpz_clear": 1, "ptr_free": 1, "end": 87, "intinf_get_int": 1, "GMP.mpz_get_int": 1, "intinf_get_lint": 1, "GMP.mpz_get_lint": 1, "intinf_get_strptr": 1, "base": 5, "GMP.mpz_get_str_null": 1, "fprint_intinf_base": 2, "out": 8, "nsz": 2, "GMP.mpz_out_str": 1, "if": 30, "then": 28, "exit_errmsg": 1, "neg_intinf0": 6, "GMP.mpz_neg": 2, "neg_intinf1": 1, "y": 80, "GMP.mpz_init": 11, "y.2": 22, "abs_intinf0": 1, "GMP.mpz_abs": 2, "abs_intinf1": 1, "succ_intinf0": 1, "add_intinf0_int": 3, "succ_intinf1": 1, "add_intinf1_int": 3, "pred_intinf0": 1, "sub_intinf0_int": 3, "pred_intinf1": 1, "sub_intinf1_int": 3, "GMP.mpz_add2_int": 1, "z": 21, "z.2": 17, "GMP.mpz_add3_int": 1, "add_int_intinf0": 1, "add_int_intinf1": 1, "add_intinf0_intinf1": 1, "GMP.mpz_add2_mpz": 2, "add_intinf1_intinf0": 1, "add_intinf1_intinf1": 1, "GMP.mpz_add3_mpz": 1, "GMP.mpz_sub2_int": 1, "GMP.mpz_sub3_int": 1, "sub_int_intinf0": 1, "sub_int_intinf1": 1, "sub_intinf0_intinf1": 2, "GMP.mpz_sub2_mpz": 1, "sub_intinf1_intinf0": 1, "sub_intinf1_intinf1": 1, "GMP.mpz_sub3_mpz": 1, "mul_intinf0_int": 2, "GMP.mpz_mul2_int": 1, "mul_intinf1_int": 2, "GMP.mpz_mul3_int": 1, "mul_int_intinf0": 1, "mul_int_intinf1": 1, "mul_intinf0_intinf1": 1, "GMP.mpz_mul2_mpz": 2, "mul_intinf1_intinf0": 1, "mul_intinf1_intinf1": 1, "GMP.mpz_mul3_mpz": 1, "div_intinf0_int": 2, "j": 66, "GMP.mpz_tdiv2_q_uint": 2, "else": 25, "of": 50, "div_intinf1_int": 2, "GMP.mpz_tdiv3_q_uint": 2, "div_intinf0_intinf1": 1, "GMP.mpz_tdiv2_q_mpz": 1, "div_intinf1_intinf1": 1, "GMP.mpz_tdiv3_q_mpz": 1, "ndiv_intinf0_int": 1, "ndiv_intinf1_int": 1, "nmod_intinf0_int": 1, "r": 31, "GMP.mpz_fdiv_uint": 2, "UN.cast": 20, "intBtw": 2, "nmod_intinf1_int": 1, "lt_intinf_int": 2, "sgn": 54, "GMP.mpz_cmp_int": 8, "ans": 12, "<": 30, "true": 13, "false": 12, "bool": 37, "lt_intinf_intinf": 2, "GMP.mpz_cmp_mpz": 7, "lte_intinf_int": 2, "lte_intinf_intinf": 2, "gt_intinf_int": 2, "gt_intinf_intinf": 2, "gte_intinf_int": 2, "gte_intinf_intinf": 2, "eq_intinf_int": 2, "eq_intinf_intinf": 2, "neq_intinf_int": 2, "neq_intinf_intinf": 2, "compare_intinf_int": 2, "-": 50, "compare_int_intinf": 2, "compare_intinf_intinf": 2, "pow_intinf_int": 1, "exp": 2, "r.2": 2, "GMP.mpz_pow_uint": 1, "base.2": 1, "print_intinf": 1, "fprint_intinf": 3, "stdout_ref": 4, "prerr_intinf": 1, "stderr_ref": 1, "fun": 48, "channel_cap": 1, "intGte": 2, "abstype": 6, "session_msg": 2, "vt@ype": 2, "ssession_nil": 2, "ssession_cons": 3, "type": 64, "ssn": 53, "stadef": 7, "msg": 9, "nil": 6, "cons": 2, "session_append": 2, "ssn1": 13, "ssn2": 13, "append": 4, "session_choose": 2, "choose": 4, "session_repeat": 2, "repeat": 6, "typedef": 11, "session_sing": 1, "absvtype": 2, "channel1_vtype": 3, "G": 87, "iset": 23, "n": 120, "channel1": 39, "cchannel1": 3, "ncomp": 1, "channel1_get_nrole": 1, "chan": 4, "channel1_get_group": 1, "intset": 2, "vt0p": 8, "channel1_close": 1, "void": 24, "channel1_skipin": 1, "nat": 14, "ismbr": 20, ";": 22, "function": 2, "praxi": 2, "lemma_channel1_skipin": 2, "channel1_skipex": 1, "lemma_channel1_skipex": 2, "channel1_send": 2, "channel1_recv": 2, "&": 1, "channel1_recv_val": 1, "channel1_append": 2, "fserv": 2, "": 2, "datatype": 5, "choosetag": 3, "b": 18, "c": 6, "choosetag_l": 1, "choosetag_r": 1, "channel1_choose_l": 2, "channel1_choose_r": 2, "channel1_choose_tag": 1, "isnil": 2, "ssn_chosen": 6, "#": 4, "channel1_repeat_0": 1, "channel1_repeat_nil": 1, "channel1_repeat_1": 1, "channel1_repeat_more": 1, "channel1_repeat_tag": 1, "channel1_link": 1, "G1": 3, "G2": 3, "isful": 1, "+": 8, "G1*G2": 1, "channel1_link_elim": 1, "cchannel1_create_exn": 2, "nrole": 1, "%": 3, "#define": 2, "NPHIL": 6, "nphil": 12, "natLt": 1, "phil_left": 3, "phil_right": 3, "phil_loop": 9, "cleaner_loop": 5, "fork_vtype": 3, "fork": 11, "fork_get_num": 4, "phil_dine": 3, "lf": 5, "rf": 5, "phil_think": 3, "cleaner_wash": 3, "f": 22, "cleaner_return": 3, "fork_changet": 5, "channel": 3, "forktray_changet": 4, "_": 7, "nmod": 1, "extern": 19, "randsleep": 6, "ignoret": 2, "sleep": 2, "uInt": 1, "rand": 1, "mod": 1, "println": 9, "nl": 2, "nr": 2, "ch_lfork": 2, "ch_rfork": 2, "channel_takeout": 3, "try": 1, "to": 1, "actively": 1, "induce": 1, "deadlock": 1, "ch_forktray": 3, "channel_insert": 4, "ch": 7, "f0": 4, "dynload": 3, "mythread_create_cloptr": 6, "llam": 6, "main0": 3, "while": 1, "datavtype": 1, "FORK": 3, "the_forkarray": 2, "t": 1, "array_tabulate": 1, "fopr": 1, "": 2, "channel_create_exn": 2, "": 2, "i2sz": 5, "arrayref_tabulate": 1, "the_forktray": 2, "sortdef": 2, "ftype": 13, "infixr": 2, "": 3, "functor": 12, "F": 34, "list0": 9, "functor_list0": 7, "lam": 20, "xs": 4, "list0_map": 2, "": 3, "": 3, "CoYoneda": 7, "CoYoneda_phi": 2, "CoYoneda_psi": 3, "ftor": 9, "fx": 8, "int0": 4, "I": 7, "True": 7, "False": 8, "boxed": 2, "boolean": 2, "bool2string": 4, "string": 3, "case": 2, "fprint_val": 2, "": 2, "fprint": 2, "int2bool": 2, "myintlist0": 2, "g0ofg1": 1, "list": 1, "myboolist0": 9, "fprintln": 3, "option0": 3, "functor_option0": 2, "opt": 2, "option0_map": 1, "functor_homres": 2, "Yoneda_phi": 3, "Yoneda_psi": 3, "m": 4, "mf": 4, "natrans": 3, "Yoneda_phi_nat": 2, "Yoneda_psi_nat": 2, "*": 1, "list_t": 1, "g0ofg1_list": 1, "Yoneda_bool_list0": 3, "myboolist1": 2, "#ifdef": 2, "MYGRADING_HATS": 1, "#then": 1, "#else": 1, "csv_parse_line": 3, "line": 7, "List0_vt": 2, "Strptr1": 3, "#endif": 1, "getpos": 3, "is_end": 3, "char_at": 4, "Strptr1_at": 4, "i0": 11, "rmove": 4, "rmove_while": 5, "test": 4, "char": 2, "c0": 3, "int2char0": 1, "g1ofg0": 1, "var": 2, "p_i": 4, "addr@i": 1, "n0": 5, "sz2i": 1, "length": 1, "get_i": 6, "UN.ptr0_get": 1, "": 3, "inc_i": 2, "UN.ptr0_addby": 1, "set_i": 1, "UN.ptr0_set": 1, "ckastloc_gintGte": 2, "char2u2int0": 1, "i1": 4, "ckastloc_gintBtwe": 1, "UN.castvwtp0": 1, "string_make_substring": 1, "res_vt": 3, "loop": 3, "res": 3, "lam@": 1, "": 1, "addr@f0": 1, "s0": 2, "list_vt_cons": 1, "list_vt_reverse": 1, "list_vt_nil": 1 }, "ActionScript": { "package": 2, "mypackage": 1, "{": 10, "public": 5, "class": 4, "Hello": 1, "function": 4, "sayHello": 1, "(": 11, ")": 11, "void": 1, "trace": 3, ";": 9, "}": 10, "foobar": 1, "import": 1, "flash.display.MovieClip": 1, "Bar": 4, "getNumber": 2, "Number": 3, "return": 2, "Foo": 3, "extends": 2, "private": 1, "var": 3, "ourNumber": 2, "override": 1, "Main": 2, "MovieClip": 1, "x": 1, "new": 2, "y": 1, "x.getNumber": 1, "y.getNumber": 1 }, "Adobe Font Metrics": { "StartFontMetrics": 3, "Comment": 6, "Generated": 3, "by": 4, "FontForge": 3, "Creation": 3, "Date": 3, "Sun": 3, "Jul": 3, "FontName": 3, "SpecialElite": 1, "-": 635, "Regular": 4, "FullName": 3, "Special": 2, "Elite": 2, "FamilyName": 3, "Weight": 3, "Book": 1, "Notice": 3, "(": 6, "Copyright": 1, "c": 4, ")": 6, "Brian": 1, "J.": 1, "Bonislawsky": 1, "DBA": 1, "Astigmatic": 1, "AOETI": 1, ".": 1, "All": 1, "rights": 1, "reserved.": 1, "Available": 1, "under": 1, "the": 1, "Apache": 1, "licence.http": 1, "2.0.html": 1, "ItalicAngle": 3, "IsFixedPitch": 3, "false": 3, "UnderlinePosition": 3, "UnderlineThickness": 3, "Version": 3, "EncodingScheme": 3, "ISO10646": 3, "FontBBox": 3, "CapHeight": 2, "XHeight": 2, "Ascender": 2, "Descender": 2, "StartCharMetrics": 3, "C": 273, ";": 1084, "WX": 271, "N": 272, "space": 3, "B": 273, "exclam": 2, "quotedbl": 36, "numbersign": 2, "dollar": 2, "percent": 2, "ampersand": 9, "quotesingle": 9, "parenleft": 1, "parenright": 1, "asterisk": 2, "plus": 1, "comma": 5, "hyphen": 7, "period": 5, "slash": 28, "zero": 1, "one": 2, "two": 1, "three": 1, "four": 2, "five": 1, "six": 1, "seven": 2, "eight": 1, "nine": 1, "colon": 1, "semicolon": 1, "less": 1, "equal": 1, "greater": 1, "question": 2, "at": 1, "A": 5, "D": 1, "E": 1, "F": 1, "G": 1, "H": 1, "I": 2, "J": 39, "K": 61, "L": 24, "M": 1, "O": 1, "P": 1, "Q": 1, "R": 1, "S": 1, "T": 3, "U": 1, "V": 3, "W": 1, "X": 1, "Y": 3, "Z": 2, "bracketleft": 1, "backslash": 2, "ugrave": 2, "uacute": 2, "ucircumflex": 2, "udieresis": 2, "yacute": 3, "thorn": 1, "ydieresis": 3, "Amacron": 4, "amacron": 1, "Abreve": 4, "abreve": 1, "Aogonek": 4, "aogonek": 1, "Cacute": 1, "cacute": 2, "Ccircumflex": 1, "ccircumflex": 2, "Cdotaccent": 1, "cdotaccent": 2, "Ccaron": 1, "ccaron": 2, "Dcaron": 1, "dcaron": 2, "Dcroat": 1, "dcroat": 1, "Emacron": 1, "emacron": 3, "Ebreve": 1, "ebreve": 3, "Edotaccent": 1, "edotaccent": 2, "Eogonek": 1, "eogonek": 2, "Ecaron": 1, "ecaron": 2, "Gcircumflex": 1, "gcircumflex": 1, "Gbreve": 1, "gbreve": 1, "Gdotaccent": 1, "gdotaccent": 1, "Gcommaaccent": 1, "gcommaaccent": 2, "Hcircumflex": 1, "hcircumflex": 1, "Hbar": 1, "hbar": 1, "Itilde": 1, "itilde": 2, "Imacron": 2, "imacron": 2, "Ibreve": 1, "ibreve": 2, "Iogonek": 2, "iogonek": 2, "Idotaccent": 2, "dotlessi": 1, "IJ": 1, "ij": 1, "Jcircumflex": 4, "jcircumflex": 1, "Kcommaaccent": 1, "kcommaaccent": 1, "kgreenlandic": 1, "Lacute": 1, "lacute": 1, "Lcommaaccent": 1, "lcommaaccent": 1, "Lcaron": 1, "lcaron": 1, "Ldot": 1, "ldotaccent": 1, "Lslash": 1, "lslash": 1, "Nacute": 1, "nacute": 2, "Ncommaaccent": 1, "ncommaaccent": 2, "Ncaron": 1, "ncaron": 2, "napostrophe": 1, "Eng": 1, "eng": 2, "Omacron": 1, "omacron": 3, "Obreve": 1, "obreve": 3, "Ohungarumlaut": 1, "ohungarumlaut": 3, "OE": 1, "oe": 2, "Racute": 1, "racute": 2, "Rcommaaccent": 1, "rcommaaccent": 2, "Rcaron": 1, "rcaron": 2, "Sacute": 1, "sacute": 2, "Scircumflex": 1, "scircumflex": 2, "Scedilla": 1, "scedilla": 2, "Scaron": 1, "scaron": 1, "Tcommaaccent": 2, "tcommaaccent": 1, "Tcaron": 2, "tcaron": 1, "Tbar": 2, "tbar": 1, "Utilde": 1, "utilde": 2, "Umacron": 1, "umacron": 2, "Ubreve": 1, "ubreve": 2, "Uring": 1, "uring": 2, "Uhungarumlaut": 1, "uhungarumlaut": 2, "Uogonek": 1, "uogonek": 2, "Wcircumflex": 1, "wcircumflex": 4, "Ycircumflex": 2, "ycircumflex": 3, "Ydieresis": 2, "Zacute": 1, "zacute": 1, "Zdotaccent": 1, "zdotaccent": 2, "Zcaron": 1, "zcaron": 1, "AEacute": 3, "aeacute": 1, "Oslashacute": 1, "oslashacute": 3, "dotlessj": 1, "circumflex": 1, "caron": 1, "breve": 1, "dotaccent": 1, "ring": 1, "ogonek": 1, "tilde": 1, "hungarumlaut": 1, "uni0312": 1, "uni0315": 1, "uni0326": 1, "mu": 1, "Wgrave": 1, "wgrave": 4, "Wacute": 1, "wacute": 4, "Wdieresis": 1, "wdieresis": 4, "Ygrave": 2, "ygrave": 3, "endash": 3, "emdash": 3, "quoteleft": 9, "quoteright": 2, "quotesinglbase": 3, "quotedblleft": 2, "quotedblright": 2, "quotedblbase": 3, "dagger": 1, "daggerdbl": 1, "bullet": 1, "ellipsis": 3, "perthousand": 1, "guilsinglleft": 3, "guilsinglright": 2, "fraction": 1, "Euro": 1, "trademark": 9, "partialdiff": 1, "product": 1, "minus": 1, "approxequal": 1, "notequal": 1, "fi": 1, "fl": 1, ".notdef": 2, ".null": 1, "nonmarkingreturn": 1, "EndCharMetrics": 3, "StartKernData": 2, "StartKernPairs": 2, "KPX": 215, "Aacute": 2, "Acircumflex": 2, "Atilde": 2, "Agrave": 2, "Aring": 3, "Adieresis": 3, "AE": 3, "Yacute": 2, "edieresis": 2, "ecircumflex": 2, "egrave": 2, "eacute": 2, "e": 3, "v": 3, "guillemotright": 1, "guillemotleft": 2, "germandbls": 1, "p": 1, "m": 1, "b": 3, "y": 2, "w": 2, "u": 1, "q": 2, "otilde": 1, "odieresis": 1, "ocircumflex": 1, "ograve": 1, "oacute": 1, "eth": 1, "oslash": 1, "o": 2, "d": 2, "ccedilla": 1, "EndKernPairs": 2, "EndKernData": 2, "EndFontMetrics": 3, "Greek_Lambda_Character": 3, "NONE.": 1, "NADA.": 1, "PUBLIC": 1, "DOMAIN": 1, "BOI": 1, "uni000D": 1, "lambda": 1, "NULL": 1, "OpenSansCondensed": 1, "Bold": 3, "Open": 2, "Sans": 2, "Condensed": 2, "Digitized": 1, "data": 1, "copyright": 1, "Google": 1, "Corporation.": 1, "six.os": 1, "seven.os": 1, "eight.os": 1, "nine.os": 1, "g.alt": 1, "gcircumflex.alt": 1, "gbreve.alt": 1, "gdot.alt": 1, "gcommaaccent.alt": 1, "cyrotmarkcomb": 1, "uni1ECA": 1, "uni1EC8": 1, "Idieresis": 1, "Icircumflex": 1, "Iacute": 1, "Igrave": 1, "uni1EF9": 1, "g": 1, "Delta": 7 }, "Agda": { "module": 3, "NatCat": 1, "where": 2, "open": 2, "import": 2, "EasyCategory": 3, "(": 36, "obj": 4, "Set": 2, ")": 36, "_": 6, "{": 10, "x": 34, "y": 28, "z": 18, "}": 10, "id": 9, "single": 4, "-": 17, "inhabitant": 4, "r": 26, "s": 29, "assoc": 2, "w": 4, "t": 6, "Data.Nat": 1, "same": 5, ".0": 2, "n": 14, "refl": 6, ".": 5, "suc": 6, "m": 6, "cong": 1, "trans": 5, ".n": 1, "zero": 1, "Nat": 1 }, "Alloy": { "module": 3, "examples/systems/marksweepgc": 1, "sig": 20, "Node": 12, "{": 58, "}": 64, "HeapState": 5, "left": 3, "right": 1, "-": 20, "lone": 6, "marked": 1, "set": 10, "freeList": 1, "pred": 17, "clearMarks": 1, "[": 89, "hs": 24, "no": 9, "fun": 1, "reachable": 1, "n": 5, "]": 77, "+": 14, "n.": 1, "(": 12, "hs.left": 1, "hs.right": 1, ")": 12, "mark": 1, "from": 1, "setFreeList": 1, ".left": 4, "in": 22, "hs.marked": 2, "all": 18, "|": 20, ".freeList.*": 1, "else": 1, "GC": 1, "root": 6, "some": 4, "hs1": 2, "hs2": 2, "hs.clearMarks": 1, "&&": 4, "hs1.mark": 1, "hs2.setFreeList": 1, "assert": 4, "Soundness1": 2, "h": 15, "h.GC": 3, "live": 1, "h.reachable": 1, "Soundness2": 2, ".reachable": 2, "Completeness": 2, "check": 6, "for": 6, "expect": 6, "examples/systems/views": 1, "open": 2, "util/ordering": 1, "State": 17, "as": 2, "so": 1, "util/relation": 1, "rel": 1, "Ref": 16, "Object": 10, "refs": 5, "obj": 1, "one": 8, "views": 1, "ViewType": 8, "dirty": 1, "Map": 2, "extends": 10, "keys": 3, "map": 1, "s": 6, "Ref.map": 1, "s.refs": 3, "MapRef": 4, "fact": 5, "State.obj": 3, "Iterator": 2, "done": 3, "lastRef": 2, "IteratorRef": 5, "Set": 2, "elts": 2, "SetRef": 6, "abstract": 2, "KeySetView": 11, "ViewTypes": 1, "State.views": 3, "IteratorView": 3, "s.views": 2, "modifies": 6, "pre": 18, "post": 17, "rs": 4, "let": 5, "vr": 1, "pre.views": 9, "mods": 3, "rs.*vr": 1, "r": 3, "pre.refs": 6, "pre.obj": 11, "post.obj": 8, "b": 11, "v": 22, "t": 14, "viewFrame": 4, "post.dirty": 1, "pre.dirty": 1, "allocates": 6, "&": 1, "post.refs": 1, ".map": 5, ".elts": 4, "dom": 2, "<": 2, "v.map": 1, "MapRef.keySet": 1, "setRefs": 4, "this": 15, "none": 5, "post.views": 5, "MapRef.put": 1, "k": 5, "SetRef.iterator": 1, "iterRef": 4, "i": 11, "i.left": 2, "i.done": 1, "i.lastRef": 1, "IteratorRef.remove": 1, "IteratorRef.next": 1, "ref": 2, "IteratorRef.hasNext": 1, "s.obj": 1, "zippishOK": 2, "ks": 3, "vs": 3, "m": 3, "ki": 2, "vi": 2, "s0": 4, "so/first": 1, "s1": 4, "so/next": 7, "s2": 6, "s3": 4, "s4": 4, "s5": 4, "s6": 4, "s7": 2, "precondition": 2, "s0.dirty": 1, "ks.iterator": 1, "vs.iterator": 1, "ki.hasNext": 1, "vi.hasNext": 1, "ki.this/next": 1, "vi.this/next": 1, "m.put": 1, "ki.remove": 1, "vi.remove": 1, "State.dirty": 1, "but": 1, "#s.obj": 1, "examples/systems/file_system": 1, "Name": 2, "File": 1, "d": 3, "Dir": 8, "d.entries.contents": 1, "entries": 3, "DirEntry": 2, "parent": 3, "this.": 4, "@contents.": 1, "@entries": 1, "e1": 2, "e2": 2, "e1.name": 1, "e2.name": 1, "@parent": 2, "Root": 5, "Cur": 1, "name": 1, "contents": 2, "OneParent_buggyVersion": 2, "d.parent": 2, "OneParent_correctVersion": 2, "contents.d": 1, "NoDirAliases": 3, "o": 1, "o.": 1 }, "Alpine Abuild": { "pkgname": 1, "abuild": 2, "pkgver": 2, "_ver": 1, "{": 6, "%": 1, "_git*": 1, "}": 6, "pkgrel": 1, "pkgdesc": 3, "url": 1, "arch": 3, "license": 1, "depends": 4, "attr": 1, "tar": 1, "pkgconf": 1, "patch": 2, "if": 1, "[": 1, "]": 1, ";": 4, "then": 1, "fi": 1, "makedepends_build": 1, "makedepends_host": 1, "makedepends": 1, "install": 4, "subpackages": 1, "options": 1, "pkggroups": 1, "source": 2, "_builddir": 1, "prepare": 1, "(": 5, ")": 6, "cd": 3, "for": 1, "i": 5, "in": 2, "do": 1, "case": 1, "*.patch": 1, "msg": 1, "-": 13, "p1": 1, "/": 1, "||": 5, "return": 5, "esac": 1, "done": 1, "sed": 1, "e": 1, "abuild.conf": 2, "build": 1, "make": 2, "package": 1, "DESTDIR": 1, "m": 2, "/etc/abuild.conf": 1, "d": 1, "g": 1, "/var/cache/distfiles": 1, "cpan": 2, "mkdir": 2, "p": 2, "/usr/bin": 2, "mv": 2, "/usr/bin/apkbuild": 2, "/usr/bin/": 2, "gems": 1, "gem": 1, "resolver": 1, "md5sums": 1, "sha256sums": 1, "sha512sums": 1 }, "AngelScript": { "#include": 1, "BotManager": 6, "g_BotManager": 1, "(": 202, "@CreateDumbBot": 1, ")": 202, ";": 166, "CConCommand@": 1, "m_pAddBot": 1, "void": 16, "PluginInit": 1, "{": 59, "g_BotManager.PluginInit": 1, "@m_pAddBot": 1, "@CConCommand": 1, "@AddBotCallback": 1, "}": 59, "AddBotCallback": 1, "const": 1, "CCommand@": 1, "args": 3, "if": 39, "args.ArgC": 1, "<": 10, "g_Game.AlertMessage": 3, "at_console": 3, "return": 16, "BaseBot@": 2, "pBot": 2, "g_BotManager.CreateBot": 1, "[": 30, "]": 30, "is": 17, "null": 15, "+": 25, "else": 10, "final": 1, "class": 2, "DumbBot": 2, "BaseBot": 2, "CBasePlayer@": 2, "pPlayer": 4, "super": 2, "Think": 2, "Player.pev.deadflag": 1, "DEAD_RESPAWNABLE": 1, "Player.pev.button": 4, "|": 2, "IN_ATTACK": 4, "&": 8, "KeyValueBuffer@": 1, "pInfoBuffer": 1, "g_EngineFuncs.GetInfoKeyBuffer": 1, "Player.edict": 1, "pInfoBuffer.SetValue": 2, "Math.RandomLong": 4, "for": 8, "uint": 13, "uiIndex": 4, "m_vecVelocity": 1, "-": 5, "CreateDumbBot": 1, "@DumbBot": 1, "array": 3, "": 6, "PayloadBeginTrigger": 1, "g_payloadBeginTriggers": 2, "PayloadTeamForcefield": 1, "g_teamForceFields": 3, "GameMode": 1, "Payload": 2, "TeamVersusGameMode": 12, "Editable": 8, "UnitFeed": 2, "PayloadUnit": 1, "FirstNode": 1, "default": 7, "int": 21, "PrepareTime": 2, "TimeLimit": 2, "TimeAddCheckpoint": 1, "float": 3, "TimeOvertime": 2, "TimePayloadHeal": 1, "PayloadHeal": 1, "PayloadBehavior@": 1, "m_payload": 2, "m_tmStarting": 6, "m_tmStarted": 7, "m_tmLimitCustom": 3, "m_tmOvertime": 7, "m_tmInOvertime": 3, "PayloadHUD@": 1, "m_payloadHUD": 1, "PayloadClassSwitchWindow@": 1, "m_switchClass": 1, "": 1, "@": 1, "m_switchedSidesData": 6, "Scene@": 1, "scene": 2, "m_tmRespawnCountdown": 1, "@m_payloadHUD": 1, "PayloadHUD": 1, "m_guiBuilder": 3, "@m_switchTeam": 1, "PayloadTeamSwitchWindow": 1, "@m_switchClass": 1, "PayloadClassSwitchWindow": 1, "UpdateFrame": 2, "ms": 4, "GameInput": 1, "gameInput": 2, "MenuInput": 1, "menuInput": 2, "override": 14, "m_payloadHUD.Update": 1, "Network": 6, "IsServer": 3, "uint64": 1, "tmNow": 4, "CurrPlaytimeLevel": 2, "GetPlayersInTeam": 2, "&&": 4, "Message": 3, "<<": 2, ".SendToAll": 3, "*": 3, "i": 24, "g_payloadBeginTriggers.length": 1, "WorldScript@": 1, "ws": 1, "WorldScript": 2, "GetWorldScript": 1, "g_scene": 1, "ws.Execute": 1, "m_ended": 1, "CheckTimeReached": 2, "string": 1, "NameForTeam": 1, "index": 3, "dt": 3, "m_payload.AttackersInside": 1, "TimeReached": 3, "SetWinner": 2, "false": 2, "bool": 6, "ShouldFreezeControls": 2, "m_switchClass.m_visible": 2, "||": 2, "ShouldDisplayCursor": 2, "CanSwitchTeams": 1, "PlayerRecord@": 3, "CreatePlayerRecord": 1, "PayloadPlayerRecord": 1, "GetPlayerClassCount": 1, "PlayerClass": 1, "playerClass": 2, "TeamVersusScore@": 2, "team": 7, "ret": 3, "team.m_players.length": 1, "team.m_players": 2, ".peer": 4, "continue": 4, "auto": 5, "record": 5, "cast": 9, "": 3, "record.playerClass": 1, "PlayerClassesUpdated": 1, "attackers": 3, "print": 2, "m_payloadHUD.Winner": 1, "EndMatch": 1, "DisplayPlayerName": 2, "idt": 10, "SpriteBatch": 3, "sb": 10, "PlayerHusk@": 1, "plr": 3, "vec2": 4, "pos": 5, "m_payloadHUD.DisplayPlayerName": 1, "RenderFrame": 2, "Player@": 1, "player": 4, "GetLocalPlayer": 1, "PlayerHealgun@": 1, "healgun": 2, "": 1, "player.m_currWeapon": 1, "healgun.RenderMarkers": 1, "RenderWidgets": 2, "m_payloadHUD.Draw": 1, "m_switchClass.Draw": 1, "GoNextMap": 2, "ChangeLevel": 1, "GetCurrentLevelFilename": 1, "SpawnPlayers": 2, "m_switchedSidesData.length": 1, "peer": 4, ".GetInteger": 2, "joinScore": 2, "FindTeamScore": 1, "m_teamScores": 3, "@joinScore": 2, "j": 10, "g_players.length": 2, "g_players": 6, "SpawnPlayer": 3, "joinScore.m_team": 1, "break": 2, "Save": 2, "SValueBuilder": 1, "builder": 2, "builder.PushArray": 1, "builder.PushInteger": 2, ".team": 1, "builder.PopArray": 1, "Start": 2, "uint8": 1, "SValue@": 1, "save": 4, "StartMode": 1, "sMode": 2, "@m_switchedSidesData": 1, "GetParamArray": 1, "UnitPtr": 3, "m_tmLimit": 1, "//": 2, "infinite": 1, "time": 1, "limit": 1, "as": 2, "far": 1, "VersusGameMode": 1, "concerned": 1, "minutes": 1, "by": 1, "@m_payload": 1, "": 1, "PayloadUnit.FetchFirst": 1, ".GetScriptBehavior": 1, "PrintError": 4, "unitFirstNode": 2, "FirstNode.FetchFirst": 1, "unitFirstNode.IsValid": 1, "node": 6, "PayloadNode": 4, "unitFirstNode.GetScriptBehavior": 2, "@m_payload.m_targetNode": 1, "PayloadNode@": 1, "prevNode": 3, "totalDistance": 3, "unitNode": 2, "while": 2, "unitNode.IsValid": 1, "unitNode.GetScriptBehavior": 2, "node.NextNode.FetchFirst": 1, "@node.m_prevNode": 1, "@node.m_nextNode": 1, "dist": 2, "prevNode.Position": 1, "node.Position": 1, "@prevNode": 1, "currDistance": 3, "distNode": 2, "distNode.m_prevNode": 1, "distNode.m_locationFactor": 2, "distNode.m_prevNode.Position": 1, "distNode.Position": 1, "/": 1, "@distNode": 1, "distNode.m_nextNode": 1, "m_payloadHUD.AddCheckpoints": 1, "unitId": 2, "PayloadPlayerRecord@": 1, "record.HandlePlayerClass": 1, ".local": 1, "//TODO": 1, "This": 1, "doesn": 1, "localAttackers": 2, "HashString": 1, "g_teamForceFields.length": 1, "hasCollision": 2, ".Attackers": 1, "units": 3, ".Units.FetchAll": 1, "k": 5, "units.length": 1, "PhysicsBody@": 1, "body": 2, ".GetPhysicsBody": 1, ".GetDebugName": 1, "body.SetActive": 1 }, "Ant Build System": { "": 2, "version=": 2, "encoding=": 2, "": 2, "name=": 64, "": 2, "": 32, "file=": 38, "": 2, "property=": 4, "": 2, "": 34, "location=": 32, "": 30, "depends=": 30, "description=": 16, "": 2, "": 2, "": 2 }, "ApacheConf": { "#": 182, "ServerRoot": 2, "#Listen": 2, "Listen": 2, "LoadModule": 126, "authn_file_module": 2, "authn_dbm_module": 2, "libexec/apache2/mod_authn_dbm.so": 1, "authn_anon_module": 2, "authn_dbd_module": 2, "libexec/apache2/mod_authn_dbd.so": 1, "authn_default_module": 2, "authz_host_module": 2, "authz_groupfile_module": 2, "authz_user_module": 2, "authz_dbm_module": 2, "libexec/apache2/mod_authz_dbm.so": 1, "authz_owner_module": 2, "authz_default_module": 2, "auth_basic_module": 2, "auth_digest_module": 2, "cache_module": 2, "libexec/apache2/mod_cache.so": 1, "disk_cache_module": 2, "mem_cache_module": 2, "libexec/apache2/mod_mem_cache.so": 1, "dbd_module": 2, "libexec/apache2/mod_dbd.so": 1, "dumpio_module": 2, "libexec/apache2/mod_dumpio.so": 1, "reqtimeout_module": 1, "ext_filter_module": 2, "include_module": 2, "libexec/apache2/mod_include.so": 1, "filter_module": 2, "libexec/apache2/mod_filter.so": 1, "substitute_module": 1, "deflate_module": 2, "libexec/apache2/mod_deflate.so": 1, "log_config_module": 3, "log_forensic_module": 2, "logio_module": 3, "libexec/apache2/mod_logio.so": 1, "env_module": 2, "libexec/apache2/mod_env.so": 1, "mime_magic_module": 2, "cern_meta_module": 2, "libexec/apache2/mod_cern_meta.so": 1, "expires_module": 2, "libexec/apache2/mod_expires.so": 1, "headers_module": 2, "libexec/apache2/mod_headers.so": 1, "ident_module": 2, "libexec/apache2/mod_ident.so": 1, "usertrack_module": 2, "libexec/apache2/mod_usertrack.so": 1, "#LoadModule": 4, "unique_id_module": 2, "libexec/apache2/mod_unique_id.so": 1, "setenvif_module": 2, "libexec/apache2/mod_setenvif.so": 1, "version_module": 2, "libexec/apache2/mod_version.so": 1, "proxy_module": 2, "libexec/apache2/mod_proxy.so": 1, "proxy_connect_module": 2, "proxy_ftp_module": 2, "libexec/apache2/mod_proxy_ftp.so": 1, "proxy_http_module": 2, "proxy_scgi_module": 1, "proxy_ajp_module": 2, "libexec/apache2/mod_proxy_ajp.so": 1, "proxy_balancer_module": 2, "ssl_module": 4, "libexec/apache2/mod_ssl.so": 1, "mime_module": 4, "libexec/apache2/mod_mime.so": 1, "dav_module": 2, "libexec/apache2/mod_dav.so": 1, "status_module": 2, "libexec/apache2/mod_status.so": 1, "autoindex_module": 2, "libexec/apache2/mod_autoindex.so": 1, "asis_module": 2, "libexec/apache2/mod_asis.so": 1, "info_module": 2, "libexec/apache2/mod_info.so": 1, "cgi_module": 2, "libexec/apache2/mod_cgi.so": 1, "dav_fs_module": 2, "libexec/apache2/mod_dav_fs.so": 1, "vhost_alias_module": 2, "negotiation_module": 2, "dir_module": 4, "libexec/apache2/mod_dir.so": 1, "imagemap_module": 2, "libexec/apache2/mod_imagemap.so": 1, "actions_module": 2, "libexec/apache2/mod_actions.so": 1, "speling_module": 2, "libexec/apache2/mod_speling.so": 1, "userdir_module": 2, "libexec/apache2/mod_userdir.so": 1, "alias_module": 4, "libexec/apache2/mod_alias.so": 1, "rewrite_module": 2, "libexec/apache2/mod_rewrite.so": 1, "perl_module": 1, "libexec/apache2/mod_perl.so": 1, "php5_module": 1, "libexec/apache2/libphp5.so": 1, "hfs_apple_module": 1, "libexec/apache2/mod_hfs_apple.so": 1, "": 17, "mpm_netware_module": 2, "mpm_winnt_module": 1, "User": 2, "_www": 2, "Group": 2, "": 17, "ServerAdmin": 3, "you@example.com": 2, "#ServerName": 2, "www.example.com": 2, "DocumentRoot": 3, "": 7, "Options": 7, "FollowSymLinks": 5, "AllowOverride": 7, "None": 8, "Order": 11, "deny": 11, "allow": 11, "Deny": 6, "from": 11, "all": 11, "": 7, "Library": 2, "WebServer": 2, "Documents": 1, "Indexes": 3, "MultiViews": 2, "Allow": 5, "DirectoryIndex": 3, "index.html": 2, "": 2, "Hh": 1, "Tt": 1, "Dd": 1, "Ss": 2, "_": 1, "Satisfy": 4, "All": 5, "": 2, "": 1, "rsrc": 1, "": 1, "": 1, "namedfork": 1, "": 1, "ErrorLog": 2, "LogLevel": 2, "warn": 2, "LogFormat": 6, "combined": 4, "common": 4, "combinedio": 2, "CustomLog": 2, "#CustomLog": 2, "ScriptAliasMatch": 1, "/cgi": 2, "-": 43, "bin/": 2, "(": 16, "i": 1, "webobjects": 1, ")": 17, ".*": 3, "cgid_module": 3, "#Scriptsock": 2, "/private/var/run/cgisock": 1, "CGI": 1, "Executables": 1, "DefaultType": 2, "text/plain": 2, "TypesConfig": 2, "/private/etc/apache2/mime.types": 1, "#AddType": 4, "application/x": 6, "gzip": 6, ".tgz": 6, "#AddEncoding": 4, "x": 4, "compress": 4, ".Z": 4, ".gz": 4, "AddType": 4, "#AddHandler": 4, "cgi": 3, "script": 2, ".cgi": 2, "type": 2, "map": 2, "var": 3, "text/html": 2, ".shtml": 4, "#AddOutputFilter": 2, "INCLUDES": 2, "#MIMEMagicFile": 2, "/private/etc/apache2/magic": 1, "#ErrorDocument": 8, "/missing.html": 2, "http": 2, "#MaxRanges": 1, "unlimited": 1, "#EnableMMAP": 2, "off": 5, "#EnableSendfile": 2, "TraceEnable": 1, "Include": 6, "/private/etc/apache2/extra/httpd": 11, "mpm.conf": 2, "#Include": 17, "multilang": 2, "errordoc.conf": 2, "autoindex.conf": 2, "languages.conf": 2, "userdir.conf": 2, "info.conf": 2, "vhosts.conf": 2, "manual.conf": 2, "dav.conf": 2, "default.conf": 2, "ssl.conf": 2, "SSLRandomSeed": 4, "startup": 2, "builtin": 4, "connect": 2, "authn_alias_module": 1, "authnz_ldap_module": 1, "file_cache_module": 1, "charset_lite_module": 1, "ldap_module": 1, "suexec_module": 1, "dav_lock_module": 1, "daemon": 2, "usr": 2, "share": 1, "apache2": 1, "default": 1, "site": 1, "htdocs": 1, "ht": 1, "/var/log/apache2/error_log": 1, "/var/log/apache2/access_log": 2, "ScriptAlias": 1, "/var/run/apache2/cgisock": 1, "lib": 1, "bin": 1, "/etc/apache2/mime.types": 1, "/etc/apache2/magic": 1, "/etc/apache2/extra/httpd": 11, "ServerSignature": 1, "Off": 1, "RewriteCond": 15, "%": 48, "{": 16, "REQUEST_METHOD": 1, "}": 16, "HEAD": 1, "|": 86, "TRACE": 1, "DELETE": 1, "TRACK": 1, "[": 17, "NC": 13, "OR": 14, "]": 17, "THE_REQUEST": 1, "r": 1, "n": 1, "0A": 6, "0D": 6, "HTTP_REFERER": 1, "<": 7, "3C": 5, "3E": 5, "HTTP_COOKIE": 1, "REQUEST_URI": 1, "/": 3, ";": 2, ".": 7, "HTTP_USER_AGENT": 5, "java": 1, "curl": 2, "wget": 2, "winhttp": 1, "HTTrack": 1, "clshttp": 1, "archiver": 1, "loader": 1, "email": 1, "harvest": 1, "extract": 1, "grab": 1, "miner": 1, "libwww": 1, "perl": 1, "python": 1, "nikto": 1, "scan": 1, "#Block": 1, "mySQL": 1, "injects": 1, "QUERY_STRING": 5, "*": 1, "union": 1, "select": 1, "insert": 1, "cast": 1, "set": 1, "declare": 1, "drop": 1, "update": 1, "md5": 1, "benchmark": 1, "./": 1, "localhost": 1, "loopback": 1, ".0": 2, ".1": 1, "a": 1, "z0": 1, "RewriteRule": 1, "index.php": 2, "F": 1, "#######################": 1, "######################": 1, "": 1, "127": 1, "0": 2, "1": 1, "PORT": 1, "patrick@heysparkbox.com": 1, "ServerName": 1, "HOSTNAME": 2, "www": 1, "": 1 }, "Apex": { "global": 70, "class": 7, "EmailUtils": 1, "{": 215, "static": 83, "void": 9, "sendEmailWithStandardAttachments": 3, "(": 466, "List": 71, "": 61, "recipients": 11, "String": 89, "emailSubject": 10, "body": 8, "Boolean": 38, "useHTML": 6, "": 1, "attachmentIDs": 2, ")": 466, "": 2, "stdAttachments": 4, "[": 82, "SELECT": 1, "id": 1, "name": 2, "FROM": 1, "Attachment": 2, "WHERE": 1, "Id": 1, "IN": 1, "]": 82, ";": 294, "}": 215, "": 3, "fileAttachments": 5, "new": 60, "for": 24, "attachment": 1, "Messaging.EmailFileAttachment": 2, "fileAttachment": 2, "fileAttachment.setFileName": 1, "attachment.Name": 1, "fileAttachment.setBody": 1, "attachment.Body": 1, "fileAttachments.add": 1, "sendEmail": 4, "sendTextEmail": 1, "textBody": 2, "false": 13, "null": 92, "sendHTMLEmail": 1, "htmlBody": 2, "true": 12, "if": 91, "return": 106, "recipients.size": 1, "Messaging.SingleEmailMessage": 3, "mail": 2, "//the": 2, "email": 1, "is": 5, "not": 3, "saved": 1, "as": 1, "an": 2, "activity.": 1, "mail.setSaveAsActivity": 1, "mail.setToAddresses": 1, "mail.setSubject": 1, "mail.setBccSender": 1, "mail.setUseSignature": 1, "mail.setHtmlBody": 1, "else": 25, "mail.setPlainTextBody": 1, "&&": 42, "fileAttachments.size": 1, "mail.setFileAttachments": 1, "Messaging.sendEmail": 1, "isValidEmailAddress": 2, "str": 10, "str.trim": 3, ".length": 2, "split": 5, "str.split": 1, "split.size": 2, ".split": 1, "isNotValidEmailAddress": 1, "ArrayUtils": 1, "EMPTY_STRING_ARRAY": 1, "Integer": 34, "MAX_NUMBER_OF_ELEMENTS_IN_LIST": 5, "get": 4, "objectToString": 1, "": 22, "objects": 3, "strings": 3, "objects.size": 1, "Object": 23, "obj": 3, "instanceof": 1, "strings.add": 1, "reverse": 2, "anArray": 14, "i": 55, "j": 10, "anArray.size": 2, "-": 20, "tmp": 6, "while": 8, "+": 71, "SObject": 19, "lowerCase": 1, "strs": 9, "returnValue": 22, "strs.size": 3, "returnValue.add": 3, "str.toLowerCase": 1, "upperCase": 1, "str.toUpperCase": 1, "trim": 1, "mergex": 2, "array1": 8, "array2": 9, "merged": 6, "array1.size": 4, "array2.size": 2, "<": 24, "": 19, "sObj": 4, "merged.add": 2, "isEmpty": 7, "objectArray": 17, "objectArray.size": 6, "isNotEmpty": 4, "pluck": 1, "fieldName": 3, "||": 10, "fieldName.trim": 2, "plucked": 3, ".get": 4, "toString": 3, "assertArraysAreEqual": 2, "expected": 16, "actual": 16, "//check": 2, "to": 4, "see": 2, "one": 2, "param": 2, "but": 2, "the": 3, "other": 2, "System.assert": 6, "ArrayUtils.toString": 12, "expected.size": 4, "actual.size": 2, "merg": 2, "list1": 13, "list2": 9, "returnList": 11, "list1.size": 8, "list2.size": 2, "throw": 6, "IllegalArgumentException": 5, "elmt": 8, "returnList.add": 8, "subset": 6, "aList": 4, "count": 10, "startIndex": 9, "list1.get": 2, "//": 8, "//LIST/ARRAY": 1, "SORTING": 1, "//FOR": 2, "FORCE.COM": 1, "PRIMITIVES": 1, "Double": 1, "ID": 1, "etc.": 1, "qsort": 18, "theList": 72, "PrimitiveComparator": 2, "sortAsc": 24, "ObjectComparator": 3, "comparator": 18, "theList.size": 2, "SALESFORCE": 1, "OBJECTS": 1, "sObjects": 1, "ISObjectComparator": 3, "private": 10, "lo0": 6, "hi0": 8, "lo": 42, "hi": 50, "comparator.compare": 8, "<0>": 2, "prs": 8, "pivot": 14, "2": 4, "compare": 4, "0": 2, "BooleanUtils": 1, "isFalse": 1, "bool": 32, "isNotFalse": 1, "isNotTrue": 1, "isTrue": 1, "negate": 1, "toBooleanDefaultIfNull": 1, "defaultVal": 2, "toBoolean": 2, "value": 10, "strToBoolean": 1, "StringUtils.equalsIgnoreCase": 1, "//Converts": 1, "int": 1, "a": 4, "boolean": 1, "specifying": 1, "conversion": 1, "values.": 1, "//Returns": 1, "//Throws": 1, "trueValue": 2, "falseValue": 2, "toInteger": 1, "toStringYesNo": 1, "toStringYN": 1, "trueString": 2, "falseString": 2, "xor": 1, "boolArray": 4, "boolArray.size": 1, "firstItem": 2, "LanguageUtils": 1, "final": 6, "HTTP_LANGUAGE_CODE_PARAMETER_KEY": 2, "DEFAULT_LANGUAGE_CODE": 3, "Set": 6, "SUPPORTED_LANGUAGE_CODES": 2, "//Chinese": 2, "Simplified": 1, "Traditional": 1, "//Dutch": 1, "//English": 1, "//Finnish": 1, "//French": 1, "//German": 1, "//Italian": 1, "//Japanese": 1, "//Korean": 1, "//Polish": 1, "//Portuguese": 1, "Brazilian": 1, "//Russian": 1, "//Spanish": 1, "//Swedish": 1, "//Thai": 1, "//Czech": 1, "//Danish": 1, "//Hungarian": 1, "//Indonesian": 1, "//Turkish": 1, "Map": 33, "DEFAULTS": 1, "getLangCodeByHttpParam": 4, "LANGUAGE_CODE_SET": 1, "getSuppLangCodeSet": 2, "ApexPages.currentPage": 4, ".getParameters": 2, "LANGUAGE_HTTP_PARAMETER": 7, "StringUtils.lowerCase": 3, "StringUtils.replaceChars": 2, "//underscore": 1, "//dash": 1, "DEFAULTS.containsKey": 3, "DEFAULTS.get": 3, "StringUtils.isNotBlank": 1, "getLangCodeByBrowser": 4, "LANGUAGES_FROM_BROWSER_AS_STRING": 2, ".getHeaders": 1, "LANGUAGES_FROM_BROWSER_AS_LIST": 3, "languageFromBrowser": 6, "getLangCodeByUser": 3, "UserInfo.getLanguage": 1, "StringUtils.defaultString": 4, "header": 2, "tokens": 3, "StringUtils.split": 1, "token": 7, "token.contains": 1, "token.substring": 1, "token.indexOf": 1, "StringUtils.length": 1, "StringUtils.substring": 1, "langCodes": 2, "langCode": 3, "langCodes.add": 1, "getLanguageName": 1, "displayLanguageCode": 13, "languageCode": 2, "translatedLanguageNames.get": 2, "filterLanguageCode": 4, "getAllLanguages": 3, "translatedLanguageNames": 1, "TwilioAPI": 2, "extends": 1, "Exception": 1, "TwilioRestClient": 5, "client": 2, "public": 10, "getDefaultClient": 2, "TwilioConfig__c": 5, "twilioCfg": 7, "getTwilioConfig": 3, "TwilioAPI.client": 2, "twilioCfg.AccountSid__c": 3, "twilioCfg.AuthToken__c": 3, "TwilioAccount": 1, "getDefaultAccount": 1, ".getAccount": 2, "TwilioCapability": 2, "createCapability": 1, "createClient": 1, "accountSid": 2, "authToken": 2, "Test.isRunningTest": 1, "dummy": 2, "sid": 1, "TwilioConfig__c.getOrgDefaults": 1, "@isTest": 1, "test_TwilioAPI": 1, "System.assertEquals": 5, "TwilioAPI.getTwilioConfig": 2, ".AccountSid__c": 1, ".AuthToken__c": 1, "TwilioAPI.getDefaultClient": 2, ".getAccountSid": 1, ".getSid": 2, "TwilioAPI.getDefaultAccount": 1, "GeoUtils": 1, "string": 5, "generateFromContent": 1, "PageReference": 2, "pr": 1, "ret": 7, "try": 1, "pr.getContent": 1, ".toString": 1, "ret.replaceAll": 4, "content": 1, "produces": 1, "quote": 1, "chars": 1, "we": 1, "need": 1, "escape": 1, "these": 2, "in": 1, "node": 1, "catch": 1, "exception": 1, "e": 2, "system.debug": 2, "must": 1, "use": 1, "ALL": 1, "since": 1, "many": 1, "line": 1, "may": 1, "also": 1, "geo_response": 1, "accountAddressString": 2, "account": 1, "acct": 1, "adr": 9, "acct.billingstreet": 1, "acct.billingcity": 1, "acct.billingstate": 1, "acct.billingpostalcode": 2, "acct.billingcountry": 2, "adr.replaceAll": 4, "testmethod": 1, "t1": 1, "pageRef": 3, "Page.kmlPreviewTemplate": 1, "Test.setCurrentPage": 1, "system.assert": 1, "GeoUtils.generateFromContent": 1, "Account": 2, "billingstreet": 1, "billingcity": 1, "billingstate": 1, "billingpostalcode": 1, "billingcountry": 1, "insert": 1, "system.assertEquals": 1 }, "Apollo Guidance Computer": { "#": 340, "It": 2, "is": 1, "part": 1, "of": 9, "the": 15, "source": 1, "code": 1, "for": 2, "Lunar": 1, "Module": 1, "Apollo": 2, "Guidance": 1, "Computer": 1, "(": 97, "AGC": 3, ")": 97, "Luminary131": 1, "file": 1, "using": 1, "page": 1, "images": 1, "from": 3, "Luminary": 1, "1A.": 1, "-": 95, "RSB": 3, "Corrected": 1, "typos.": 1, "Added": 1, "Onno": 1, "this": 2, "function": 1, "which": 1, "he": 1, "got": 1, "Don": 2, "Eyles.": 1, "Assemble": 1, "revision": 1, "program": 1, "LMY99": 1, "by": 2, "NASA": 1, "JULY": 1, "##": 11, "At": 1, "get": 1, "together": 1, "developers": 1, "celebrating": 1, "40th": 1, "anniversary": 1, "first": 1, "moonwalk": 1, "Eyles": 1, "one": 1, "authors": 1, "routine": 1, "along": 1, "with": 1, "Peter": 1, "Adler": 1, "has": 1, "related": 1, "to": 3, "us": 1, "a": 1, "little": 1, "interesting": 1, "history": 1, "behind": 1, "naming": 1, "routine.": 1, "
": 2, "traces": 1, "back": 1, "and": 4, "Los": 2, "Angeles": 2, "riots": 1, "was": 2, "inspired": 1, "disc": 1, "jockey": 1, "extraordinaire": 1, "radio": 1, "station": 1, "owner": 1, "Magnificent": 3, "Montague.": 1, "Montague": 2, "used": 1, "phrase": 1, "when": 1, "spinning": 1, "hottest": 1, "new": 1, "records.": 1, "charismatic": 1, "voice": 1, "soul": 1, "music": 1, "in": 1, "Chicago": 1, "New": 1, "York": 1, "mid": 2, "1950s": 1, "1960s.": 1, "BANK": 14, "SETLOC": 7, "P40S": 3, "EBANK": 27, "WHICH": 20, "COUNT*": 7, "/P40": 5, "TABLES": 1, "FOR": 36, "THE": 25, "IGNITION": 8, "ROUTINE": 4, "NOLI": 1, "SE": 1, "TANGERE": 1, "P12TABLE": 1, "VN": 6, "TCF": 111, "ULLGNOT": 6, "COMFAIL3": 4, "GOCUTOFF": 3, "TASKOVER": 16, "P12SPOT": 2, "DEC": 12, "NO": 4, "ULLAGE": 8, "2CADR": 22, "SERVEXIT": 2, "DISPCHNG": 5, "WAITABIT": 6, "P12IGN": 2, "P40TABLE": 2, "COMFAIL4": 3, "GOPOST": 3, "P40SPOT": 4, "OMEGAQ": 3, "STEERING": 2, "P40SJUNK": 3, "P40IGN": 2, "REP40ALM": 3, "P41TABLE": 2, "P41SPOT": 3, "CALCN85": 1, "COMMON": 2, "TIGTASK": 2, "P42TABLE": 2, "WANTAPS": 2, "P42SPOT": 2, "P42IGN": 5, "P42STAGE": 1, "P63TABLE": 2, "V99RECYC": 2, "P63SPOT": 2, "P63IGN": 2, "ABRTABLE": 1, "NOOP": 5, "ABRTIGN": 2, "GENERAL": 1, "PURPOSE": 1, "ROUTINES": 1, "BURNBABY": 1, "TC": 97, "PHASCHNG": 15, "GROUP": 7, "RESTARTS": 4, "HERE": 2, "OCT": 27, "CAF": 34, "ZERO": 5, "EXTIRPATE": 1, "JUNK": 1, "LEFT": 1, "IN": 23, "DVTOTAL": 3, "TS": 43, "+": 15, "BANKCALL": 13, "P40AUTO": 3, "MUST": 8, "BE": 7, "BANKCALLED": 2, "EVEN": 3, "FROM": 3, "ITS": 2, "CADR": 25, "OWN": 2, "TO": 23, "SET": 15, "UP": 12, "RETURN": 9, "PROPERLY": 1, "B*RNB*B*": 1, "EXTEND": 38, "DCA": 18, "TIG": 44, "STORE": 3, "NOMINAL": 2, "OBLATENESS": 1, "COMP.": 1, "DXCH": 22, "GOBLTIME": 1, "AND": 10, "P70": 3, "OR": 5, "P71.": 2, "INHINT": 12, "IBNKCALL": 5, "ENGINOF3": 1, "RELINT": 4, "INDEX": 18, "P63": 6, "CLOKTASK": 14, "ALREADY": 1, "GOING": 2, "CS": 34, "CNTDNDEX": 6, "GENERALIZED": 2, "STCLOK2": 2, "INTPRET": 2, "DLOAD": 1, "DSU": 1, "D29.9SEC": 3, "STCALL": 2, "TDEC1": 3, "INITCDUW": 1, "BOFF": 1, "CALL": 1, "MUNFLAG": 1, "GOMIDAV": 2, "CSMPREC": 1, "VLOAD": 2, "MXV": 2, "VATT1": 1, "REFSMMAT": 2, "VSR1": 1, "STOVL": 1, "V": 1, "CSM": 6, "VELOCITY": 1, "M/CS*2": 2, "RATT1": 1, "VSL4": 1, "R": 1, "POSITION": 1, "M*2": 1, "MUNGRAV": 1, "STODL": 1, "G": 3, "GRAVITY": 1, "VEC.": 1, "TAT": 1, "RELOAD": 1, "MIDTOAV.": 1, "CALRB": 1, "MIDTOAV1": 1, "CALLT": 2, "MADE": 1, "IT": 8, "TIME.": 3, "WAS": 1, "SLIPPED": 1, "SO": 4, "RESET": 4, "PIPTIME1": 1, "SECONDS": 6, "AFTER": 3, "TIME": 3, "WE": 5, "DID": 1, "INTEGRATE.": 1, "DAS": 5, "MPAC": 4, "SAVET": 4, "DELTA": 3, "T": 3, "UNTIL": 2, "DCS": 3, "5SECDP": 1, "LONGCALL": 1, "TTOGO": 8, "4.25SPOT": 1, "RESTART.": 2, "CHECKMM": 2, "ENDOFJOB": 15, "NOT": 11, "CAN": 2, "START": 4, "DISPLAYING": 2, "NOW.": 1, "DISPDEX": 21, "ABVAL": 1, "VN1": 1, "ABVEL": 2, "INITIALIZE": 4, "DISPLAY": 7, "EXIT": 1, "********************************": 7, "5SEC": 2, "TWIDDLE": 8, "ADRES": 25, "4.15SPOT": 1, "RESTART": 10, "BLANKDEX": 2, "BLANK": 4, "DSKY": 3, "CHECK": 5, "BZMF": 2, "4.9SEC": 2, "TASK": 13, "RESTORE": 4, "AT": 11, "PRIO17": 3, "A": 22, "NEGATIVE": 5, "INDICATES": 3, "P41": 1, "NOVAC": 4, "CASE": 4, "HAVE": 2, "JOB": 3, "FIVE": 1, "SINCE": 4, "P41BLANK": 2, "CLOKJOB": 5, "IS": 22, "RUNNING": 2, "DURING": 1, "P41.": 1, "DSKY.": 2, "CLEANDSP": 2, "30A": 2, "V16N85B": 1, "DISPLAY.": 2, "REGODSP": 4, "DOES": 3, "S24.9SEC": 2, "AGAIN": 2, "PICK": 1, "APPROPRIATE": 3, "ON": 8, "CA": 22, "Was": 1, "DON": 3, "SAVE": 3, "ULLGTASK": 4, "THREE": 2, "PROTECT": 1, "1.3SPOT": 1, "L": 13, "PHASE1": 1, "TIME1": 3, "TBASE1": 1, "FLGWRD10": 3, "P42": 3, "ENSURE": 2, "APSFLAG": 1, "SET.": 2, "IF": 9, "MASK": 20, "APSFLBIT": 2, "WASN": 1, "ADS": 7, "ASCENT": 2, "VALUES": 1, "BY": 5, "1/ACCS": 1, "SECONDS.": 1, "LOAD": 1, "AVEGEXIT": 3, "WITH": 4, "TWO": 5, "4.2SPOT": 1, "IMMEDIATELY": 2, "REDO4.2": 2, "ALSO": 2, "CORRECT": 1, "PHASE4": 3, "TBASE4": 4, "REDO2.17": 1, "NEG0": 4, "CLEAR": 1, "OUT": 1, "LAMBERT": 1, "PHASE2": 1, "NEEDED.": 1, "CCS": 10, "PHASE5": 1, "SERVICER": 1, "YES": 5, "POSTJUMP": 2, "PREREAD": 2, "END": 1, "THIS": 7, "ONULLAGE": 2, "COMES": 2, "INSURE": 2, "THAT": 4, "INACTIVE.": 1, "PHASE3": 2, "DOWNFLAG": 8, "IGNFLAG": 4, "ASINFLAG": 1, "LIGHT": 2, "LOGIC.": 1, "ASTNFLAG": 4, "P40": 1, "P42.": 1, "S40.13": 4, "PROGRESS": 1, "PRIO20": 1, "FINDVAC": 4, "3.5SPOT": 1, "VB99DEX": 2, "4.7SPOT": 1, "FLAGWRD7": 8, "HAS": 4, "ARRIVED": 1, "IGNFLBIT": 2, "THROTTLE": 3, "ZOOMTIME": 3, "ACTUAL": 1, "IGNYET": 2, "WAITLIST": 3, "DVCNTR": 7, "P63ZOOM": 2, "2PHSCHNG": 3, "ASTNBIT": 1, "ASTRONAUT": 1, "RESPONDED": 2, "OUR": 1, "ENGINE": 2, "ENABLE": 3, "REQUEST": 1, "BZF": 6, "BRANCH": 1, "HE": 1, "YET": 1, "FLAGWRD5": 3, "ENGONFLG": 1, "ENGONBIT": 1, "PRIO30": 1, "TURN": 8, "ENGINE.": 1, "RAND": 2, "DSALMOUT": 2, "AD": 5, "BIT13": 2, "WRITE": 1, "TEVENT": 2, "DOWNLINK": 1, "TIME2": 6, "UPDATE": 1, "USING": 3, "TGO": 4, "FLUNDBIT": 1, "PERMIT": 2, "GUIDANCE": 2, "LOOP": 2, "DISPLAYS": 4, "FLAGWRD8": 2, "INITIATE": 1, "BURN": 1, "DSP2CADR": 2, "AVGEXIT": 2, "Z": 5, "ASSASSINATE": 1, "FLAGWRD9": 2, "FLAG": 2, "P71": 1, "LETABBIT": 1, "SWANDISP": 1, "R10.": 2, "SWANDBIT": 2, "PULSES": 1, "MAKE": 1, "SURE": 1, "DAP": 4, "MINIMUM": 1, "IMPULSE": 2, "DAPBOOLS": 8, "MODE": 3, "OF": 9, "SWITCH": 2, "P66": 1, "WCHPHASE": 2, "FLPASS0": 2, "WCHPHOLD": 1, "WHCPHOLD": 1, "NOTHRBIT": 1, "P40ZOOM": 2, "P63IGN1": 1, "3.3SPOT": 1, "ZOOM": 5, "TYPE": 1, "C": 1, "EBANK6": 1, "AOSQ": 2, "IGNAOSQ": 1, "BIAS": 1, "ACCELERATION": 1, "ESTIMATES": 1, "P12": 1, "IGNITION.": 1, "IGNAOSR": 1, "AOSR": 1, "EBANK7": 1, "KILL": 9, "CONNECT": 2, "GYIDANCE": 1, "SERVICER.": 1, "ATMAGADR": 2, "DRIFTBIT": 1, "POWERED": 1, "FLIGHT": 1, "SWITCHING": 1, "CURVES": 1, "ARE": 3, "USED.": 1, "IMPULBIT": 1, "EXAMINE": 1, "FLAGWRD2": 1, "IMPLBURN": 1, "DVMONCON": 1, "DVMON": 2, "IDLEFLAG": 3, "FIXDELAY": 2, "OFF": 6, "HALF": 1, "SECOND": 4, "UP.": 1, "ULLAGOFF": 1, "NOULLAGE": 3, "TIGTASK1": 2, "P40S3": 1, "PRIO16": 1, "TRKMKCNT": 1, "TIGNOW": 1, "LUNLANAD": 2, "FLATOUT": 1, "P40ZOOMA": 3, "THRUST": 1, "BIT4": 1, "WOR": 1, "CHAN14": 1, "LUNLAND": 1, "COMFAIL": 1, "UPFLAG": 5, "SUPRESS": 1, "CONFLICTING": 1, "FLUNDISP": 3, "FOUR": 1, "PHASE6": 2, "CLOCKTASK": 1, "ACTIVE": 1, "OTHERWISE": 1, "STCLOK1": 2, "VB97DEX": 2, "COMFAIL1": 2, "RECONNECT": 1, "DV": 2, "MONITOR": 1, "COMFAIL2": 2, "PROTECTION": 1, "KILLTASK": 8, "COMMAND": 1, "ENGINOF4": 1, "DRIFT": 1, "BIT": 1, "DAP.": 1, "DRIFTDFL": 1, "INVFLAG": 2, "USE": 1, "OTHER": 2, "RCS": 1, "SYSTEM": 1, "AORBTFLG": 1, "ULLAGFLG": 1, "BIT1": 2, "SUBROUTINES": 1, "Q": 7, "DEBIT": 1, "COM": 3, "RXOR": 1, "LCHAN": 1, "COMFLAG": 1, "ULLAGER": 2, "CALLED": 3, "UNDER": 1, "ULLAGE.": 2, "WHILE": 1, "INHINTED.": 1, "STARTS": 1, "COUNT": 1, "DOWN": 1, ".": 2, "SETTING": 2, "STCLOK3": 1, "MAKECADR": 2, "POSITIVE": 3, "KILLS": 1, "IT.": 2, "UNDOUBTEDLY": 1, "NUMBER": 2, "TPAGREE": 1, "PASSED": 1, "1SEC": 1, "CHECK.": 1, "LOW5": 1, "RESTRICT": 1, "MAGNITUDE": 1, "GET": 2, "REMAINDER": 1, "6.3SPOT": 1, "BANKJUMP": 2, "TBASE6": 2, "KILLCLOK": 2, "PRIO27": 1, "WAIT": 1, "BEFORE": 1, "STARTING": 1, "OVER": 1, "BEEN": 2, "HIGHER": 1, "PRIORITY": 2, "LAST": 1, "AVOID": 1, "AS": 1, "AN": 1, "INDEX.": 1, "*****": 2, "NEVER": 1, "B": 1, "DISPNOT": 2, "DUE": 1, "EFFECT": 1, "OCT35": 1, "PROPER": 4, "INDICATE": 3, "VERB": 2, "PASTE": 2, "NVWORD1": 2, "NVWORD": 2, "CONTAINS": 1, "V06": 1, "&": 2, "NOUN": 2, "CLOCPLAY": 2, "STOPCLOK": 4, "TERMINATE": 4, "WAY": 2, "P00H": 1, "V06N61": 2, "PRIMARILY": 1, "USED": 2, "CREW": 2, "HIS": 1, "EVENT": 1, "TIMER": 1, "AGREE": 1, "REFLASH": 1, "TIG.": 1, "ASTNRETN": 2, "LOW4": 1, "OCT17": 1, "ONE": 2, "INTERVALS.": 1, "NORMALLY": 1, "OPERATED": 1, "BETWEEN": 1, "ELEVEN": 1, "OCT13": 1, "EQUALS": 2, "BIT9": 1, ";": 1, "INITIATED": 1, "SEC.": 1, "V99NXX": 1, "WHERE": 1, "XX": 1, "HAD": 1, "PREVIOUSLY": 1, "DISPLAYED": 1, "GOTOP00H": 6, "TURNS": 1, "*PROCEED": 2, "*ENTER": 2, "BLANKED": 1, "AVERAGE": 1, "STARTING.": 1, "NULLCLOK": 4, "STOP": 2, "P00": 1, "RELINTS": 1, "QXCH": 2, "P40/RET": 2, "...": 1, "THERE": 1, "BUT": 1, "KEEP": 1, "PRIO13": 1, "STARIND": 1, "ASTNRET": 1, "IGNITE": 2, "PRIO12": 1, "LOWER": 1, "THAN": 2, "POSTBURN": 2, "COASTING": 2, "FLIGHT.": 2, "ALLCOAST": 2, "CUTOFF": 2, "IGNITE1": 2, "OCT23": 1, "IMMEDIATE": 1, "OLD": 1, "P40ALM": 1, "ALARM": 2, "PROGRAM": 1, "SELECTION": 1, "CONSISTENT": 1, "VEHICLE": 2, "CONFIGURATION": 1, "V05N09": 1, "GOFLASH": 1, "V34E": 2, "PROCEED": 1, "V32E": 1, "REDISPLAY": 1, "ALLOW": 1, "PRECEED": 1, "THOUGH": 1, "UNSTAGED.": 1, "P40S2": 1, "HELLO": 1, "THERE.": 1, "TEMPR60": 2, "BANKS.": 1, "P40A/P": 2, "SUBROUTINE": 1, "PGNCS": 4, "CONTROL": 1, "N": 1, "AUTO": 6, "STABILIZATION": 1, "MODES": 1, "TURNITON": 2, "AND/OR": 1, "DESCENT": 1, "STAGE": 1, "GOBACK": 3, "BIT5": 3, "CHAN30": 1, "P40A/PMD": 2, "V50N25": 1, "R1": 1, "PLEASE": 1, "PERFORM": 1, "CHECKLIST": 1, "ETC.": 1, "GOPERF1": 1, "RECYCLE": 1, "GOODBYE.": 1, "COME": 1, "SOON.": 1, "CONSTANTS": 1, "SERVCADR": 1, "P40ADRES": 1, "P41ADRES": 1, "P42ADRES": 1, "P63DISPS": 1, "ATMAG": 1, "2DEC": 1, "OCT20": 1, "REMOVE": 2, "SUBSTITUTING": 1, "NULL": 1, "NULLTASK": 1, "MERELY": 1, "TASKOVER.": 1, "SAME": 1, "SCHEDULED": 2, "MORE": 1, "ONCE": 1, "ONLY": 1, "WILL": 1, "OCCUR": 1, "FIRST": 1, "REMOVED.": 2, "TAKES": 1, "ACTION": 1, "RETURNS": 1, "ALARM.": 1, "LEAVES": 1, "INTERRUPTS": 1, "INHIBITED": 1, "CALLER": 2, "FIXED": 3, "LST2": 5, "BLOCK": 1, "FIXED.": 2, "FFTAG6": 1, "/KILL": 2, "KILLBB": 2, "LXCH": 3, "CADR.": 1, "BBANK": 1, "KILLTSK2": 3, "CONTINUE": 2, "SWITCHED": 1, "BBCON": 1, "P40S1": 1, "ITEMP2": 2, "INCR": 3, "ITEMP1": 3, "2ADR": 1, "ITEMP3": 4, "LOW10": 3, "BIT11": 1, "ITEMP4": 2, "GENADR": 1, "FBANK": 1, "ZL": 1, "ADRSCAN": 2, "COMPARE": 3, "GENADRS": 1, "TSTFBANK": 2, "THEY": 1, "MATCH": 3, "FBANKS": 2, "LETITLIV": 2, "LSTLIM": 2, "DONE": 2, "DEAD": 3, "LOOP.": 1, "DTCB": 1, "ONLY.": 1, "SU": 1, "KILLDEAD": 2, "CONTINUE.": 1, "TCTSKOVR": 1, "INSERTING": 1 }, "AppleScript": { "tell": 40, "application": 16, "set": 113, "localMailboxes": 3, "to": 131, "every": 3, "mailbox": 2, "if": 54, "(": 92, "count": 10, "of": 73, ")": 91, "is": 40, "greater": 5, "than": 6, "then": 29, "messageCountDisplay": 5, "&": 64, "return": 17, "my": 3, "getMessageCountsForMailboxes": 4, "else": 16, "end": 70, "everyAccount": 2, "account": 1, "repeat": 19, "with": 11, "eachAccount": 3, "in": 13, "accountMailboxes": 3, "name": 8, "outputMessage": 2, "make": 2, "new": 2, "outgoing": 2, "message": 2, "properties": 2, "{": 33, "content": 2, "subject": 1, "visible": 2, "true": 8, "}": 33, "font": 2, "size": 5, "on": 17, "theMailboxes": 2, "displayString": 4, "eachMailbox": 4, "mailboxName": 2, "messageCount": 2, "messages": 1, "as": 28, "string": 14, "unreadCount": 2, "unread": 1, "padString": 3, "theString": 4, "fieldLength": 5, "stringLength": 4, "length": 1, "paddedString": 5, "text": 15, "from": 9, "character": 2, "-": 41, "less": 1, "or": 6, "equal": 3, "paddingLength": 2, "times": 1, "space": 1, "property": 7, "type_list": 6, "extension_list": 6, "html": 2, "not": 3, "currently": 2, "handled": 2, "run": 4, "FinderSelection": 4, "the": 56, "selection": 2, "alias": 8, "list": 8, "FS": 12, "Ideally": 2, "this": 2, "could": 2, "be": 2, "passed": 2, "open": 8, "handler": 2, "SelectionCount": 6, "number": 6, "userPicksFolder": 8, "MyPath": 4, "path": 6, "me": 2, "item": 12, "If": 2, "I": 4, "these_items": 18, "choose": 2, "file": 6, "prompt": 2, "type": 6, "thesefiles": 2, "item_info": 24, "i": 10, "this_item": 14, "info": 4, "for": 4, "folder": 10, "a": 2, "processFolder": 8, "false": 9, "and": 7, "extension": 4, "theFilePath": 8, "thePOSIXFilePath": 8, "POSIX": 4, "processFile": 8, "process": 5, "folders": 2, "theFolder": 6, "without": 2, "invisibles": 2, "thePOSIXFileName": 6, "try": 10, "terminalCommand": 6, "convertCommand": 4, "newFileName": 4, "do": 4, "shell": 2, "script": 2, "lowFontSize": 9, "highFontSize": 6, "messageText": 4, "userInput": 4, "display": 6, "dialog": 6, "default": 5, "answer": 4, "buttons": 3, "button": 4, "returned": 6, "minimumFontSize": 4, "newFontSize": 6, "result": 2, "integer": 2, "theText": 3, "exit": 1, "fontList": 2, "activate": 3, "crazyTextMessage": 2, "eachCharacter": 4, "characters": 1, "some": 1, "random": 4, "color": 1, "need": 1, "pass": 1, "URL": 1, "Terminal": 1, "current": 3, "pane": 4, "UI": 1, "elements": 1, "enabled": 1, "tab": 1, "group": 1, "window": 5, "click": 1, "radio": 1, "delay": 3, "get": 1, "value": 1, "field": 1, "isVoiceOverRunning": 3, "isRunning": 3, "processes": 2, "contains": 1, "isRunningWithAppleScript": 3, "x": 1, "bounds": 2, "vo": 1, "cursor": 1, "error": 3, "currentDate": 4, "date": 1, "amPM": 4, "currentHour": 9, "currentMinutes": 5, "<": 2, "currentTime": 3, "s": 1, "day": 1, "output": 1, "say": 1, "windowWidth": 5, "windowHeight": 5, "AppleScript": 2, "res": 3, "items": 1, "screen_width": 2, "JavaScript": 2, "document": 2, "screen_height": 2, "myFrontMost": 3, "first": 1, "whose": 1, "frontmost": 1, "desktopTop": 2, "desktopLeft": 1, "desktopRight": 1, "desktopBottom": 1, "desktop": 1, "w": 5, "h": 4, "drawer": 2, "position": 1, "/": 2 }, "AsciiDoc": { "AsciiDoc": 3, "Home": 1, "Page": 1, "Title": 2, "-": 9, "Example": 1, "Articles": 1, "Item": 6, "Gregory": 2, "Rom": 2, "has": 2, "written": 2, "an": 2, "plugin": 2, "for": 2, "the": 2, "Redmine": 2, "project": 2, "management": 2, "application.": 2, "https": 1, "//github.com/foo": 1, "users/foo": 1, "vicmd": 1, "gif": 1, "tag": 1, "rom": 2, "[": 2, "]": 2, "end": 1, "berschrift": 1, "*": 4, "Codierungen": 1, "sind": 1, "verr": 1, "ckt": 1, "auf": 1, "lteren": 1, "Versionen": 1, "von": 1, "Ruby": 1, "Document": 1, "Doc": 1, "Writer": 1, "": 1, "asciidoctor": 1, "org": 1, "idprefix": 1, "id_": 1, "Preamble": 1, "paragraph.": 4, "NOTE": 1, "This": 1, "is": 1, "test": 1, "only": 1, "a": 1, "test.": 1, "Section": 3, "A": 2, "*Section": 3, "A*": 2, "Subsection": 1, "B": 2, "B*": 1, ".Section": 1, "list": 1 }, "AspectJ": { "package": 2, ";": 29, "import": 5, "java.util.Map": 2, "java.util.WeakHashMap": 1, "org.aspectj.lang.JoinPoint": 1, "public": 6, "aspect": 2, "CacheAspect": 1, "{": 11, "pointcut": 3, "cache": 3, "(": 46, "Cachable": 2, "cachable": 5, ")": 46, "execution": 1, "@Cachable": 1, "*": 2, "..": 1, "&&": 2, "@annotation": 1, "Object": 15, "around": 2, "String": 3, "evaluatedKey": 6, "this.evaluateKey": 1, "cachable.scriptKey": 1, "thisJoinPoint": 1, "if": 2, "cache.containsKey": 1, "System.out.println": 5, "+": 7, "return": 5, "this.cache.get": 1, "}": 11, "value": 3, "proceed": 2, "cache.put": 1, "protected": 2, "evaluateKey": 1, "key": 2, "JoinPoint": 1, "joinPoint": 1, "Map": 3, "": 2, "new": 1, "WeakHashMap": 1, "aspects.caching": 1, "abstract": 3, "OptimizeRecursionCache": 2, "@SuppressWarnings": 3, "private": 1, "_cache": 2, "getCache": 2, "operation": 4, "o": 16, "topLevelOperation": 4, "cflowbelow": 1, "before": 1, "cachedValue": 4, "_cache.get": 1, "null": 1, "after": 2, "returning": 2, "result": 3, "_cache.put": 1, "_cache.size": 1 }, "Assembly": { "BLARGG_MACROS_INCLUDED": 1, ";": 2290, "Allows": 1, "extra": 1, "error": 3, "checking": 2, "with": 5, "modified": 1, "version": 2, "of": 35, "ca65.": 1, "Otherwise": 1, "acts": 1, "like": 1, "a": 7, "constant": 2, "ADDR": 1, "Switches": 1, "to": 37, "Segment": 7, "and": 27, "places": 1, "Line": 4, "there.": 1, "can": 7, "be": 9, "an": 1, ".align": 2, "directive": 1, ".res": 3, ".byte": 2, "etc.": 1, "Examples": 1, "seg_data": 6, "BSS": 2, "RODATA": 2, "{": 16, "message": 1, "}": 16, ".macro": 28, ".pushseg": 1, ".segment": 1, ".string": 5, "(": 186, ")": 182, ".popseg": 1, ".endmacro": 28, "Reserves": 1, "Size": 5, "bytes": 2, "in": 16, "for": 10, "Name.": 1, "If": 3, "is": 3, "omitted": 1, "reserves": 1, "one": 1, "byte.": 6, "seg_res": 5, "Name": 6, ".ifblank": 1, ".else": 7, ".endif": 11, "Shortcuts": 1, "zeropage": 1, "bss": 1, "stack": 23, ".define": 9, "zp_res": 2, "ZEROPAGE": 1, "nv_res": 1, "NVRAM": 1, "bss_res": 1, "sp_res": 1, "STACK": 1, "zp_byte": 1, "Copies": 2, "byte": 40, "from": 8, "Src": 21, "Addr.": 4, "begins": 2, "#": 21, "it": 8, "sets": 2, "Addr": 27, "the": 58, "immediate": 3, "value.": 2, "Out": 4, "A": 18, "copied": 1, "Preserved": 9, "X": 7, "Y": 8, "mov": 418, "lda": 16, "sta": 14, "word": 17, "high": 3, "movw": 1, ".if": 5, ".match": 3, ".left": 3, "<": 20, ".right": 5, ".tcount": 5, "-": 1167, "+": 111, "Increments": 2, "bit": 5, "value": 8, "at": 5, "EQ/NE": 1, "based": 2, "on": 7, "resulting": 1, "incw": 1, ".local": 6, "@Skip": 6, "inc": 14, "bne": 6, "Adds": 1, "result": 1, "carry": 1, "set": 7, "appropriately": 1, "addw": 1, "addw_": 2, "clc": 6, "adc": 12, "Imm": 3, "": 1, "if": 42, "bcc": 4, "Splits": 1, "list": 3, "words": 19, "into": 8, "tables": 1, "low": 1, "Example": 1, "split_words": 2, "foo": 1, "expands": 1, "foo_l": 1, "foo_h": 1, "foo_count": 1, "Label": 5, "Words": 3, ".ident": 4, ".concat": 4, ".lobytes": 1, ".hibytes": 1, "*": 20, "SELECT": 1, "Bool": 3, "True": 2, "False": 3, "Extra": 4, ".ifndef": 3, ".elseif": 1, "DEFAULT": 1, "Value": 2, ".ifp02": 1, "doesn": 1, "blt": 1, "bge": 1, "bcs": 3, "jlt": 1, "jcc": 2, "jge": 2, "jcs": 2, "Jxx": 1, "Target": 18, "Bxx": 1, "except": 2, "go": 3, "farther": 1, "than": 1, "bytes.": 1, "Implemented": 1, "via": 1, "branch": 1, "around": 1, "JMP.": 1, "Don": 1, "s": 2, "longbranch": 2, "because": 1, "they": 1, "fail": 1, "@labels": 1, ".macpack": 1, "jeq": 1, "jmp": 53, "jne": 6, "beq": 2, "jmi": 1, "bpl": 1, "jpl": 1, "bmi": 1, "jvs": 1, "bvc": 1, "jvc": 1, "bvs": 1, "Passes": 1, "data": 21, "routine": 12, "addr": 13, "jsr_with_addr": 1, "pha": 4, "": 1, "pla": 4, "jsr": 3, "Calls": 2, "multiple": 1, "times": 5, "having": 1, "first": 1, "time": 2, "second": 1, "up": 2, "last": 4, "time.": 2, "for_loop": 3, "start": 16, "end": 16, "step": 9, "@for_loop": 7, "#start": 1, "#step": 2, "cmp": 74, "n": 4, "times.": 1, "The": 20, "counts": 1, "loop_n_times": 1, "Same": 1, "as": 4, "uses": 1, "YX.": 1, "for_loop16": 1, "||": 1, ".error": 1, "@for_loop_skip": 4, "ldy": 3, "tax": 1, "tya": 1, "tay": 1, "iny": 2, "dey": 1, "cpy": 1, "Stores": 3, "setb": 3, "#byte": 1, "setw": 1, "Loads": 1, "XY": 2, "or": 16, "address": 16, "ldxy": 1, "Arg": 8, "ldx": 3, "register": 1, "CONSTANT": 1, "Z": 1, "flag": 7, "entire": 1, "result.": 1, "Time": 1, "clocks": 1, "inxy": 1, "inx": 2, "Negates": 1, "adds": 1, "operand": 1, "subaf": 1, "Operand": 2, "eor": 1, "FF": 2, "sec": 1, "Initializes": 1, "CPU": 1, "registers": 1, "reasonable": 1, "values": 1, "init_cpu_regs": 1, "sei": 1, "cld": 5, "unnecessary": 1, "NES": 1, "but": 1, "might": 1, "help": 1, "clone": 1, "txs": 1, "BUILD_NSF": 1, "stx": 1, "PPUCTRL": 1, "push": 36, "r2": 2, "dint": 1, "nop": 1, "bis": 1, "#MPYDLYWRTEN": 1, "&": 166, "MPY32CTL0": 2, "bic": 1, "#MPYDLY32": 1, "#SUMEXT": 1, "r13": 1, "clr": 18, "r12": 42, "@r15": 8, "r4": 16, "r5": 16, "r6": 8, "r7": 8, "r8": 9, "r9": 9, "r10": 10, "r11": 10, "sub": 32, "#2*8": 1, "r15": 7, "MPY32L": 1, "MPY32H": 1, "OP2L": 25, "OP2H": 25, "RES0": 19, "2*0": 1, "r14": 20, "RES1": 19, "2*": 11, "RES2": 18, "RES3": 18, "MAC32L": 14, "MAC32H": 14, "add": 69, "SUMEXT": 10, "2*2": 1, "@r13": 14, "2*4": 1, "2*6": 1, "2*8": 4, "2*9": 2, "2*10": 1, "2*12": 1, "2*14": 1, "2*16": 1, "2*18": 1, "pop": 26, "eint": 1, "flat": 1, "assembler": 3, "interface": 1, "Win32": 1, "Copyright": 1, "c": 4, "Tomasz": 1, "Grysztar.": 1, "All": 1, "rights": 1, "reserved.": 1, "format": 2, "PE": 1, "console": 1, "section": 5, "code": 10, "readable": 4, "executable": 1, "[": 195, "con_handle": 2, "]": 195, "STD_OUTPUT_HANDLE": 1, "esi": 77, "_logo": 2, "call": 230, "display_string": 7, "get_params": 2, "jc": 3, "information": 2, "init_memory": 1, "_memory_prefix": 2, "eax": 247, "memory_end": 1, "memory_start": 1, "additional_memory_end": 1, "additional_memory": 1, "shr": 6, "display_number": 5, "_memory_suffix": 2, "GetTickCount": 3, "start_time": 3, "preprocessor": 1, "parser": 1, "formatter": 1, "display_user_messages": 1, "movzx": 25, "current_pass": 1, "_passes_suffix": 2, "xor": 25, "edx": 106, "ebx": 418, "div": 5, "jz": 28, "display_bytes_count": 2, "dl": 5, "display_character": 1, "_seconds_suffix": 2, "written_size": 1, "_bytes_suffix": 2, "al": 87, "exit_program": 2, "_usage": 2, "input_file": 4, "output_file": 3, "symbols_file": 2, "memory_setting": 3, "passes_limit": 2, "GetCommandLine": 2, "edi": 106, "params": 2, "find_command_start": 2, "lodsb": 18, "20h": 8, "je": 26, "22h": 4, "skip_quoted_name": 3, "skip_name": 2, "find_param": 7, "all_params": 5, "option_param": 2, "0Dh": 15, "get_output_file": 2, "process_param": 3, "bad_params": 11, "string_param": 3, "copy_param": 2, "stosb": 10, "param_end": 6, "string_param_end": 2, "memory_option": 4, "passes_option": 4, "symbols_option": 3, "stc": 2, "ret": 193, "get_option_value": 3, "get_option_digit": 2, "option_value_ok": 4, "30h": 1, "invalid_option_value": 5, "ja": 5, "imul": 6, "jo": 1, "dec": 10, "shl": 4, "jae": 1, "10000h": 2, "dx": 1, "find_symbols_file_name": 2, "include": 15, "writeable": 2, "_copyright": 1, "db": 41, "0Ah": 11, "VERSION_STRING": 1, "align": 9, "dd": 256, "bytes_count": 1, "displayed_count": 1, "character": 1, "last_displayed": 1, "rb": 4, "1000h": 2, "options": 1, "buffer": 11, "4000h": 1, "import": 1, "rva": 16, "kernel_name": 2, "kernel_table": 2, "ExitProcess": 1, "_ExitProcess": 2, "CreateFile": 1, "_CreateFileA": 2, "ReadFile": 1, "_ReadFile": 2, "WriteFile": 1, "_WriteFile": 2, "CloseHandle": 1, "_CloseHandle": 2, "SetFilePointer": 1, "_SetFilePointer": 2, "_GetCommandLineA": 2, "GetEnvironmentVariable": 1, "_GetEnvironmentVariable": 2, "GetStdHandle": 1, "_GetStdHandle": 2, "VirtualAlloc": 1, "_VirtualAlloc": 2, "VirtualFree": 1, "_VirtualFree": 2, "_GetTickCount": 2, "GetSystemTime": 1, "_GetSystemTime": 2, "GlobalMemoryStatus": 1, "_GlobalMemoryStatus": 2, "dw": 14, "fixups": 1, "discardable": 1, "ORG": 7, "0000h": 1, "SJMP": 3, "START": 2, "0003h": 1, "LCALL": 9, "INT0_ISR": 2, "RETI": 5, "000Bh": 1, "T0_ISR": 2, "0013h": 1, "INT1_ISR": 2, "001Bh": 1, "T1_ISR": 2, "0023h": 1, "UART_ISR": 2, "0030h": 1, "MOV": 9, "#11111110b": 2, "SETB": 3, "IT0": 1, "Set": 3, "External": 2, "Interrupt": 2, "falling": 1, "edge": 1, "triggered": 1, "EX0": 1, "Enable": 2, "Interrut": 1, "EA": 1, "LEFT": 3, "CJNE": 2, "#01111111b": 1, "LOOP1": 2, "JMP": 2, "RIGHT": 3, "P1": 4, "RL": 1, "DELAY": 5, "LOOP2": 2, "RR": 1, "R1": 2, "#3": 1, "FLASH": 2, "#00h": 1, "#0FFh": 1, "DJNZ": 4, "RET": 6, "R5": 2, "#20": 1, "R5*20": 1, "mS": 1, "D1": 2, "R6": 2, "#40": 1, "D2": 2, "R7": 2, "#249": 1, "END": 1, "Forth": 2, "by": 4, "Chris": 1, "Hinsley": 1, "nasm": 1, "f": 1, "macho": 1, "forth.nasm": 1, "ld": 1, "o": 1, "forth": 1, "e": 1, "_main": 3, "forth.o": 1, "./forth": 1, "%": 243, "define": 36, "VERSION_NUM": 2, "various": 2, "area": 1, "sizes": 1, "DATA_STACK_SIZE": 2, "USER_DEFS_SIZE": 2, "64*1024": 1, "NUM_HASH_CHAINS": 5, "MAX_LINE_SIZE": 6, "SYS_exit": 2, "SYS_read": 3, "SYS_write": 3, "SYS_open": 2, "SYS_close": 2, "SYS_unlink": 2, "SYS_mprotect": 2, "SYS_fsync": 2, "SYS_rename": 2, "SYS_stat": 2, "SYS_lseek": 2, "SYS_fstat": 2, "SYS_ftruncate": 2, "PROT_READ": 2, "pages": 3, "read": 3, "PROT_WRITE": 2, "written": 1, "PROT_EXEC": 2, "executed": 1, "PROT_ALL": 2, "|": 6, "PAGE_SIZE": 2, "some": 1, "NASM": 1, "codeing": 1, "macros": 3, "macro": 34, "loopstart": 4, "loop_start": 4, "endmacro": 9, "break": 1, "loop_exit": 4, "breakif": 2, "j": 3, "loopend": 3, "repeat": 4, "until": 3, "ifnot": 3, "else": 14, "ifctx": 2, "repl": 1, "ifend": 2, "endif": 40, "elifctx": 1, "base": 2, "VM": 1, "eip": 1, "Forths": 4, "IP": 1, "esp": 27, "R": 1, "ebp": 58, "S": 1, "TOS": 1, "return": 18, "PUSHRSP": 9, "endm": 25, "top": 4, "POPRSP": 11, "save": 4, "PUTRSP": 4, "elif": 4, "&&": 6, "long": 7, "load": 3, "PICKRSP": 9, "SETRSP": 2, "get": 4, "GETRSP": 4, "adjust": 2, "ADDRSP": 8, "PUSHDSP": 20, "POPDSP": 36, "PUTDSP": 49, "PICKDSP": 116, "SETDSP": 3, "GETDSP": 2, "ADDDSP": 61, "onto": 1, "LOADTOS": 64, "move": 3, "TORSP": 10, "FROMRSP": 6, "copy": 2, "FETCHRSP": 3, "reg": 1, "DP_ALIGN": 3, "ALIGNREG": 2, "dictionary": 9, "building": 2, "entry": 3, "F_IMMED": 10, "F_HIDDEN": 5, "F_LENMASK": 6, "NULL": 4, "H_LLINK": 3, "H_HLINK": 4, "H_NSIZE": 11, "H_NAME": 6, "XT_BODY": 5, "XT_LENGTH": 6, "XT_COMPILE": 5, "XT_SIZE": 5, "defword": 182, "newword": 1, "strlen": 1, "len": 12, "dic_": 1, "LATEST": 3, "link": 5, "hash": 5, "chain": 3, "flags": 5, "length": 21, "name": 6, "body": 2, "pointer": 4, "code_end": 2, "compile": 7, "action": 2, "follows": 1, "defword_end": 182, "defvar": 11, "WORD_INLINE_COMMA": 117, "var_": 4, "defvar2": 2, "defconst": 33, "point": 1, "SECTION": 2, ".text": 1, "global": 1, "use": 1, "mprotect": 1, "allow": 1, "read/write/execute": 1, "forth_start": 3, "ecx": 117, "forth_end": 3, "padding": 1, "int": 4, ".data": 1, "init": 1, "stacks": 1, "saving": 1, "initial": 1, "positions": 1, "vars": 1, "R0": 2, "S0": 2, "var_WORD_SZ": 2, "var_WORD_RZ": 1, "built": 4, "dictionary_start": 3, "lodsd": 1, "cl": 7, "lea": 11, "strhashi": 5, "hash_buckets": 5, "dictionary_end": 2, "z": 9, "var_WORD_LATEST": 5, "run": 1, "temp": 1, "interpreter": 2, "loop": 9, "till": 3, "we": 4, "real": 1, "QUIT": 2, "WORD_LBRAC": 3, "interpret": 1, "state": 1, "666q": 1, "octal": 1, "bootfile": 2, "WORD_SYS_OPEN": 2, "WORD_SYSCALL": 2, "fd": 3, "tib_buffer": 5, "WORD_READLINE": 2, "num": 2, "WORD_DROP2": 7, "WORD_SWAP": 9, "WORD_INHASH": 4, "WORD_STORE2": 3, "WORD_TOIN": 5, "WORD_STORE": 4, "WORD_INTERPRET": 2, "takes": 1, "over": 1, "few": 1, "case": 3, "insensative": 1, "string": 18, "operations": 1, "to_lower": 8, "lower": 2, "check": 1, "ge": 2, "le": 1, "make": 1, "strcpyi": 2, "test": 34, "nz": 10, "strcpyi_l1": 2, "strcmpi": 2, "strcmpi_l1": 2, "bl": 56, "function": 1, "strhashi_l1": 2, "syscall": 4, "functions": 1, "_syscall": 4, "neg": 28, "_lsyscall": 2, "not": 14, "variables": 1, "STATE": 3, "Is": 1, "executing": 2, "compiling": 2, "non": 1, "zero": 2, "Points": 2, "latest": 1, "most": 1, "recently": 1, "defined": 1, "dictionary.": 1, "DP": 6, "next": 1, "free": 1, "memory.": 1, "When": 1, "compiled": 1, "here.": 1, "parameter": 1, "stack.": 2, "BASE": 1, "current": 8, "printing": 1, "reading": 1, "numbers.": 1, "#IN": 1, "input": 6, "descriptor.": 2, "IN": 1, "offset.": 6, "SOURCEFD": 1, "source": 2, "file": 1, "BLK": 1, "block": 1, "number.": 1, "CHARBUF": 1, "Single": 1, "char": 2, "buffer.": 3, "WORD_STATE": 1, "WORD_DP": 1, "WORD_LATEST": 4, "WORD_SZ": 1, "WORD_RZ": 1, "WORD_BASE": 2, "WORD_SOURCEFD": 1, "WORD_BLK": 1, "WORD_CHARBUF": 1, "constants": 1, "VERSION": 1, "this": 6, "FORTH.": 1, "WORDBUF": 1, "WORD": 2, "uses.": 1, "LINESIZE": 1, "line": 2, "size.": 1, "IMMEDIATE": 2, "HIDDEN": 2, "mask": 1, "flags/len": 2, "field": 6, "xt": 11, "pointer.": 1, "size": 16, "SYS_*": 1, "numeric": 1, "codes": 1, "syscalls.": 1, "O_*": 1, "Various": 1, "sycall": 1, "flags/modes.": 1, "WORD_VERSION": 1, "WORD_WORDBUF": 1, "word_buf": 4, "WORD_LINESIZE": 2, "WORD__F_IMMED": 1, "WORD__F_HIDDEN": 1, "WORD__F_LENMASK": 1, "WORD__H_NSIZE": 1, "WORD__H_NAME": 1, "WORD__XT_BODY": 1, "WORD__XT_LENGTH": 1, "WORD__XT_COMPILE": 1, "WORD__XT_SIZE": 1, "WORD_SYS_EXIT": 1, "WORD_SYS_CLOSE": 1, "WORD_SYS_READ": 1, "WORD_SYS_WRITE": 1, "WORD_SYS_UNLINK": 1, "WORD_SYS_RENAME": 1, "WORD_SYS_FTRUNCATE": 1, "WORD_SYS_FSYNC": 1, "WORD_SYS_LSEEK": 1, "WORD_SYS_FSTAT": 1, "WORD_SYS_STAT": 1, "WORD_O_RDONLY": 1, "WORD_O_WRONLY": 1, "WORD_O_RDWR": 1, "WORD_O_CREAT": 1, "WORD_O_EXCL": 1, "WORD_O_TRUNC": 1, "WORD_O_APPEND": 1, "WORD_O_NONBLOCK": 1, "ordering": 2, "WORD_DSPFETCH": 1, "WORD_DSPSTORE": 1, "WORD_DROP": 11, "xchg": 1, "WORD_DUP": 4, "WORD_OVER": 12, "WORD_ROT": 2, "WORD_NROT": 2, "WORD_DUP2": 7, "WORD_SWAP2": 6, "WORD_ROT2": 1, "WORD_QDUP": 1, "WORD_NQDUP": 1, "WORD_NIP": 4, "WORD_TUCK": 3, "WORD_PICK": 1, "WORD_TUCK2": 1, "WORD_NIP2": 1, "WORD_OVER2": 1, "WORD_TOR": 1, "WORD_FROMR": 1, "WORD_TOR2": 1, "WORD_FROMR2": 1, "WORD_RSPFETCH": 1, "WORD_RFETCH": 1, "WORD_RSTORE": 1, "WORD_RFETCH2": 1, "WORD_RSPSTORE": 1, "WORD_RDROP": 1, "WORD_RDROP2": 1, "WORD_NTOR": 1, "WORD_CALL_COMMA": 66, "rep": 13, "movsd": 2, "WORD_NFROMR": 1, "memory": 1, "fetch": 1, "store": 3, "WORD_FETCH": 5, "WORD_ADDSTORE": 1, "WORD_SUBSTORE": 1, "WORD_STOREBYTE": 5, "WORD_ADDBYTE": 1, "WORD_FETCHBYTE": 3, "WORD_STORESHORT": 1, "ax": 4, "WORD_FETCHSHORT": 1, "bx": 1, "WORD_FETCH2": 2, "WORD_BLANK": 1, "WORD_ERASE": 1, "WORD_FILL": 1, "WORD_CMOVEB": 1, "std": 3, "movsb": 8, "WORD_CMOVE": 3, "WORD_MOVE": 1, "single": 2, "precision": 5, "alu": 1, "WORD_ADD": 6, "WORD_SUB": 7, "WORD_MULL": 2, "WORD_DIV": 1, "cdq": 4, "idiv": 8, "WORD_MOD": 1, "WORD_INCR": 6, "WORD_DECR": 2, "WORD_INCR4": 1, "WORD_DECR4": 1, "WORD_INCR2": 1, "WORD_DECR2": 1, "WORD_TWOMUL": 1, "WORD_TWODIV": 1, "sar": 3, "WORD_ABS": 1, "WORD_MIN": 2, "g": 1, "WORD_MAX": 1, "l": 3, "WORD_LSHIFT": 1, "WORD_RSHIFT": 1, "WORD_AND": 1, "WORD_OR": 1, "WORD_XOR": 1, "WORD_NEGATE": 1, "WORD_INVERT": 1, "comparision": 2, "WORD_EQ": 1, "sete": 1, "WORD_NE": 1, "setne": 1, "WORD_LT": 1, "setl": 4, "WORD_GT": 1, "setg": 2, "WORD_ULT": 1, "WORD_UGT": 1, "seta": 1, "WORD_ULTEQ": 2, "setbe": 1, "WORD_UGTEQ": 1, "setae": 1, "WORD_LTEQ": 1, "setle": 2, "WORD_GTEQ": 1, "setge": 2, "WORD_ZEQ": 2, "setz": 3, "WORD_ZNE": 1, "setnz": 3, "WORD_ZLT": 1, "WORD_ZGT": 1, "WORD_ZLTEQ": 1, "WORD_ZGTEQ": 1, "double": 2, "ALU": 1, "WORD_STOD": 1, "WORD_DTOS": 1, "WORD_DPLUS": 1, "WORD_DMINUS": 1, "sbb": 8, "WORD_D2STAR": 1, "rcl": 1, "WORD_D2SLASH": 1, "rcr": 1, "WORD_MULDIV": 1, "WORD_STARSMOD": 1, "WORD_DIVMOD": 1, "WORD_DNEGATE": 2, "WORD_DABS": 1, "WORD_DMAX": 1, "WORD_DMIN": 1, "WORD_DZEQ": 1, "WORD_DZNEQ": 1, "WORD_DZLT": 1, "WORD_DEQ": 1, "WORD_DNEQ": 1, "WORD_DLT": 1, "WORD_DULT": 1, "mixed": 1, "WORD_MPLUS": 2, "WORD_MMINUS": 1, "WORD_MULSTAR": 1, "WORD_MSLASH": 1, "WORD_UMULSTAR": 2, "mul": 2, "WORD_UMDIVMOD": 1, "WORD_FMDIVMOD": 1, "WORD_SMDIVREM": 1, "WORD_UDIVMOD": 1, "WORD_DMULSTAR": 2, "control": 1, "flow": 1, "WORD_BRANCH": 1, "i_jmp": 3, "strict": 4, "near": 5, "i_ret": 3, "WORD_ZBRANCH": 1, "WORD_EXIT": 2, "WORD_EXIT_COMMA": 2, "var_WORD_DP": 24, "lastcall": 3, "are": 5, "just": 1, "after": 2, "instruction": 1, "change": 1, "WORD_EXECUTE": 2, "Get": 2, "After": 1, "runs": 1, "its": 1, "will": 2, "continue": 1, "word.": 2, "jump": 1, "it.": 3, "terminal": 2, "WORD_READCHAR": 3, "var_WORD_CHARBUF": 3, "2nd": 2, "param": 5, "3rd": 2, "max": 1, "cur": 11, "readline_l1": 2, "readline_l4": 2, "readline_l2": 2, "readline_l5": 2, "LF": 2, "readline_l3": 2, "WORD_KEY": 2, "stdin": 1, "WORD_ACCEPT": 2, "accept_l1": 4, "BS": 1, "accept_l2": 2, "accept_l3": 2, "key": 1, "accept_l4": 2, "WORD_TABSTOSPACES": 2, "TAB": 1, "output": 1, "WORD_TYPE_FD": 6, "1st": 1, "FD": 1, "write": 3, "WORD_TYPE": 5, "stdout": 1, "WORD_EMIT": 10, "emit_scratch": 3, "needs": 1, "system": 1, "syscallret": 5, "System": 2, "number": 2, "see": 3, "": 2, "Result": 2, "negative": 2, "errno": 2, "caller": 2, "WORD_LSYSCALL": 1, "WORD_COUNT": 4, "WORD_TRAILING": 1, "trailing_l1": 2, "WORD_SSTRING": 3, "WORD_COMPARE": 1, "lowest": 2, "jnz": 9, "compare_l2": 3, "compare_l3": 2, "both": 2, "compare_l4": 4, "otherwise": 2, "longest": 2, "wins": 2, "cmpsb": 2, "chars": 4, "same": 9, "all": 3, "strings": 2, "compare_l7": 3, "compare_l6": 2, "compare_l5": 1, "WORD_COMPAREI": 1, "comparei_l2": 3, "comparei_l3": 2, "comparei_l4": 4, "ah": 6, "comparei_l7": 3, "comparei_l6": 2, "comparei_l5": 1, "searching": 1, "WORD_FIND": 2, "WORD_FIND_DICT": 3, "WORD_TCFA": 5, "now": 1, "scan": 1, "back": 3, "through": 2, "findd_l1": 2, "linked": 1, "findd_l4": 2, "Length": 1, "findd_l2": 3, "Save": 2, "repe": 1, "Dictionary": 1, "against.": 1, "Not": 1, "same.": 1, "Move": 1, "previous": 1, "..": 1, "loop.": 1, "Return": 1, "indicate": 1, "found.": 1, "Load": 1, "al.": 1, "skip": 4, "Just": 1, "flags.": 1, "WORD_BUCKET": 1, "WORD_UNUSED": 1, "WORD_ALIGNDP": 3, "WORD_HEADER_COMMA": 3, "header": 3, "header.": 2, "Store": 3, "length/flags": 1, "clear": 1, "gap": 1, "WORD_LIT_COMMA": 4, "litc_l1": 3, "litc_l2": 2, "WORD_SLITS": 1, "past": 1, "WORD_CLITS": 1, "WORD_COMMA": 4, "stosd": 2, "Update": 2, "incremented": 2, "WORD_CHAR_COMMA": 2, "WORD_COLON": 1, "WORD_PARSENAME": 6, "Create": 1, "/": 1, "WORD_HIDDEN": 3, "Make": 1, "hidden": 2, "WORD_RBRAC": 2, "Go": 1, "mode.": 2, "WORD_CREATE": 1, "create_l1": 5, "create_l4": 2, "create_l2": 2, "create_l3": 3, "WORD_DODOES": 2, "WORD_DOES": 1, "WORD_COMPILE_COMMA": 6, "does_l1": 2, "WORD_POSTPONE": 1, "record": 1, "location": 1, "i_call": 2, "actual": 1, "minus": 1, "inline": 1, "update": 1, "WORD_SEMICOLON": 1, "toggle": 1, "unhide": 1, "below": 1, "definition": 1, ".": 1, "WORD_IMMEDIATE": 1, "Point": 2, "name/flags": 2, "Toggle": 2, "IMMED": 1, "bit.": 2, "var_WORD_STATE": 4, "WORD_SOURCE": 4, "WORD_REFILL": 1, "tib": 3, "TIB": 1, "WORD_ISSPACE": 3, "WORD_ISNOTSPACE": 2, "WORD_XTSKIP": 3, "xtskip_l1": 2, "xtskip_l3": 2, "xtskip_l2": 2, "parseing": 1, "print": 3, "out": 3, "WORD_WORDNAME": 1, "buf": 12, "cstring": 3, "debug": 2, "WORD_INTERPNAME": 2, "intep_name_buf": 3, "WORD_INTERP": 2, "tryasnumber": 2, "jle": 1, "nonimediate": 2, "executeword": 2, "imedeate": 1, "mode": 1, "adr": 1, "0d": 1, "WORD_TOSNUMBER": 2, "d": 1, "parseproblem": 2, "LIT": 1, "errmsg": 3, "errmsgend": 2, "errmsgnl": 3, "var_WORD_TOIN": 1, "WORD_TONUMBER": 3, "ud": 6, "tonumber_l1": 2, "tonumber_l4": 2, "jb": 3, "tonumber_l3": 4, "tonumber_l2": 2, "var_WORD_BASE": 2, "tick": 1, "WORD_TICKS": 1, "rdtsc": 1, "WORD_TEST": 1, "read/write": 1, "saved": 1, "layed": 1, "down": 1, "compiler": 1, "keyboard": 1, "static": 2, "where": 2, "returns.": 2, "Subsequent": 2, "calls": 2, "overwrite": 2, "INTERPNAME": 1, "scratch": 1, "used": 1, "EMIT": 1, "table": 1, "addresses": 1, "words.": 1, "ends": 1, "part": 1, "user": 2, "space": 1, "booting": 1, "dic_WORD_ABS": 1, "dic_WORD_ACCEPT": 1, "dic_WORD_ADD": 1, "dic_WORD_ADDBYTE": 1, "dic_WORD_ADDSTORE": 1, "dic_WORD_ALIGNDP": 1, "dic_WORD_AND": 1, "dic_WORD_BASE": 1, "dic_WORD_BLANK": 1, "dic_WORD_BLK": 1, "dic_WORD_BRANCH": 1, "dic_WORD_BUCKET": 1, "dic_WORD_CALL_COMMA": 1, "dic_WORD_CHARBUF": 1, "dic_WORD_CHAR_COMMA": 1, "dic_WORD_CLITS": 1, "dic_WORD_CMOVE": 1, "dic_WORD_CMOVEB": 1, "dic_WORD_COLON": 1, "dic_WORD_COMMA": 1, "dic_WORD_COMPARE": 1, "dic_WORD_COMPAREI": 1, "dic_WORD_COMPILE_COMMA": 1, "dic_WORD_COUNT": 1, "dic_WORD_CREATE": 1, "dic_WORD_D2SLASH": 1, "dic_WORD_D2STAR": 1, "dic_WORD_DABS": 1, "dic_WORD_DECR": 1, "dic_WORD_DECR2": 1, "dic_WORD_DECR4": 1, "dic_WORD_DEQ": 1, "dic_WORD_DIV": 1, "dic_WORD_DIVMOD": 1, "dic_WORD_DLT": 1, "dic_WORD_DMAX": 1, "dic_WORD_DMIN": 1, "dic_WORD_DMINUS": 1, "dic_WORD_DMULSTAR": 1, "dic_WORD_DNEGATE": 1, "dic_WORD_DNEQ": 1, "dic_WORD_DODOES": 1, "dic_WORD_DOES": 1, "dic_WORD_DP": 1, "dic_WORD_DPLUS": 1, "dic_WORD_DROP": 1, "dic_WORD_DROP2": 1, "dic_WORD_DSPFETCH": 1, "dic_WORD_DSPSTORE": 1, "dic_WORD_DTOS": 1, "dic_WORD_DULT": 1, "dic_WORD_DUP": 1, "dic_WORD_DUP2": 1, "dic_WORD_DZEQ": 1, "dic_WORD_DZLT": 1, "dic_WORD_DZNEQ": 1, "dic_WORD_EMIT": 1, "dic_WORD_EQ": 1, "dic_WORD_ERASE": 1, "dic_WORD_EXECUTE": 1, "dic_WORD_EXIT": 1, "dic_WORD_FETCH": 1, "dic_WORD_FETCH2": 1, "dic_WORD_FETCHBYTE": 1, "dic_WORD_FETCHSHORT": 1, "dic_WORD_FILL": 1, "dic_WORD_FIND": 1, "dic_WORD_FIND_DICT": 1, "dic_WORD_FMDIVMOD": 1, "dic_WORD_FROMR": 1, "dic_WORD_FROMR2": 1, "dic_WORD_GT": 1, "dic_WORD_GTEQ": 1, "dic_WORD_HEADER_COMMA": 1, "dic_WORD_HIDDEN": 1, "dic_WORD_IMMEDIATE": 1, "dic_WORD_INCR": 1, "dic_WORD_INCR2": 1, "dic_WORD_INCR4": 1, "dic_WORD_INHASH": 1, "dic_WORD_INLINE_COMMA": 1, "dic_WORD_INTERP": 1, "dic_WORD_INTERPNAME": 1, "dic_WORD_INTERPRET": 1, "dic_WORD_INVERT": 1, "dic_WORD_ISNOTSPACE": 1, "dic_WORD_ISSPACE": 1, "dic_WORD_KEY": 1, "dic_WORD_LATEST": 1, "dic_WORD_LBRAC": 1, "dic_WORD_LINESIZE": 1, "dic_WORD_LIT_COMMA": 1, "dic_WORD_LSHIFT": 1, "dic_WORD_LSYSCALL": 1, "dic_WORD_LT": 1, "dic_WORD_LTEQ": 1, "dic_WORD_MAX": 1, "dic_WORD_MIN": 1, "dic_WORD_MMINUS": 1, "dic_WORD_MOD": 1, "dic_WORD_MOVE": 1, "dic_WORD_MPLUS": 1, "dic_WORD_MSLASH": 1, "dic_WORD_MULDIV": 1, "dic_WORD_MULL": 1, "dic_WORD_MULSTAR": 1, "dic_WORD_NE": 1, "dic_WORD_NEGATE": 1, "dic_WORD_NFROMR": 1, "dic_WORD_NIP": 1, "dic_WORD_NIP2": 1, "dic_WORD_NQDUP": 1, "dic_WORD_NROT": 1, "dic_WORD_NTOR": 1, "dic_WORD_OR": 1, "dic_WORD_OVER": 1, "dic_WORD_OVER2": 1, "dic_WORD_O_APPEND": 1, "dic_WORD_O_CREAT": 1, "dic_WORD_O_EXCL": 1, "dic_WORD_O_NONBLOCK": 1, "dic_WORD_O_RDONLY": 1, "dic_WORD_O_RDWR": 1, "dic_WORD_O_TRUNC": 1, "dic_WORD_O_WRONLY": 1, "dic_WORD_PARSENAME": 1, "dic_WORD_PICK": 1, "dic_WORD_POSTPONE": 1, "dic_WORD_QDUP": 1, "dic_WORD_RBRAC": 1, "dic_WORD_RDROP": 1, "dic_WORD_RDROP2": 1, "dic_WORD_READCHAR": 1, "dic_WORD_READLINE": 1, "dic_WORD_REFILL": 1, "dic_WORD_RFETCH": 1, "dic_WORD_RFETCH2": 1, "dic_WORD_ROT": 1, "dic_WORD_ROT2": 1, "dic_WORD_RSHIFT": 1, "dic_WORD_RSPFETCH": 1, "dic_WORD_RSPSTORE": 1, "dic_WORD_RSTORE": 1, "dic_WORD_RZ": 1, "dic_WORD_SEMICOLON": 1, "dic_WORD_SLITS": 1, "dic_WORD_SMDIVREM": 1, "dic_WORD_SOURCE": 1, "dic_WORD_SOURCEFD": 1, "dic_WORD_SSTRING": 1, "dic_WORD_STARSMOD": 1, "dic_WORD_STATE": 1, "dic_WORD_STOD": 1, "dic_WORD_STORE": 1, "dic_WORD_STORE2": 1, "dic_WORD_STOREBYTE": 1, "dic_WORD_STORESHORT": 1, "dic_WORD_SUB": 1, "dic_WORD_SUBSTORE": 1, "dic_WORD_SWAP": 1, "dic_WORD_SWAP2": 1, "dic_WORD_SYSCALL": 1, "dic_WORD_SYS_CLOSE": 1, "dic_WORD_SYS_EXIT": 1, "dic_WORD_SYS_FSTAT": 1, "dic_WORD_SYS_FSYNC": 1, "dic_WORD_SYS_FTRUNCATE": 1, "dic_WORD_SYS_LSEEK": 1, "dic_WORD_SYS_OPEN": 1, "dic_WORD_SYS_READ": 1, "dic_WORD_SYS_RENAME": 1, "dic_WORD_SYS_STAT": 1, "dic_WORD_SYS_UNLINK": 1, "dic_WORD_SYS_WRITE": 1, "dic_WORD_SZ": 1, "dic_WORD_TABSTOSPACES": 1, "dic_WORD_TCFA": 1, "dic_WORD_TICKS": 1, "dic_WORD_TOIN": 1, "dic_WORD_TONUMBER": 1, "dic_WORD_TOR": 1, "dic_WORD_TOR2": 1, "dic_WORD_TOSNUMBER": 1, "dic_WORD_TRAILING": 1, "dic_WORD_TUCK": 1, "dic_WORD_TUCK2": 1, "dic_WORD_TWODIV": 1, "dic_WORD_TWOMUL": 1, "dic_WORD_TYPE": 1, "dic_WORD_TYPE_FD": 1, "dic_WORD_UDIVMOD": 1, "dic_WORD_UGT": 1, "dic_WORD_UGTEQ": 1, "dic_WORD_ULT": 1, "dic_WORD_ULTEQ": 1, "dic_WORD_UMDIVMOD": 1, "dic_WORD_UMULSTAR": 1, "dic_WORD_UNUSED": 1, "dic_WORD_VERSION": 1, "dic_WORD_WORDBUF": 1, "dic_WORD_WORDNAME": 1, "dic_WORD_XOR": 1, "dic_WORD_XTSKIP": 1, "dic_WORD_ZBRANCH": 1, "dic_WORD_ZEQ": 1, "dic_WORD_ZGT": 1, "dic_WORD_ZGTEQ": 1, "dic_WORD_ZLT": 1, "dic_WORD_ZLTEQ": 1, "dic_WORD_ZNE": 1, "dic_WORD__F_HIDDEN": 1, "dic_WORD__F_IMMED": 1, "dic_WORD__F_LENMASK": 1, "dic_WORD__H_NAME": 1, "dic_WORD__H_NSIZE": 1, "dic_WORD__XT_BODY": 1, "dic_WORD__XT_COMPILE": 1, "dic_WORD__XT_LENGTH": 1, "dic_WORD__XT_SIZE": 1, "dic_WORD_TEST": 1, "room": 1, "AL": 1, "DispAL": 6, "dwDispPos": 6, "0Fh": 2, "0000b": 2, "1111b": 1, ".begin": 2, "01111b": 1, ".1": 7, ".2": 6, "gs": 3, "DispInt": 2, "07h": 1, "0111b": 1, "DispStr": 3, "pszInfo": 1, ".3": 2, "0FFh": 1, "DispReturn": 2, "szReturn": 1, "printf": 1, "memcpy": 1, "void*": 3, "MemCpy": 3, "es": 2, "pDest": 1, "ds": 2, "pSrc": 1, "iSize": 1, "Destination": 1, "Source": 1, "Counter": 1 }, "Asymptote": { "import": 2, "graph3": 1, ";": 96, "//ASY": 1, "file": 7, "for": 2, "figarc4_3D.asy": 1, "in": 1, "Chapter": 1, "size": 5, "(": 176, "IgnoreAspect": 2, ")": 177, "//currentprojection": 2, "perspective": 1, "currentprojection": 1, "orthographic": 2, "-": 38, ".0323": 1, "defaultrender.merge": 1, "true": 4, "usepackage": 2, "texpreamble": 4, "real": 18, "[": 21, "]": 21, "myxchoice": 2, "{": 26, "}": 26, "myychoice": 2, "myzchoice": 2, "defaultpen": 1, "0.5mm": 1, "pair": 6, "xbounds": 1, ".25": 1, "ybounds": 1, "zbounds": 1, "xaxis3": 1, "xbounds.x": 2, "xbounds.y": 3, "black": 10, "OutTicks": 3, "Arrow3": 3, "3mm": 3, "yaxis3": 1, "ybounds.x": 2, "ybounds.y": 3, "zaxis3": 1, "zbounds.x": 2, "zbounds.y": 3, "invisible": 1, "label": 13, "+": 28, "0.05*": 3, "//label": 1, "//": 6, "addplot3": 4, "domain": 5, ".9": 10, "y": 6, "samples": 4, "surf": 1, "shader": 1, "flat": 1, "colormap": 1, "mp2": 1, "colormapone": 1, ".5": 6, "colorone": 1, "x": 11, "sin": 2, "deg": 1, "smooth": 2, ".98*cos": 1, ".98*sin": 1, "dashed": 2, ".78*cos": 2, ".78*sin": 2, "pen": 3, "p": 14, "rgb": 7, ".7": 6, "triple": 4, "f2": 2, "t": 18, "return": 6, "t.x": 3, ".41*": 2, ".78": 3, "*sin": 1, "t.y": 2, "*cos": 1, "surface": 4, "s2": 2, "2*pi": 4, "Spline": 3, "draw": 9, "emissive": 1, ".6": 6, "opacity": 4, "meshpen": 5, "g3": 6, "path3": 3, "p3": 6, "graph": 4, "operator": 4, "..": 4, "blue": 6, ".4mm": 1, ".2mm": 6, ".985*sin": 1, ".985*cos": 1, ".985": 1, "red": 3, ".6mm": 1, ".05": 12, "S": 4, "XY*": 2, ".49": 1, "E": 3, "Embedded": 3, ".85": 1, ".37": 1, "W": 1, "rotate": 1, "*": 1, "//real": 1, "f": 6, "z": 1, "z.x": 1, "2*z.x": 1, "z.y": 1, "2*z.y": 1, "//surface": 2, "s": 7, "//pen": 3, "//draw": 7, "//triple": 2, "pi": 1, "paleblue": 2, "lightblue": 1, "thick": 1, "nolight": 1, "render": 2, "merge": 2, "mypath": 3, "2bp": 1, "g": 2, "2*t": 1, "4*t": 1, "//path3": 1, "linewidth": 1, "wtk_graph": 1, "15cm": 1, "10cm": 1, "scale": 1, "Linear": 2, "xscale": 6, "1e9": 1, "fscale": 5, "1e12": 1, "void": 1, "graphSawtooth": 2, "string": 4, "k": 8, "int": 3, "xcol": 2, "fcol": 2, "dx": 3, "df": 3, "fin": 1, "input": 1, ".line": 1, "a": 5, "fin.dimension": 1, "transpose": 1, "f/k": 1, "graphData": 1, "yscale": 1, "dy": 1, "dots": 1, "false": 1, "green": 1, "cyan": 1, "magenta": 1, "yellow": 1, "i": 10, "k.length": 1, "format": 3, "math": 2, "units": 2, "*1e3": 1, "if": 1, "*i": 1, "xlimits": 1, "*xscale": 1, "crop": 1, "xaxis": 1, "sLabel": 3, "BottomTop": 1, "LeftTicks": 1, "yaxis": 1, "LeftRight": 1, "RightTicks": 1, "point": 3, "N": 2, "add": 1, "legend": 1, "20E": 2, "//add": 1, "lengend": 1, ".": 1, "UnFill": 1 }, "AutoHotkey": { "MsgBox": 1, "Hello": 1, "World": 1 }, "Awk": { "SHEBANG#!awk": 1, "BEGIN": 1, "{": 17, "n": 13, ";": 55, "printf": 1, "network_max_bandwidth_in_byte": 3, "network_max_packet_per_second": 3, "last3": 3, "last4": 3, "last5": 3, "last6": 3, "}": 17, "if": 14, "(": 14, "/Average/": 1, ")": 14, "#": 48, "Skip": 1, "the": 12, "Average": 1, "values": 1, "next": 1, "/all/": 1, "This": 8, "is": 7, "cpu": 1, "info": 7, "print": 35, "FILENAME": 35, "-": 2, "/eth0/": 1, "eth0": 1, "network": 1, "Total": 9, "number": 9, "of": 22, "packets": 4, "received": 4, "per": 14, "second.": 8, "else": 4, "transmitted": 4, "bytes": 4, "/proc": 1, "|": 4, "cswch": 1, "tps": 1, "kbmemfree": 1, "totsck/": 1, "/": 2, "[": 1, "]": 1, "proc/s": 1, "context": 1, "switches": 1, "second": 6, "disk": 1, "total": 1, "transfers": 1, "read": 1, "requests": 2, "write": 1, "block": 2, "reads": 1, "writes": 1, "mem": 1, "Amount": 7, "free": 2, "memory": 6, "available": 1, "in": 11, "kilobytes.": 7, "used": 8, "does": 1, "not": 1, "take": 1, "into": 1, "account": 1, "by": 4, "kernel": 3, "itself.": 1, "Percentage": 2, "memory.": 1, "X": 1, "shared": 1, "system": 1, "Always": 1, "zero": 1, "with": 1, "kernels.": 1, "as": 1, "buffers": 1, "to": 1, "cache": 1, "data": 1, "swap": 3, "space": 2, "space.": 1, "socket": 1, "sockets.": 1, "Number": 4, "TCP": 1, "sockets": 3, "currently": 4, "use.": 4, "UDP": 1, "RAW": 1, "IP": 1, "fragments": 1, "END": 1 }, "Ballerina": { "import": 7, "ballerina.lang.system": 4, ";": 47, "function": 5, "main": 4, "(": 29, "string": 4, "[": 5, "]": 5, "args": 4, ")": 29, "{": 12, "json": 7, "j1": 2, "system": 18, "println": 18, "j2": 3, "j3": 2, "true": 1, "j4": 2, "false": 2, "j5": 1, "null": 2, "//JSON": 2, "Objects.": 1, "j6": 2, "name": 1, "color": 1, "price": 1, "}": 12, "Arrays.": 1, "They": 1, "are": 1, "arrays": 1, "of": 2, "any": 1, "JSON": 1, "value.": 2, "j7": 2, "first": 1, "last": 1, "xml": 9, "x1": 3, "": 1, "The": 1, "Lost": 1, "World": 1, "": 1, "x2": 3, "Hello": 1, "world": 1, "x3": 3, "": 1, "subtract": 2, "from": 4, "if": 10, "difference": 1, "is": 3, "nonnegative": 1, "then": 2, "replace": 2, "increment": 2, "quotient": 17, "halve": 1, "zero": 8, "break": 1, "out": 1, "larger": 1, "than": 1, "partially": 1, "examine": 1, "remainder": 9, "for": 4, "nonzero": 1, "digits": 1, "decrement": 1, "with": 1, "normalize": 1, "end": 1, "..": 2, "<-.>": 1, "<.>": 2, "Read": 2, "first": 2, "character": 7, "start": 1, "outer": 2, "reading": 2, "Skip": 2, "forward": 4, "Set": 2, "up": 3, "32": 1, "division": 7, "MEMORY": 2, "LAYOUT": 2, "copy": 6, "x": 1, "minus": 2, "1": 1, "enter": 1, "Increase": 1, "/": 4, "reduce": 1, "Normal": 2, "case": 4, "skip": 4, "Special": 2, "move": 2, "back": 3, "increase": 4, "Decrement": 2, "End": 5, ";": 4, "former": 1, "reuse": 1, "space": 1, "a": 2, "flag": 4, "Zero": 4, "that": 1, "unless": 1, "was": 8, "or": 2, "check": 1, "If": 1, "set": 1, "second": 2, "Reduce": 1, "it": 2, "Decrease": 1, "Add": 1, "get": 1, "useful": 1, "add": 1, "jump": 1, "here": 1, "/32": 1, "not": 1, "Clear": 1, "skipped": 1, "Output": 1, "ROT13ed": 1, "clear": 1, "next": 1 }, "Brightscript": { "Sub": 4, "Main": 1, "(": 44, ")": 45, "initTheme": 2, "gridstyle": 8, "while": 4, "<": 1, "print": 8, ";": 11, "screen": 5, "preShowGridScreen": 2, "showGridScreen": 2, "end": 5, "End": 9, "app": 1, "CreateObject": 4, "app.SetTheme": 1, "CreateDefaultTheme": 2, "Function": 13, "as": 6, "Object": 7, "theme": 2, "theme.ThemeType": 1, "theme.GridScreenBackgroundColor": 1, "theme.GridScreenMessageColor": 1, "theme.GridScreenRetrievingColor": 1, "theme.GridScreenListNameColor": 1, "theme.CounterTextLeft": 1, "theme.CounterSeparator": 1, "theme.CounterTextRight": 1, "theme.GridScreenLogoHD": 1, "theme.GridScreenLogoOffsetHD_X": 1, "theme.GridScreenLogoOffsetHD_Y": 1, "theme.GridScreenOverhangHeightHD": 1, "theme.GridScreenLogoSD": 1, "theme.GridScreenOverhangHeightSD": 1, "theme.GridScreenLogoOffsetSD_X": 1, "theme.GridScreenLogoOffsetSD_Y": 1, "return": 8, "style": 2, "string": 3, "As": 7, "m.port": 3, "screen.SetMessagePort": 1, "screen.SetDisplayMode": 1, "screen.SetGridStyle": 1, "categoryList": 6, "getCategoryList": 2, "[": 6, "]": 6, "+": 8, "screen.setupLists": 1, "categoryList.count": 2, "screen.SetListNames": 1, "StyleButtons": 3, "getGridControlButtons": 2, "screen.SetContentList": 2, "for": 2, "i": 3, "to": 2, "-": 2, "getShowsForCategoryItem": 2, "screen.Show": 1, "true": 2, "msg": 3, "wait": 1, "getmessageport": 1, "does": 1, "not": 1, "work": 1, "on": 1, "gridscreen": 1, "type": 2, "if": 6, "then": 4, "msg.GetMessage": 1, "msg.GetIndex": 3, "msg.getData": 2, "msg.isListItemFocused": 1, "else": 2, "msg.isListItemSelected": 1, "row": 3, "selection": 3, ".Title": 1, "endif": 1, "msg.isScreenClosed": 1, "If": 1, "displayShowDetailScreen": 1, "category": 10, "showIndex": 1, "Integer": 2, "s": 1, "representing": 1, "d": 1, "go": 1, "a": 1, "feed": 1, "service": 1, "fetch": 1, "and": 1, "parse": 1, "showList": 2, "{": 11, "Title": 11, "releaseDate": 6, "length": 1, "Description": 12, "hdBranded": 1, "HDPosterUrl": 11, "SDPosterUrl": 11, "Synopsis": 1, "StarRating": 6, "}": 11, "rating": 5, "numEpisodes": 2, "contentType": 2, "UserStarRating": 2, "function": 1, "object": 1, "buttons": 2, "ReleaseDate": 5 }, "C": { "#include": 259, "": 1, "": 8, "": 7, "": 1, "": 1, "": 1, "": 1, "void": 317, "SSL_CUSTOM_EXTENSION_free": 1, "(": 5968, "SSL_CUSTOM_EXTENSION": 9, "*custom_extension": 1, ")": 5964, "{": 1358, "OPENSSL_free": 1, "custom_extension": 1, ";": 4716, "}": 1349, "static": 234, "const": 322, "*custom_ext_find": 1, "STACK_OF": 3, "*stack": 2, "unsigned": 143, "*out_index": 2, "uint16_t": 45, "value": 60, "size_t": 76, "i": 451, "for": 100, "<": 221, "sk_SSL_CUSTOM_EXTENSION_num": 2, "stack": 21, "+": 691, "*ext": 4, "sk_SSL_CUSTOM_EXTENSION_value": 2, "if": 785, "ext": 30, "-": 1454, "out_index": 1, "NULL": 287, "return": 555, "int": 411, "default_add_callback": 1, "SSL": 11, "*ssl": 6, "extension_value": 4, "uint8_t": 28, "**out": 2, "*out_len": 2, "*out_alert_value": 1, "*add_arg": 2, "ssl": 22, "server": 5, "custom_ext_add_hello": 3, "CBB": 4, "*extensions": 3, "ctx": 151, "client_custom_extensions": 2, "server_custom_extensions": 2, "&&": 227, "s3": 6, "tmp.custom_extensions.received": 3, "&": 339, "<<": 59, "continue": 15, "*contents": 1, "contents_len": 5, "alert": 3, "SSL_AD_DECODE_ERROR": 2, "contents_cbb": 3, "switch": 20, "add_callback": 1, "contents": 4, "add_arg": 3, "case": 83, "CBB_add_u16": 1, "extensions": 6, "||": 91, "CBB_add_u16_length_prefixed": 1, "CBB_add_bytes": 1, "CBB_flush": 1, "OPENSSL_PUT_ERROR": 5, "ERR_R_INTERNAL_ERROR": 1, "ERR_add_error_dataf": 5, "free_callback": 4, "assert": 29, "tmp.custom_extensions.sent": 4, "|": 109, "break": 91, "default": 13, "ssl3_send_alert": 1, "SSL3_AL_FATAL": 1, "SSL_R_CUSTOM_EXTENSION_ERROR": 3, "custom_ext_add_clienthello": 1, "custom_ext_parse_serverhello": 1, "*out_alert": 3, "CBS": 2, "*extension": 2, "index": 25, "custom_ext_find": 2, "SSL_R_UNEXPECTED_EXTENSION": 1, "parse_callback": 4, "CBS_data": 2, "extension": 4, "CBS_len": 2, "out_alert": 2, "parse_arg": 2, "custom_ext_parse_clienthello": 1, "custom_ext_add_serverhello": 1, "#define": 980, "MAX_NUM_CUSTOM_EXTENSIONS": 1, "sizeof": 61, "struct": 514, "ssl3_state_st": 1, "*": 513, "custom_ext_append": 1, "**stack": 2, "SSL_custom_ext_add_cb": 1, "add_cb": 2, "SSL_custom_ext_free_cb": 1, "free_cb": 1, "SSL_custom_ext_parse_cb": 1, "parse_cb": 1, "*parse_arg": 1, "SSL_extension_supported": 1, "#pragma": 23, "once": 14, "": 13, "": 1, "IP4_TOS_ICMP": 1, "typedef": 218, "uint32_t": 202, "ip4_addr_t": 3, "hl": 1, "version": 5, "tos": 1, "len": 62, "id": 11, "off": 9, "ttl": 1, "p": 32, "checksum": 2, "src": 14, "dst": 17, "ip4_header_t": 1, "type": 153, "code": 16, "sequence": 7, "ip4_icmp_header_t": 1, "ip4_receive": 1, "net_device_t*": 1, "origin": 1, "net_l2proto_t": 1, "proto": 1, "size": 133, "void*": 146, "raw": 1, "": 5, "": 2, "": 1, "": 1, "": 10, "": 2, "#ifdef": 62, "__APPLE__": 2, "#endif": 242, "#if": 88, "defined": 51, "TARGET_OS_IPHONE": 1, "#else": 95, "extern": 41, "char": 428, "**environ": 1, "uv__chld": 2, "EV_P_": 1, "ev_child*": 1, "watcher": 4, "revents": 2, "status": 20, "rstatus": 1, "exit_status": 3, "term_signal": 3, "uv_process_t": 1, "*process": 1, "data": 53, "process": 19, "child_watcher": 5, "EV_CHILD": 1, "ev_child_stop": 2, "EV_A_": 1, "WIFEXITED": 1, "WEXITSTATUS": 2, "WIFSIGNALED": 2, "WTERMSIG": 2, "exit_cb": 3, "uv__make_socketpair": 2, "fds": 20, "[": 1184, "]": 1184, "flags": 64, "SOCK_NONBLOCK": 2, "fl": 8, "SOCK_CLOEXEC": 1, "UV__F_NONBLOCK": 5, "socketpair": 2, "AF_UNIX": 2, "SOCK_STREAM": 2, "errno": 17, "EINVAL": 3, "uv__cloexec": 4, "uv__nonblock": 5, "uv__make_pipe": 2, "__linux__": 3, "UV__O_CLOEXEC": 1, "UV__O_NONBLOCK": 1, "uv__pipe2": 1, "ENOSYS": 1, "pipe": 40, "uv__process_init_stdio": 2, "uv_stdio_container_t*": 4, "container": 17, "writable": 8, "fd": 29, "UV_IGNORE": 2, "UV_CREATE_PIPE": 4, "UV_INHERIT_FD": 3, "UV_INHERIT_STREAM": 2, "data.stream": 7, "UV_NAMED_PIPE": 2, "data.fd": 1, "else": 145, "uv__process_stdio_flags": 2, "uv_pipe_t*": 1, "ipc": 1, "UV_STREAM_READABLE": 2, "UV_STREAM_WRITABLE": 2, "uv__process_open_stream": 2, "child_fd": 3, "close": 13, "uv__stream_open": 1, "uv_stream_t*": 2, "uv__process_close_stream": 2, "uv__stream_close": 1, "uv__process_child_init": 2, "uv_process_options_t": 2, "options": 62, "stdio_count": 7, "int*": 22, "pipes": 23, "options.flags": 4, "UV_PROCESS_DETACHED": 2, "setsid": 2, "close_fd": 2, "use_fd": 7, "open": 4, "O_RDONLY": 1, "O_RDWR": 2, "perror": 5, "_exit": 6, "dup2": 4, "options.cwd": 2, "chdir": 2, "UV_PROCESS_SETGID": 2, "setgid": 1, "options.gid": 1, "UV_PROCESS_SETUID": 2, "setuid": 1, "options.uid": 1, "environ": 8, "options.env": 1, "execvp": 1, "options.file": 2, "options.args": 1, "#ifndef": 100, "SPAWN_WAIT_EXEC": 5, "uv_spawn": 1, "uv_loop_t*": 1, "loop": 9, "uv_process_t*": 3, "char**": 15, "save_our_env": 3, "options.stdio_count": 4, "malloc": 8, "signal_pipe": 7, "pollfd": 1, "pfd": 2, "pid_t": 2, "pid": 14, "ENOMEM": 2, "goto": 31, "error": 50, "uv__handle_init": 1, "uv_handle_t*": 1, "UV_PROCESS": 1, "counters.process_init": 1, "uv__handle_start": 1, "options.exit_cb": 1, "options.stdio": 3, "fork": 2, "do": 20, "pfd.fd": 1, "pfd.events": 1, "POLLIN": 1, "POLLHUP": 1, "pfd.revents": 1, "poll": 1, "while": 72, "EINTR": 1, "ev_child_init": 1, "ev_child_start": 1, "ev": 7, "child_watcher.data": 1, "j": 216, "free": 74, "uv__set_sys_error": 2, "uv_process_kill": 1, "signum": 4, "r": 57, "kill": 4, "uv_err_t": 1, "uv_kill": 1, "uv__new_sys_error": 1, "uv_ok_": 1, "uv__process_close": 1, "handle": 10, "uv__handle_stop": 1, "main": 2, "printf": 3, "": 1, "": 1, "": 1, "system_node": 8, "root": 13, "clone": 12, "read": 4, "pipe_end": 4, "*endself": 2, "*endtarget": 2, "service_state": 6, "*state": 7, "count": 33, "*buffer": 12, "buffer_rcfifo": 1, "endself": 3, "buffer": 31, "endtarget": 4, "node.refcount": 1, "list_add": 2, "readlinks": 2, "state": 16, "link": 4, "task_setstatus": 2, "link.data": 2, "TASK_STATUS_BLOCKED": 2, "system_wakeup": 2, "writelinks": 2, "write": 10, "buffer_wcfifo": 1, "end0_read": 2, "*self": 10, "*pipe": 8, "self": 32, "parent": 12, "end0": 4, "end1": 4, "end0_write": 2, "end1_read": 2, "end1_write": 2, "clone_child": 2, "*path": 1, "list_item": 1, "*current": 1, "current": 8, "root.children.head": 1, "next": 25, "*node": 1, "node": 3, "end0.node.refcount": 1, "end1.node.refcount": 1, "child": 1, "path": 4, "pipe_init": 1, "buffer_init": 2, "end0.buffer": 1, "end0.data": 1, "end1.buffer": 1, "end1.data": 1, "system_initnode": 5, "end0.node": 2, "SYSTEM_NODETYPE_NORMAL": 2, "end1.node": 2, "end0.node.read": 1, "end0.node.write": 1, "end1.node.read": 1, "end1.node.write": 1, "SYSTEM_NODETYPE_GROUP": 3, "SYSTEM_NODETYPE_MULTI": 1, "system_addchild": 4, "pipe_register": 1, "pipe_unregister": 1, "system_removechild": 1, "module_init": 1, "clone.child": 1, "module_register": 1, "system_registernode": 1, "module_unregister": 1, "system_unregisternode": 1, "": 1, "__bump_up": 3, "n": 82, "base": 5, "*__array_alloc": 2, "length": 68, "allocated": 8, "__array_header": 4, "*head": 7, "head": 23, "__array_resize": 5, "**array": 2, "difference": 3, "__header": 5, "array": 35, "elem": 8, "CPUID_H": 2, "inline": 5, "do_cpuid": 1, "dword_t": 5, "*eax": 4, "*ebx": 3, "*ecx": 3, "*edx": 3, "leaf": 4, "//": 342, "we": 14, "support": 3, "barely": 1, "anything": 1, "Genu": 1, "ineI": 1, "ntel": 1, "is": 12, "too": 1, "high": 1, "use": 2, "highest": 1, "supported": 1, "say": 1, "nothing": 1, "about": 1, "cpu": 1, "model": 1, "number": 21, "processor": 1, "flushes": 1, "bytes": 229, "on": 2, "clflush": 1, "none": 2, "of": 50, "the": 87, "features": 2, "in": 12, "ecx": 1, "also": 1, "edx": 1, "BLOB_H": 2, "*blob_type": 2, "blob": 6, "object": 40, "*lookup_blob": 2, "*sha1": 16, "parse_blob_buffer": 2, "*item": 30, "long": 97, "_NMEX_NIGHTMARE_H": 2, "//#define": 1, "NMEX": 1, "START_HEAD": 2, "END_HEAD": 1, "REFU_USTRING_H": 2, "": 1, "RF_MODULE_STRINGS//": 1, "check": 11, "strings": 3, "are": 4, "included": 2, "as": 2, "a": 39, "module": 3, "": 2, "argument": 1, "": 2, "local": 5, "memory": 4, "function": 25, "wrapping": 1, "functionality": 1, "": 1, "unicode": 1, "__cplusplus": 18, "opening": 2, "bracket": 4, "calling": 4, "from": 10, "C": 6, "RF_CASE_IGNORE": 2, "RF_MATCH_WORD": 5, "RF_STRING_INDEX_OUT_OF_BOUNDS": 2, "rfUTF8_IsContinuationByte2": 1, "b__": 3, "pack": 2, "push": 52, "RF_String": 23, "char*": 177, "byteLength": 197, "pop": 31, "RF_IAMHERE_FOR_DOXYGEN": 22, "RF_String*": 230, "RFS_": 6, "s": 142, "...": 130, "i_rfString_CreateLocal": 2, "__VA_ARGS__": 66, "RF_OPTION_DEFAULT_ARGUMENTS": 24, "i_DECLIMEX_": 121, "rfString_Create": 3, "i_rfString_Create": 3, "i_NVrfString_Create": 3, "RP_SELECT_FUNC_IF_NARGIS": 5, "i_SELECT_RF_STRING_CREATE": 1, "i_SELECT_RF_STRING_CREATE1": 1, "i_SELECT_RF_STRING_CREATE0": 1, "///Internal": 1, "that": 6, "creates": 1, "temporary": 4, "i_rfString_CreateLocal1": 3, "i_NVrfString_CreateLocal": 3, "i_SELECT_RF_STRING_CREATELOCAL": 1, "i_SELECT_RF_STRING_CREATELOCAL1": 1, "i_SELECT_RF_STRING_CREATELOCAL0": 1, "rfString_Init": 3, "str": 158, "i_rfString_Init": 3, "i_NVrfString_Init": 3, "i_SELECT_RF_STRING_INIT": 1, "i_SELECT_RF_STRING_INIT1": 1, "i_SELECT_RF_STRING_INIT0": 1, "rfString_Create_cp": 2, "rfString_Init_cp": 3, "rfString_Create_nc": 3, "i_rfString_Create_nc": 3, "i_NVrfString_Create_nc": 3, "i_SELECT_RF_STRING_CREATE_NC": 1, "i_SELECT_RF_STRING_CREATE_NC1": 1, "i_SELECT_RF_STRING_CREATE_NC0": 1, "rfString_Init_nc": 4, "i_rfString_Init_nc": 3, "i_NVrfString_Init_nc": 3, "i_SELECT_RF_STRING_INIT_NC": 1, "i_SELECT_RF_STRING_INIT_NC1": 1, "i_SELECT_RF_STRING_INIT_NC0": 1, "rfString_Create_i": 2, "int32_t": 114, "rfString_Init_i": 2, "rfString_Create_f": 2, "float": 227, "f": 178, "rfString_Init_f": 2, "rfString_Create_UTF16": 2, "endianess": 40, "rfString_Init_UTF16": 3, "rfString_Create_UTF32": 2, "rfString_Init_UTF32": 3, "//@": 1, "rfString_Assign": 2, "dest": 7, "source": 8, "i_rfString_Assign": 3, "i_DESTINATION_": 2, "i_SOURCE_": 2, "i_rfLMS_WRAP2": 5, "rfString_Assign_char": 2, "thisstr": 213, "character": 10, "rfString_Destroy": 2, "rfString_Deinit": 3, "rfString_ToUTF8": 2, "i_STRING_": 2, "rfString_ToCstr": 2, "uint16_t*": 11, "rfString_ToUTF16": 4, "uint32_t*": 33, "rfString_ToUTF32": 4, "uint32_t*length": 1, "String": 6, "iteration": 8, "/": 31, "rfString_Iterate_Start": 6, "string_": 9, "startCharacterPos_": 4, "characterUnicodeValue_": 4, "byteIndex_": 12, "j_": 6, "rfUTF8_IsContinuationByte": 12, "false": 94, "rfString_BytePosToCodePoint": 7, "rfString_Iterate_End": 5, "//Two": 1, "macros": 1, "to": 32, "accomplish": 1, "an": 2, "any": 3, "given": 5, "going": 1, "backwards.": 1, "This": 1, "macro": 3, "should": 1, "be": 3, "used": 9, "with": 6, "its": 1, "end": 51, "pair.": 1, "rfString_IterateB_Start": 1, "characterPos_": 5, "b_index_": 6, "int64_t": 2, "c_index_": 3, "rfString_IterateB_End": 1, "rfString_Length": 5, "rfString_GetChar": 2, "c": 196, "bytepos": 12, "rfString_BytePosToCharPos": 4, "before": 4, "rfString_Equal": 2, "s1": 15, "s2": 14, "i_rfString_Equal": 3, "i_STRING1_": 2, "i_STRING2_": 2, "i_rfLMSX_WRAP2": 4, "rfString_Find": 3, "sstr": 39, "i_rfString_Find": 5, "i_THISSTR_": 60, "i_SEARCHSTR_": 26, "i_OPTIONS_": 28, "i_rfLMS_WRAP3": 4, "i_RFI8_": 54, "RF_SELECT_FUNC_IF_NARGGT": 10, "i_NPSELECT_RF_STRING_FIND": 1, "i_NPSELECT_RF_STRING_FIND1": 1, "RF_COMPILE_ERROR": 33, "i_NPSELECT_RF_STRING_FIND0": 1, "RF_SELECT_FUNC": 10, "i_SELECT_RF_STRING_FIND": 1, "i_SELECT_RF_STRING_FIND2": 1, "i_SELECT_RF_STRING_FIND3": 1, "i_SELECT_RF_STRING_FIND1": 1, "i_SELECT_RF_STRING_FIND0": 1, "rfString_ToInt": 2, "int32_t*": 2, "v": 20, "rfString_ToDouble": 2, "double*": 2, "rfString_Copy_OUT": 2, "rfString_Copy_IN": 2, "rfString_Copy_chars": 2, "rfString_ScanfAfter": 2, "afterstr": 5, "format": 14, "var": 7, "i_rfString_ScanfAfter": 3, "i_AFTERSTR_": 8, "i_FORMAT_": 2, "i_VAR_": 2, "i_rfLMSX_WRAP4": 11, "rfString_Count": 4, "i_rfString_Count": 5, "i_NPSELECT_RF_STRING_COUNT": 1, "i_NPSELECT_RF_STRING_COUNT1": 1, "i_NPSELECT_RF_STRING_COUNT0": 1, "i_SELECT_RF_STRING_COUNT": 1, "i_SELECT_RF_STRING_COUNT2": 1, "i_rfLMSX_WRAP3": 5, "i_SELECT_RF_STRING_COUNT3": 1, "i_SELECT_RF_STRING_COUNT1": 1, "i_SELECT_RF_STRING_COUNT0": 1, "rfString_Tokenize": 2, "sep": 3, "tokensN": 2, "RF_String**": 2, "tokens": 3, "rfString_Between": 3, "lstr": 6, "rstr": 24, "result": 37, "i_rfString_Between": 4, "i_NPSELECT_RF_STRING_BETWEEN": 1, "i_NPSELECT_RF_STRING_BETWEEN1": 1, "i_NPSELECT_RF_STRING_BETWEEN0": 1, "i_SELECT_RF_STRING_BETWEEN": 1, "i_SELECT_RF_STRING_BETWEEN4": 1, "i_LEFTSTR_": 6, "i_RIGHTSTR_": 6, "i_RESULT_": 12, "i_rfLMSX_WRAP5": 9, "i_SELECT_RF_STRING_BETWEEN5": 1, "i_SELECT_RF_STRING_BETWEEN3": 1, "i_SELECT_RF_STRING_BETWEEN2": 1, "i_SELECT_RF_STRING_BETWEEN1": 1, "i_SELECT_RF_STRING_BETWEEN0": 1, "rfString_Beforev": 4, "parN": 10, "i_rfString_Beforev": 16, "i_NPSELECT_RF_STRING_BEFOREV": 1, "i_NPSELECT_RF_STRING_BEFOREV1": 1, "RF_SELECT_FUNC_IF_NARGGT2": 2, "i_LIMSELECT_RF_STRING_BEFOREV": 1, "i_NPSELECT_RF_STRING_BEFOREV0": 1, "i_LIMSELECT_RF_STRING_BEFOREV1": 1, "i_LIMSELECT_RF_STRING_BEFOREV0": 1, "i_SELECT_RF_STRING_BEFOREV": 1, "i_SELECT_RF_STRING_BEFOREV5": 1, "i_ARG1_": 56, "i_ARG2_": 56, "i_ARG3_": 56, "i_ARG4_": 56, "i_RFUI8_": 28, "i_SELECT_RF_STRING_BEFOREV6": 1, "i_rfLMSX_WRAP6": 2, "i_SELECT_RF_STRING_BEFOREV7": 1, "i_rfLMSX_WRAP7": 2, "i_SELECT_RF_STRING_BEFOREV8": 1, "i_rfLMSX_WRAP8": 2, "i_SELECT_RF_STRING_BEFOREV9": 1, "i_rfLMSX_WRAP9": 2, "i_SELECT_RF_STRING_BEFOREV10": 1, "i_rfLMSX_WRAP10": 2, "i_SELECT_RF_STRING_BEFOREV11": 1, "i_rfLMSX_WRAP11": 2, "i_SELECT_RF_STRING_BEFOREV12": 1, "i_rfLMSX_WRAP12": 2, "i_SELECT_RF_STRING_BEFOREV13": 1, "i_rfLMSX_WRAP13": 2, "i_SELECT_RF_STRING_BEFOREV14": 1, "i_rfLMSX_WRAP14": 2, "i_SELECT_RF_STRING_BEFOREV15": 1, "i_rfLMSX_WRAP15": 2, "i_SELECT_RF_STRING_BEFOREV16": 1, "i_rfLMSX_WRAP16": 2, "i_SELECT_RF_STRING_BEFOREV17": 1, "i_rfLMSX_WRAP17": 2, "i_SELECT_RF_STRING_BEFOREV18": 1, "i_rfLMSX_WRAP18": 2, "rfString_Before": 3, "i_rfString_Before": 5, "i_NPSELECT_RF_STRING_BEFORE": 1, "i_NPSELECT_RF_STRING_BEFORE1": 1, "i_NPSELECT_RF_STRING_BEFORE0": 1, "i_SELECT_RF_STRING_BEFORE": 1, "i_SELECT_RF_STRING_BEFORE3": 1, "i_SELECT_RF_STRING_BEFORE4": 1, "i_SELECT_RF_STRING_BEFORE2": 1, "i_SELECT_RF_STRING_BEFORE1": 1, "i_SELECT_RF_STRING_BEFORE0": 1, "rfString_After": 4, "after": 6, "out": 10, "i_rfString_After": 5, "i_NPSELECT_RF_STRING_AFTER": 1, "i_NPSELECT_RF_STRING_AFTER1": 1, "i_NPSELECT_RF_STRING_AFTER0": 1, "i_SELECT_RF_STRING_AFTER": 1, "i_SELECT_RF_STRING_AFTER3": 1, "i_OUTSTR_": 6, "i_SELECT_RF_STRING_AFTER4": 1, "i_SELECT_RF_STRING_AFTER2": 1, "i_SELECT_RF_STRING_AFTER1": 1, "i_SELECT_RF_STRING_AFTER0": 1, "rfString_Afterv": 4, "i_rfString_Afterv": 16, "i_NPSELECT_RF_STRING_AFTERV": 1, "i_NPSELECT_RF_STRING_AFTERV1": 1, "i_LIMSELECT_RF_STRING_AFTERV": 1, "i_NPSELECT_RF_STRING_AFTERV0": 1, "i_LIMSELECT_RF_STRING_AFTERV1": 1, "i_LIMSELECT_RF_STRING_AFTERV0": 1, "i_SELECT_RF_STRING_AFTERV": 1, "i_SELECT_RF_STRING_AFTERV5": 1, "i_SELECT_RF_STRING_AFTERV6": 1, "i_SELECT_RF_STRING_AFTERV7": 1, "i_SELECT_RF_STRING_AFTERV8": 1, "i_SELECT_RF_STRING_AFTERV9": 1, "i_SELECT_RF_STRING_AFTERV10": 1, "i_SELECT_RF_STRING_AFTERV11": 1, "i_SELECT_RF_STRING_AFTERV12": 1, "i_SELECT_RF_STRING_AFTERV13": 1, "i_SELECT_RF_STRING_AFTERV14": 1, "i_SELECT_RF_STRING_AFTERV15": 1, "i_SELECT_RF_STRING_AFTERV16": 1, "i_SELECT_RF_STRING_AFTERV17": 1, "i_SELECT_RF_STRING_AFTERV18": 1, "rfString_Append": 5, "other": 15, "i_rfString_Append": 3, "i_OTHERSTR_": 4, "rfString_Append_i": 2, "rfString_Append_f": 2, "rfString_Prepend": 2, "i_rfString_Prepend": 3, "rfString_Remove": 3, "i_rfString_Remove": 6, "i_NPSELECT_RF_STRING_REMOVE": 1, "i_NPSELECT_RF_STRING_REMOVE1": 1, "i_NPSELECT_RF_STRING_REMOVE0": 1, "i_SELECT_RF_STRING_REMOVE": 1, "i_SELECT_RF_STRING_REMOVE2": 1, "i_REPSTR_": 16, "i_RFUI32_": 8, "i_SELECT_RF_STRING_REMOVE3": 1, "i_NUMBER_": 12, "i_SELECT_RF_STRING_REMOVE4": 1, "i_SELECT_RF_STRING_REMOVE1": 1, "i_SELECT_RF_STRING_REMOVE0": 1, "rfString_KeepOnly": 2, "keepstr": 5, "i_rfString_KeepOnly": 3, "I_KEEPSTR_": 2, "rfString_PruneStart": 2, "rfString_PruneEnd": 2, "rfString_PruneMiddleB": 2, "rfString_PruneMiddleF": 2, "rfString_Replace": 3, "i_rfString_Replace": 6, "i_NPSELECT_RF_STRING_REPLACE": 1, "i_NPSELECT_RF_STRING_REPLACE1": 1, "i_NPSELECT_RF_STRING_REPLACE0": 1, "i_SELECT_RF_STRING_REPLACE": 1, "i_SELECT_RF_STRING_REPLACE3": 1, "i_SELECT_RF_STRING_REPLACE4": 1, "i_SELECT_RF_STRING_REPLACE5": 1, "i_SELECT_RF_STRING_REPLACE2": 1, "i_SELECT_RF_STRING_REPLACE1": 1, "i_SELECT_RF_STRING_REPLACE0": 1, "rfString_StripStart": 3, "sub": 10, "i_rfString_StripStart": 3, "i_SUBSTR_": 6, "rfString_StripEnd": 3, "i_rfString_StripEnd": 3, "rfString_Strip": 2, "i_rfString_Strip": 3, "rfString_Create_fUTF8": 2, "FILE*": 64, "eof": 53, "rfString_Init_fUTF8": 3, "rfString_Assign_fUTF8": 2, "rfString_Append_fUTF8": 2, "rfString_Create_fUTF16": 2, "rfString_Init_fUTF16": 3, "rfString_Append_fUTF16": 2, "rfString_Assign_fUTF16": 2, "rfString_Create_fUTF32": 2, "rfString_Init_fUTF32": 3, "rfString_Assign_fUTF32": 2, "rfString_Append_fUTF32": 2, "rfString_Fwrite": 2, "encoding": 13, "i_rfString_Fwrite": 5, "i_NPSELECT_RF_STRING_FWRITE": 1, "i_NPSELECT_RF_STRING_FWRITE1": 1, "i_NPSELECT_RF_STRING_FWRITE0": 1, "i_SELECT_RF_STRING_FWRITE": 1, "i_SELECT_RF_STRING_FWRITE3": 1, "i_STR_": 8, "i_FILE_": 16, "i_ENCODING_": 4, "i_SELECT_RF_STRING_FWRITE2": 1, "RF_UTF8": 8, "i_SELECT_RF_STRING_FWRITE1": 1, "i_SELECT_RF_STRING_FWRITE0": 1, "rfString_Fwrite_fUTF8": 1, "closing": 1, "include": 7, "#error": 4, "Attempted": 1, "Refu": 1, "manipulation": 1, "flag": 1, "off.": 1, "Rebuild": 1, "library": 3, "option": 9, "added": 1, "you": 1, "need": 4, "them": 3, "#endif//": 1, "guards": 2, "": 1, "": 1, "SCHEDULER_MAXNAME": 3, "SCHEDULER_TASK_PATH_MAX": 2, "task": 2, "name": 35, "*parent": 1, "cpu_state_t*": 3, "task*": 2, "previous": 1, "entry": 3, "vmem_context": 14, "*memory_context": 1, "enum": 36, "TASK_STATE_KILLED": 1, "TASK_STATE_TERMINATED": 1, "TASK_STATE_BLOCKING": 1, "TASK_STATE_STOPPED": 1, "TASK_STATE_RUNNING": 1, "task_state": 1, "argv": 45, "argc": 24, "cwd": 1, "task_t": 3, "scheduler_state": 1, "task_t*": 8, "scheduler_new": 1, "vmem_context*": 1, "memory_context": 1, "bool": 40, "map_structs": 1, "scheduler_add": 1, "*task": 1, "scheduler_terminate_current": 1, "scheduler_get_current": 1, "scheduler_select": 1, "lastRegs": 1, "scheduler_init": 1, "scheduler_yield": 1, "scheduler_remove": 1, "*t": 1, "scheduler_fork": 1, "to_fork": 1, "__GLK_MATRIX_4_H": 2, "": 3, "": 2, "": 7, "__ARM_NEON__": 13, "": 1, "": 1, "": 1, "": 1, "": 1, "mark": 9, "Prototypes": 1, "GLKMatrix4": 183, "GLKMatrix4Identity": 3, "__inline__": 95, "GLKMatrix4Make": 2, "m00": 6, "m01": 6, "m02": 6, "m03": 6, "m10": 6, "m11": 6, "m12": 6, "m13": 6, "m20": 6, "m21": 6, "m22": 6, "m23": 6, "m30": 6, "m31": 6, "m32": 6, "m33": 6, "GLKMatrix4MakeAndTranspose": 2, "GLKMatrix4MakeWithArray": 2, "values": 37, "GLKMatrix4MakeWithRows": 2, "GLKVector4": 44, "row0": 2, "row1": 2, "row2": 2, "row3": 2, "GLKMatrix4MakeWithColumns": 2, "column0": 2, "column1": 2, "column2": 2, "column3": 2, "GLKMatrix4MakeWithQuaternion": 2, "GLKQuaternion": 2, "quaternion": 4, "GLKMatrix4MakeTranslation": 2, "tx": 8, "ty": 8, "tz": 8, "GLKMatrix4MakeScale": 2, "sx": 10, "sy": 10, "sz": 10, "GLKMatrix4MakeRotation": 5, "radians": 34, "x": 117, "y": 59, "z": 19, "GLKMatrix4MakeXRotation": 3, "GLKMatrix4MakeYRotation": 3, "GLKMatrix4MakeZRotation": 3, "GLKMatrix4MakePerspective": 2, "fovyRadians": 3, "aspect": 3, "nearZ": 17, "farZ": 15, "GLKMatrix4MakeFrustum": 2, "left": 8, "right": 8, "bottom": 8, "top": 10, "GLKMatrix4MakeOrtho": 2, "GLKMatrix4MakeLookAt": 2, "eyeX": 3, "eyeY": 3, "eyeZ": 3, "centerX": 3, "centerY": 3, "centerZ": 3, "upX": 3, "upY": 3, "upZ": 3, "GLKMatrix3": 3, "GLKMatrix4GetMatrix3": 2, "matrix": 64, "GLKMatrix2": 3, "GLKMatrix4GetMatrix2": 2, "GLKMatrix4GetRow": 2, "row": 12, "GLKMatrix4GetColumn": 2, "column": 14, "GLKMatrix4SetRow": 2, "vector": 4, "GLKMatrix4SetColumn": 2, "GLKMatrix4Transpose": 2, "GLKMatrix4Invert": 1, "*isInvertible": 2, "GLKMatrix4InvertAndTranspose": 1, "GLKMatrix4Multiply": 8, "matrixLeft": 21, "matrixRight": 9, "GLKMatrix4Add": 2, "GLKMatrix4Subtract": 2, "GLKMatrix4Translate": 2, "GLKMatrix4TranslateWithVector3": 2, "GLKVector3": 31, "translationVector": 4, "GLKMatrix4TranslateWithVector4": 2, "GLKMatrix4Scale": 2, "GLKMatrix4ScaleWithVector3": 2, "scaleVector": 4, "GLKMatrix4ScaleWithVector4": 2, "GLKMatrix4Rotate": 2, "GLKMatrix4RotateWithVector3": 2, "axisVector": 4, "GLKMatrix4RotateWithVector4": 2, "GLKMatrix4RotateX": 2, "GLKMatrix4RotateY": 2, "GLKMatrix4RotateZ": 2, "GLKMatrix4MultiplyVector3": 3, "vectorRight": 8, "GLKMatrix4MultiplyVector3Array": 2, "*vectors": 8, "vectorCount": 12, "GLKMatrix4MultiplyVector4": 6, "GLKMatrix4MultiplyVector4Array": 2, "Implementations": 1, "m": 82, "float32x4x4_t": 29, "vld4q_f32": 2, "row0.v": 4, "row1.v": 4, "row2.v": 4, "row3.v": 4, "m.val": 52, "vld1q_f32": 6, "column0.v": 5, "column1.v": 5, "column2.v": 5, "column3.v": 5, "GLKQuaternionNormalize": 1, "quaternion.q": 4, "w": 21, "_2x": 7, "_2y": 5, "_2z": 3, "_2w": 7, "m.m": 54, "GLKVector3Normalize": 3, "GLKVector3Make": 4, "cos": 15, "cosf": 4, "cosp": 10, "sin": 17, "sinf": 4, "v.v": 27, "cotan": 3, "tanf": 1, "ral": 4, "rsl": 6, "tsb": 6, "tab": 4, "fan": 4, "fsn": 6, "cv": 2, "uv": 2, "GLKVector3Add": 1, "GLKVector3Negate": 4, "u": 12, "GLKVector3CrossProduct": 2, "u.v": 3, "n.v": 3, "GLKVector3DotProduct": 3, "matrix.m": 171, "float32x4_t": 2, "vector.v": 9, "*dst": 1, "vst1q_f32": 1, "iMatrixLeft": 3, "iMatrixRight": 3, "vmulq_n_f32": 17, "iMatrixLeft.val": 24, "vgetq_lane_f32": 16, "iMatrixRight.val": 24, "vmlaq_n_f32": 12, "matrixLeft.m": 112, "matrixRight.m": 96, "vaddq_f32": 7, "vsubq_f32": 4, "translationVector.v": 18, "iMatrix": 4, "iMatrix.val": 28, "float32_t": 13, "scaleVector.v": 30, "rm": 12, "axisVector.v": 6, "v4": 3, "GLKVector4Make": 3, "vectorRight.v": 29, "v4.v": 10, "GLKVector3MultiplyScalar": 1, "vectors": 8, "http_parser_h": 2, "HTTP_PARSER_VERSION_MAJOR": 1, "HTTP_PARSER_VERSION_MINOR": 1, "": 2, "_WIN32": 2, "__MINGW32__": 1, "_MSC_VER": 5, "<1600>": 1, "__int8": 2, "int8_t": 2, "__int16": 2, "int16_t": 1, "__int32": 2, "__int64": 3, "uint64_t": 8, "ssize_t": 3, "stdint": 1, "h": 13, "HTTP_PARSER_STRICT": 1, "HTTP_PARSER_DEBUG": 4, "HTTP_MAX_HEADER_SIZE": 1, "80*1024": 1, "http_parser": 7, "http_parser_settings": 4, "HTTP_METHOD_MAP": 3, "XX": 76, "DELETE": 2, "GET": 2, "HEAD": 2, "POST": 2, "PUT": 2, "CONNECT": 2, "OPTIONS": 2, "TRACE": 2, "COPY": 2, "LOCK": 2, "MKCOL": 2, "MOVE": 2, "PROPFIND": 2, "PROPPATCH": 2, "SEARCH": 3, "UNLOCK": 2, "REPORT": 2, "MKACTIVITY": 2, "CHECKOUT": 2, "MERGE": 2, "MSEARCH": 1, "M": 1, "NOTIFY": 2, "SUBSCRIBE": 2, "UNSUBSCRIBE": 2, "PATCH": 2, "PURGE": 2, "http_method": 2, "num": 27, "string": 29, "HTTP_##name": 1, "#undef": 6, "http_parser_type": 2, "HTTP_REQUEST": 1, "HTTP_RESPONSE": 1, "HTTP_BOTH": 1, "F_CHUNKED": 1, "F_CONNECTION_KEEP_ALIVE": 1, "F_CONNECTION_CLOSE": 1, "F_TRAILING": 1, "F_UPGRADE": 1, "F_SKIPBODY": 1, "HTTP_ERRNO_MAP": 2, "OK": 2, "CB_message_begin": 1, "CB_url": 1, "CB_header_field": 1, "CB_header_value": 1, "CB_headers_complete": 1, "CB_body": 1, "CB_message_complete": 1, "INVALID_EOF_STATE": 1, "HEADER_OVERFLOW": 1, "CLOSED_CONNECTION": 1, "INVALID_VERSION": 1, "INVALID_STATUS": 1, "INVALID_METHOD": 1, "INVALID_URL": 1, "INVALID_HOST": 1, "INVALID_PORT": 1, "INVALID_PATH": 1, "INVALID_QUERY_STRING": 1, "INVALID_FRAGMENT": 1, "LF_EXPECTED": 1, "INVALID_HEADER_TOKEN": 1, "INVALID_CONTENT_LENGTH": 1, "INVALID_CHUNK_SIZE": 1, "INVALID_CONSTANT": 1, "INVALID_INTERNAL_STATE": 1, "STRICT": 1, "PAUSED": 1, "UNKNOWN": 1, "HTTP_ERRNO_GEN": 3, "HPE_##n": 1, "http_errno": 8, "HTTP_PARSER_ERRNO": 5, "HTTP_PARSER_ERRNO_LINE": 2, "error_lineno": 3, "header_state": 1, "nread": 1, "content_length": 1, "short": 3, "http_major": 1, "http_minor": 1, "status_code": 1, "method": 1, "upgrade": 1, "*data": 8, "http_cb": 3, "on_message_begin": 1, "http_data_cb": 4, "on_url": 1, "on_header_field": 1, "on_header_value": 1, "on_headers_complete": 1, "on_body": 1, "on_message_complete": 1, "http_parser_url_fields": 1, "UF_SCHEMA": 1, "UF_HOST": 1, "UF_PORT": 1, "UF_PATH": 1, "UF_QUERY": 1, "UF_FRAGMENT": 1, "UF_MAX": 2, "http_parser_url": 2, "field_set": 1, "port": 17, "field_data": 1, "http_parser_init": 1, "*parser": 4, "http_parser_execute": 1, "*settings": 1, "http_should_keep_alive": 1, "*http_method_str": 1, "*http_errno_name": 1, "err": 15, "*http_errno_description": 1, "http_parser_parse_url": 1, "*buf": 15, "buflen": 1, "is_connect": 1, "*u": 1, "http_parser_pause": 1, "paused": 1, "__SUNPRO_C": 1, "align": 1, "ArrowLeft": 3, "__GNUC__": 12, "__attribute__": 11, "__aligned__": 1, "REFU_IO_H": 2, "RF_LF": 10, "RF_CR": 1, "REFU_WIN32_VERSION": 1, "i_PLUSB_WIN32": 2, "foff_rft": 2, "off64_t": 1, "///Fseek": 1, "and": 13, "Ftelll": 1, "definitions": 1, "rfFseek": 2, "i_OFFSET_": 4, "i_WHENCE_": 4, "_fseeki64": 1, "rfFtell": 2, "_ftelli64": 1, "fseeko64": 1, "ftello64": 1, "rfFReadLine_UTF8": 5, "utf8": 36, "bufferSize": 6, "rfFReadLine_UTF16BE": 6, "rfFReadLine_UTF16LE": 4, "rfFReadLine_UTF32BE": 1, "rfFReadLine_UTF32LE": 4, "rfFgets_UTF32BE": 1, "buff": 95, "rfFgets_UTF32LE": 2, "rfFgets_UTF16BE": 2, "rfFgets_UTF16LE": 2, "rfFgets_UTF8": 2, "rfFgetc_UTF8": 3, "*c": 69, "cp": 12, "rfFgetc_UTF16BE": 4, "rfFgetc_UTF16LE": 4, "rfFgetc_UTF32LE": 4, "rfFgetc_UTF32BE": 3, "rfFback_UTF32BE": 2, "rfFback_UTF32LE": 2, "rfFback_UTF16BE": 2, "rfFback_UTF16LE": 2, "rfFback_UTF8": 2, "rfPopen": 2, "command": 3, "mode": 6, "i_rfPopen": 2, "i_CMD_": 2, "i_MODE_": 2, "rfPclose": 1, "stream": 1, "///closing": 1, "#endif//include": 1, "background": 1, "foreground": 1, "console_color_t": 3, "CONSOLE_COLOR_BLACK": 1, "CONSOLE_COLOR_BLUE": 1, "CONSOLE_COLOR_GREEN": 1, "CONSOLE_COLOR_CYAN": 1, "CONSOLE_COLOR_RED": 1, "CONSOLE_COLOR_MAGENTA": 1, "CONSOLE_COLOR_BROWN": 1, "CONSOLE_COLOR_LGREY": 1, "CONSOLE_COLOR_DGREY": 1, "CONSOLE_COLOR_LBLUE": 1, "CONSOLE_COLOR_LGREEN": 1, "CONSOLE_COLOR_LCYAN": 1, "CONSOLE_COLOR_LRED": 1, "CONSOLE_COLOR_LMAGENTA": 1, "CONSOLE_COLOR_YELLOW": 1, "CONSOLE_COLOR_WHITE": 1, "HAVE_CONFIG_H": 1, "": 1, "": 1, "": 1, "": 1, "ZEPHIR_INIT_CLASS": 2, "Test_Router_Exception": 2, "ZEPHIR_REGISTER_CLASS_EX": 1, "Test": 1, "Router": 1, "Exception": 1, "test": 1, "router_exception": 1, "zend_exception_get_default": 1, "TSRMLS_C": 1, "SUCCESS": 1, "": 3, "CONSOLE_DRV_CAP_CLEAR": 1, "CONSOLE_DRV_CAP_SCROLL": 1, "CONSOLE_DRV_CAP_SET_CURSOR": 1, "shift_left": 1, "shift_right": 1, "control_left": 1, "control_right": 1, "alt": 1, "super": 1, "console_modifiers_t": 1, "console_modifiers_t*": 1, "modifiers": 1, "console_read_t": 1, "capabilities": 1, "VALUE": 13, "rb_cRDiscount": 4, "rb_rdiscount_to_html": 2, "*argv": 5, "*res": 2, "szres": 8, "text": 22, "rb_funcall": 14, "rb_intern": 15, "buf": 95, "rb_str_buf_new": 2, "Check_Type": 2, "T_STRING": 2, "rb_rdiscount__get_flags": 3, "MMIOT": 2, "*doc": 2, "mkd_string": 2, "RSTRING_PTR": 2, "RSTRING_LEN": 2, "mkd_compile": 2, "doc": 6, "mkd_document": 1, "res": 4, "EOF": 26, "rb_str_cat": 4, "mkd_cleanup": 2, "rb_respond_to": 1, "rb_rdiscount_toc_content": 2, "mkd_toc": 1, "ruby_obj": 11, "MKD_TABSTOP": 1, "MKD_NOHEADER": 1, "Qtrue": 10, "MKD_NOPANTS": 1, "MKD_NOHTML": 1, "MKD_TOC": 1, "MKD_NOIMAGE": 1, "MKD_NOLINKS": 1, "MKD_NOTABLES": 1, "MKD_STRICT": 1, "MKD_AUTOLINK": 1, "MKD_SAFELINK": 1, "MKD_NO_EXT": 1, "Init_rdiscount": 1, "rb_define_class": 1, "rb_cObject": 1, "rb_define_method": 2, "save_commit_buffer": 3, "*commit_type": 2, "commit": 53, "*check_commit": 1, "*obj": 9, "quiet": 5, "obj": 46, "OBJ_COMMIT": 5, "sha1_to_hex": 8, "sha1": 20, "typename": 2, "*lookup_commit_reference_gently": 2, "deref_tag": 1, "parse_object": 1, "check_commit": 2, "*lookup_commit_reference": 2, "lookup_commit_reference_gently": 1, "*lookup_commit_or_die": 2, "*ref_name": 2, "lookup_commit_reference": 2, "die": 4, "_": 2, "ref_name": 2, "hashcmp": 2, "object.sha1": 8, "warning": 1, "*lookup_commit": 2, "lookup_object": 2, "create_object": 2, "alloc_commit_node": 1, "*lookup_commit_reference_by_name": 2, "*name": 9, "*commit": 9, "get_sha1": 1, "parse_commit": 3, "parse_commit_date": 2, "*tail": 2, "*dateptr": 1, "tail": 12, "memcmp": 7, "dateptr": 2, "strtoul": 1, "commit_graft": 13, "**commit_graft": 1, "commit_graft_alloc": 4, "commit_graft_nr": 5, "commit_graft_pos": 2, "lo": 6, "hi": 5, "mi": 5, "*graft": 3, "cmp": 6, "graft": 10, "register_commit_graft": 2, "ignore_dups": 2, "pos": 7, "alloc_nr": 1, "xrealloc": 2, "parse_commit_buffer": 3, "*bufptr": 1, "commit_list": 31, "**pptr": 1, "item": 176, "object.parsed": 4, "bufptr": 12, "get_sha1_hex": 2, "tree": 2, "lookup_tree": 1, "pptr": 5, "parents": 3, "lookup_commit_graft": 1, "*new_parent": 2, "nr_parent": 3, "grafts_replace_parents": 1, "new_parent": 6, "lookup_commit": 2, "commit_list_insert": 2, "date": 4, "object_type": 1, "ret": 124, "read_sha1_file": 1, "find_commit_subject": 2, "*commit_buffer": 2, "**subject": 2, "*eol": 1, "*p": 3, "commit_buffer": 1, "b_date": 3, "b": 19, "a_date": 2, "*commit_list_get_next": 1, "*a": 3, "commit_list_set_next": 1, "*next": 7, "commit_list_sort_by_date": 2, "**list": 5, "*list": 5, "llist_mergesort": 1, "peel_to_type": 1, "util": 2, "merge_remote_desc": 3, "*desc": 1, "desc": 1, "xmalloc": 1, "BOOTSTRAP_H": 2, "*true": 1, "*false": 1, "*eof": 1, "*empty_list": 1, "*global_enviroment": 1, "obj_type": 1, "scm_bool": 1, "scm_empty_list": 1, "scm_eof": 1, "scm_char": 1, "scm_int": 1, "scm_pair": 1, "scm_symbol": 1, "scm_prim_fun": 1, "scm_lambda": 1, "scm_str": 1, "scm_file": 1, "*eval_proc": 1, "*maybe_add_begin": 1, "*code": 2, "init_enviroment": 1, "*env": 4, "eval_err": 1, "*msg": 8, "noreturn": 1, "define_var": 1, "*var": 4, "*val": 6, "set_var": 1, "*get_var": 1, "*cond2nested_if": 1, "*cond": 1, "*let2lambda": 1, "*let": 1, "*and2nested_if": 1, "*and": 1, "*or2nested_if": 1, "*or": 1, "": 4, "strncasecmp": 2, "_strnicmp": 1, "REF_TABLE_SIZE": 1, "BUFFER_BLOCK": 5, "BUFFER_SPAN": 9, "MKD_LI_END": 1, "gperf_case_strncmp": 1, "GPERF_DOWNCASE": 1, "GPERF_CASE_STRNCMP": 1, "link_ref": 2, "*link": 2, "*title": 1, "sd_markdown": 6, "tag": 1, "tag_len": 3, "is_empty": 4, "htmlblock_end": 3, "*curtag": 2, "*rndr": 4, "start_of_line": 2, "tag_size": 3, "strlen": 21, "curtag": 8, "end_tag": 4, "block_lines": 3, "htmlblock_end_tag": 1, "rndr": 25, "parse_htmlblock": 1, "*ob": 3, "do_render": 4, "tag_end": 7, "work": 4, "find_block_tag": 1, "work.size": 5, "cb.blockhtml": 6, "ob": 14, "opaque": 8, "strcmp": 16, "parse_table_row": 1, "columns": 4, "*col_data": 1, "header_flag": 3, "col": 28, "*row_work": 1, "cb.table_cell": 3, "cb.table_row": 2, "row_work": 4, "rndr_newbuf": 2, "cell_start": 5, "cell_end": 6, "*cell_work": 1, "cell_work": 3, "_isspace": 3, "parse_inline": 1, "col_data": 2, "rndr_popbuf": 2, "empty_cell": 2, "parse_table_header": 1, "*columns": 2, "**column_data": 1, "header_end": 7, "under_end": 1, "*column_data": 1, "calloc": 5, "beg": 10, "doc_size": 6, "document": 9, "UTF8_BOM": 1, "is_ref": 1, "md": 18, "refs": 2, "expand_tabs": 1, "bufputc": 2, "bufgrow": 1, "MARKDOWN_GROW": 1, "cb.doc_header": 2, "parse_block": 1, "cb.doc_footer": 2, "bufrelease": 3, "free_link_refs": 1, "work_bufs": 8, ".size": 2, "sd_markdown_free": 1, "*md": 1, ".asize": 2, ".item": 2, "stack_free": 2, "sd_version": 1, "*ver_major": 2, "*ver_minor": 2, "*ver_revision": 2, "SUNDOWN_VER_MAJOR": 1, "SUNDOWN_VER_MINOR": 1, "SUNDOWN_VER_REVISION": 1, "set_vgabasemem": 2, "ULONG": 1, "vgabase": 3, "SELECTOR": 1, "tmp": 25, "asm": 5, "mov": 1, "ds": 1, "dpmi_get_sel_base": 1, "vgabasemem": 3, "drw_chdis": 4, "change": 2, "display": 2, "regs.b.ah": 1, "seet": 1, "theh": 1, "moode": 1, "regs.b.al": 1, "it": 26, "like": 2, "innit": 1, "regs.h.flags": 1, "Set": 2, "dingoes": 1, "kidneys": 1, "FLAGS": 1, "eh": 1, "regs.h.ss": 1, "Like": 1, "totally": 1, "set": 1, "segment": 1, "regs.h.sp": 1, "tha": 1, "pointaaaaahhhhh": 1, "dpmi_simulate_real_interrupt": 1, "regs": 2, "drw_pix": 2, "COLORS": 12, "*VGAPIX": 6, "drw_line": 6, "x0": 10, "y0": 10, "x1": 10, "y1": 9, "stp": 3, "abs": 3, "dx": 4, "dy": 3, "yi": 5, "excrement": 1, "drw_rectl": 2, "drw_rectf": 2, "drw_circl": 1, "rad": 2, "mang": 3, "max": 5, "angle": 1, "haha": 1, "px": 4, "py": 4, "Yeah": 1, "yeah": 1, "I": 1, "*rad": 2, "causes": 1, "some": 1, "really": 1, "cools": 1, "effects": 1, "D": 1, "drw_tex": 2, "tex": 3, "i*w": 1, "j*w": 1, "2D_init": 2, "2D_exit": 2, "syscalldef": 1, "syscalldefs": 1, "SYSCALL_OR_NUM": 3, "SYS_restart_syscall": 1, "MAKE_UINT16": 3, "SYS_exit": 1, "SYS_fork": 1, "ASM_H": 2, "": 1, "enable": 1, "disable": 1, "inb": 2, "val": 10, "volatile": 2, "outb": 2, "MULTIBOOT_KERNELMAGIC": 1, "MULTIBOOT_FLAG_MEM": 1, "MULTIBOOT_FLAG_DEVICE": 1, "MULTIBOOT_FLAG_CMDLINE": 1, "MULTIBOOT_FLAG_MODS": 1, "MULTIBOOT_FLAG_AOUT": 1, "MULTIBOOT_FLAG_ELF": 1, "MULTIBOOT_FLAG_MMAP": 1, "MULTIBOOT_FLAG_CONFIG": 1, "MULTIBOOT_FLAG_LOADER": 1, "MULTIBOOT_FLAG_APM": 1, "MULTIBOOT_FLAG_VBE": 1, "tabSize": 1, "strSize": 1, "addr": 3, "reserved": 2, "packed": 8, "multiboot_aoutSymbolTable_t": 2, "shndx": 1, "multiboot_memoryMap_t": 1, "start": 11, "cmdLine": 2, "multiboot_module_t": 1, "memLower": 1, "memUpper": 1, "bootDevice": 1, "modsCount": 1, "multiboot_module_t*": 1, "modsAddr": 1, "union": 1, "aoutSym": 1, "elfSec": 1, "mmapLength": 1, "mmapAddr": 1, "drivesLength": 1, "drivesAddr": 1, "configTable": 1, "bootLoaderName": 1, "apmTable": 1, "vbeControlInfo": 1, "vbeModeInfo": 1, "vbeMode": 1, "vbeInterfaceSeg": 1, "vbeInterfaceOff": 1, "vbeInterfaceLen": 1, "multiboot_info_t": 1, "multiboot_info_t*": 1, "multiboot_info": 1, "arch_multiboot_printInfo": 1, "": 1, "ELF_TYPE_NONE": 1, "ELF_TYPE_REL": 1, "ELF_TYPE_EXEC": 1, "ELF_TYPE_DYN": 1, "ELF_TYPE_CORE": 1, "ELF_ARCH_NONE": 1, "ELF_ARCH_386": 1, "ELF_VERSION_CURRENT": 1, "magic": 1, "pad": 1, "elf_ident_t": 2, "offset": 4, "virtaddr": 1, "physaddr": 1, "filesize": 1, "memsize": 1, "alignment": 1, "elf_program_t": 1, "ident": 1, "machine": 1, "phoff": 1, "shoff": 1, "ehsize": 1, "phentsize": 1, "phnum": 1, "shentsize": 1, "shnum": 1, "shstrndx": 1, "elf_t": 1, "elf_load": 1, "elf_t*": 1, "bin": 1, "elf_load_file": 1, "VFS_SEEK_SET": 1, "VFS_SEEK_CUR": 1, "VFS_SEEK_END": 1, "mount_path": 2, "mountpoint": 2, "vfs_file_t": 1, "vfs_dir_t": 1, "SHEBANG#!tcc": 1, "_XOPEN_SOURCE": 1, "": 5, "": 2, "": 2, "": 1, "ADDRESS_SPACE_LIMIT": 1, "": 3, "ATTRIBUTE_PRINTF": 3, "N_ELEMENTS": 1, "*strdup_printf": 1, "*format": 7, "strdup_vprintf": 3, "va_list": 7, "ap": 15, "aq": 4, "va_copy": 1, "vsnprintf": 3, "va_end": 6, "strdup": 1, "strdup_printf": 3, "va_start": 5, "*result": 1, "*s": 9, "///": 23, "Buffer": 1, "alloc": 10, "Number": 3, "memory_failure": 10, "Memory": 5, "allocation": 4, "failed": 3, "BUFFER_INITIALIZER": 1, "buffer_append": 11, "realloc": 2, "true": 83, "memcpy": 36, "buffer_append_c": 7, "item_type": 3, "ITEM_STRING": 20, "ITEM_WORD": 7, "ITEM_INTEGER": 44, "ITEM_FLOAT": 40, "ITEM_LIST": 19, "ITEM_HEADER": 6, "item_string": 20, "Length": 1, "sans": 1, "The": 6, "null": 5, "terminated": 2, "get_string": 2, "It": 1, "looks": 1, "but": 1, "doesn": 1, "item_word": 4, "get_word": 1, "item_integer": 6, "integer": 1, "get_integer": 41, "item_float": 4, "double": 23, "floating": 1, "point": 1, "get_float": 37, "item_list": 11, "list": 14, "get_list": 12, "set_list": 1, "head_": 2, "item_free_list": 8, "item_type_to_str": 17, "abort": 3, "*new_clone_list": 1, "item_free": 31, "new_clone": 3, "*x": 4, "*clone": 2, "new_clone_list": 2, "*out": 1, "new_string": 5, "new_word": 1, "new_integer": 19, "new_float": 21, "new_list": 2, "PARSE_ERROR_TABLE": 2, "INVALID_HEXA_ESCAPE": 1, "INVALID_ESCAPE": 1, "MEMORY": 1, "FLOAT_RANGE": 1, "INTEGER_RANGE": 1, "INVALID_INPUT": 1, "UNEXPECTED_INPUT": 1, "tokenizer_error": 2, "PARSE_ERROR_": 1, "##": 1, "PARSE_ERROR_COUNT": 1, "tokenizer": 3, "*cursor": 1, "decode_hexa_escape": 1, "tolower": 3, "parse_list": 1, "parse_item_list": 1, "cursor": 1, "PARSE_ERROR_EOF": 1, "fn": 13, "chain": 1, "handler_fn": 1, "handler": 4, "Internal": 1, "or": 1, "*script": 4, "Alternatively": 1, "runtime": 1, "*g_functions": 1, "Maps": 1, "words": 1, "functions": 1, "context_init": 1, "context": 10, "*ctx": 19, "stack_size": 2, "reduction_count": 2, "reduction_limit": 2, "error_is_fatal": 2, "user_data": 1, "context_free": 1, "set_error": 18, "bump_reductions": 2, "execute": 4, "call_function": 1, "*iter": 3, "iter": 13, "g_functions": 2, "found": 21, "script": 13, "*tmp": 2, "free_function": 1, "*fn": 1, "unregister_function": 1, "**iter": 1, "success": 14, "defn": 20, "fn_dup": 1, "check_stack": 18, "fn_drop": 1, "fn_swap": 1, "*second": 1, "*first": 2, "second": 1, "first": 5, "fn_call": 1, "check_type": 8, "fn_dip": 1, "fn_unit": 1, "fn_cons": 1, "fn_cat": 1, "*scnd": 1, "*frst": 1, "frst": 4, "scnd": 4, "**tail": 1, "fn_uncons": 1, "fail": 6, "to_boolean": 1, "*ok": 1, "*get_string": 1, "op1": 105, "*repeat": 1, "op2": 106, "repeat": 4, "allocation_fail": 6, "fn_times": 1, "*op2": 11, "*op1": 11, "ok": 64, "push_repeated_string": 2, "fn_pow": 1, "powl": 4, "fn_div": 1, "fn_mod": 1, "%": 4, "fmodl": 3, "push_concatenated_string": 2, "*s1": 2, "*s2": 2, "fn_plus": 1, "fn_minus": 1, "compare_strings": 4, "compare_lists": 4, "compare_list_items": 2, "fn_eq": 1, "fn_lt": 1, "fn_rand": 1, "rand": 1, "RAND_MAX": 1, "fn_time": 1, "time": 11, "fn_strftime": 1, "*time_": 1, "time_": 4, "time_t": 5, "time__": 2, "tm": 4, "gmtime_r": 1, "strftime": 2, "item_list_to_str": 3, "string_to_str": 2, "*string": 1, "isprint": 1, "snprintf": 3, "item_to_str": 3, "*word": 1, "word": 2, "alloc_failure": 3, "message": 3, "*prefix": 3, "Message": 1, "prefix": 6, "*command": 1, "IRC": 1, "*params": 3, "Command": 1, "parameters": 2, "n_params": 1, "present": 1, "cut_word": 1, "**s": 1, "*start": 1, "*end": 1, "strcspn": 1, "": 1, "": 2, "console_info_t": 2, "info": 65, "console_filter_t*": 2, "input_filter": 1, "output_filter": 1, "console_driver_t*": 2, "input_driver": 1, "output_driver": 1, "console_t": 1, "console_t*": 5, "default_console": 1, "console_init": 1, "console_write": 2, "console": 6, "console_write2": 1, "console_read": 1, "console_scroll": 1, "pages": 1, "console_clear": 1, "READLINE_READLINE_CATS": 3, "": 1, "rl_library_version": 1, "rl_readline_version": 1, "atscntrb_readline_readline": 1, "readline": 1, "ifndef": 1, "_PQIV_H_INCLUDED": 2, "": 1, "": 1, "": 1, "PQIV_VERSION": 2, "FILE_FLAGS_ANIMATION": 1, "guint": 5, "FILE_FLAGS_MEMORY_IMAGE": 1, "file_type_handler_struct_t": 1, "file_type_handler_t": 2, "*file_type": 1, "file_flags": 1, "gchar": 2, "*display_name": 1, "*file_name": 1, "GBytes": 1, "*file_data": 1, "GFileMonitor": 1, "*file_monitor": 1, "gboolean": 1, "is_loaded": 1, "width": 4, "height": 4, "*private": 1, "file_t": 1, "PARAMETER": 1, "RECURSION": 1, "INOTIFY": 1, "BROWSE_ORIGINAL_PARAMETER": 1, "FILTER_OUTPUT": 1, "load_images_state_t": 1, "BOSNode": 1, "_NME_WMAN_H": 2, "NTS": 1, "NWMan_event": 1, "NSTRUCT": 1, "NWMan": 1, "namespace": 2, "v8": 1, "internal": 1, "RUNTIME_FUNCTION": 6, "Runtime_CompileLazy": 1, "HandleScope": 6, "scope": 6, "isolate": 28, "DCHECK_EQ": 4, "args.length": 6, "CONVERT_ARG_HANDLE_CHECKED": 4, "JSFunction": 4, "DEBUG": 1, "FLAG_trace_lazy": 1, "shared": 2, "is_compiled": 5, "PrintF": 2, "PrintName": 1, "StackLimitCheck": 4, "check.JsHasOverflowed": 4, "KB": 4, "StackOverflow": 4, "Compiler": 7, "Compile": 1, "KEEP_EXCEPTION": 1, "heap": 6, "exception": 4, "DCHECK": 10, "Runtime_CompileBaseline": 1, "CompileBaseline": 1, "CompileOptimized": 2, "CONCURRENT": 1, "NOT_CONCURRENT": 1, "Runtime_NotifyStubFailure": 1, "Deoptimizer*": 2, "deoptimizer": 8, "Deoptimizer": 4, "Grab": 2, "AllowHeapAllocation": 2, "IsAllowed": 2, "delete": 2, "undefined_value": 2, "class": 1, "ActivationsFinder": 3, "public": 2, "ThreadVisitor": 1, "Code*": 2, "code_": 3, "has_code_activations_": 3, "explicit": 1, "VisitThread": 1, "Isolate*": 1, "ThreadLocalTop*": 1, "JavaScriptFrameIterator": 3, "VisitFrames": 2, "JavaScriptFrameIterator*": 1, "done": 2, "Advance": 1, "JavaScriptFrame*": 2, "frame": 3, "contains": 1, "pc": 1, "Runtime_NotifyDeoptimized": 1, "CONVERT_SMI_ARG_CHECKED": 1, "type_arg": 2, "BailoutType": 2, "static_cast": 1, "": 1, "TimerEventScope": 1, "": 1, "timer": 1, "TRACE_EVENT0": 1, "Handle": 2, "": 1, "": 1, "optimized_code": 2, "compiled_code": 1, "kind": 2, "Code": 1, "OPTIMIZED_FUNCTION": 1, "bailout_type": 1, "MaterializeHeapObjects": 1, "top_it": 1, "top_frame": 2, "top_it.frame": 1, "set_context": 1, "Context": 1, "cast": 2, "LAZY": 1, "activations_finder": 1, "PQC_ENCRYPT_H": 2, "": 1, "": 1, "ntru_encrypt_poly": 1, "fmpz_poly_t": 6, "msg_tern": 1, "pub_key": 2, "rnd": 2, "ntru_params": 2, "ntru_encrypt_string": 1, "ARRAY_H": 2, "initial_length": 2, "__array_alloc": 1, "aforeach": 1, "alength": 9, "afree": 1, "apush": 1, "**": 7, "*array": 6, "apop": 1, "aremove": 2, "memmove": 3, "ainsert": 1, "acontains": 1, "__array_search": 2, "__arrayallocated": 1, "*elem": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 2, "": 1, "": 1, "sharedObjectsStruct": 1, "R_Zero": 2, "R_PosInf": 2, "R_NegInf": 2, "R_Nan": 2, "redisServer": 1, "redisCommand": 6, "*commandTable": 1, "redisCommandTable": 5, "getCommand": 1, "setCommand": 1, "noPreloadGetKeys": 6, "setnxCommand": 1, "setexCommand": 1, "psetexCommand": 1, "appendCommand": 1, "strlenCommand": 1, "delCommand": 1, "existsCommand": 1, "setbitCommand": 1, "getbitCommand": 1, "setrangeCommand": 1, "getrangeCommand": 2, "incrCommand": 1, "decrCommand": 1, "mgetCommand": 1, "rpushCommand": 1, "lpushCommand": 1, "rpushxCommand": 1, "lpushxCommand": 1, "linsertCommand": 1, "rpopCommand": 1, "lpopCommand": 1, "brpopCommand": 1, "brpoplpushCommand": 1, "blpopCommand": 1, "llenCommand": 1, "lindexCommand": 1, "lsetCommand": 1, "lrangeCommand": 1, "ltrimCommand": 1, "lremCommand": 1, "rpoplpushCommand": 1, "saddCommand": 1, "sremCommand": 1, "smoveCommand": 1, "sismemberCommand": 1, "scardCommand": 1, "spopCommand": 1, "srandmemberCommand": 1, "sinterCommand": 2, "sinterstoreCommand": 1, "sunionCommand": 1, "sunionstoreCommand": 1, "sdiffCommand": 1, "sdiffstoreCommand": 1, "zaddCommand": 1, "zincrbyCommand": 1, "zremCommand": 1, "zremrangebyscoreCommand": 1, "zremrangebyrankCommand": 1, "zunionstoreCommand": 1, "zunionInterGetKeys": 4, "zinterstoreCommand": 1, "zrangeCommand": 1, "zrangebyscoreCommand": 1, "zrevrangebyscoreCommand": 1, "zcountCommand": 1, "zrevrangeCommand": 1, "zcardCommand": 1, "zscoreCommand": 1, "zrankCommand": 1, "zrevrankCommand": 1, "hsetCommand": 1, "hsetnxCommand": 1, "hgetCommand": 1, "hmsetCommand": 1, "hmgetCommand": 1, "hincrbyCommand": 1, "hincrbyfloatCommand": 1, "hdelCommand": 1, "hlenCommand": 1, "hkeysCommand": 1, "hvalsCommand": 1, "hgetallCommand": 1, "hexistsCommand": 1, "incrbyCommand": 1, "decrbyCommand": 1, "incrbyfloatCommand": 1, "getsetCommand": 1, "msetCommand": 1, "msetnxCommand": 1, "randomkeyCommand": 1, "selectCommand": 1, "moveCommand": 1, "renameCommand": 1, "renameGetKeys": 2, "renamenxCommand": 1, "expireCommand": 1, "expireatCommand": 1, "pexpireCommand": 1, "pexpireatCommand": 1, "keysCommand": 1, "dbsizeCommand": 1, "authCommand": 3, "pingCommand": 2, "echoCommand": 2, "saveCommand": 1, "bgsaveCommand": 1, "bgrewriteaofCommand": 1, "shutdownCommand": 2, "lastsaveCommand": 1, "typeCommand": 1, "multiCommand": 2, "execCommand": 2, "discardCommand": 2, "syncCommand": 1, "flushdbCommand": 1, "flushallCommand": 1, "sortCommand": 1, "infoCommand": 4, "monitorCommand": 2, "ttlCommand": 1, "pttlCommand": 1, "persistCommand": 1, "slaveofCommand": 2, "debugCommand": 1, "configCommand": 1, "subscribeCommand": 2, "unsubscribeCommand": 2, "psubscribeCommand": 2, "punsubscribeCommand": 2, "publishCommand": 1, "watchCommand": 2, "unwatchCommand": 1, "clusterCommand": 1, "restoreCommand": 1, "migrateCommand": 1, "askingCommand": 1, "dumpCommand": 1, "objectCommand": 1, "clientCommand": 1, "evalCommand": 1, "evalShaCommand": 1, "slowlogCommand": 1, "scriptCommand": 2, "timeCommand": 2, "bitopCommand": 1, "bitcountCommand": 1, "redisLogRaw": 3, "level": 11, "syslogLevelMap": 2, "LOG_DEBUG": 1, "LOG_INFO": 1, "LOG_NOTICE": 1, "LOG_WARNING": 1, "FILE": 3, "*fp": 3, "rawmode": 2, "REDIS_LOG_RAW": 2, "server.verbosity": 4, "fp": 13, "server.logfile": 8, "stdout": 5, "fopen": 3, "fprintf": 16, "msg": 10, "timeval": 4, "tv": 8, "gettimeofday": 4, "localtime": 1, "tv.tv_sec": 4, "tv.tv_usec/1000": 1, "getpid": 7, "fflush": 2, "fclose": 5, "server.syslog_enabled": 3, "syslog": 1, "redisLog": 33, "*fmt": 2, "REDIS_MAX_LOGMSG_LEN": 1, "fmt": 4, "redisLogFromHandler": 2, "server.daemonize": 5, "O_APPEND": 2, "O_CREAT": 2, "O_WRONLY": 2, "STDOUT_FILENO": 2, "ll2string": 3, "oom": 3, "REDIS_WARNING": 19, "sleep": 1, "ustime": 7, "ust": 7, "*1000000": 1, "tv.tv_usec": 3, "mstime": 5, "/1000": 1, "exitFromChild": 1, "retcode": 3, "COVERAGE_TEST": 1, "exit": 18, "dictVanillaFree": 1, "*privdata": 8, "DICT_NOTUSED": 6, "privdata": 8, "zfree": 2, "dictListDestructor": 2, "listRelease": 1, "list*": 1, "dictSdsKeyCompare": 6, "*key1": 4, "*key2": 4, "l1": 4, "l2": 3, "sdslen": 14, "sds": 13, "key1": 5, "key2": 5, "dictSdsKeyCaseCompare": 2, "strcasecmp": 13, "dictRedisObjectDestructor": 7, "decrRefCount": 6, "dictSdsDestructor": 4, "sdsfree": 2, "dictObjKeyCompare": 2, "robj": 7, "*o1": 2, "*o2": 2, "o1": 7, "ptr": 18, "o2": 7, "dictObjHash": 2, "*key": 5, "*o": 7, "key": 9, "dictGenHashFunction": 5, "o": 75, "dictSdsHash": 4, "dictSdsCaseHash": 2, "dictGenCaseHashFunction": 1, "dictEncObjKeyCompare": 4, "robj*": 3, "REDIS_ENCODING_INT": 4, "getDecodedObject": 3, "dictEncObjHash": 4, "REDIS_ENCODING_RAW": 1, "hash": 3, "dictType": 8, "setDictType": 1, "zsetDictType": 1, "dbDictType": 2, "keyptrDictType": 2, "commandTableDictType": 2, "hashDictType": 1, "keylistDictType": 4, "clusterNodesDictType": 1, "htNeedsResize": 3, "dict": 11, "*dict": 3, "dictSlots": 3, "dictSize": 10, "DICT_HT_INITIAL_SIZE": 2, "used*100/size": 1, "REDIS_HT_MINFILL": 1, "tryResizeHashTables": 2, "server.dbnum": 8, "server.db": 23, ".dict": 9, "dictResize": 2, ".expires": 8, "incrementallyRehash": 2, "dictIsRehashing": 2, "dictRehashMilliseconds": 2, "updateDictResizePolicy": 2, "server.rdb_child_pid": 12, "server.aof_child_pid": 10, "dictEnableResize": 1, "dictDisableResize": 1, "activeExpireCycle": 2, "timelimit": 5, "expired": 4, "redisDb": 3, "*db": 2, "db": 8, "expires": 3, "slots": 2, "now": 5, "num*100/slots": 1, "REDIS_EXPIRELOOKUPS_PER_CRON": 2, "dictEntry": 2, "*de": 2, "t": 10, "de": 12, "dictGetRandomKey": 4, "dictGetSignedIntegerVal": 1, "dictGetKey": 4, "*keyobj": 2, "createStringObject": 11, "propagateExpire": 2, "keyobj": 6, "dbDelete": 2, "server.stat_expiredkeys": 3, "REDIS_EXPIRELOOKUPS_PER_CRON/4": 1, "updateLRUClock": 3, "server.lruclock": 2, "REDIS_LRU_CLOCK_MAX": 1, "trackOperationsPerSecond": 2, "server.ops_sec_last_sample_time": 3, "ops": 1, "server.stat_numcommands": 4, "server.ops_sec_last_sample_ops": 3, "ops_sec": 3, "ops*1000/t": 1, "server.ops_sec_samples": 4, "server.ops_sec_idx": 4, "REDIS_OPS_SEC_SAMPLES": 3, "getOperationsPerSecond": 2, "sum": 3, "clientsCronHandleTimeout": 2, "redisClient": 12, "server.unixtime": 10, "server.maxidletime": 3, "REDIS_SLAVE": 3, "REDIS_MASTER": 2, "REDIS_BLOCKED": 2, "pubsub_channels": 2, "listLength": 14, "pubsub_patterns": 2, "lastinteraction": 3, "REDIS_VERBOSE": 3, "freeClient": 1, "bpop.timeout": 2, "addReply": 13, "shared.nullmultibulk": 2, "unblockClientWaitingData": 1, "clientsCronResizeQueryBuffer": 2, "querybuf_size": 3, "sdsAllocSize": 1, "querybuf": 6, "idletime": 2, "REDIS_MBULK_BIG_ARG": 1, "querybuf_size/": 1, "querybuf_peak": 2, "sdsavail": 1, "sdsRemoveFreeSpace": 1, "clientsCron": 2, "numclients": 3, "server.clients": 7, "iterations": 4, "numclients/": 1, "REDIS_HZ*10": 1, "listNode": 4, "listRotate": 1, "listFirst": 2, "listNodeValue": 3, "run_with_period": 6, "_ms_": 2, "loops": 2, "1000/REDIS_HZ": 2, "serverCron": 2, "aeEventLoop": 2, "*eventLoop": 2, "*clientData": 1, "server.cronloops": 3, "REDIS_NOTUSED": 5, "eventLoop": 2, "clientData": 1, "server.watchdog_period": 3, "watchdogScheduleSignal": 1, "zmalloc_used_memory": 8, "server.stat_peak_memory": 5, "server.shutdown_asap": 3, "prepareForShutdown": 2, "REDIS_OK": 23, "vkeys": 8, "server.activerehashing": 2, "server.slaves": 9, "server.aof_rewrite_scheduled": 4, "rewriteAppendOnlyFileBackground": 2, "statloc": 5, "wait3": 1, "WNOHANG": 1, "exitcode": 3, "bysignal": 4, "backgroundSaveDoneHandler": 1, "backgroundRewriteDoneHandler": 1, "server.saveparamslen": 3, "saveparam": 1, "*sp": 1, "server.saveparams": 2, "server.dirty": 3, "sp": 4, "changes": 2, "server.lastsave": 3, "seconds": 2, "REDIS_NOTICE": 13, "rdbSaveBackground": 1, "server.rdb_filename": 4, "server.aof_rewrite_perc": 3, "server.aof_current_size": 2, "server.aof_rewrite_min_size": 2, "server.aof_rewrite_base_size": 4, "growth": 3, "server.aof_current_size*100/base": 1, "server.aof_flush_postponed_start": 2, "flushAppendOnlyFile": 2, "server.masterhost": 7, "freeClientsInAsyncFreeQueue": 1, "replicationCron": 1, "server.cluster_enabled": 6, "clusterCron": 1, "beforeSleep": 2, "*ln": 3, "server.unblocked_clients": 4, "ln": 8, "redisAssert": 1, "listDelNode": 1, "REDIS_UNBLOCKED": 1, "server.current_client": 3, "processInputBuffer": 1, "createSharedObjects": 2, "shared.crlf": 2, "createObject": 31, "REDIS_STRING": 31, "sdsnew": 27, "shared.ok": 3, "shared.err": 1, "shared.emptybulk": 1, "shared.czero": 1, "shared.cone": 1, "shared.cnegone": 1, "shared.nullbulk": 1, "shared.emptymultibulk": 1, "shared.pong": 2, "shared.queued": 2, "shared.wrongtypeerr": 1, "shared.nokeyerr": 1, "shared.syntaxerr": 2, "shared.sameobjecterr": 1, "shared.outofrangeerr": 1, "shared.noscripterr": 1, "shared.loadingerr": 2, "shared.slowscripterr": 2, "shared.masterdownerr": 2, "shared.bgsaveerr": 2, "shared.roslaveerr": 2, "shared.oomerr": 2, "shared.space": 1, "shared.colon": 1, "shared.plus": 1, "REDIS_SHARED_SELECT_CMDS": 1, "shared.select": 1, "sdscatprintf": 24, "sdsempty": 8, "shared.messagebulk": 1, "shared.pmessagebulk": 1, "shared.subscribebulk": 1, "shared.unsubscribebulk": 1, "shared.psubscribebulk": 1, "shared.punsubscribebulk": 1, "shared.del": 1, "shared.rpop": 1, "shared.lpop": 1, "REDIS_SHARED_INTEGERS": 1, "shared.integers": 2, "REDIS_SHARED_BULKHDR_LEN": 1, "shared.mbulkhdr": 1, "shared.bulkhdr": 1, "initServerConfig": 2, "getRandomHexChars": 1, "server.runid": 3, "REDIS_RUN_ID_SIZE": 2, "server.arch_bits": 3, "server.port": 7, "REDIS_SERVERPORT": 1, "server.bindaddr": 2, "server.unixsocket": 7, "server.unixsocketperm": 2, "server.ipfd": 9, "server.sofd": 9, "REDIS_DEFAULT_DBNUM": 1, "REDIS_MAXIDLETIME": 1, "server.client_max_querybuf_len": 1, "REDIS_MAX_QUERYBUF_LEN": 1, "server.loading": 4, "server.syslog_ident": 2, "zstrdup": 5, "server.syslog_facility": 2, "LOG_LOCAL0": 1, "server.aof_state": 7, "REDIS_AOF_OFF": 5, "server.aof_fsync": 1, "AOF_FSYNC_EVERYSEC": 1, "server.aof_no_fsync_on_rewrite": 1, "REDIS_AOF_REWRITE_PERC": 1, "REDIS_AOF_REWRITE_MIN_SIZE": 1, "server.aof_last_fsync": 1, "server.aof_rewrite_time_last": 2, "server.aof_rewrite_time_start": 2, "server.aof_delayed_fsync": 2, "server.aof_fd": 4, "server.aof_selected_db": 1, "server.pidfile": 3, "server.aof_filename": 3, "server.requirepass": 4, "server.rdb_compression": 1, "server.rdb_checksum": 1, "server.maxclients": 6, "REDIS_MAX_CLIENTS": 1, "server.bpop_blocked_clients": 2, "server.maxmemory": 6, "server.maxmemory_policy": 11, "REDIS_MAXMEMORY_VOLATILE_LRU": 3, "server.maxmemory_samples": 3, "server.hash_max_ziplist_entries": 1, "REDIS_HASH_MAX_ZIPLIST_ENTRIES": 1, "server.hash_max_ziplist_value": 1, "REDIS_HASH_MAX_ZIPLIST_VALUE": 1, "server.list_max_ziplist_entries": 1, "REDIS_LIST_MAX_ZIPLIST_ENTRIES": 1, "server.list_max_ziplist_value": 1, "REDIS_LIST_MAX_ZIPLIST_VALUE": 1, "server.set_max_intset_entries": 1, "REDIS_SET_MAX_INTSET_ENTRIES": 1, "server.zset_max_ziplist_entries": 1, "REDIS_ZSET_MAX_ZIPLIST_ENTRIES": 1, "server.zset_max_ziplist_value": 1, "REDIS_ZSET_MAX_ZIPLIST_VALUE": 1, "server.repl_ping_slave_period": 1, "REDIS_REPL_PING_SLAVE_PERIOD": 1, "server.repl_timeout": 1, "REDIS_REPL_TIMEOUT": 1, "server.cluster.configfile": 1, "server.lua_caller": 1, "server.lua_time_limit": 1, "REDIS_LUA_TIME_LIMIT": 1, "server.lua_client": 1, "server.lua_timedout": 2, "resetServerSaveParams": 2, "appendServerSaveParams": 3, "60*60": 1, "server.masterauth": 1, "server.masterport": 2, "server.master": 3, "server.repl_state": 6, "REDIS_REPL_NONE": 1, "server.repl_syncio_timeout": 1, "REDIS_REPL_SYNCIO_TIMEOUT": 1, "server.repl_serve_stale_data": 2, "server.repl_slave_ro": 2, "server.repl_down_since": 2, "server.client_obuf_limits": 9, "REDIS_CLIENT_LIMIT_CLASS_NORMAL": 3, ".hard_limit_bytes": 3, ".soft_limit_bytes": 3, ".soft_limit_seconds": 3, "REDIS_CLIENT_LIMIT_CLASS_SLAVE": 3, "1024*1024*256": 1, "1024*1024*64": 1, "REDIS_CLIENT_LIMIT_CLASS_PUBSUB": 3, "1024*1024*32": 1, "1024*1024*8": 1, "1.0/R_Zero": 2, "R_Zero/R_Zero": 1, "server.commands": 1, "dictCreate": 6, "populateCommandTable": 2, "server.delCommand": 1, "lookupCommandByCString": 3, "server.multiCommand": 1, "server.lpushCommand": 1, "server.slowlog_log_slower_than": 1, "REDIS_SLOWLOG_LOG_SLOWER_THAN": 1, "server.slowlog_max_len": 1, "REDIS_SLOWLOG_MAX_LEN": 1, "server.assert_failed": 1, "server.assert_file": 1, "server.assert_line": 1, "server.bug_report_start": 1, "adjustOpenFilesLimit": 2, "rlim_t": 3, "maxfiles": 6, "rlimit": 1, "limit": 3, "getrlimit": 1, "RLIMIT_NOFILE": 2, "strerror": 3, "oldlimit": 5, "limit.rlim_cur": 2, "limit.rlim_max": 1, "setrlimit": 1, "initServer": 2, "signal": 2, "SIGHUP": 1, "SIG_IGN": 2, "SIGPIPE": 1, "setupSignalHandlers": 2, "openlog": 1, "LOG_PID": 1, "LOG_NDELAY": 1, "LOG_NOWAIT": 1, "listCreate": 6, "server.clients_to_close": 1, "server.monitors": 2, "server.el": 7, "aeCreateEventLoop": 1, "zmalloc": 2, "*server.dbnum": 1, "anetTcpServer": 1, "server.neterr": 4, "ANET_ERR": 2, "unlink": 3, "anetUnixServer": 1, ".blocking_keys": 1, ".watched_keys": 1, ".id": 1, "server.pubsub_channels": 2, "server.pubsub_patterns": 4, "listSetFreeMethod": 1, "freePubsubPattern": 1, "listSetMatchMethod": 1, "listMatchPubsubPattern": 1, "aofRewriteBufferReset": 1, "server.aof_buf": 3, "server.rdb_save_time_last": 2, "server.rdb_save_time_start": 2, "server.stat_numconnections": 2, "server.stat_evictedkeys": 3, "server.stat_starttime": 2, "server.stat_keyspace_misses": 2, "server.stat_keyspace_hits": 2, "server.stat_fork_time": 2, "server.stat_rejected_conn": 2, "memset": 1, "server.lastbgsave_status": 3, "server.stop_writes_on_bgsave_err": 2, "aeCreateTimeEvent": 1, "aeCreateFileEvent": 2, "AE_READABLE": 2, "acceptTcpHandler": 1, "AE_ERR": 2, "acceptUnixHandler": 1, "REDIS_AOF_ON": 2, "3584LL*": 1, "1024*1024": 3, "REDIS_MAXMEMORY_NO_EVICTION": 2, "clusterInit": 1, "scriptingInit": 1, "slowlogInit": 1, "bioInit": 1, "numcommands": 5, "/sizeof": 2, "*f": 2, "sflags": 1, "retval": 3, "cmd": 34, "arity": 3, "addReplyErrorFormat": 1, "authenticated": 3, "proc": 14, "addReplyError": 6, "getkeys_proc": 1, "firstkey": 1, "hashslot": 3, "server.cluster.state": 1, "REDIS_CLUSTER_OK": 1, "ask": 3, "clusterNode": 1, "*n": 1, "getNodeByQuery": 1, "server.cluster.myself": 1, "addReplySds": 3, "ip": 4, "freeMemoryIfNeeded": 2, "REDIS_CMD_DENYOOM": 1, "REDIS_ERR": 5, "REDIS_CMD_WRITE": 2, "REDIS_REPL_CONNECTED": 3, "REDIS_MULTI": 1, "queueMultiCommand": 1, "call": 1, "REDIS_CALL_FULL": 1, "save": 2, "REDIS_SHUTDOWN_SAVE": 1, "nosave": 2, "REDIS_SHUTDOWN_NOSAVE": 1, "SIGKILL": 2, "rdbRemoveTempFile": 1, "aof_fsync": 1, "rdbSave": 1, "addReplyBulk": 1, "addReplyMultiBulkLen": 1, "addReplyBulkLongLong": 2, "bytesToHuman": 3, "d": 11, "sprintf": 10, "n/": 3, "1024LL*1024*1024": 2, "1024LL*1024*1024*1024": 1, "genRedisInfoString": 2, "*section": 2, "uptime": 2, "rusage": 1, "self_ru": 2, "c_ru": 2, "lol": 3, "bib": 3, "allsections": 12, "defsections": 11, "sections": 11, "section": 15, "getrusage": 2, "RUSAGE_SELF": 1, "RUSAGE_CHILDREN": 1, "getClientsMaxBuffers": 1, "utsname": 1, "sdscat": 14, "uname": 1, "REDIS_VERSION": 4, "redisGitSHA1": 3, "strtol": 3, "redisGitDirty": 3, "name.sysname": 1, "name.release": 1, "name.machine": 1, "aeGetApiName": 1, "__GNUC_MINOR__": 2, "__GNUC_PATCHLEVEL__": 1, "uptime/": 1, "3600*24": 1, "hmem": 3, "peak_hmem": 3, "zmalloc_get_rss": 1, "lua_gc": 1, "server.lua": 1, "LUA_GCCOUNT": 1, "*1024LL": 1, "zmalloc_get_fragmentation_ratio": 1, "ZMALLOC_LIB": 2, "aofRewriteBufferSize": 2, "bioPendingJobsOfType": 1, "REDIS_BIO_AOF_FSYNC": 1, "perc": 3, "eta": 4, "elapsed": 3, "off_t": 1, "remaining_bytes": 1, "server.loading_total_bytes": 3, "server.loading_loaded_bytes": 3, "server.loading_start_time": 2, "elapsed*remaining_bytes": 1, "/server.loading_loaded_bytes": 1, "REDIS_REPL_TRANSFER": 2, "server.repl_transfer_left": 1, "server.repl_transfer_lastio": 1, "slaveid": 3, "listIter": 2, "li": 6, "listRewind": 2, "listNext": 2, "*slave": 2, "anetPeerToString": 1, "slave": 3, "replstate": 1, "REDIS_REPL_WAIT_BGSAVE_START": 1, "REDIS_REPL_WAIT_BGSAVE_END": 1, "REDIS_REPL_SEND_BULK": 1, "REDIS_REPL_ONLINE": 1, "self_ru.ru_stime.tv_sec": 1, "self_ru.ru_stime.tv_usec/1000000": 1, "self_ru.ru_utime.tv_sec": 1, "self_ru.ru_utime.tv_usec/1000000": 1, "c_ru.ru_stime.tv_sec": 1, "c_ru.ru_stime.tv_usec/1000000": 1, "c_ru.ru_utime.tv_sec": 1, "c_ru.ru_utime.tv_usec/1000000": 1, "calls": 4, "microseconds": 1, "microseconds/c": 1, "keys": 4, "REDIS_MONITOR": 1, "slaveseldb": 1, "listAddNodeTail": 1, "mem_used": 9, "mem_tofree": 3, "mem_freed": 4, "slaves": 3, "obuf_bytes": 3, "getClientOutputBufferMemoryUsage": 1, "k": 15, "keys_freed": 3, "bestval": 5, "bestkey": 9, "REDIS_MAXMEMORY_ALLKEYS_LRU": 2, "REDIS_MAXMEMORY_ALLKEYS_RANDOM": 2, "REDIS_MAXMEMORY_VOLATILE_RANDOM": 1, "thiskey": 7, "thisval": 8, "dictFind": 1, "dictGetVal": 2, "estimateObjectIdleTime": 1, "REDIS_MAXMEMORY_VOLATILE_TTL": 1, "delta": 4, "flushSlavesOutputBuffers": 1, "linuxOvercommitMemoryValue": 2, "fgets": 1, "atoi": 3, "linuxOvercommitMemoryWarning": 2, "createPidFile": 2, "daemonize": 2, "STDIN_FILENO": 1, "STDERR_FILENO": 2, "usage": 2, "stderr": 13, "redisAsciiArt": 2, "1024*16": 2, "ascii_logo": 1, "sigtermHandler": 2, "sig": 2, "sigaction": 6, "act": 6, "sigemptyset": 2, "act.sa_mask": 2, "act.sa_flags": 2, "act.sa_handler": 1, "SIGTERM": 1, "HAVE_BACKTRACE": 1, "SA_NODEFER": 1, "SA_RESETHAND": 1, "SA_SIGINFO": 1, "act.sa_sigaction": 1, "sigsegvHandler": 1, "SIGSEGV": 1, "SIGBUS": 1, "SIGFPE": 1, "SIGILL": 1, "memtest": 2, "megabytes": 1, "passes": 1, "**argv": 5, "zmalloc_enable_thread_safeness": 1, "srand": 1, "dictSetHashFunctionSeed": 1, "*configfile": 1, "configfile": 2, "sdscatrepr": 1, "loadServerConfig": 1, "loadAppendOnlyFile": 1, "/1000000": 2, "rdbLoad": 1, "ENOENT": 2, "aeSetBeforeSleepProc": 1, "aeMain": 1, "aeDeleteEventLoop": 1, "HELLO_H": 2, "hello": 1, "yajl_status_to_string": 1, "yajl_status": 4, "stat": 3, "statStr": 6, "yajl_status_ok": 1, "yajl_status_client_canceled": 1, "yajl_status_insufficient_data": 1, "yajl_status_error": 1, "yajl_handle": 10, "yajl_alloc": 1, "yajl_callbacks": 1, "callbacks": 3, "yajl_parser_config": 1, "config": 4, "yajl_alloc_funcs": 3, "afs": 8, "allowComments": 4, "validateUTF8": 3, "hand": 28, "afsBuffer": 3, "yajl_set_default_alloc_funcs": 1, "YA_MALLOC": 1, "yajl_handle_t": 1, "checkUTF8": 1, "lexer": 4, "yajl_lex_alloc": 1, "bytesConsumed": 2, "decodeBuf": 2, "yajl_buf_alloc": 1, "yajl_bs_init": 1, "stateStack": 3, "yajl_bs_push": 1, "yajl_state_start": 1, "yajl_reset_parser": 1, "yajl_lex_realloc": 1, "yajl_free": 1, "yajl_bs_free": 1, "yajl_buf_free": 1, "yajl_lex_free": 1, "YA_FREE": 2, "yajl_parse": 2, "jsonText": 4, "jsonTextLen": 4, "yajl_do_parse": 1, "yajl_parse_complete": 1, "yajl_get_error": 1, "verbose": 2, "yajl_render_error_string": 1, "yajl_get_bytes_consumed": 1, "yajl_free_error": 1, "": 1, "": 2, "": 2, "rfUTF8_IsContinuationbyte": 1, "e.t.c.": 1, "bytesN": 98, "bIndex": 5, "RF_NEWLINE_CRLF": 1, "newLineFound": 1, "*bufferSize": 1, "RF_OPTION_FGETS_READBYTESN": 5, "RF_MALLOC": 47, "tempBuff": 6, "RF_SUCCESS": 13, "RE_FILE_EOF": 22, "*eofReached": 14, "LOG_ERROR": 64, "RF_HEXEQ_UI": 7, "else//": 14, "undo": 5, "peek": 5, "ahead": 5, "file": 7, "pointer": 5, "fseek": 19, "SEEK_CUR": 19, "eofReached": 4, "RF_HEXEQ_C": 9, "fgetc": 9, "ferror": 2, "RE_FILE_READ": 2, "*ret": 20, "c2": 13, "c3": 9, "c4": 5, "i_READ_CHECK": 20, "cc": 24, "more": 2, "RE_UTF8_INVALID_SEQUENCE_END": 6, "RE_UTF8_INVALID_SEQUENCE_CONBYTE": 6, "decoded": 3, "codepoint": 47, "decode": 6, "RF_HEXGE_C": 1, "//invalid": 1, "byte": 6, "//if": 1, "needing": 1, "than": 5, "swapE": 21, "v1": 38, "v2": 26, "rfUTILS_Endianess": 24, "RF_LITTLE_ENDIAN": 23, "fread": 12, "swap": 8, "needed": 10, "rfUTILS_SwapEndianUS": 10, "RF_HEXGE_US": 4, "RF_HEXLE_US": 4, "RF_HEXL_US": 8, "RF_HEXG_US": 8, "RE_UTF16_INVALID_SEQUENCE": 20, "RE_UTF16_NO_SURRPAIR": 2, "user": 2, "wants": 2, "surrogate": 4, "pair": 4, "existence": 2, "RF_BIG_ENDIAN": 10, "rfUTILS_SwapEndianUI": 11, "i_FSEEK_CHECK": 14, "depending": 1, "backwards": 1, "RE_UTF8_INVALID_SEQUENCE": 2, "__wglew_h__": 2, "__WGLEW_H__": 1, "__wglext_h_": 2, "wglext.h": 1, "wglew.h": 1, "WINAPI": 119, "": 1, "GLEW_STATIC": 1, "WGL_3DFX_multisample": 2, "WGL_SAMPLE_BUFFERS_3DFX": 1, "WGL_SAMPLES_3DFX": 1, "WGLEW_3DFX_multisample": 1, "WGLEW_GET_VAR": 49, "__WGLEW_3DFX_multisample": 2, "WGL_3DL_stereo_control": 2, "WGL_STEREO_EMITTER_ENABLE_3DL": 1, "WGL_STEREO_EMITTER_DISABLE_3DL": 1, "WGL_STEREO_POLARITY_NORMAL_3DL": 1, "WGL_STEREO_POLARITY_INVERT_3DL": 1, "BOOL": 84, "HDC": 65, "hDC": 33, "UINT": 30, "uState": 1, "wglSetStereoEmitterState3DL": 1, "WGLEW_GET_FUN": 120, "__wglewSetStereoEmitterState3DL": 2, "WGLEW_3DL_stereo_control": 1, "__WGLEW_3DL_stereo_control": 2, "WGL_AMD_gpu_association": 2, "WGL_GPU_VENDOR_AMD": 1, "WGL_GPU_RENDERER_STRING_AMD": 1, "WGL_GPU_FASTEST_TARGET_GPUS_AMD": 1, "WGL_GPU_RAM_AMD": 1, "WGL_GPU_CLOCK_AMD": 1, "WGL_GPU_NUM_PIPES_AMD": 1, "WGL_GPU_NUM_SIMD_AMD": 1, "WGL_GPU_NUM_RB_AMD": 1, "WGL_GPU_NUM_SPI_AMD": 1, "VOID": 6, "HGLRC": 14, "dstCtx": 1, "GLint": 18, "srcX0": 1, "srcY0": 1, "srcX1": 1, "srcY1": 1, "dstX0": 1, "dstY0": 1, "dstX1": 1, "dstY1": 1, "GLbitfield": 1, "mask": 1, "GLenum": 8, "filter": 1, "hShareContext": 2, "attribList": 2, "hglrc": 5, "PFNWGLGETCONTEXTGPUIDAMDPROC": 2, "PFNWGLGETGPUIDSAMDPROC": 2, "maxCount": 1, "UINT*": 6, "ids": 1, "INT": 3, "PFNWGLGETGPUINFOAMDPROC": 2, "property": 1, "dataType": 1, "wglBlitContextFramebufferAMD": 1, "__wglewBlitContextFramebufferAMD": 2, "wglCreateAssociatedContextAMD": 1, "wglDeleteAssociatedContextAMD": 1, "wglGetContextGPUIDAMD": 1, "__wglewGetContextGPUIDAMD": 2, "wglGetGPUIDsAMD": 1, "__wglewGetGPUIDsAMD": 2, "wglGetGPUInfoAMD": 1, "__wglewGetGPUInfoAMD": 2, "WGLEW_AMD_gpu_association": 1, "__WGLEW_AMD_gpu_association": 2, "WGL_ARB_buffer_region": 2, "WGL_FRONT_COLOR_BUFFER_BIT_ARB": 1, "WGL_BACK_COLOR_BUFFER_BIT_ARB": 1, "WGL_DEPTH_BUFFER_BIT_ARB": 1, "WGL_STENCIL_BUFFER_BIT_ARB": 1, "HANDLE": 14, "PFNWGLCREATEBUFFERREGIONARBPROC": 2, "iLayerPlane": 5, "uType": 1, "PFNWGLDELETEBUFFERREGIONARBPROC": 2, "hRegion": 3, "PFNWGLRESTOREBUFFERREGIONARBPROC": 2, "xSrc": 1, "ySrc": 1, "PFNWGLSAVEBUFFERREGIONARBPROC": 2, "wglCreateBufferRegionARB": 1, "__wglewCreateBufferRegionARB": 2, "wglDeleteBufferRegionARB": 1, "__wglewDeleteBufferRegionARB": 2, "wglRestoreBufferRegionARB": 1, "__wglewRestoreBufferRegionARB": 2, "wglSaveBufferRegionARB": 1, "__wglewSaveBufferRegionARB": 2, "WGLEW_ARB_buffer_region": 1, "__WGLEW_ARB_buffer_region": 2, "WGL_ARB_create_context": 2, "WGL_CONTEXT_DEBUG_BIT_ARB": 1, "WGL_CONTEXT_MAJOR_VERSION_ARB": 1, "WGL_CONTEXT_MINOR_VERSION_ARB": 1, "WGL_CONTEXT_LAYER_PLANE_ARB": 1, "WGL_CONTEXT_FLAGS_ARB": 1, "ERROR_INVALID_VERSION_ARB": 1, "ERROR_INVALID_PROFILE_ARB": 1, "wglCreateContextAttribsARB": 1, "__wglewCreateContextAttribsARB": 2, "WGLEW_ARB_create_context": 1, "__WGLEW_ARB_create_context": 2, "WGL_ARB_create_context_profile": 2, "WGL_CONTEXT_CORE_PROFILE_BIT_ARB": 1, "WGL_CONTEXT_PROFILE_MASK_ARB": 1, "WGLEW_ARB_create_context_profile": 1, "WGL_LOSE_CONTEXT_ON_RESET_ARB": 1, "WGL_NO_RESET_NOTIFICATION_ARB": 1, "WGL_ARB_extensions_string": 2, "PFNWGLGETEXTENSIONSSTRINGARBPROC": 2, "hdc": 16, "wglGetExtensionsStringARB": 1, "__wglewGetExtensionsStringARB": 2, "WGLEW_ARB_extensions_string": 1, "__WGLEW_ARB_extensions_string": 2, "WGL_ARB_framebuffer_sRGB": 2, "WGL_FRAMEBUFFER_SRGB_CAPABLE_ARB": 1, "WGLEW_ARB_framebuffer_sRGB": 1, "__WGLEW_ARB_framebuffer_sRGB": 2, "WGL_ARB_make_current_read": 2, "ERROR_INVALID_PIXEL_TYPE_ARB": 1, "PFNWGLGETCURRENTREADDCARBPROC": 2, "PFNWGLMAKECONTEXTCURRENTARBPROC": 2, "hDrawDC": 2, "hReadDC": 2, "wglGetCurrentReadDCARB": 1, "__wglewGetCurrentReadDCARB": 2, "wglMakeContextCurrentARB": 1, "__wglewMakeContextCurrentARB": 2, "WGLEW_ARB_make_current_read": 1, "__WGLEW_ARB_make_current_read": 2, "WGL_ARB_multisample": 2, "WGL_SAMPLE_BUFFERS_ARB": 1, "WGL_SAMPLES_ARB": 1, "WGLEW_ARB_multisample": 1, "__WGLEW_ARB_multisample": 2, "WGL_ARB_pbuffer": 2, "WGL_DRAW_TO_PBUFFER_ARB": 1, "WGL_MAX_PBUFFER_PIXELS_ARB": 1, "WGL_MAX_PBUFFER_WIDTH_ARB": 1, "WGL_MAX_PBUFFER_HEIGHT_ARB": 1, "WGL_PBUFFER_LARGEST_ARB": 1, "WGL_PBUFFER_WIDTH_ARB": 1, "WGL_PBUFFER_HEIGHT_ARB": 1, "WGL_PBUFFER_LOST_ARB": 1, "DECLARE_HANDLE": 6, "HPBUFFERARB": 12, "PFNWGLCREATEPBUFFERARBPROC": 2, "iPixelFormat": 6, "iWidth": 2, "iHeight": 2, "piAttribList": 4, "PFNWGLDESTROYPBUFFERARBPROC": 2, "hPbuffer": 14, "PFNWGLGETPBUFFERDCARBPROC": 2, "PFNWGLQUERYPBUFFERARBPROC": 2, "iAttribute": 8, "piValue": 8, "PFNWGLRELEASEPBUFFERDCARBPROC": 2, "wglCreatePbufferARB": 1, "__wglewCreatePbufferARB": 2, "wglDestroyPbufferARB": 1, "__wglewDestroyPbufferARB": 2, "wglGetPbufferDCARB": 1, "__wglewGetPbufferDCARB": 2, "wglQueryPbufferARB": 1, "__wglewQueryPbufferARB": 2, "wglReleasePbufferDCARB": 1, "__wglewReleasePbufferDCARB": 2, "WGLEW_ARB_pbuffer": 1, "__WGLEW_ARB_pbuffer": 2, "WGL_ARB_pixel_format": 2, "WGL_NUMBER_PIXEL_FORMATS_ARB": 1, "WGL_DRAW_TO_WINDOW_ARB": 1, "WGL_DRAW_TO_BITMAP_ARB": 1, "WGL_ACCELERATION_ARB": 1, "WGL_NEED_PALETTE_ARB": 1, "WGL_NEED_SYSTEM_PALETTE_ARB": 1, "WGL_SWAP_LAYER_BUFFERS_ARB": 1, "WGL_SWAP_METHOD_ARB": 1, "WGL_NUMBER_OVERLAYS_ARB": 1, "WGL_NUMBER_UNDERLAYS_ARB": 1, "WGL_TRANSPARENT_ARB": 1, "WGL_SHARE_DEPTH_ARB": 1, "WGL_SHARE_STENCIL_ARB": 1, "WGL_SHARE_ACCUM_ARB": 1, "WGL_SUPPORT_GDI_ARB": 1, "WGL_SUPPORT_OPENGL_ARB": 1, "WGL_DOUBLE_BUFFER_ARB": 1, "WGL_STEREO_ARB": 1, "WGL_PIXEL_TYPE_ARB": 1, "WGL_COLOR_BITS_ARB": 1, "WGL_RED_BITS_ARB": 1, "WGL_RED_SHIFT_ARB": 1, "WGL_GREEN_BITS_ARB": 1, "WGL_GREEN_SHIFT_ARB": 1, "WGL_BLUE_BITS_ARB": 1, "WGL_BLUE_SHIFT_ARB": 1, "WGL_ALPHA_BITS_ARB": 1, "WGL_ALPHA_SHIFT_ARB": 1, "WGL_ACCUM_BITS_ARB": 1, "WGL_ACCUM_RED_BITS_ARB": 1, "WGL_ACCUM_GREEN_BITS_ARB": 1, "WGL_ACCUM_BLUE_BITS_ARB": 1, "WGL_ACCUM_ALPHA_BITS_ARB": 1, "WGL_DEPTH_BITS_ARB": 1, "WGL_STENCIL_BITS_ARB": 1, "WGL_AUX_BUFFERS_ARB": 1, "WGL_NO_ACCELERATION_ARB": 1, "WGL_GENERIC_ACCELERATION_ARB": 1, "WGL_FULL_ACCELERATION_ARB": 1, "WGL_SWAP_EXCHANGE_ARB": 1, "WGL_SWAP_COPY_ARB": 1, "WGL_SWAP_UNDEFINED_ARB": 1, "WGL_TYPE_RGBA_ARB": 1, "WGL_TYPE_COLORINDEX_ARB": 1, "WGL_TRANSPARENT_RED_VALUE_ARB": 1, "WGL_TRANSPARENT_GREEN_VALUE_ARB": 1, "WGL_TRANSPARENT_BLUE_VALUE_ARB": 1, "WGL_TRANSPARENT_ALPHA_VALUE_ARB": 1, "WGL_TRANSPARENT_INDEX_VALUE_ARB": 1, "PFNWGLCHOOSEPIXELFORMATARBPROC": 2, "piAttribIList": 2, "FLOAT": 4, "*pfAttribFList": 2, "nMaxFormats": 2, "*piFormats": 2, "*nNumFormats": 2, "nAttributes": 4, "piAttributes": 4, "*pfValues": 2, "*piValues": 2, "wglChoosePixelFormatARB": 1, "__wglewChoosePixelFormatARB": 2, "wglGetPixelFormatAttribfvARB": 1, "__wglewGetPixelFormatAttribfvARB": 2, "wglGetPixelFormatAttribivARB": 1, "__wglewGetPixelFormatAttribivARB": 2, "WGLEW_ARB_pixel_format": 1, "__WGLEW_ARB_pixel_format": 2, "WGL_ARB_pixel_format_float": 2, "WGL_TYPE_RGBA_FLOAT_ARB": 1, "WGLEW_ARB_pixel_format_float": 1, "__WGLEW_ARB_pixel_format_float": 2, "WGL_ARB_render_texture": 2, "WGL_BIND_TO_TEXTURE_RGB_ARB": 1, "WGL_BIND_TO_TEXTURE_RGBA_ARB": 1, "WGL_TEXTURE_FORMAT_ARB": 1, "WGL_TEXTURE_TARGET_ARB": 1, "WGL_MIPMAP_TEXTURE_ARB": 1, "WGL_TEXTURE_RGB_ARB": 1, "WGL_TEXTURE_RGBA_ARB": 1, "WGL_NO_TEXTURE_ARB": 2, "WGL_TEXTURE_CUBE_MAP_ARB": 1, "WGL_TEXTURE_1D_ARB": 1, "WGL_TEXTURE_2D_ARB": 1, "WGL_MIPMAP_LEVEL_ARB": 1, "WGL_CUBE_MAP_FACE_ARB": 1, "WGL_FRONT_LEFT_ARB": 1, "WGL_FRONT_RIGHT_ARB": 1, "WGL_BACK_LEFT_ARB": 1, "WGL_BACK_RIGHT_ARB": 1, "WGL_AUX0_ARB": 1, "WGL_AUX1_ARB": 1, "WGL_AUX2_ARB": 1, "WGL_AUX3_ARB": 1, "WGL_AUX4_ARB": 1, "WGL_AUX5_ARB": 1, "WGL_AUX6_ARB": 1, "WGL_AUX7_ARB": 1, "WGL_AUX8_ARB": 1, "WGL_AUX9_ARB": 1, "PFNWGLBINDTEXIMAGEARBPROC": 2, "iBuffer": 2, "PFNWGLRELEASETEXIMAGEARBPROC": 2, "PFNWGLSETPBUFFERATTRIBARBPROC": 2, "wglBindTexImageARB": 1, "__wglewBindTexImageARB": 2, "wglReleaseTexImageARB": 1, "__wglewReleaseTexImageARB": 2, "wglSetPbufferAttribARB": 1, "__wglewSetPbufferAttribARB": 2, "WGLEW_ARB_render_texture": 1, "__WGLEW_ARB_render_texture": 2, "WGL_ATI_pixel_format_float": 2, "WGL_TYPE_RGBA_FLOAT_ATI": 1, "GL_RGBA_FLOAT_MODE_ATI": 1, "WGLEW_ATI_pixel_format_float": 1, "__WGLEW_ATI_pixel_format_float": 2, "WGL_ATI_render_texture_rectangle": 2, "WGL_TEXTURE_RECTANGLE_ATI": 1, "WGL_CONTEXT_ES2_PROFILE_BIT_EXT": 1, "WGL_EXT_depth_float": 2, "WGL_DEPTH_FLOAT_EXT": 1, "WGLEW_EXT_depth_float": 1, "__WGLEW_EXT_depth_float": 2, "WGL_EXT_display_color_table": 2, "GLboolean": 53, "GLushort": 3, "GLushort*": 1, "table": 1, "GLuint": 9, "wglBindDisplayColorTableEXT": 1, "__wglewBindDisplayColorTableEXT": 2, "wglCreateDisplayColorTableEXT": 1, "wglDestroyDisplayColorTableEXT": 1, "wglLoadDisplayColorTableEXT": 1, "__wglewLoadDisplayColorTableEXT": 2, "WGLEW_EXT_display_color_table": 1, "__WGLEW_EXT_display_color_table": 2, "WGL_EXT_extensions_string": 2, "PFNWGLGETEXTENSIONSSTRINGEXTPROC": 2, "wglGetExtensionsStringEXT": 1, "__wglewGetExtensionsStringEXT": 2, "WGLEW_EXT_extensions_string": 1, "__WGLEW_EXT_extensions_string": 2, "WGL_EXT_framebuffer_sRGB": 2, "WGL_FRAMEBUFFER_SRGB_CAPABLE_EXT": 1, "WGLEW_EXT_framebuffer_sRGB": 1, "__WGLEW_EXT_framebuffer_sRGB": 2, "WGL_EXT_make_current_read": 2, "ERROR_INVALID_PIXEL_TYPE_EXT": 1, "PFNWGLGETCURRENTREADDCEXTPROC": 2, "PFNWGLMAKECONTEXTCURRENTEXTPROC": 2, "wglGetCurrentReadDCEXT": 1, "__wglewGetCurrentReadDCEXT": 2, "wglMakeContextCurrentEXT": 1, "__wglewMakeContextCurrentEXT": 2, "WGLEW_EXT_make_current_read": 1, "__WGLEW_EXT_make_current_read": 2, "WGL_EXT_multisample": 2, "WGL_SAMPLE_BUFFERS_EXT": 1, "WGL_SAMPLES_EXT": 1, "WGLEW_EXT_multisample": 1, "__WGLEW_EXT_multisample": 2, "WGL_EXT_pbuffer": 2, "WGL_DRAW_TO_PBUFFER_EXT": 1, "WGL_MAX_PBUFFER_PIXELS_EXT": 1, "WGL_MAX_PBUFFER_WIDTH_EXT": 1, "WGL_MAX_PBUFFER_HEIGHT_EXT": 1, "WGL_OPTIMAL_PBUFFER_WIDTH_EXT": 1, "WGL_OPTIMAL_PBUFFER_HEIGHT_EXT": 1, "WGL_PBUFFER_LARGEST_EXT": 1, "WGL_PBUFFER_WIDTH_EXT": 1, "WGL_PBUFFER_HEIGHT_EXT": 1, "HPBUFFEREXT": 6, "PFNWGLCREATEPBUFFEREXTPROC": 2, "PFNWGLDESTROYPBUFFEREXTPROC": 2, "PFNWGLGETPBUFFERDCEXTPROC": 2, "PFNWGLQUERYPBUFFEREXTPROC": 2, "PFNWGLRELEASEPBUFFERDCEXTPROC": 2, "wglCreatePbufferEXT": 1, "__wglewCreatePbufferEXT": 2, "wglDestroyPbufferEXT": 1, "__wglewDestroyPbufferEXT": 2, "wglGetPbufferDCEXT": 1, "__wglewGetPbufferDCEXT": 2, "wglQueryPbufferEXT": 1, "__wglewQueryPbufferEXT": 2, "wglReleasePbufferDCEXT": 1, "__wglewReleasePbufferDCEXT": 2, "WGLEW_EXT_pbuffer": 1, "__WGLEW_EXT_pbuffer": 2, "WGL_EXT_pixel_format": 2, "WGL_NUMBER_PIXEL_FORMATS_EXT": 1, "WGL_DRAW_TO_WINDOW_EXT": 1, "WGL_DRAW_TO_BITMAP_EXT": 1, "WGL_ACCELERATION_EXT": 1, "WGL_NEED_PALETTE_EXT": 1, "WGL_NEED_SYSTEM_PALETTE_EXT": 1, "WGL_SWAP_LAYER_BUFFERS_EXT": 1, "WGL_SWAP_METHOD_EXT": 1, "WGL_NUMBER_OVERLAYS_EXT": 1, "WGL_NUMBER_UNDERLAYS_EXT": 1, "WGL_TRANSPARENT_EXT": 1, "WGL_TRANSPARENT_VALUE_EXT": 1, "WGL_SHARE_DEPTH_EXT": 1, "WGL_SHARE_STENCIL_EXT": 1, "WGL_SHARE_ACCUM_EXT": 1, "WGL_SUPPORT_GDI_EXT": 1, "WGL_SUPPORT_OPENGL_EXT": 1, "WGL_DOUBLE_BUFFER_EXT": 1, "WGL_STEREO_EXT": 1, "WGL_PIXEL_TYPE_EXT": 1, "WGL_COLOR_BITS_EXT": 1, "WGL_RED_BITS_EXT": 1, "WGL_RED_SHIFT_EXT": 1, "WGL_GREEN_BITS_EXT": 1, "WGL_GREEN_SHIFT_EXT": 1, "WGL_BLUE_BITS_EXT": 1, "WGL_BLUE_SHIFT_EXT": 1, "WGL_ALPHA_BITS_EXT": 1, "WGL_ALPHA_SHIFT_EXT": 1, "WGL_ACCUM_BITS_EXT": 1, "WGL_ACCUM_RED_BITS_EXT": 1, "WGL_ACCUM_GREEN_BITS_EXT": 1, "WGL_ACCUM_BLUE_BITS_EXT": 1, "WGL_ACCUM_ALPHA_BITS_EXT": 1, "WGL_DEPTH_BITS_EXT": 1, "WGL_STENCIL_BITS_EXT": 1, "WGL_AUX_BUFFERS_EXT": 1, "WGL_NO_ACCELERATION_EXT": 1, "WGL_GENERIC_ACCELERATION_EXT": 1, "WGL_FULL_ACCELERATION_EXT": 1, "WGL_SWAP_EXCHANGE_EXT": 1, "WGL_SWAP_COPY_EXT": 1, "WGL_SWAP_UNDEFINED_EXT": 1, "WGL_TYPE_RGBA_EXT": 1, "WGL_TYPE_COLORINDEX_EXT": 1, "PFNWGLCHOOSEPIXELFORMATEXTPROC": 2, "wglChoosePixelFormatEXT": 1, "__wglewChoosePixelFormatEXT": 2, "wglGetPixelFormatAttribfvEXT": 1, "__wglewGetPixelFormatAttribfvEXT": 2, "wglGetPixelFormatAttribivEXT": 1, "__wglewGetPixelFormatAttribivEXT": 2, "WGLEW_EXT_pixel_format": 1, "__WGLEW_EXT_pixel_format": 2, "WGL_TYPE_RGBA_UNSIGNED_FLOAT_EXT": 1, "WGL_EXT_swap_control": 2, "PFNWGLGETSWAPINTERVALEXTPROC": 2, "PFNWGLSWAPINTERVALEXTPROC": 2, "interval": 1, "wglGetSwapIntervalEXT": 1, "__wglewGetSwapIntervalEXT": 2, "wglSwapIntervalEXT": 1, "__wglewSwapIntervalEXT": 2, "WGLEW_EXT_swap_control": 1, "__WGLEW_EXT_swap_control": 2, "WGL_I3D_digital_video_control": 2, "wglGetDigitalVideoParametersI3D": 1, "wglSetDigitalVideoParametersI3D": 1, "WGLEW_I3D_digital_video_control": 1, "WGL_I3D_gamma": 2, "WGL_GAMMA_TABLE_SIZE_I3D": 1, "WGL_GAMMA_EXCLUDE_DESKTOP_I3D": 1, "PFNWGLGETGAMMATABLEI3DPROC": 2, "iEntries": 2, "USHORT*": 2, "puRed": 2, "USHORT": 4, "*puGreen": 2, "*puBlue": 2, "PFNWGLSETGAMMATABLEI3DPROC": 2, "wglGetGammaTableI3D": 1, "__wglewGetGammaTableI3D": 2, "wglGetGammaTableParametersI3D": 1, "wglSetGammaTableI3D": 1, "__wglewSetGammaTableI3D": 2, "wglSetGammaTableParametersI3D": 1, "WGLEW_I3D_gamma": 1, "__WGLEW_I3D_gamma": 2, "WGL_I3D_genlock": 2, "WGL_GENLOCK_SOURCE_MULTIVIEW_I3D": 1, "WGL_GENLOCK_SOURCE_EDGE_BOTH_I3D": 1, "PFNWGLDISABLEGENLOCKI3DPROC": 2, "PFNWGLENABLEGENLOCKI3DPROC": 2, "PFNWGLGENLOCKSAMPLERATEI3DPROC": 2, "uRate": 2, "PFNWGLGENLOCKSOURCEDELAYI3DPROC": 2, "uDelay": 2, "PFNWGLGENLOCKSOURCEEDGEI3DPROC": 2, "uEdge": 2, "PFNWGLGENLOCKSOURCEI3DPROC": 2, "uSource": 2, "PFNWGLGETGENLOCKSOURCEI3DPROC": 2, "PFNWGLISENABLEDGENLOCKI3DPROC": 2, "BOOL*": 3, "pFlag": 3, "uMaxLineDelay": 1, "*uMaxPixelDelay": 1, "wglDisableGenlockI3D": 1, "__wglewDisableGenlockI3D": 2, "wglEnableGenlockI3D": 1, "__wglewEnableGenlockI3D": 2, "wglGenlockSampleRateI3D": 1, "__wglewGenlockSampleRateI3D": 2, "wglGenlockSourceDelayI3D": 1, "__wglewGenlockSourceDelayI3D": 2, "wglGenlockSourceEdgeI3D": 1, "__wglewGenlockSourceEdgeI3D": 2, "wglGenlockSourceI3D": 1, "__wglewGenlockSourceI3D": 2, "wglGetGenlockSampleRateI3D": 1, "__wglewGetGenlockSampleRateI3D": 2, "wglGetGenlockSourceDelayI3D": 1, "__wglewGetGenlockSourceDelayI3D": 2, "wglGetGenlockSourceEdgeI3D": 1, "__wglewGetGenlockSourceEdgeI3D": 2, "wglGetGenlockSourceI3D": 1, "__wglewGetGenlockSourceI3D": 2, "wglIsEnabledGenlockI3D": 1, "__wglewIsEnabledGenlockI3D": 2, "wglQueryGenlockMaxSourceDelayI3D": 1, "WGLEW_I3D_genlock": 1, "__WGLEW_I3D_genlock": 2, "WGL_I3D_image_buffer": 2, "WGL_IMAGE_BUFFER_MIN_ACCESS_I3D": 1, "WGL_IMAGE_BUFFER_LOCK_I3D": 1, "HANDLE*": 3, "pEvent": 1, "LPVOID": 3, "*pAddress": 1, "DWORD": 5, "*pSize": 1, "PFNWGLCREATEIMAGEBUFFERI3DPROC": 2, "dwSize": 1, "uFlags": 1, "PFNWGLDESTROYIMAGEBUFFERI3DPROC": 2, "pAddress": 2, "LPVOID*": 1, "wglAssociateImageBufferEventsI3D": 1, "wglCreateImageBufferI3D": 1, "__wglewCreateImageBufferI3D": 2, "wglDestroyImageBufferI3D": 1, "__wglewDestroyImageBufferI3D": 2, "wglReleaseImageBufferEventsI3D": 1, "WGLEW_I3D_image_buffer": 1, "__WGLEW_I3D_image_buffer": 2, "WGL_I3D_swap_frame_lock": 2, "PFNWGLDISABLEFRAMELOCKI3DPROC": 2, "PFNWGLENABLEFRAMELOCKI3DPROC": 2, "PFNWGLISENABLEDFRAMELOCKI3DPROC": 2, "wglDisableFrameLockI3D": 1, "__wglewDisableFrameLockI3D": 2, "wglEnableFrameLockI3D": 1, "__wglewEnableFrameLockI3D": 2, "wglIsEnabledFrameLockI3D": 1, "__wglewIsEnabledFrameLockI3D": 2, "wglQueryFrameLockMasterI3D": 1, "__wglewQueryFrameLockMasterI3D": 2, "WGLEW_I3D_swap_frame_lock": 1, "__WGLEW_I3D_swap_frame_lock": 2, "WGL_I3D_swap_frame_usage": 2, "PFNWGLBEGINFRAMETRACKINGI3DPROC": 2, "PFNWGLENDFRAMETRACKINGI3DPROC": 2, "PFNWGLGETFRAMEUSAGEI3DPROC": 2, "float*": 1, "pUsage": 1, "PFNWGLQUERYFRAMETRACKINGI3DPROC": 2, "DWORD*": 1, "pFrameCount": 1, "*pMissedFrames": 1, "*pLastMissedUsage": 1, "wglBeginFrameTrackingI3D": 1, "__wglewBeginFrameTrackingI3D": 2, "wglEndFrameTrackingI3D": 1, "__wglewEndFrameTrackingI3D": 2, "wglGetFrameUsageI3D": 1, "__wglewGetFrameUsageI3D": 2, "wglQueryFrameTrackingI3D": 1, "__wglewQueryFrameTrackingI3D": 2, "WGLEW_I3D_swap_frame_usage": 1, "__WGLEW_I3D_swap_frame_usage": 2, "WGL_NV_DX_interop": 2, "WGL_ACCESS_READ_ONLY_NV": 1, "WGL_ACCESS_READ_WRITE_NV": 1, "WGL_ACCESS_WRITE_DISCARD_NV": 1, "PFNWGLDXCLOSEDEVICENVPROC": 2, "hDevice": 9, "PFNWGLDXLOCKOBJECTSNVPROC": 2, "hObjects": 2, "PFNWGLDXOBJECTACCESSNVPROC": 2, "hObject": 2, "access": 2, "PFNWGLDXOPENDEVICENVPROC": 2, "dxDevice": 1, "PFNWGLDXREGISTEROBJECTNVPROC": 2, "dxObject": 2, "shareHandle": 1, "PFNWGLDXUNLOCKOBJECTSNVPROC": 2, "PFNWGLDXUNREGISTEROBJECTNVPROC": 2, "wglDXCloseDeviceNV": 1, "__wglewDXCloseDeviceNV": 2, "wglDXLockObjectsNV": 1, "__wglewDXLockObjectsNV": 2, "wglDXObjectAccessNV": 1, "__wglewDXObjectAccessNV": 2, "wglDXOpenDeviceNV": 1, "__wglewDXOpenDeviceNV": 2, "wglDXRegisterObjectNV": 1, "__wglewDXRegisterObjectNV": 2, "wglDXSetResourceShareHandleNV": 1, "wglDXUnlockObjectsNV": 1, "__wglewDXUnlockObjectsNV": 2, "wglDXUnregisterObjectNV": 1, "__wglewDXUnregisterObjectNV": 2, "WGLEW_NV_DX_interop": 1, "__WGLEW_NV_DX_interop": 2, "WGL_NV_copy_image": 2, "PFNWGLCOPYIMAGESUBDATANVPROC": 2, "hSrcRC": 1, "srcName": 1, "srcTarget": 1, "srcLevel": 1, "srcX": 1, "srcY": 1, "srcZ": 1, "hDstRC": 1, "dstName": 1, "dstTarget": 1, "dstLevel": 1, "dstX": 1, "dstY": 1, "dstZ": 1, "GLsizei": 4, "depth": 2, "wglCopyImageSubDataNV": 1, "__wglewCopyImageSubDataNV": 2, "WGLEW_NV_copy_image": 1, "__WGLEW_NV_copy_image": 2, "WGL_NV_float_buffer": 2, "WGL_FLOAT_COMPONENTS_NV": 1, "WGL_TEXTURE_FLOAT_R_NV": 1, "WGL_TEXTURE_FLOAT_RG_NV": 1, "WGL_TEXTURE_FLOAT_RGB_NV": 1, "WGL_TEXTURE_FLOAT_RGBA_NV": 1, "WGLEW_NV_float_buffer": 1, "__WGLEW_NV_float_buffer": 2, "WGL_NV_gpu_affinity": 2, "HGPUNV": 5, "_GPU_DEVICE": 1, "cb": 1, "CHAR": 2, "DeviceName": 1, "DeviceString": 1, "Flags": 1, "RECT": 1, "rcVirtualScreen": 1, "GPU_DEVICE": 1, "*PGPU_DEVICE": 1, "PFNWGLCREATEAFFINITYDCNVPROC": 2, "*phGpuList": 1, "PFNWGLDELETEDCNVPROC": 2, "PFNWGLENUMGPUDEVICESNVPROC": 2, "hGpu": 1, "iDeviceIndex": 1, "PGPU_DEVICE": 1, "lpGpuDevice": 1, "hAffinityDC": 1, "iGpuIndex": 2, "*hGpu": 1, "PFNWGLENUMGPUSNVPROC": 2, "*phGpu": 1, "wglCreateAffinityDCNV": 1, "__wglewCreateAffinityDCNV": 2, "wglDeleteDCNV": 1, "__wglewDeleteDCNV": 2, "wglEnumGpuDevicesNV": 1, "__wglewEnumGpuDevicesNV": 2, "wglEnumGpusFromAffinityDCNV": 1, "__wglewEnumGpusFromAffinityDCNV": 2, "wglEnumGpusNV": 1, "__wglewEnumGpusNV": 2, "WGLEW_NV_gpu_affinity": 1, "__WGLEW_NV_gpu_affinity": 2, "WGL_NV_multisample_coverage": 2, "WGL_COVERAGE_SAMPLES_NV": 1, "WGL_COLOR_SAMPLES_NV": 1, "WGLEW_NV_multisample_coverage": 1, "__WGLEW_NV_multisample_coverage": 2, "WGL_NV_present_video": 2, "WGL_NUM_VIDEO_SLOTS_NV": 1, "HVIDEOOUTPUTDEVICENV": 2, "PFNWGLBINDVIDEODEVICENVPROC": 2, "hDc": 6, "uVideoSlot": 2, "hVideoDevice": 4, "HVIDEOOUTPUTDEVICENV*": 1, "phDeviceList": 2, "PFNWGLQUERYCURRENTCONTEXTNVPROC": 2, "wglBindVideoDeviceNV": 1, "__wglewBindVideoDeviceNV": 2, "wglEnumerateVideoDevicesNV": 1, "__wglewEnumerateVideoDevicesNV": 2, "wglQueryCurrentContextNV": 1, "__wglewQueryCurrentContextNV": 2, "WGLEW_NV_present_video": 1, "__WGLEW_NV_present_video": 2, "WGL_NV_render_depth_texture": 2, "WGL_BIND_TO_TEXTURE_DEPTH_NV": 1, "WGL_DEPTH_TEXTURE_FORMAT_NV": 1, "WGL_TEXTURE_DEPTH_COMPONENT_NV": 1, "WGL_DEPTH_COMPONENT_NV": 1, "WGLEW_NV_render_depth_texture": 1, "__WGLEW_NV_render_depth_texture": 2, "WGL_NV_render_texture_rectangle": 2, "WGL_TEXTURE_RECTANGLE_NV": 1, "WGL_NV_swap_group": 2, "PFNWGLBINDSWAPBARRIERNVPROC": 2, "group": 3, "barrier": 1, "PFNWGLJOINSWAPGROUPNVPROC": 2, "PFNWGLQUERYFRAMECOUNTNVPROC": 2, "GLuint*": 3, "PFNWGLQUERYMAXSWAPGROUPSNVPROC": 2, "maxGroups": 1, "*maxBarriers": 1, "PFNWGLQUERYSWAPGROUPNVPROC": 2, "*barrier": 1, "PFNWGLRESETFRAMECOUNTNVPROC": 2, "wglBindSwapBarrierNV": 1, "__wglewBindSwapBarrierNV": 2, "wglJoinSwapGroupNV": 1, "__wglewJoinSwapGroupNV": 2, "wglQueryFrameCountNV": 1, "__wglewQueryFrameCountNV": 2, "wglQueryMaxSwapGroupsNV": 1, "__wglewQueryMaxSwapGroupsNV": 2, "wglQuerySwapGroupNV": 1, "__wglewQuerySwapGroupNV": 2, "wglResetFrameCountNV": 1, "__wglewResetFrameCountNV": 2, "WGLEW_NV_swap_group": 1, "__WGLEW_NV_swap_group": 2, "WGL_NV_vertex_array_range": 2, "PFNWGLALLOCATEMEMORYNVPROC": 2, "GLfloat": 3, "readFrequency": 1, "writeFrequency": 1, "priority": 1, "PFNWGLFREEMEMORYNVPROC": 2, "*pointer": 1, "wglAllocateMemoryNV": 1, "__wglewAllocateMemoryNV": 2, "wglFreeMemoryNV": 1, "__wglewFreeMemoryNV": 2, "WGLEW_NV_vertex_array_range": 1, "__WGLEW_NV_vertex_array_range": 2, "WGL_NV_video_capture": 2, "WGL_UNIQUE_ID_NV": 1, "WGL_NUM_VIDEO_CAPTURE_SLOTS_NV": 1, "HVIDEOINPUTDEVICENV": 5, "HVIDEOINPUTDEVICENV*": 1, "wglBindVideoCaptureDeviceNV": 1, "__wglewBindVideoCaptureDeviceNV": 2, "wglLockVideoCaptureDeviceNV": 1, "__wglewLockVideoCaptureDeviceNV": 2, "wglQueryVideoCaptureDeviceNV": 1, "__wglewQueryVideoCaptureDeviceNV": 2, "wglReleaseVideoCaptureDeviceNV": 1, "WGLEW_NV_video_capture": 1, "__WGLEW_NV_video_capture": 2, "WGL_NV_video_output": 2, "WGL_BIND_TO_VIDEO_RGB_NV": 1, "WGL_BIND_TO_VIDEO_RGBA_NV": 1, "WGL_VIDEO_OUT_COLOR_NV": 1, "WGL_VIDEO_OUT_ALPHA_NV": 1, "WGL_VIDEO_OUT_DEPTH_NV": 1, "WGL_VIDEO_OUT_COLOR_AND_ALPHA_NV": 1, "WGL_VIDEO_OUT_COLOR_AND_DEPTH_NV": 1, "WGL_VIDEO_OUT_FRAME": 1, "WGL_VIDEO_OUT_FIELD_1": 1, "WGL_VIDEO_OUT_FIELD_2": 1, "WGL_VIDEO_OUT_STACKED_FIELDS_1_2": 1, "WGL_VIDEO_OUT_STACKED_FIELDS_2_1": 1, "HPVIDEODEV": 4, "PFNWGLBINDVIDEOIMAGENVPROC": 2, "iVideoBuffer": 2, "PFNWGLGETVIDEODEVICENVPROC": 2, "numDevices": 1, "HPVIDEODEV*": 1, "PFNWGLGETVIDEOINFONVPROC": 2, "hpVideoDevice": 1, "long*": 2, "pulCounterOutputPbuffer": 1, "*pulCounterOutputVideo": 1, "PFNWGLRELEASEVIDEODEVICENVPROC": 2, "PFNWGLRELEASEVIDEOIMAGENVPROC": 2, "PFNWGLSENDPBUFFERTOVIDEONVPROC": 2, "iBufferType": 1, "pulCounterPbuffer": 1, "bBlock": 1, "wglBindVideoImageNV": 1, "__wglewBindVideoImageNV": 2, "wglGetVideoDeviceNV": 1, "__wglewGetVideoDeviceNV": 2, "wglGetVideoInfoNV": 1, "__wglewGetVideoInfoNV": 2, "wglReleaseVideoDeviceNV": 1, "__wglewReleaseVideoDeviceNV": 2, "wglReleaseVideoImageNV": 1, "__wglewReleaseVideoImageNV": 2, "wglSendPbufferToVideoNV": 1, "__wglewSendPbufferToVideoNV": 2, "WGLEW_NV_video_output": 1, "__WGLEW_NV_video_output": 2, "WGL_OML_sync_control": 2, "PFNWGLGETMSCRATEOMLPROC": 2, "INT32*": 1, "numerator": 1, "INT32": 1, "*denominator": 1, "PFNWGLGETSYNCVALUESOMLPROC": 2, "INT64*": 3, "INT64": 18, "*msc": 3, "*sbc": 3, "PFNWGLSWAPBUFFERSMSCOMLPROC": 2, "target_msc": 3, "divisor": 3, "remainder": 3, "PFNWGLSWAPLAYERBUFFERSMSCOMLPROC": 2, "fuPlanes": 1, "PFNWGLWAITFORMSCOMLPROC": 2, "PFNWGLWAITFORSBCOMLPROC": 2, "target_sbc": 1, "wglGetMscRateOML": 1, "__wglewGetMscRateOML": 2, "wglGetSyncValuesOML": 1, "__wglewGetSyncValuesOML": 2, "wglSwapBuffersMscOML": 1, "__wglewSwapBuffersMscOML": 2, "wglSwapLayerBuffersMscOML": 1, "__wglewSwapLayerBuffersMscOML": 2, "wglWaitForMscOML": 1, "__wglewWaitForMscOML": 2, "wglWaitForSbcOML": 1, "__wglewWaitForSbcOML": 2, "WGLEW_OML_sync_control": 1, "__WGLEW_OML_sync_control": 2, "GLEW_MX": 4, "WGLEW_EXPORT": 167, "GLEWAPI": 6, "WGLEWContextStruct": 2, "WGLEWContext": 1, "wglewContextInit": 2, "WGLEWContext*": 2, "wglewContextIsSupported": 2, "wglewInit": 1, "wglewGetContext": 4, "wglewIsSupported": 2, "wglewGetExtension": 1, "ULLONG_MAX": 1, "MIN": 1, "SET_ERRNO": 4, "e": 4, "parser": 9, "__LINE__": 8, "CALLBACK_NOTIFY_": 3, "FOR": 11, "ER": 4, "HPE_OK": 4, "settings": 4, "on_##FOR": 4, "HPE_CB_##FOR": 2, "CALLBACK_NOTIFY": 1, "CALLBACK_NOTIFY_NOADVANCE": 1, "CALLBACK_DATA_": 3, "LEN": 2, "FOR##_mark": 7, "CALLBACK_DATA": 1, "CALLBACK_DATA_NOADVANCE": 1, "MARK": 1, "PROXY_CONNECTION": 1, "CONNECTION": 1, "CONTENT_LENGTH": 1, "TRANSFER_ENCODING": 1, "UPGRADE": 1, "CHUNKED": 1, "KEEP_ALIVE": 1, "CLOSE": 1, "*method_strings": 1, "#string": 1, "unhex": 1, "OBJ_BLOB": 3, "alloc_blob_node": 1, "": 1, "READ_VSNPRINTF_ARGS": 5, "rfUTF8_VerifySequence": 7, "RF_FAILURE": 25, "RE_STRING_INIT_FAILURE": 8, "buffAllocated": 11, "RF_OPTION_SOURCE_ENCODING": 30, "characterLength": 16, "*codepoints": 2, "rfLMS_MacroEvalPtr": 2, "RF_LMS": 6, "RF_UTF16_LE": 9, "RF_UTF16_BE": 7, "codepoints": 44, "i/2": 2, "#elif": 12, "RF_UTF32_LE": 3, "RF_UTF32_BE": 5, "UTF16": 4, "rfUTF16_Decode": 5, "cleanup": 12, "rfUTF16_Decode_swap": 5, "RF_UTF16_BE//": 2, "RF_UTF32_LE//": 2, "copy": 4, "UTF32": 4, "into": 8, "": 2, "4": 6, "elif": 2, "j=": 2, "endif": 5, "UTF": 12, "8": 11, "encode": 2, "rfUTF8_Encode": 4, "0": 8, "While": 2, "attempting": 2, "create": 2, "could": 2, "not": 5, "properly": 2, "encoded": 2, "RE_UTF8_ENCODING": 2, "End": 2, "Non": 2, "code=": 2, "progress": 1, "normally": 1, "since": 3, "here": 6, "have": 1, "validity": 2, "get": 5, "Error": 2, "at": 2, "Allocation": 2, "due": 2, "invalid": 2, "rfLMS_Push": 4, "Local": 2, "Stack": 2, "Insufficient": 2, "space": 4, "Consider": 2, "compiling": 2, "bigger": 3, "Quitting": 2, "proccess": 2, "RE_LOCALMEMSTACK_INSUFFICIENT": 8, "during": 1, "RF_HEXLE_UI": 8, "RF_HEXGE_UI": 6, "RE_UTF8_INVALID_CODE_POINT": 2, "numLen": 8, "most": 3, "environment": 3, "so": 4, "chars": 3, "will": 3, "certainly": 3, "fit": 3, "strcpy": 4, "utf8ByteLength": 34, "last": 1, "utf": 1, "termination": 3, "byteLength*2": 1, "allocate": 1, "same": 1, "different": 1, "RE_INPUT": 1, "ends": 5, "codeBuffer": 9, "big": 14, "endian": 20, "little": 7, "according": 1, "standard": 1, "no": 1, "BOM": 1, "means": 2, "rfUTF32_Length": 1, "sourceP": 2, "RF_REALLOC": 9, "<5>": 1, "bytesWritten": 2, "charsN": 5, "rfUTF8_Decode": 2, "rfUTF16_Encode": 1, "RF_STRING_ITERATE_START": 9, "RF_STRING_ITERATE_END": 9, "codePoint": 18, "thisstrP": 34, "charPos": 8, "byteI": 7, "s1P": 2, "s2P": 2, "sstrP": 6, "optionsP": 10, "*optionsP": 9, "RF_BITFLAG_ON": 5, "strstr": 2, "exact": 6, "": 1, "substring": 4, "search": 1, "this": 4, "*v": 1, "strtod": 1, "srcP": 6, "bytePos": 23, "terminate": 1, "afterstrP": 2, "sscanf": 1, "sstr2": 2, "move": 12, "rfString_FindBytePos": 10, "*tokensN": 1, "lstrP": 1, "rstrP": 5, "temp": 10, "parNP": 6, "*parNP": 2, "minPos": 17, "thisPos": 8, "argList": 8, "va_arg": 2, "afterP": 2, "minPosLength": 3, "go": 8, "otherP": 4, "strncat": 1, "goes": 1, "numberP": 1, "*numberP": 1, "occurences": 5, "keepstrP": 2, "keepLength": 2, "charValue": 12, "*keepChars": 1, "exists": 4, "charBLength": 5, "keepChars": 4, "4*keepLength": 1, "": 1, "does": 1, "exist": 1, "back": 1, "cover": 1, "effectively": 1, "gets": 1, "deleted": 1, "rfUTF8_FromCodepoint": 1, "non": 1, "clean": 1, "way": 1, "internally": 1, "uses": 1, "variable": 1, "determine": 1, "backs": 1, "by": 1, "contiuing": 1, "make": 2, "sure": 2, "position": 1, "won": 1, "nBytePos": 23, "RF_STRING_ITERATEB_START": 2, "RF_STRING_ITERATEB_END": 2, "pBytePos": 15, "indexing": 1, "works": 1, "pbytePos": 2, "pth": 2, "got": 1, "all": 1, "numP": 1, "*numP": 1, "RF_StringX": 1, "just": 1, "finding": 1, "foundN": 10, "diff": 9, "bSize": 4, "bytePositions": 17, "bSize*sizeof": 1, "rfStringX_FromString_IN": 1, "temp.bIndex": 2, "temp.bytes": 1, "temp.byteLength": 1, "rfStringX_Deinit": 1, "replace": 3, "removed": 2, "one": 2, "orSize": 5, "nSize": 4, "number*diff": 1, "strncpy": 3, "smaller": 1, "diff*number": 1, "remove": 1, "equal": 1, "subP": 7, "RF_String*sub": 2, "noMatch": 8, "*subValues": 2, "subLength": 6, "subValues": 8, "4*subLength": 2, "lastBytePos": 4, "testity": 2, "res1": 2, "res2": 2, "unused": 3, "FILE*f": 2, "utf8BufferSize": 4, "char*utf8": 3, "<0>": 1, "Failure": 1, "initialize": 1, "reading": 1, "Little": 1, "Endian": 1, "32": 1, "bytesN=": 1, "sP": 2, "encodingP": 1, "*utf32": 1, "utf16": 11, "*encodingP": 1, "fwrite": 5, "logging": 5, "": 1, "2": 2, "i=": 3, "utf32": 10, "log": 1, "i_WRITE_CHECK": 1, "Writting": 1, "RE_FILE_WRITE": 1, "": 1, "cursor_x": 1, "cursor_y": 1, "rows": 1, "tabstop": 1, "default_color": 1, "current_color": 1, "nonblocking": 1, "reverse_video": 1, "bold": 1, "blink": 1, "underline": 1, "newline_mode": 1, "auto_echo": 1, "handle_backspace": 1, "numbits": 2, "bits": 1, "bitmap_t": 7, "bitmap_init": 1, "bitmap_get": 1, "bitmap": 5, "bitnum": 3, "bitmap_set": 1, "bitmap_clear": 1, "bitmap_clearAll": 1, "bitmap_findFirstClear": 1, "console_filter": 2, "console_filter*": 1, "console_filter_t": 1, "PY_SSIZE_T_CLEAN": 1, "Py_PYTHON_H": 1, "Python": 2, "headers": 1, "compile": 1, "please": 1, "install": 1, "development": 1, "Python.": 1, "PY_VERSION_HEX": 11, "Cython": 1, "requires": 1, ".": 1, "offsetof": 2, "member": 2, "type*": 1, "WIN32": 2, "MS_WINDOWS": 2, "__stdcall": 2, "__cdecl": 2, "__fastcall": 2, "DL_IMPORT": 2, "DL_EXPORT": 2, "PY_LONG_LONG": 2, "LONG_LONG": 1, "Py_HUGE_VAL": 2, "HUGE_VAL": 1, "PYPY_VERSION": 1, "CYTHON_COMPILING_IN_PYPY": 2, "CYTHON_COMPILING_IN_CPYTHON": 6, "Py_ssize_t": 29, "PY_SSIZE_T_MAX": 1, "INT_MAX": 1, "PY_SSIZE_T_MIN": 1, "INT_MIN": 1, "PY_FORMAT_SIZE_T": 1, "CYTHON_FORMAT_SSIZE_T": 2, "PyInt_FromSsize_t": 6, "PyInt_FromLong": 3, "PyInt_AsSsize_t": 3, "__Pyx_PyInt_AsInt": 1, "PyNumber_Index": 1, "PyNumber_Check": 2, "PyFloat_Check": 2, "PyNumber_Int": 1, "PyErr_Format": 4, "PyExc_TypeError": 4, "Py_TYPE": 4, "tp_name": 4, "PyObject*": 17, "__Pyx_PyIndex_Check": 3, "PyComplex_Check": 1, "PyIndex_Check": 2, "PyErr_WarnEx": 1, "category": 2, "stacklevel": 1, "PyErr_Warn": 1, "__PYX_BUILD_PY_SSIZE_T": 2, "Py_REFCNT": 1, "ob_refcnt": 1, "ob_type": 7, "Py_SIZE": 1, "PyVarObject*": 1, "ob_size": 1, "PyVarObject_HEAD_INIT": 1, "PyObject_HEAD_INIT": 1, "PyType_Modified": 1, "PyObject": 48, "itemsize": 1, "readonly": 2, "ndim": 2, "*shape": 1, "*strides": 1, "*suboffsets": 1, "*internal": 1, "Py_buffer": 4, "PyBUF_SIMPLE": 1, "PyBUF_WRITABLE": 3, "PyBUF_FORMAT": 3, "PyBUF_ND": 2, "PyBUF_STRIDES": 6, "PyBUF_C_CONTIGUOUS": 1, "PyBUF_F_CONTIGUOUS": 1, "PyBUF_ANY_CONTIGUOUS": 1, "PyBUF_INDIRECT": 2, "PyBUF_RECORDS": 1, "PyBUF_FULL": 1, "PY_MAJOR_VERSION": 11, "__Pyx_BUILTIN_MODULE_NAME": 2, "__Pyx_PyCode_New": 2, "l": 7, "fv": 4, "cell": 4, "fline": 4, "lnos": 4, "PyCode_New": 2, "PY_MINOR_VERSION": 1, "PyUnicode_FromString": 1, "PyUnicode_Decode": 1, "Py_TPFLAGS_CHECKTYPES": 1, "Py_TPFLAGS_HAVE_INDEX": 1, "Py_TPFLAGS_HAVE_NEWBUFFER": 1, "PyUnicode_KIND": 1, "CYTHON_PEP393_ENABLED": 2, "__Pyx_PyUnicode_READY": 2, "op": 8, "likely": 15, "PyUnicode_IS_READY": 1, "_PyUnicode_Ready": 1, "__Pyx_PyUnicode_GET_LENGTH": 2, "PyUnicode_GET_LENGTH": 1, "__Pyx_PyUnicode_READ_CHAR": 2, "PyUnicode_READ_CHAR": 1, "__Pyx_PyUnicode_READ": 2, "PyUnicode_READ": 1, "PyUnicode_GET_SIZE": 1, "Py_UCS4": 2, "PyUnicode_AS_UNICODE": 1, "Py_UNICODE*": 1, "PyBaseString_Type": 1, "PyUnicode_Type": 2, "PyStringObject": 2, "PyUnicodeObject": 1, "PyString_Type": 2, "PyString_Check": 2, "PyUnicode_Check": 1, "PyString_CheckExact": 2, "PyUnicode_CheckExact": 1, "PyBytesObject": 1, "PyBytes_Type": 1, "PyBytes_Check": 1, "PyBytes_CheckExact": 1, "PyBytes_FromString": 2, "PyString_FromString": 1, "PyBytes_FromStringAndSize": 1, "PyString_FromStringAndSize": 1, "PyBytes_FromFormat": 1, "PyString_FromFormat": 1, "PyBytes_DecodeEscape": 1, "PyString_DecodeEscape": 1, "PyBytes_AsString": 2, "PyString_AsString": 1, "PyBytes_AsStringAndSize": 1, "PyString_AsStringAndSize": 1, "PyBytes_Size": 1, "PyString_Size": 1, "PyBytes_AS_STRING": 1, "PyString_AS_STRING": 1, "PyBytes_GET_SIZE": 1, "PyString_GET_SIZE": 1, "PyBytes_Repr": 1, "PyString_Repr": 1, "PyBytes_Concat": 1, "PyString_Concat": 1, "PyBytes_ConcatAndDel": 1, "PyString_ConcatAndDel": 1, "PySet_Check": 1, "PyObject_TypeCheck": 3, "PySet_Type": 2, "PyFrozenSet_Check": 1, "PyFrozenSet_Type": 1, "PySet_CheckExact": 2, "__Pyx_TypeCheck": 1, "PyTypeObject": 3, "PyIntObject": 1, "PyLongObject": 2, "PyInt_Type": 1, "PyLong_Type": 1, "PyInt_Check": 1, "PyLong_Check": 1, "PyInt_CheckExact": 1, "PyLong_CheckExact": 1, "PyInt_FromString": 1, "PyLong_FromString": 1, "PyInt_FromUnicode": 1, "PyLong_FromUnicode": 1, "PyLong_FromLong": 1, "PyInt_FromSize_t": 1, "PyLong_FromSize_t": 1, "PyLong_FromSsize_t": 1, "PyInt_AsLong": 2, "PyLong_AsLong": 1, "PyInt_AS_LONG": 1, "PyLong_AS_LONG": 1, "PyLong_AsSsize_t": 1, "PyInt_AsUnsignedLongMask": 1, "PyLong_AsUnsignedLongMask": 1, "PyInt_AsUnsignedLongLongMask": 1, "PyLong_AsUnsignedLongLongMask": 1, "PyBoolObject": 1, "Py_hash_t": 1, "__Pyx_PyInt_FromHash_t": 2, "__Pyx_PyInt_AsHash_t": 2, "__Pyx_PySequence_GetSlice": 2, "PySequence_GetSlice": 2, "__Pyx_PySequence_SetSlice": 2, "PySequence_SetSlice": 2, "__Pyx_PySequence_DelSlice": 2, "PySequence_DelSlice": 2, "unlikely": 8, "PyErr_SetString": 3, "PyExc_SystemError": 3, "tp_as_mapping": 3, "PyMethod_New": 2, "func": 3, "klass": 1, "PyInstanceMethod_New": 1, "__Pyx_GetAttrString": 2, "PyObject_GetAttrString": 2, "__Pyx_SetAttrString": 2, "PyObject_SetAttrString": 2, "__Pyx_DelAttrString": 2, "PyObject_DelAttrString": 2, "__Pyx_NAMESTR": 2, "__Pyx_DOCSTR": 2, "__Pyx_PyNumber_Divide": 2, "PyNumber_TrueDivide": 1, "__Pyx_PyNumber_InPlaceDivide": 2, "PyNumber_InPlaceTrueDivide": 1, "PyNumber_Divide": 1, "PyNumber_InPlaceDivide": 1, "__PYX_EXTERN_C": 3, "_USE_MATH_DEFINES": 1, "_OPENMP": 1, "": 1, "PYREX_WITHOUT_ASSERTIONS": 1, "CYTHON_WITHOUT_ASSERTIONS": 1, "CYTHON_INLINE": 23, "__inline": 1, "__STDC_VERSION__": 2, "CYTHON_UNUSED": 1, "**p": 1, "is_unicode": 1, "is_str": 1, "intern": 1, "__Pyx_StringTabEntry": 1, "__Pyx_PyBytes_FromUString": 1, "__Pyx_PyBytes_AsUString": 1, "__Pyx_Owned_Py_None": 1, "Py_INCREF": 10, "Py_None": 2, "__Pyx_PyBool_FromLong": 1, "Py_True": 2, "Py_False": 2, "__Pyx_PyObject_IsTrue": 1, "__Pyx_PyNumber_Int": 1, "__Pyx_PyIndex_AsSsize_t": 1, "__Pyx_PyInt_FromSize_t": 1, "__Pyx_PyInt_AsSize_t": 1, "__pyx_PyFloat_AsDouble": 3, "PyFloat_CheckExact": 1, "PyFloat_AS_DOUBLE": 1, "PyFloat_AsDouble": 2, "__pyx_PyFloat_AsFloat": 1, "__builtin_expect": 2, "*__pyx_m": 1, "*__pyx_b": 1, "*__pyx_empty_tuple": 1, "*__pyx_empty_bytes": 1, "__pyx_lineno": 1, "__pyx_clineno": 1, "__pyx_cfilenm": 1, "__FILE__": 4, "*__pyx_filename": 1, "CYTHON_CCOMPLEX": 8, "_Complex_I": 3, "": 1, "": 1, "__sun__": 1, "1.0fj": 1, "*__pyx_f": 1, "IS_UNSIGNED": 1, "__Pyx_StructField_": 2, "__PYX_BUF_FLAGS_PACKED_STRUCT": 1, "__Pyx_StructField_*": 1, "fields": 1, "arraysize": 1, "typegroup": 1, "is_unsigned": 1, "__Pyx_TypeInfo": 1, "__Pyx_TypeInfo*": 2, "__Pyx_StructField": 2, "__Pyx_StructField*": 1, "field": 1, "parent_offset": 1, "__Pyx_BufFmt_StackElem": 1, "__Pyx_BufFmt_StackElem*": 2, "fmt_offset": 1, "new_count": 1, "enc_count": 1, "struct_alignment": 1, "is_complex": 1, "enc_type": 1, "new_packmode": 1, "enc_packmode": 1, "is_valid_array": 1, "__Pyx_BufFmt_Context": 1, "npy_int8": 1, "__pyx_t_5numpy_int8_t": 1, "npy_int16": 1, "__pyx_t_5numpy_int16_t": 1, "npy_int32": 1, "__pyx_t_5numpy_int32_t": 4, "npy_int64": 1, "__pyx_t_5numpy_int64_t": 1, "npy_uint8": 1, "__pyx_t_5numpy_uint8_t": 1, "npy_uint16": 1, "__pyx_t_5numpy_uint16_t": 1, "npy_uint32": 1, "__pyx_t_5numpy_uint32_t": 1, "npy_uint64": 1, "__pyx_t_5numpy_uint64_t": 1, "npy_float32": 1, "__pyx_t_5numpy_float32_t": 1, "npy_float64": 1, "__pyx_t_5numpy_float64_t": 4, "npy_long": 1, "__pyx_t_5numpy_int_t": 1, "npy_longlong": 2, "__pyx_t_5numpy_long_t": 1, "__pyx_t_5numpy_longlong_t": 1, "npy_ulong": 1, "__pyx_t_5numpy_uint_t": 1, "npy_ulonglong": 2, "__pyx_t_5numpy_ulong_t": 1, "__pyx_t_5numpy_ulonglong_t": 1, "npy_intp": 1, "__pyx_t_5numpy_intp_t": 1, "npy_uintp": 1, "__pyx_t_5numpy_uintp_t": 1, "npy_double": 2, "__pyx_t_5numpy_float_t": 1, "__pyx_t_5numpy_double_t": 1, "npy_longdouble": 1, "__pyx_t_5numpy_longdouble_t": 1, "std": 2, "complex": 2, "__pyx_t_float_complex": 3, "_Complex": 2, "real": 2, "imag": 2, "__pyx_t_double_complex": 3, "npy_cfloat": 1, "__pyx_t_5numpy_cfloat_t": 1, "npy_cdouble": 2, "__pyx_t_5numpy_cdouble_t": 1, "npy_clongdouble": 1, "__pyx_t_5numpy_clongdouble_t": 1, "__pyx_t_5numpy_complex_t": 1, "PyObject_HEAD": 3, "*__pyx_vtab": 3, "__pyx_base": 18, "n_samples": 1, "epsilon": 2, "current_index": 2, "stride": 2, "*X_data_ptr": 2, "*X_indptr_ptr": 1, "*X_indices_ptr": 1, "*Y_data_ptr": 2, "PyArrayObject": 5, "*feature_indices": 2, "*feature_indices_ptr": 2, "*index": 2, "*index_data_ptr": 2, "*sample_weight_data": 2, "threshold": 2, "n_features": 2, "*w": 2, "*w_data_ptr": 1, "wscale": 1, "sq_norm": 1, "CYTHON_REFNANNY": 3, "__Pyx_RefNannyAPIStruct": 3, "*__Pyx_RefNanny": 1, "*__Pyx_RefNannyImportAPI": 1, "*modname": 1, "__Pyx_RefNannyDeclarations": 2, "*__pyx_refnanny": 1, "WITH_THREAD": 1, "__Pyx_RefNannySetupContext": 3, "acquire_gil": 4, "PyGILState_STATE": 1, "__pyx_gilstate_save": 2, "PyGILState_Ensure": 1, "__pyx_refnanny": 8, "__Pyx_RefNanny": 8, "SetupContext": 3, "PyGILState_Release": 1, "__Pyx_RefNannyFinishContext": 2, "FinishContext": 1, "__Pyx_INCREF": 3, "INCREF": 1, "__Pyx_DECREF": 5, "DECREF": 1, "__Pyx_GOTREF": 3, "GOTREF": 1, "__Pyx_GIVEREF": 3, "GIVEREF": 1, "__Pyx_XINCREF": 2, "__Pyx_XDECREF": 2, "__Pyx_XGOTREF": 2, "__Pyx_XGIVEREF": 2, "Py_DECREF": 2, "Py_XINCREF": 1, "Py_XDECREF": 1, "__Pyx_CLEAR": 1, "__Pyx_XCLEAR": 1, "*__Pyx_GetName": 1, "__Pyx_ErrRestore": 1, "*type": 4, "*value": 5, "*tb": 2, "__Pyx_ErrFetch": 1, "**type": 1, "**value": 1, "**tb": 1, "__Pyx_Raise": 1, "*cause": 1, "__Pyx_RaiseArgtupleInvalid": 1, "func_name": 2, "num_min": 1, "num_max": 1, "num_found": 1, "__Pyx_RaiseDoubleKeywordsError": 1, "kw_name": 1, "__Pyx_ParseOptionalKeywords": 1, "*kwds": 1, "**argnames": 1, "*kwds2": 1, "*values": 1, "num_pos_args": 1, "function_name": 1, "__Pyx_ArgTypeTest": 1, "none_allowed": 1, "__Pyx_GetBufferAndValidate": 1, "Py_buffer*": 2, "dtype": 1, "nd": 1, "__Pyx_SafeReleaseBuffer": 1, "__Pyx_TypeTest": 1, "__Pyx_RaiseBufferFallbackError": 1, "*__Pyx_GetItemInt_Generic": 1, "*r": 7, "PyObject_GetItem": 1, "__Pyx_GetItemInt_List": 1, "to_py_func": 6, "__Pyx_GetItemInt_List_Fast": 1, "__Pyx_GetItemInt_Generic": 6, "*__Pyx_GetItemInt_List_Fast": 1, "PyList_GET_SIZE": 5, "PyList_GET_ITEM": 3, "PySequence_GetItem": 3, "__Pyx_GetItemInt_Tuple": 1, "__Pyx_GetItemInt_Tuple_Fast": 1, "*__Pyx_GetItemInt_Tuple_Fast": 1, "PyTuple_GET_SIZE": 5, "PyTuple_GET_ITEM": 3, "__Pyx_GetItemInt": 1, "__Pyx_GetItemInt_Fast": 1, "*__Pyx_GetItemInt_Fast": 1, "PyList_CheckExact": 1, "PyTuple_CheckExact": 1, "PySequenceMethods": 1, "*m": 1, "tp_as_sequence": 1, "sq_item": 2, "sq_length": 2, "PySequence_Check": 1, "__Pyx_RaiseTooManyValuesError": 1, "expected": 2, "__Pyx_RaiseNeedMoreValuesError": 1, "__Pyx_RaiseNoneNotIterableError": 1, "__Pyx_IterFinish": 1, "__Pyx_IternextUnpackEndCheck": 1, "*retval": 1, "shape": 1, "strides": 1, "suboffsets": 1, "__Pyx_Buf_DimInfo": 2, "refcount": 1, "pybuffer": 1, "__Pyx_Buffer": 2, "*rcbuffer": 1, "diminfo": 1, "__Pyx_LocalBuf_ND": 1, "__Pyx_GetBuffer": 2, "*view": 2, "__Pyx_ReleaseBuffer": 2, "PyObject_GetBuffer": 1, "PyBuffer_Release": 1, "__Pyx_zeros": 1, "__Pyx_minusones": 1, "vmem_page": 9, "VMEM_SECTION_STACK": 1, "VMEM_SECTION_CODE": 1, "VMEM_SECTION_DATA": 1, "VMEM_SECTION_HEAP": 1, "VMEM_SECTION_MMAP": 1, "VMEM_SECTION_KERNEL": 1, "VMEM_SECTION_UNMAPPED": 1, "cow": 1, "*cow_src_addr": 1, "*virt_addr": 3, "*phys_addr": 3, "*vmem_new": 1, "*vmem_new_page": 1, "vmem_add_page": 1, "*pg": 2, "*vmem_get_page_phys": 1, "*vmem_get_page_virt": 1, "*vmem_get_page": 1, "*vmem_rm_page_phys": 1, "*vmem_rm_page_virt": 1, "vmem_iterate": 1, "vmem_iterator_t": 1, "callback": 1, "vmem_count_pages": 1, "vmem_dump_page": 1, "vmem_dump": 1, "vmem_handle_fault": 1, "*addr": 1, "*instruction": 1, "vmem_set_cache": 1, "*cache": 1, "*vmem_get_cache": 1, "__i386__": 1, "PAGE_SIZE": 3, "VMEM_ALIGN": 2, "typeof": 2, "intptr_t": 3, "VMEM_ALIGN_DOWN": 1, "__2DGFX": 2, "": 1, "": 1, "VGAPIX": 1, "DPMI_REGS": 1, "//void": 1, "setvgabasemem": 1, "draw_func_change_display": 1, "drw_cirl": 1, "git_usage_string": 1, "git_more_info_string": 1, "N_": 1, "startup_info": 2, "git_startup_info": 1, "use_pager": 8, "pager_config": 3, "*cmd": 4, "want": 3, "pager_command_config": 2, "prefixcmp": 1, "git_config_maybe_bool": 1, "xstrdup": 2, "check_pager_config": 3, "c.cmd": 1, "c.want": 2, "c.value": 3, "git_config": 1, "pager_program": 1, "commit_pager_choice": 3, "setenv": 1, "setup_pager": 1, "handle_options": 1, "***argv": 2, "*argc": 1, "*envchanged": 1, "**orig_argv": 1, "new_argv": 7, "option_count": 1, "alias_command": 4, "trace_argv_printf": 3, "*argcp": 4, "subdir": 3, "die_errno": 3, "saved_errno": 1, "git_version_string": 1, "GIT_VERSION": 1, "RUN_SETUP": 81, "RUN_SETUP_GENTLY": 16, "USE_PAGER": 3, "NEED_WORK_TREE": 18, "cmd_struct": 4, "run_builtin": 2, "help": 4, "st": 2, "setup_git_directory": 1, "nongit_ok": 2, "setup_git_directory_gently": 1, "have_repository": 1, "trace_repo_setup": 1, "setup_work_tree": 1, "fstat": 1, "fileno": 1, "S_ISFIFO": 1, "st.st_mode": 2, "S_ISSOCK": 1, "handle_internal_command": 2, "commands": 3, "cmd_add": 2, "cmd_annotate": 1, "cmd_apply": 1, "cmd_archive": 1, "cmd_bisect__helper": 1, "cmd_blame": 2, "cmd_branch": 1, "cmd_bundle": 1, "cmd_cat_file": 1, "cmd_check_attr": 1, "cmd_check_ref_format": 1, "cmd_checkout": 1, "cmd_checkout_index": 1, "cmd_cherry": 1, "cmd_cherry_pick": 1, "cmd_clean": 1, "cmd_clone": 1, "cmd_column": 1, "cmd_commit": 1, "cmd_commit_tree": 1, "cmd_config": 1, "cmd_count_objects": 1, "cmd_describe": 1, "cmd_diff": 1, "cmd_diff_files": 1, "cmd_diff_index": 1, "cmd_diff_tree": 1, "cmd_fast_export": 1, "cmd_fetch": 1, "cmd_fetch_pack": 1, "cmd_fmt_merge_msg": 1, "cmd_for_each_ref": 1, "cmd_format_patch": 1, "cmd_fsck": 2, "cmd_gc": 1, "cmd_get_tar_commit_id": 1, "cmd_grep": 1, "cmd_hash_object": 1, "cmd_help": 1, "cmd_index_pack": 1, "cmd_init_db": 2, "cmd_log": 1, "cmd_ls_files": 1, "cmd_ls_remote": 2, "cmd_ls_tree": 1, "cmd_mailinfo": 1, "cmd_mailsplit": 1, "cmd_merge": 1, "cmd_merge_base": 1, "cmd_merge_file": 1, "cmd_merge_index": 1, "cmd_merge_ours": 1, "cmd_merge_recursive": 4, "cmd_merge_tree": 1, "cmd_mktag": 1, "cmd_mktree": 1, "cmd_mv": 1, "cmd_name_rev": 1, "cmd_notes": 1, "cmd_pack_objects": 1, "cmd_pack_redundant": 1, "cmd_pack_refs": 1, "cmd_patch_id": 1, "cmd_prune": 1, "cmd_prune_packed": 1, "cmd_push": 1, "cmd_read_tree": 1, "cmd_receive_pack": 1, "cmd_reflog": 1, "cmd_remote": 1, "cmd_remote_ext": 1, "cmd_remote_fd": 1, "cmd_replace": 1, "cmd_repo_config": 1, "cmd_rerere": 1, "cmd_reset": 1, "cmd_rev_list": 1, "cmd_rev_parse": 1, "cmd_revert": 1, "cmd_rm": 1, "cmd_send_pack": 1, "cmd_shortlog": 1, "cmd_show": 1, "cmd_show_branch": 1, "cmd_show_ref": 1, "cmd_status": 1, "cmd_stripspace": 1, "cmd_symbolic_ref": 1, "cmd_tag": 1, "cmd_tar_tree": 1, "cmd_unpack_file": 1, "cmd_unpack_objects": 1, "cmd_update_index": 1, "cmd_update_ref": 1, "cmd_update_server_info": 1, "cmd_upload_archive": 1, "cmd_upload_archive_writer": 1, "cmd_var": 1, "cmd_verify_pack": 1, "cmd_verify_tag": 1, "cmd_version": 1, "cmd_whatchanged": 1, "cmd_write_tree": 1, "STRIP_EXTENSION": 1, "*argv0": 1, "argv0": 2, "ARRAY_SIZE": 1, "execv_dashed_external": 1, "strbuf": 12, "STRBUF_INIT": 1, "strbuf_addf": 1, "cmd.buf": 1, "run_command_v_opt": 1, "RUN_SILENT_EXEC_FAILURE": 1, "RUN_CLEAN_ON_EXIT": 1, "strbuf_release": 1, "run_argv": 1, "done_alias": 1, "ARDUINO_CATS_ARDUINO": 3, "": 1, "delay_int": 1, "ms": 4, "delay": 2, "delay_ulint": 1, "random_int_1": 1, "random": 4, "random_int_2": 1, "random_lint_1": 1, "random_lint_2": 1, "randomSeed_int": 1, "randomSeed": 2, "randomSeed_uint": 1, "COMMIT_H": 2, "*util": 1, "indegree": 1, "*parents": 4, "*tree": 3, "decoration": 1, "name_decoration": 3, "*commit_list_insert": 1, "**commit_list_append": 1, "**next": 1, "commit_list_count": 1, "*l": 1, "*commit_list_insert_by_date": 1, "free_commit_list": 1, "cmit_fmt": 3, "CMIT_FMT_RAW": 1, "CMIT_FMT_MEDIUM": 2, "CMIT_FMT_DEFAULT": 1, "CMIT_FMT_SHORT": 1, "CMIT_FMT_FULL": 1, "CMIT_FMT_FULLER": 1, "CMIT_FMT_ONELINE": 1, "CMIT_FMT_EMAIL": 1, "CMIT_FMT_USERFORMAT": 1, "CMIT_FMT_UNSPECIFIED": 1, "pretty_print_context": 6, "abbrev": 1, "*subject": 1, "*after_subject": 1, "preserve_subject": 1, "date_mode": 2, "date_mode_explicit": 1, "need_8bit_cte": 2, "show_notes": 1, "reflog_walk_info": 1, "*reflog_info": 1, "*output_encoding": 2, "userformat_want": 2, "notes": 1, "has_non_ascii": 1, "*text": 1, "rev_info": 2, "*logmsg_reencode": 1, "*reencode_commit_message": 1, "**encoding_p": 1, "get_commit_format": 1, "*arg": 1, "*format_subject": 1, "*sb": 7, "*line_separator": 1, "userformat_find_requirements": 1, "format_commit_message": 1, "*context": 1, "pretty_print_commit": 1, "*pp": 4, "pp_commit_easy": 1, "pp_user_info": 1, "*what": 1, "*line": 1, "*encoding": 2, "pp_title_line": 1, "**msg_p": 2, "pp_remainder": 1, "indent": 1, "*pop_most_recent_commit": 1, "*pop_commit": 1, "clear_commit_marks": 1, "object_array": 2, "sort_in_topological_order": 1, "lifo": 1, "FLEX_ARRAY": 1, "*read_graft_line": 1, "*lookup_commit_graft": 1, "*get_merge_bases": 1, "*rev1": 1, "*rev2": 1, "*get_merge_bases_many": 1, "*one": 1, "**twos": 1, "*get_octopus_merge_bases": 1, "*in": 1, "register_shallow": 1, "unregister_shallow": 1, "for_each_commit_graft": 1, "each_commit_graft_fn": 1, "is_repository_shallow": 1, "*get_shallow_commits": 1, "*heads": 2, "shallow_flag": 1, "not_shallow_flag": 1, "is_descendant_of": 1, "in_merge_bases": 1, "interactive_add": 1, "patch": 1, "run_add_interactive": 1, "*revision": 1, "*patch_mode": 1, "**pathspec": 1, "single_parent": 1, "*reduce_heads": 1, "commit_extra_header": 7, "append_merge_tag_headers": 1, "***tail": 1, "commit_tree": 1, "*author": 2, "*sign_commit": 2, "commit_tree_extended": 1, "*read_commit_extra_headers": 1, "*read_commit_extra_header_lines": 1, "free_commit_extra_headers": 1, "*extra": 1, "merge_remote_util": 1, "*get_merge_parent": 1, "parse_signed_commit": 1, "*message": 1, "*signature": 1, "": 1, "_Included_jni_JniLayer": 2, "JNIEXPORT": 6, "jlong": 6, "JNICALL": 6, "JNIEnv": 6, "jobject": 6, "jintArray": 1, "jint": 7, "jfloat": 1, "": 1, "args...": 8, "portio_out8": 2, "args": 8, "outw": 1, "portio_out16": 2, "outl": 1, "portio_out32": 2, "outq": 1, "portio_out64": 2, "portio_in8": 2, "inw": 1, "portio_in16": 2, "inl": 1, "portio_in32": 2, "inq": 1, "portio_in64": 2, "zend_class_entry": 1, "*test_router_exception_ce": 1, "": 1, "syscall_t": 1, "syscall_table": 1, "sys_exit": 1, "sys_read": 1, "sys_write": 1, "sys_getpid": 1, "sys_brk": 1, "sys_getppid": 1, "sys_mmap": 1, "sys_munmap": 1, "sys_test": 1, "sys_get_hostname": 1, "sys_set_hostname": 1, "sys_uname": 1, "sys_open": 1, "sys_execve": 1, "sys_seek": 1, "sys_opendir": 1, "sys_readdir": 1, "sys_kill": 1, "sys_getexecdata": 1, "sys_chdir": 1, "sys_getcwd": 1, "sys_fork": 1, "syscall_name_table": 1 }, "C#": { "using": 12, "System": 2, ";": 101, "namespace": 3, "{": 36, "internal": 2, "class": 3, "BsonPropertyValue": 2, "public": 4, "bool": 2, "IsDictionary": 2, "get": 3, "private": 3, "set": 3, "}": 36, "Type": 4, "object": 2, "Value": 2, "(": 139, "type": 2, "value": 2, "isDictionary": 2, ")": 139, "System.Reflection": 1, "System.Runtime.CompilerServices": 1, "[": 14, "assembly": 11, "AssemblyTitle": 1, "]": 14, "AssemblyDescription": 1, "AssemblyConfiguration": 1, "AssemblyCompany": 1, "AssemblyProduct": 1, "AssemblyCopyright": 1, "AssemblyTrademark": 1, "AssemblyCulture": 1, "AssemblyVersion": 1, "//": 2, "AssemblyDelaySign": 1, "false": 1, "AssemblyKeyFile": 1, "System.Collections.Generic": 2, "System.Collections.ObjectModel": 1, "System.Linq": 2, "System.Linq.Expressions": 1, "MongoDB.Linq.Expressions": 1, "MongoExpressionVisitor": 1, "ExpressionVisitor": 1, "protected": 12, "override": 1, "Expression": 14, "Visit": 13, "exp": 13, "if": 15, "null": 12, "return": 29, "switch": 2, "MongoExpressionType": 2, "exp.NodeType": 1, "case": 8, "MongoExpressionType.Collection": 1, "VisitCollection": 2, "CollectionExpression": 2, "MongoExpressionType.Field": 1, "VisitField": 2, "FieldExpression": 3, "MongoExpressionType.Projection": 1, "VisitProjection": 2, "ProjectionExpression": 3, "MongoExpressionType.Select": 1, "VisitSelect": 2, "SelectExpression": 6, "MongoExpressionType.Aggregate": 1, "VisitAggregate": 2, "AggregateExpression": 3, "VisitAggregateSubquery": 2, "AggregateSubqueryExpression": 3, "MongoExpressionType.Scalar": 2, "VisitScalar": 3, "ScalarExpression": 6, "default": 1, "base.Visit": 1, "virtual": 10, "aggregate": 2, "var": 20, "aggregate.Argument": 2, "new": 8, "aggregate.Type": 1, "aggregate.AggregateType": 1, "aggregate.Distinct": 1, "aggregateSubquery": 2, "e": 11, "subquery": 6, "aggregateSubquery.GroupByAlias": 1, "collection": 2, "field": 3, "field.Expression": 2, "field.Alias": 1, "field.Name": 1, "projection": 2, "source": 5, "projection.Source": 2, "projector": 3, "projection.Projector": 2, "||": 7, "projection.Aggregator": 1, "ReadOnlyCollection": 4, "": 3, "VisitOrderBy": 2, "orderBys": 4, "List": 2, "alternate": 10, "for": 3, "int": 2, "i": 10, "n": 4, "orderBys.Count": 1, "<": 2, "+": 8, "OrderExpression": 2, "expr": 1, "this.Visit": 1, "expr.Expression": 2, "&&": 2, "orderBys.Take": 1, ".ToList": 2, "alternate.Add": 2, "expr.OrderType": 1, "alternate.AsReadOnly": 2, "scalar": 2, "select": 5, "scalar.Select": 2, "scalar.Type": 1, "from": 3, "VisitSource": 2, "select.From": 2, "where": 3, "select.Where": 2, "groupBy": 3, "select.GroupBy": 2, "orderBy": 3, "select.OrderBy": 2, "skip": 3, "select.Skip": 2, "take": 3, "select.Take": 2, "fields": 8, "VisitFieldDeclarationList": 2, "select.Fields": 2, "select.Alias": 1, "select.IsDistinct": 1, "VisitSubquery": 1, "SubqueryExpression": 1, "subquery.NodeType": 1, "": 3, "fields.Count": 1, "f": 1, "f.Expression": 2, "fields.Take": 1, "FieldDeclaration": 1, "f.Name": 1, "target": 2, "Argument": 2, "": 2, "configuration": 4, "solutions": 3, "GetFiles": 1, "solutionPaths": 2, "solutions.Select": 1, "solution": 7, "solution.GetDirectory": 1, "Setup": 1, "Information": 5, "Teardown": 1, "Task": 4, ".Does": 3, "foreach": 3, "path": 4, "in": 3, "CleanDirectories": 2, "NuGetRestore": 1, ".IsDependentOn": 3, "MSBuild": 1, "settings": 1, "settings.SetPlatformTarget": 1, "PlatformTarget.MSIL": 1, ".WithProperty": 1, ".WithTarget": 1, ".SetConfiguration": 1, "RunTarget": 1, "System.Text": 1, "System.Threading.Tasks": 1, "LittleSampleApp": 1, "///": 4, "": 1, "Just": 1, "what": 1, "it": 1, "says": 1, "on": 1, "the": 1, "tin.": 1, "A": 1, "little": 1, "sample": 1, "application": 1, "Linguist": 1, "to": 1, "try": 1, "out.": 1, "": 1, "Program": 1, "static": 1, "void": 1, "Main": 1, "string": 1, "args": 1, "Console.WriteLine": 2 }, "C++": { "class": 46, "Bar": 3, "{": 1048, "protected": 5, "char": 152, "*name": 7, ";": 4299, "public": 45, "void": 211, "hello": 3, "(": 5360, ")": 5358, "}": 1024, "#ifndef": 28, "ENV_H": 3, "#define": 295, "#include": 205, "": 1, "": 2, "Env": 12, "QObject": 2, "Q_OBJECT": 1, "static": 262, "*instance": 1, "parse": 10, "const": 194, "**": 2, "envp": 4, "QVariantMap": 2, "asVariantMap": 1, "private": 19, "m_map": 1, "#endif": 111, "//": 159, "UTILS_H": 3, "": 1, "": 1, "": 1, "QTemporaryFile": 1, "Utils": 4, "showUsage": 1, "messageHandler": 2, "QtMsgType": 1, "type": 10, "*msg": 2, "bool": 130, "exceptionHandler": 2, "char*": 29, "dump_path": 1, "minidump_id": 1, "void*": 59, "context": 23, "succeeded": 2, "QVariant": 1, "coffee2js": 1, "QString": 20, "&": 366, "script": 1, "injectJsInFrame": 2, "jsFilePath": 5, "libraryPath": 5, "QWebFrame": 4, "*targetFrame": 4, "startingScript": 2, "false": 80, "Encoding": 3, "jsFileEnc": 2, "readResourceFileUtf8": 1, "resourceFilePath": 1, "loadJSForDebug": 2, "autorun": 2, "cleanupFromDebug": 1, "findScript": 1, "jsFromScriptFile": 1, "scriptPath": 1, "enc": 1, "<": 125, "This": 4, "shouldn": 1, "QTemporaryFile*": 2, "m_tempHarness": 1, "We": 1, "want": 2, "to": 26, "make": 1, "sure": 2, "clean": 2, "up": 4, "after": 3, "ourselves": 1, "m_tempWrapper": 1, "": 1, "": 2, "": 1, "": 2, "": 2, "": 6, "": 1, "": 1, "#if": 68, "_MSC_VER": 11, "VC": 2, "+": 140, "#pragma": 6, "warning": 5, "disable": 5, "about": 4, "strdup": 2, "being": 3, "deprecated.": 2, "namespace": 42, "Json": 2, "isControlCharacter": 2, "ch": 9, "return": 320, "&&": 52, "containsControlCharacter": 1, "str": 7, "while": 39, "*str": 1, "if": 498, "*": 200, "true": 72, "uintToString": 3, "unsigned": 22, "int": 286, "value": 30, "current": 16, "-": 951, "do": 12, "%": 176, "/": 13, "std": 128, "string": 74, "valueToString": 3, "Int": 1, "buffer": 15, "[": 290, "]": 290, "*current": 2, "sizeof": 33, "isNegative": 3, "UInt": 2, "assert": 4, "double": 27, "defined": 54, "__STDC_SECURE_LIB__": 1, "Use": 2, "secure": 1, "version": 5, "with": 12, "visual": 1, "studio": 1, "avoid": 2, "warning.": 1, "sprintf_s": 1, "#else": 36, "sprintf": 2, "strlen": 1, "": 10, "": 2, "GOOGLE_PROTOBUF_VERSION": 1, "#error": 9, "file": 32, "was": 4, "generated": 2, "by": 4, "a": 81, "newer": 2, "of": 34, "protoc": 2, "which": 6, "is": 12, "incompatible": 2, "your": 4, "Protocol": 2, "Buffer": 3, "headers.": 3, "Please": 3, "update": 2, "an": 6, "older": 1, "regenerate": 1, "this": 49, "protoc.": 1, "": 1, "": 1, "persons": 3, "Person": 57, "google": 69, "protobuf": 69, "Message": 6, "virtual": 11, "from": 18, "inline": 36, "operator": 9, "CopyFrom": 3, "*this": 1, "UnknownFieldSet": 2, "unknown_fields": 7, "_unknown_fields_": 4, "UnknownFieldSet*": 1, "mutable_unknown_fields": 3, "Descriptor*": 3, "descriptor": 15, "default_instance": 3, "Swap": 1, "Person*": 6, "other": 1, "New": 2, "MergeFrom": 5, "Clear": 3, "IsInitialized": 2, "ByteSize": 2, "MergePartialFromCodedStream": 2, "io": 4, "CodedInputStream*": 2, "input": 17, "SerializeWithCachedSizes": 2, "CodedOutputStream*": 2, "output": 30, "uint8*": 4, "SerializeWithCachedSizesToArray": 2, "GetCachedSize": 1, "_cached_size_": 5, "SharedCtor": 4, "SharedDtor": 3, "SetCachedSize": 2, "size": 14, "Metadata": 1, "GetMetadata": 1, "has_name": 6, "clear_name": 2, "kNameFieldNumber": 2, "name": 24, "set_name": 6, "size_t": 12, "string*": 11, "mutable_name": 3, "release_name": 2, "set_allocated_name": 2, "set_has_name": 7, "clear_has_name": 5, "name_": 28, "mutable": 1, "uint32": 2, "_has_bits_": 11, "friend": 9, "InitAsDefaultInstance": 3, "default_instance_": 8, "|": 43, "internal": 44, "kEmptyString": 12, "clear": 2, "*name_": 1, "new": 73, "assign": 3, "reinterpret_cast": 4, "": 3, "NULL": 126, "else": 74, "temp": 5, "const_cast": 3, "delete": 6, "SWIG": 2, "#ifdef": 20, "template": 10, "QPBO": 6, "": 5, "": 3, "": 3, "get_type_information": 3, "type_name": 6, "type_format": 6, "ClasspathVMSystem/Properties.cpp": 1, "GNU": 1, "classpath": 1, "gnu/classpath/VMSystemProperties": 1, "": 1, "using": 11, "j3": 1, "extern": 5, "JNIEXPORT": 1, "JNICALL": 1, "NATIVE_JNI": 1, "JNIEnv": 1, "*env": 2, "jclass": 1, "clazz": 1, "JavaObject*": 2, "prop": 6, "llvm_gcroot": 2, "BEGIN_NATIVE_EXCEPTION": 2, "setProperties": 1, "END_NATIVE_EXCEPTION": 2, "setCommandLineProperties": 1, "*scan": 1, "*p": 2, "*q": 1, "YYCTYPE": 18, "YYCURSOR": 4, "p": 6, "YYLIMIT": 4, "YYMARKER": 4, "q": 2, "YYFILL": 4, "n": 33, "GDSDBREADER_H": 3, "": 1, "GDS_DIR": 1, "enum": 7, "level": 1, "LEVEL_ONE": 1, "LEVEL_TWO": 1, "LEVEL_THREE": 1, "dbDataStructure": 3, "label": 1, "quint32": 3, "depth": 1, "userIndex": 1, "QByteArray": 2, "data": 9, "COMPRESSED": 1, "optimize": 1, "ram": 1, "and": 13, "disk": 5, "space": 1, "decompressed": 1, "quint64": 1, "uniqueID": 1, "QVector": 3, "": 1, "nextItems": 1, "": 2, "nextItemsIndices": 1, "dbDataStructure*": 1, "father": 1, "fatherIndex": 1, "noFatherRoot": 1, "Used": 2, "tell": 1, "node": 1, "the": 80, "root": 7, "so": 1, "hasn": 1, "fileName": 1, "Relative": 1, "filename": 1, "for": 49, "associated": 1, "code": 2, "firstLineData": 1, "Compressed": 1, "first": 4, "line": 8, "will": 2, "be": 5, "used": 4, "number": 11, "retrieve": 1, "info": 3, "linesNumbers": 1, "First": 1, "next": 4, "lines": 1, "are": 3, "relative": 2, "numbers": 1, "*glPointer": 1, "GL": 1, "pointer": 1, "QDataStream": 4, "<<": 32, "stream": 10, "myclass": 2, "myclass.label": 2, "myclass.depth": 2, "myclass.userIndex": 2, "qCompress": 2, "myclass.data": 4, "myclass.uniqueID": 2, "myclass.nextItemsIndices": 2, "myclass.fatherIndex": 2, "myclass.noFatherRoot": 2, "myclass.fileName": 2, "myclass.firstLineData": 4, "myclass.linesNumbers": 2, "//Don": 1, "qUncompress": 2, "V8_V8_H_": 3, "GOOGLE3": 2, "DEBUG": 8, "NDEBUG": 4, "#undef": 5, "both": 1, "set": 1, "v8": 8, "Deserializer": 1, "V8": 21, "AllStatic": 1, "Initialize": 3, "Deserializer*": 2, "des": 3, "TearDown": 5, "IsRunning": 1, "is_running_": 6, "UseCrankshaft": 1, "use_crankshaft_": 6, "IsDead": 2, "has_fatal_error_": 5, "||": 63, "has_been_disposed_": 6, "SetFatalError": 2, "FatalProcessOutOfMemory": 1, "location": 2, "take_snapshot": 1, "SetEntropySource": 2, "EntropySource": 3, "source": 7, "SetReturnAddressLocationResolver": 3, "ReturnAddressLocationResolver": 2, "resolver": 3, "uint32_t": 11, "Random": 3, "Context*": 4, "RandomPrivate": 2, "Isolate*": 6, "isolate": 15, "Object*": 4, "FillHeapNumberWithRandom": 2, "heap_number": 4, "IdleNotification": 3, "hint": 3, "AddCallCompletedCallback": 2, "CallCompletedCallback": 4, "callback": 7, "RemoveCallCompletedCallback": 2, "FireCallCompletedCallback": 2, "InitializeOncePerProcessImpl": 3, "InitializeOncePerProcess": 4, "has_been_set_up_": 4, "List": 3, "": 3, "call_completed_callbacks_": 16, "NilValue": 1, "kNullValue": 1, "kUndefinedValue": 1, "EqualityKind": 1, "kStrictEquality": 1, "kNonStrictEquality": 1, "i": 161, "": 2, "Gui": 1, "once": 3, "typedef": 46, "smallPrime_t": 1, "PIC16F88Instruction": 2, "ADDWF": 1, "ANDWF": 1, "CLRF": 1, "CLRW": 1, "COMF": 1, "DECF": 1, "DECFSZ": 1, "INCF": 1, "INCFSZ": 1, "IORWF": 1, "MOVF": 1, "MOVWF": 1, "NOP": 1, "RLF": 1, "RRF": 1, "SUBWF": 1, "SWAPF": 1, "XORWF": 1, "BCF": 1, "BSF": 1, "BTFSC": 1, "BTFSS": 1, "ADDLW": 1, "ANDLW": 1, "CALL": 1, "CLRWDT": 1, "GOTO": 2, "IORLW": 1, "MOVLW": 1, "RETFIE": 1, "RETLW": 1, "RETURN": 3, "SLEEP": 1, "SUBLW": 1, "XORLW": 1, "PIC16F88": 2, "ROM": 2, "*ProgramMemory": 1, "Step": 1, "uint8_t": 17, "nextIsNop": 1, "trapped": 1, "Memory": 2, "*memory": 1, "*program": 1, "Stack": 1, "": 2, "8": 1, "*CallStack": 1, "Register": 2, "*PC": 1, "*WREG": 1, "*PCL": 1, "*STATUS": 1, "*PCLATCH": 1, "inst": 1, "uint16_t": 2, "instrWord": 1, "DecodeInstruction": 1, "ProcessInstruction": 1, "GetBank": 1, "GetMemoryContents": 1, "partialAddress": 4, "SetMemoryContents": 1, "newVal": 1, "CheckZero": 1, "StoreValue": 1, "updateZero": 1, "SetCarry": 1, "val": 4, "GetPCHFinalBits": 1, "GRPC_hello_2eproto__INCLUDED": 3, "": 9, "impl": 9, "codegen": 9, "async_stream": 1, "h": 9, "async_unary_call": 1, "method_handler_impl": 1, "proto_utils": 1, "rpc_method": 1, "service_type": 1, "status": 1, "stub_options": 1, "sync_stream": 1, "grpc": 53, "CompletionQueue": 1, "Channel": 1, "RpcService": 1, "ServerCompletionQueue": 1, "ServerContext": 1, "HelloService": 1, "final": 5, "StubInterface": 3, "Status": 10, "SayHello": 6, "ClientContext*": 6, "HelloRequest": 8, "request": 14, "HelloResponse*": 6, "response": 8, "unique_ptr": 5, "HelloResponse": 9, "AsyncSayHello": 2, "CompletionQueue*": 5, "cq": 6, "AsyncSayHelloRaw": 4, "Stub": 2, "shared_ptr": 59, "ChannelInterface": 3, "channel": 2, "override": 8, "ClientAsyncResponseReader": 3, "channel_": 1, "RpcMethod": 1, "rpcmethod_SayHello_": 1, "": 1, "NewStub": 1, "StubOptions": 2, "options": 1, "Service": 12, "ServerContext*": 6, "HelloRequest*": 5, "": 4, "BaseClass": 6, "WithAsyncMethod_SayHello": 4, "*service": 3, "MarkMethodAsync": 1, "abort": 3, "StatusCode": 3, "UNIMPLEMENTED": 3, "RequestSayHello": 1, "ServerAsyncResponseWriter": 1, "new_call_cq": 2, "ServerCompletionQueue*": 1, "notification_cq": 2, "*tag": 1, "RequestAsyncUnary": 1, "tag": 7, "": 3, "AsyncService": 1, "WithGenericMethod_SayHello": 3, "MarkMethodGeneric": 1, "WithStreamedUnaryMethod_SayHello": 6, "MarkMethodStreamed": 1, "StreamedUnaryHandler": 1, "bind": 1, "": 1, "StreamedSayHello": 2, "placeholders": 2, "_1": 1, "_2": 1, "ServerUnaryStreamer": 1, "server_unary_streamer": 1, "StreamedUnaryService": 1, "SplitStreamedService": 1, "StreamedService": 1, "": 1, "": 1, "": 2, "": 1, "": 3, "": 2, "__QNXNTO__": 1, "memcpy": 8, "sscanf": 1, "Features": 10, "allowComments_": 1, "strictRoot_": 1, "all": 4, "strictMode": 1, "features": 4, "features.allowComments_": 1, "features.strictRoot_": 1, "in": 26, "Reader": 31, "Char": 16, "c": 100, "c1": 9, "c2": 9, "c3": 4, "c4": 4, "c5": 2, "containsNewLine": 3, "Location": 9, "begin": 10, "end": 12, "*begin": 3, "codePointToUTF8": 1, "cp": 15, "result": 24, "result.resize": 4, "static_cast": 22, "": 12, "features_": 2, "document": 2, "Value": 17, "collectComments": 7, "document_": 1, "document_.c_str": 1, "*end": 1, "document_.length": 1, "istream": 1, "sin": 3, "//std": 2, "istream_iterator": 2, "doc": 3, "getline": 1, "EOF": 1, "*beginDoc": 1, "*endDoc": 1, "features_.allowComments_": 2, "begin_": 2, "beginDoc": 2, "end_": 6, "endDoc": 2, "collectComments_": 6, "current_": 16, "lastValueEnd_": 4, "lastValue_": 4, "commentsBefore_": 6, "errors_.clear": 1, "nodes_.empty": 1, "nodes_.pop": 1, "nodes_.push": 1, "successful": 12, "readValue": 2, "Token": 269, "token": 82, "skipCommentTokens": 3, "commentsBefore_.empty": 3, "root.setComment": 1, "commentAfter": 1, "features_.strictRoot_": 1, "root.isArray": 1, "root.isObject": 1, "token.type_": 18, "tokenError": 2, "token.start_": 2, "token.end_": 2, "addError": 3, "currentValue": 5, ".setComment": 1, "commentBefore": 2, "switch": 6, "case": 80, "tokenObjectBegin": 2, "readObject": 1, "break": 77, "tokenArrayBegin": 2, "readArray": 1, "tokenNumber": 2, "decodeNumber": 1, "tokenString": 2, "decodeString": 1, "tokenTrue": 2, "tokenFalse": 2, "tokenNull": 2, "default": 8, "readToken": 4, "tokenComment": 2, "expectToken": 1, "TokenType": 1, "*message": 1, "message": 4, "skipSpaces": 2, "getNextChar": 5, "ok": 11, "tokenObjectEnd": 1, "tokenArrayEnd": 1, "readString": 1, "readComment": 2, "readNumber": 2, "match": 4, "tokenArraySeparator": 1, "tokenMemberSeparator": 1, "tokenEndOfStream": 1, "*current_": 2, "pattern": 2, "patternLength": 4, "index": 9, "commentBegin": 4, "readCStyleComment": 2, "readCppStyleComment": 2, "CommentPlacement": 2, "placement": 6, "commentAfterOnSameLine": 2, "addComment": 2, "setComment": 1, "": 1, "": 2, "": 4, "": 3, "": 1, "BPackageKit": 1, "BPackageInfo": 7, "ParseErrorListener": 2, "Parser": 7, "ParseErrorListener*": 1, "listener": 2, "fListener": 13, "fPos": 6, "status_t": 3, "Parse": 1, "BString": 3, "packageInfoString": 1, "BPackageInfo*": 1, "packageInfo": 3, "B_BAD_VALUE": 1, "packageInfoString.String": 2, "try": 3, "_Parse": 1, "catch": 6, "ParseError": 3, "error": 10, "inLineOffset": 5, "int32": 4, "offset": 8, "error.pos": 4, "newlinePos": 6, "packageInfoString.FindLast": 2, "column": 5, "OnError": 6, "error.message": 3, "B_BAD_DATA": 3, "bad_alloc": 3, "e": 10, "B_NO_MEMORY": 3, "B_OK": 3, "ParseVersion": 1, "versionString": 1, "revisionIsOptional": 2, "BPackageVersion": 1, "_version": 2, "versionString.String": 2, "TOKEN_STRING": 2, "versionString.Length": 1, "_ParseVersionValue": 1, "ParseResolvableExpression": 1, "expressionString": 1, "BPackageResolvableExpression": 1, "_expression": 2, "expressionString.String": 2, "expressionString.Length": 1, "_ParseResolvableExpression": 1, "_NextToken": 2, "itemSeparatorPos": 1, "inComment": 2, "*fPos": 1, "isspace": 1, "BITCOIN_KEY_H": 2, "": 6, "": 1, "EC_KEY": 3, "definition": 2, "key_error": 6, "runtime_error": 2, "explicit": 3, "CKeyID": 5, "uint160": 8, "CScriptID": 3, "CPubKey": 11, "vector": 37, "": 27, "vchPubKey": 6, "CKey": 26, "vchPubKeyIn": 2, "b": 53, "a.vchPubKey": 3, "b.vchPubKey": 3, "IMPLEMENT_SERIALIZE": 1, "READWRITE": 1, "GetID": 1, "Hash160": 1, "uint256": 12, "GetHash": 1, "Hash": 1, "vchPubKey.begin": 1, "vchPubKey.end": 1, "IsValid": 3, "vchPubKey.size": 3, "IsCompressed": 2, "Raw": 1, "secure_allocator": 2, "CPrivKey": 3, "CSecret": 4, "EC_KEY*": 1, "pkey": 14, "fSet": 7, "fCompressedPubKey": 5, "SetCompressedPubKey": 4, "Reset": 3, "IsNull": 1, "MakeNewKey": 1, "fCompressed": 3, "SetPrivKey": 1, "vchPrivKey": 1, "SetSecret": 1, "vchSecret": 1, "GetSecret": 2, "GetPrivKey": 1, "SetPubKey": 1, "GetPubKey": 5, "Sign": 2, "hash": 20, "vchSig": 18, "SignCompact": 2, "SetCompactSignature": 2, "Verify": 2, "VerifyCompact": 2, "V8_DECLARE_ONCE": 1, "init_once": 2, "LazyMutex": 1, "entropy_mutex": 1, "LAZY_MUTEX_INITIALIZER": 1, "entropy_source": 4, "FlagList": 1, "EnforceFlagImplications": 1, "Isolate": 9, "CurrentPerIsolateThreadData": 4, "EnterDefaultIsolate": 1, "ASSERT": 16, "thread_id": 1, ".Equals": 1, "ThreadId": 1, "Current": 5, "Init": 2, "IsDefaultIsolate": 1, "ElementsAccessor": 2, "LOperand": 2, "TearDownCaches": 1, "RegisteredExtension": 1, "UnregisterAll": 1, "OS": 3, "seed_random": 2, "uint32_t*": 2, "state": 26, "FLAG_random_seed": 2, "ScopedLock": 1, "lock": 5, "entropy_mutex.Pointer": 1, "random": 1, "random_base": 3, "StackFrame": 1, "IsGlobalContext": 1, "ByteArray*": 1, "seed": 2, "random_seed": 1, "": 3, "GetDataStartAddress": 1, "private_random_seed": 1, "FLAG_use_idle_notification": 1, "HEAP": 1, "Lazy": 1, "init.": 1, "length": 7, "at": 8, "Add": 1, "Remove": 1, "HandleScopeImplementer*": 1, "handle_scope_implementer": 5, "CallDepthIsZero": 1, "IncrementCallDepth": 1, "DecrementCallDepth": 1, "union": 1, "double_value": 1, "uint64_t": 4, "uint64_t_value": 1, "double_int_union": 2, "r": 63, "random_bits": 2, "binary_million": 3, "r.double_value": 3, "r.uint64_t_value": 1, "HeapNumber": 1, "cast": 1, "set_value": 1, "SetUp": 4, "FLAG_crankshaft": 1, "Serializer": 1, "enabled": 1, "CPU": 2, "SupportsCrankshaft": 1, "PostSetUp": 1, "RuntimeProfiler": 1, "GlobalSetUp": 1, "FLAG_stress_compaction": 1, "FLAG_gc_global": 1, "FLAG_max_new_space_size": 1, "kPageSizeBits": 1, "SetUpCaches": 1, "SetUpJSCallerSavedCodeData": 1, "SamplerRegistry": 1, "ExternalReference": 1, "CallOnce": 1, "Field": 2, "Free": 1, "Black": 1, "White": 1, "Illegal": 1, "Player": 1, "setup": 3, "Serial.begin": 1, "loop": 3, "Serial.print": 2, "": 1, "SRS_AUTO_INGEST": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "SRS_AUTO_INGESTER_SLEEP_US": 2, "int64_t": 4, "3*1000*1000LL": 1, "SrsIngesterFFMPEG": 15, "ffmpeg": 23, "srs_freep": 9, "initialize": 6, "SrsFFMPEG*": 4, "ff": 2, "v": 13, "ret": 111, "ERROR_SUCCESS": 31, "vhost": 30, "id": 4, "starttime": 2, "srs_get_system_time_ms": 2, "uri": 4, "alive": 2, "equals": 4, "start": 5, "stop": 7, "cycle": 4, "fast_stop": 3, "SrsIngester": 20, "_srs_config": 20, "subscribe": 1, "pthread": 5, "SrsReusableThread": 1, "pprint": 4, "SrsPithyPrint": 1, "create_ingester": 1, "unsubscribe": 1, "clear_engines": 4, "srs_error": 6, "srs_trace": 14, "cid": 1, "_srs_context": 1, "get_id": 1, "parse_ingesters": 3, "SrsConfDirective*": 12, "": 3, "ingesters": 2, "get_ingesters": 1, "arg0": 16, "ingesters.size": 4, "ingest": 21, "parse_engines": 3, "get_ingest_enabled": 1, "ffmpeg_bin": 3, "get_ingest_ffmpeg": 1, "ffmpeg_bin.empty": 1, "ERROR_ENCODER_PARSE": 1, "engines": 2, "get_transcode_engines": 1, "engines.empty": 1, "SrsFFMPEG": 2, "initialize_ffmpeg": 3, "ERROR_ENCODER_LOOP": 2, "SrsIngesterFFMPEG*": 8, "ingester": 28, "ingesters.push_back": 2, "engines.size": 1, "engine": 10, ".c_str": 12, "dispose": 1, "": 5, "iterator": 5, "it": 30, "ingesters.begin": 5, "ingesters.end": 5, "*it": 5, "ingesters.empty": 1, "show_ingest_log_message": 2, "on_thread_stop": 1, "ingesters.clear": 1, "vhosts": 3, "get_vhosts": 1, "vhosts.size": 1, "port": 3, "": 1, "ip_ports": 2, "get_listens": 1, "srs_assert": 1, "ip_ports.size": 1, "ep": 2, "ip": 2, "srs_parse_endpoint": 1, "get_engine_output": 1, "srs_string_replace": 2, "output.empty": 1, "ERROR_ENCODER_NO_OUTPUT": 1, "url": 3, "app": 5, "pos": 22, "npos": 4, "url.rfind": 2, "url.substr": 4, "app.rfind": 1, "app.substr": 1, "log_file": 13, "SRS_CONSTS_NULL_FILE": 1, "disabled": 1, "get_ffmpeg_log_enabled": 1, "get_ffmpeg_log_dir": 1, "input_type": 3, "get_ingest_input_type": 1, "input_type.empty": 1, "ERROR_ENCODER_NO_INPUT": 3, "srs_config_ingest_is_file": 1, "input_url": 4, "get_ingest_input_url": 2, "input_url.empty": 2, "set_iparams": 2, "srs_config_ingest_is_stream": 1, "ERROR_ENCODER_INPUT_TYPE": 1, "input_type.c_str": 1, "set_oformat": 1, "vcodec": 1, "get_engine_vcodec": 1, "acodec": 1, "get_engine_acodec": 1, "engine_disabled": 2, "get_engine_enabled": 1, "vcodec.empty": 1, "acodec.empty": 1, "initialize_copy": 1, "initialize_transcode": 1, "elapse": 1, "rand": 1, "ingesters.at": 1, "can_print": 1, "SRS_CONSTS_LOG_INGESTER": 1, "PRId64": 1, "age": 1, "on_reload_vhost_added": 1, "_vhost": 4, "get_vhost": 2, "vhost.c_str": 5, "on_reload_vhost_removed": 1, "continue": 4, "ingesters.erase": 2, "on_reload_ingest_removed": 2, "ingest_id": 7, "on_reload_ingest_added": 2, "_ingester": 2, "get_ingest_by_id": 1, "ingest_id.c_str": 2, "on_reload_ingest_updated": 1, "ADDEQ": 1, "ANDAND": 1, "ANDEQ": 1, "ARRAY": 1, "ASM": 1, "AUTO": 1, "BREAK": 2, "CASE": 2, "CHAR": 1, "CONST": 2, "CONTINUE": 2, "DECR": 1, "DEFAULT": 2, "DEREF": 1, "DIVEQ": 1, "DO": 2, "DOUBLE": 1, "ELLIPSIS": 1, "ELSE": 2, "ENUM": 1, "EQL": 1, "EXTERN": 1, "FCON": 1, "FLOAT": 1, "FOR": 2, "FUNCTION": 2, "GEQ": 1, "ICON": 1, "ID": 2, "IF": 2, "INCR": 1, "INT": 1, "LEQ": 1, "LONG": 1, "LSHIFT": 1, "LSHIFTEQ": 1, "MODEQ": 1, "MULEQ": 1, "NEQ": 1, "OREQ": 1, "OROR": 1, "POINTER": 1, "REGISTER": 1, "RSHIFT": 1, "RSHIFTEQ": 1, "SCON": 1, "SHORT": 1, "SIGNED": 1, "SIZEOF": 1, "STATIC": 1, "STRUCT": 1, "SUBEQ": 1, "SWITCH": 2, "TYPEDEF": 1, "UNION": 1, "UNSIGNED": 1, "VOID": 2, "VOLATILE": 1, "WHILE": 2, "XOREQ": 1, "EOI": 3, "uint": 3, "uchar": 8, "BSIZE": 6, "cursor": 18, "s": 66, "lim": 12, "ptr": 10, "fill": 1, "RET": 2, "cur": 2, "struct": 13, "Scanner": 27, "fd": 17, "*bot": 1, "*tok": 1, "*ptr": 1, "*cur": 1, "*pos": 1, "*lim": 1, "*top": 1, "*eof": 1, "*fill": 1, "*s": 3, "*cursor": 4, "eof": 4, "cnt": 9, "tok": 9, "bot": 10, "top": 3, "*buf": 2, "uchar*": 1, "malloc": 3, "*sizeof": 1, "buf": 8, "free": 3, "read": 1, "scan": 5, "comment": 3, "goto": 158, "any": 3, "*/": 1, "main": 5, "t": 13, "memset": 3, "in.fd": 2, "close": 7, "": 1, "": 2, "": 1, "": 2, "": 1, "long": 16, "ll": 1, "mod": 1, "pb": 1, "push_back": 1, "r2": 5, "m": 8, "dfs": 5, "graph": 13, "//cout": 1, "endl": 4, "point": 4, "rr": 8, "cc": 4, "stack": 1, "": 1, "st": 1, "search": 2, "t.r": 5, "t.c": 5, "st.push": 5, "st.empty": 1, "u": 1, "st.top": 1, "st.pop": 1, "u.r": 1, "u.c": 1, "cout": 5, "ios": 1, "sync_with_stdio": 1, "freopen": 1, "stdin": 1, "cin": 4, "": 1, "graph.pb": 1, "r1": 5, "buttons": 6, "octaves": 5, "pinMode": 3, "OUTPUT": 1, "": 1, "INPUT": 2, "0": 6, "Serial": 2, "9600": 1, "delay": 1, "1": 8, "wait": 1, "print": 1, "digitalRead": 3, "LOW": 3, "output=": 1, "7": 1, "i=": 1, "Serial.println": 1, "digitalWrite": 2, "HIGH": 1, "": 1, "currentR": 4, "currentG": 4, "currentB": 4, "currentA": 5, "currentScreen": 3, "GFX_BOTTOM": 2, "float": 80, "transX": 5, "transY": 5, "isPushed": 4, "u32": 5, "getCurrentColor": 1, "RGBA8": 1, "setColor": 2, "g": 6, "setScreen": 1, "screen": 2, "getCurrentScreen": 5, "screenShot": 1, "//for": 1, "showing": 1, "stuff": 1, "done": 1, "FILE": 2, "topScreen": 3, "fopen": 2, "fwrite": 2, "gfxGetFramebuffer": 2, "GFX_TOP": 1, "GFX_LEFT": 2, "fclose": 2, "bottomScreen": 3, "translateCoords": 1, "x": 85, "y": 19, "*x": 2, "*y": 1, "translate": 1, "dx": 2, "dy": 2, "sf2d_get_current_screen": 4, "push": 3, "pop": 1, "setScissor": 1, "width": 3, "height": 3, "GPU_SCISSORMODE": 1, "mode": 4, "GPU_SCISSOR_NORMAL": 1, "GPU_SCISSOR_DISABLE": 1, "sf2d_set_scissor_test": 1, "PY_SSIZE_T_CLEAN": 1, "Py_PYTHON_H": 1, "Python": 1, "headers": 1, "needed": 2, "compile": 1, "C": 1, "extensions": 1, "please": 1, "install": 1, "development": 1, "Python.": 1, "": 1, "offsetof": 2, "member": 2, "type*": 1, "WIN32": 3, "MS_WINDOWS": 2, "__stdcall": 2, "__cdecl": 2, "__fastcall": 2, "DL_IMPORT": 2, "DL_EXPORT": 2, "PY_LONG_LONG": 5, "LONG_LONG": 1, "PY_VERSION_HEX": 9, "METH_COEXIST": 1, "PyDict_CheckExact": 1, "op": 28, "Py_TYPE": 4, "PyDict_Type": 1, "PyDict_Contains": 1, "d": 9, "o": 20, "PySequence_Contains": 1, "Py_ssize_t": 17, "PY_SSIZE_T_MAX": 1, "INT_MAX": 1, "PY_SSIZE_T_MIN": 1, "INT_MIN": 1, "PY_FORMAT_SIZE_T": 1, "PyInt_FromSsize_t": 2, "z": 46, "PyInt_FromLong": 13, "PyInt_AsSsize_t": 2, "PyInt_AsLong": 2, "PyNumber_Index": 1, "PyNumber_Int": 1, "PyIndex_Check": 1, "PyNumber_Check": 1, "PyErr_WarnEx": 1, "category": 2, "stacklevel": 1, "PyErr_Warn": 1, "Py_REFCNT": 1, "ob": 6, "PyObject*": 16, "ob_refcnt": 1, "ob_type": 7, "Py_SIZE": 1, "PyVarObject*": 1, "ob_size": 1, "PyVarObject_HEAD_INIT": 1, "PyObject_HEAD_INIT": 1, "PyType_Modified": 1, "PyObject": 221, "*obj": 2, "len": 4, "itemsize": 2, "readonly": 3, "ndim": 2, "*format": 1, "*shape": 1, "*strides": 1, "*suboffsets": 1, "*internal": 1, "Py_buffer": 5, "PyBUF_SIMPLE": 1, "PyBUF_WRITABLE": 1, "PyBUF_FORMAT": 1, "PyBUF_ND": 2, "PyBUF_STRIDES": 5, "PyBUF_C_CONTIGUOUS": 3, "PyBUF_F_CONTIGUOUS": 3, "PyBUF_ANY_CONTIGUOUS": 1, "PyBUF_INDIRECT": 1, "PY_MAJOR_VERSION": 10, "__Pyx_BUILTIN_MODULE_NAME": 2, "Py_TPFLAGS_CHECKTYPES": 1, "Py_TPFLAGS_HAVE_INDEX": 1, "Py_TPFLAGS_HAVE_NEWBUFFER": 1, "PyBaseString_Type": 1, "PyUnicode_Type": 2, "PyStringObject": 2, "PyUnicodeObject": 1, "PyString_Type": 2, "PyString_Check": 2, "PyUnicode_Check": 1, "PyString_CheckExact": 2, "PyUnicode_CheckExact": 1, "PyBytesObject": 1, "PyBytes_Type": 1, "PyBytes_Check": 1, "PyBytes_CheckExact": 1, "PyBytes_FromString": 2, "PyString_FromString": 1, "PyBytes_FromStringAndSize": 1, "PyString_FromStringAndSize": 1, "PyBytes_FromFormat": 1, "PyString_FromFormat": 1, "PyBytes_DecodeEscape": 1, "PyString_DecodeEscape": 1, "PyBytes_AsString": 2, "PyString_AsString": 1, "PyBytes_AsStringAndSize": 1, "PyString_AsStringAndSize": 1, "PyBytes_Size": 1, "PyString_Size": 1, "PyBytes_AS_STRING": 1, "PyString_AS_STRING": 1, "PyBytes_GET_SIZE": 1, "PyString_GET_SIZE": 1, "PyBytes_Repr": 1, "PyString_Repr": 1, "PyBytes_Concat": 1, "PyString_Concat": 1, "PyBytes_ConcatAndDel": 1, "PyString_ConcatAndDel": 1, "PySet_Check": 1, "obj": 42, "PyObject_TypeCheck": 3, "PySet_Type": 2, "PyFrozenSet_Check": 1, "PyFrozenSet_Type": 1, "PySet_CheckExact": 2, "__Pyx_TypeCheck": 1, "PyTypeObject": 2, "PyIntObject": 1, "PyLongObject": 2, "PyInt_Type": 1, "PyLong_Type": 1, "PyInt_Check": 1, "PyLong_Check": 1, "PyInt_CheckExact": 1, "PyLong_CheckExact": 1, "PyInt_FromString": 1, "PyLong_FromString": 1, "PyInt_FromUnicode": 1, "PyLong_FromUnicode": 1, "PyLong_FromLong": 1, "PyInt_FromSize_t": 1, "PyLong_FromSize_t": 1, "PyLong_FromSsize_t": 1, "PyLong_AsLong": 1, "PyInt_AS_LONG": 1, "PyLong_AS_LONG": 1, "PyLong_AsSsize_t": 1, "PyInt_AsUnsignedLongMask": 1, "PyLong_AsUnsignedLongMask": 1, "PyInt_AsUnsignedLongLongMask": 1, "PyLong_AsUnsignedLongLongMask": 1, "PyBoolObject": 1, "__Pyx_PyNumber_Divide": 2, "PyNumber_TrueDivide": 1, "__Pyx_PyNumber_InPlaceDivide": 2, "PyNumber_InPlaceTrueDivide": 1, "PyNumber_Divide": 1, "PyNumber_InPlaceDivide": 1, "__Pyx_PySequence_GetSlice": 2, "PySequence_GetSlice": 2, "__Pyx_PySequence_SetSlice": 2, "PySequence_SetSlice": 2, "__Pyx_PySequence_DelSlice": 2, "PySequence_DelSlice": 2, "unlikely": 69, "PyErr_SetString": 4, "PyExc_SystemError": 3, "likely": 15, "tp_as_mapping": 3, "PyErr_Format": 4, "PyExc_TypeError": 5, "tp_name": 4, "PyMethod_New": 2, "func": 3, "self": 3, "klass": 1, "PyInstanceMethod_New": 1, "__Pyx_GetAttrString": 2, "PyObject_GetAttrString": 3, "__Pyx_SetAttrString": 2, "PyObject_SetAttrString": 2, "__Pyx_DelAttrString": 2, "PyObject_DelAttrString": 2, "__Pyx_NAMESTR": 3, "__Pyx_DOCSTR": 3, "__cplusplus": 10, "__PYX_EXTERN_C": 2, "_USE_MATH_DEFINES": 1, "": 1, "__PYX_HAVE_API__wrapper_inner": 1, "PYREX_WITHOUT_ASSERTIONS": 1, "CYTHON_WITHOUT_ASSERTIONS": 1, "CYTHON_INLINE": 68, "__GNUC__": 5, "__inline__": 1, "#elif": 7, "__inline": 1, "__STDC_VERSION__": 2, "CYTHON_UNUSED": 7, "**p": 1, "encoding": 1, "is_unicode": 1, "is_str": 1, "intern": 1, "__Pyx_StringTabEntry": 1, "__Pyx_PyBytes_FromUString": 1, "__Pyx_PyBytes_AsUString": 1, "__Pyx_PyBool_FromLong": 1, "Py_INCREF": 3, "Py_True": 2, "Py_False": 2, "__Pyx_PyObject_IsTrue": 8, "__Pyx_PyNumber_Int": 1, "__Pyx_PyIndex_AsSsize_t": 1, "__Pyx_PyInt_FromSize_t": 1, "__Pyx_PyInt_AsSize_t": 1, "__pyx_PyFloat_AsDouble": 3, "PyFloat_CheckExact": 1, "PyFloat_AS_DOUBLE": 1, "PyFloat_AsDouble": 1, "__GNUC_MINOR__": 1, "__builtin_expect": 2, "*__pyx_m": 1, "*__pyx_b": 1, "*__pyx_empty_tuple": 1, "*__pyx_empty_bytes": 1, "__pyx_lineno": 80, "__pyx_clineno": 80, "__pyx_cfilenm": 1, "__FILE__": 2, "*__pyx_filename": 1, "CYTHON_CCOMPLEX": 12, "_Complex_I": 3, "": 1, "": 1, "__sun__": 1, "1.0fj": 1, "*__pyx_f": 1, "npy_int8": 1, "__pyx_t_5numpy_int8_t": 1, "npy_int16": 1, "__pyx_t_5numpy_int16_t": 1, "npy_int32": 1, "__pyx_t_5numpy_int32_t": 1, "npy_int64": 1, "__pyx_t_5numpy_int64_t": 1, "npy_uint8": 1, "__pyx_t_5numpy_uint8_t": 1, "npy_uint16": 1, "__pyx_t_5numpy_uint16_t": 1, "npy_uint32": 1, "__pyx_t_5numpy_uint32_t": 1, "npy_uint64": 1, "__pyx_t_5numpy_uint64_t": 1, "npy_float32": 1, "__pyx_t_5numpy_float32_t": 1, "npy_float64": 1, "__pyx_t_5numpy_float64_t": 1, "npy_long": 1, "__pyx_t_5numpy_int_t": 1, "npy_longlong": 1, "__pyx_t_5numpy_long_t": 1, "npy_intp": 10, "__pyx_t_5numpy_intp_t": 1, "npy_uintp": 1, "__pyx_t_5numpy_uintp_t": 1, "npy_ulong": 1, "__pyx_t_5numpy_uint_t": 1, "npy_ulonglong": 1, "__pyx_t_5numpy_ulong_t": 1, "npy_double": 2, "__pyx_t_5numpy_float_t": 1, "__pyx_t_5numpy_double_t": 1, "npy_longdouble": 1, "__pyx_t_5numpy_longdouble_t": 1, "complex": 2, "__pyx_t_float_complex": 27, "_Complex": 2, "real": 2, "imag": 2, "__pyx_t_double_complex": 27, "npy_cfloat": 1, "__pyx_t_5numpy_cfloat_t": 1, "npy_cdouble": 2, "__pyx_t_5numpy_cdouble_t": 1, "npy_clongdouble": 1, "__pyx_t_5numpy_clongdouble_t": 1, "__pyx_t_5numpy_complex_t": 1, "CYTHON_REFNANNY": 3, "__Pyx_RefNannyAPIStruct": 4, "*__Pyx_RefNanny": 1, "__Pyx_RefNannyImportAPI": 1, "*modname": 1, "*m": 1, "*r": 1, "PyImport_ImportModule": 1, "modname": 1, "PyLong_AsVoidPtr": 1, "Py_XDECREF": 3, "__Pyx_RefNannySetupContext": 13, "*__pyx_refnanny": 1, "__Pyx_RefNanny": 6, "SetupContext": 1, "__LINE__": 84, "__Pyx_RefNannyFinishContext": 12, "FinishContext": 1, "__pyx_refnanny": 5, "__Pyx_INCREF": 36, "INCREF": 1, "__Pyx_DECREF": 65, "DECREF": 1, "__Pyx_GOTREF": 60, "GOTREF": 1, "__Pyx_GIVEREF": 10, "GIVEREF": 1, "__Pyx_XDECREF": 26, "Py_DECREF": 1, "__Pyx_XGIVEREF": 7, "__Pyx_XGOTREF": 1, "__Pyx_TypeTest": 4, "*type": 3, "*__Pyx_GetName": 1, "*dict": 1, "__Pyx_ErrRestore": 1, "*value": 2, "*tb": 2, "__Pyx_ErrFetch": 1, "**type": 1, "**value": 1, "**tb": 1, "__Pyx_Raise": 8, "__Pyx_RaiseNoneNotIterableError": 1, "__Pyx_RaiseNeedMoreValuesError": 1, "__Pyx_RaiseTooManyValuesError": 1, "expected": 1, "__Pyx_UnpackTupleError": 2, "*__Pyx_Import": 1, "*from_list": 1, "__Pyx_Print": 1, "__pyx_print": 1, "__pyx_print_kwargs": 1, "__Pyx_PrintOne": 4, "*o": 1, "*__Pyx_PyInt_to_py_Py_intptr_t": 1, "Py_intptr_t": 1, "__Pyx_CREAL": 4, ".real": 3, "__Pyx_CIMAG": 4, ".imag": 3, "__real__": 1, "__imag__": 1, "_WIN32": 1, "__Pyx_SET_CREAL": 2, "__Pyx_SET_CIMAG": 2, "__pyx_t_float_complex_from_parts": 1, "__Pyx_c_eqf": 2, "__Pyx_c_sumf": 2, "__Pyx_c_difff": 2, "__Pyx_c_prodf": 2, "__Pyx_c_quotf": 2, "__Pyx_c_negf": 2, "__Pyx_c_is_zerof": 3, "__Pyx_c_conjf": 3, "conj": 3, "__Pyx_c_absf": 3, "abs": 2, "__Pyx_c_powf": 3, "pow": 2, "conjf": 1, "cabsf": 1, "cpowf": 1, "__Pyx_c_eq": 2, "__Pyx_c_sum": 2, "__Pyx_c_diff": 2, "__Pyx_c_prod": 2, "__Pyx_c_quot": 2, "__Pyx_c_neg": 2, "__Pyx_c_is_zero": 3, "__Pyx_c_conj": 3, "__Pyx_c_abs": 3, "__Pyx_c_pow": 3, "cabs": 1, "cpow": 1, "__Pyx_PyInt_AsUnsignedChar": 1, "short": 3, "__Pyx_PyInt_AsUnsignedShort": 1, "__Pyx_PyInt_AsUnsignedInt": 1, "__Pyx_PyInt_AsChar": 1, "__Pyx_PyInt_AsShort": 1, "__Pyx_PyInt_AsInt": 1, "signed": 5, "__Pyx_PyInt_AsSignedChar": 1, "__Pyx_PyInt_AsSignedShort": 1, "__Pyx_PyInt_AsSignedInt": 1, "__Pyx_PyInt_AsLongDouble": 1, "__Pyx_PyInt_AsUnsignedLong": 1, "__Pyx_PyInt_AsUnsignedLongLong": 1, "__Pyx_PyInt_AsLong": 1, "__Pyx_PyInt_AsLongLong": 1, "__Pyx_PyInt_AsSignedLong": 1, "__Pyx_PyInt_AsSignedLongLong": 1, "__Pyx_WriteUnraisable": 3, "__Pyx_ExportFunction": 1, "PyArray_Descr": 6, "__pyx_f_5numpy_set_array_base": 1, "PyArrayObject": 19, "*__pyx_f_5numpy_get_array_base": 1, "inner_work_1d": 2, "inner_work_2d": 2, "__Pyx_MODULE_NAME": 1, "*__pyx_builtin_ValueError": 1, "*__pyx_builtin_range": 1, "*__pyx_builtin_RuntimeError": 1, "__pyx_k_1": 1, "__pyx_k_2": 1, "__pyx_k_3": 1, "__pyx_k_5": 1, "__pyx_k_7": 1, "__pyx_k_9": 1, "__pyx_k_11": 1, "__pyx_k_12": 1, "__pyx_k_15": 1, "__pyx_k__B": 2, "__pyx_k__H": 2, "__pyx_k__I": 2, "__pyx_k__L": 2, "__pyx_k__O": 2, "__pyx_k__Q": 2, "__pyx_k__b": 2, "__pyx_k__d": 2, "__pyx_k__f": 2, "__pyx_k__g": 2, "__pyx_k__h": 2, "__pyx_k__i": 2, "__pyx_k__l": 2, "__pyx_k__q": 2, "__pyx_k__Zd": 2, "__pyx_k__Zf": 2, "__pyx_k__Zg": 2, "__pyx_k__np": 1, "__pyx_k__buf": 1, "__pyx_k__obj": 1, "__pyx_k__base": 1, "__pyx_k__ndim": 1, "__pyx_k__ones": 1, "__pyx_k__descr": 1, "__pyx_k__names": 1, "__pyx_k__numpy": 1, "__pyx_k__range": 1, "__pyx_k__shape": 1, "__pyx_k__fields": 1, "__pyx_k__format": 1, "__pyx_k__strides": 1, "__pyx_k____main__": 1, "__pyx_k____test__": 1, "__pyx_k__itemsize": 1, "__pyx_k__readonly": 1, "__pyx_k__type_num": 1, "__pyx_k__byteorder": 1, "__pyx_k__ValueError": 1, "__pyx_k__suboffsets": 1, "__pyx_k__work_module": 1, "__pyx_k__RuntimeError": 1, "__pyx_k__pure_py_test": 1, "__pyx_k__wrapper_inner": 1, "__pyx_k__do_awesome_work": 1, "*__pyx_kp_s_1": 1, "*__pyx_kp_u_11": 1, "*__pyx_kp_u_12": 1, "*__pyx_kp_u_15": 1, "*__pyx_kp_s_2": 1, "*__pyx_kp_s_3": 1, "*__pyx_kp_u_5": 1, "*__pyx_kp_u_7": 1, "*__pyx_kp_u_9": 1, "*__pyx_n_s__RuntimeError": 1, "*__pyx_n_s__ValueError": 1, "*__pyx_n_s____main__": 1, "*__pyx_n_s____test__": 1, "*__pyx_n_s__base": 1, "*__pyx_n_s__buf": 1, "*__pyx_n_s__byteorder": 1, "*__pyx_n_s__descr": 1, "*__pyx_n_s__do_awesome_work": 1, "*__pyx_n_s__fields": 1, "*__pyx_n_s__format": 1, "*__pyx_n_s__itemsize": 1, "*__pyx_n_s__names": 1, "*__pyx_n_s__ndim": 1, "*__pyx_n_s__np": 1, "*__pyx_n_s__numpy": 1, "*__pyx_n_s__obj": 1, "*__pyx_n_s__ones": 1, "*__pyx_n_s__pure_py_test": 1, "*__pyx_n_s__range": 1, "*__pyx_n_s__readonly": 1, "*__pyx_n_s__shape": 1, "*__pyx_n_s__strides": 1, "*__pyx_n_s__suboffsets": 1, "*__pyx_n_s__type_num": 1, "*__pyx_n_s__work_module": 1, "*__pyx_n_s__wrapper_inner": 1, "*__pyx_int_5": 1, "*__pyx_int_15": 1, "*__pyx_k_tuple_4": 1, "*__pyx_k_tuple_6": 1, "*__pyx_k_tuple_8": 1, "*__pyx_k_tuple_10": 1, "*__pyx_k_tuple_13": 1, "*__pyx_k_tuple_14": 1, "*__pyx_k_tuple_16": 1, "__pyx_v_num_x": 4, "*__pyx_v_data_ptr": 2, "*__pyx_v_answer_ptr": 2, "__pyx_v_nd": 6, "*__pyx_v_dims": 2, "__pyx_v_typenum": 6, "*__pyx_v_data_np": 2, "__pyx_v_sum": 6, "__pyx_t_1": 154, "*__pyx_t_2": 4, "*__pyx_t_3": 4, "*__pyx_t_4": 3, "__pyx_t_5": 75, "__pyx_kp_s_1": 1, "__pyx_filename": 79, "__pyx_f": 79, "__pyx_L1_error": 88, "__pyx_v_dims": 4, "NPY_DOUBLE": 3, "__pyx_t_2": 120, "PyArray_SimpleNewFromData": 2, "__pyx_v_data_ptr": 2, "Py_None": 38, "__pyx_ptype_5numpy_ndarray": 2, "__pyx_v_data_np": 10, "__Pyx_GetName": 4, "__pyx_m": 4, "__pyx_n_s__work_module": 3, "__pyx_t_3": 113, "PyObject_GetAttr": 4, "__pyx_n_s__do_awesome_work": 3, "PyTuple_New": 4, "PyTuple_SET_ITEM": 4, "__pyx_t_4": 35, "PyObject_Call": 11, "PyErr_Occurred": 2, "__pyx_v_answer_ptr": 2, "__pyx_L0": 24, "__pyx_v_num_y": 2, "__pyx_kp_s_2": 1, "*__pyx_self": 2, "*unused": 2, "PyMethodDef": 1, "PyCFunction": 1, "METH_NOARGS": 1, "*__pyx_v_data": 1, "*__pyx_r": 7, "*__pyx_t_1": 8, "__pyx_self": 2, "__pyx_v_data": 7, "__pyx_kp_s_3": 1, "__pyx_n_s__np": 1, "__pyx_n_s__ones": 1, "__pyx_k_tuple_4": 1, "__pyx_r": 39, "__Pyx_AddTraceback": 7, "*__pyx_v_self": 4, "*__pyx_v_info": 4, "__pyx_v_flags": 4, "__pyx_v_copy_shape": 5, "__pyx_v_i": 6, "__pyx_v_ndim": 6, "__pyx_v_endian_detector": 6, "__pyx_v_little_endian": 8, "__pyx_v_t": 29, "*__pyx_v_f": 2, "*__pyx_v_descr": 2, "__pyx_v_offset": 9, "__pyx_v_hasfields": 4, "__pyx_t_6": 40, "__pyx_t_7": 9, "*__pyx_t_8": 1, "*__pyx_t_9": 1, "__pyx_v_info": 33, "__pyx_v_self": 16, "PyArray_NDIM": 1, "__pyx_L5": 6, "PyArray_CHKFLAGS": 2, "NPY_C_CONTIGUOUS": 1, "__pyx_builtin_ValueError": 5, "__pyx_k_tuple_6": 1, "__pyx_L6": 6, "NPY_F_CONTIGUOUS": 1, "__pyx_k_tuple_8": 1, "__pyx_L7": 2, "PyArray_DATA": 1, "strides": 5, "shape": 3, "PyArray_STRIDES": 2, "PyArray_DIMS": 2, "__pyx_L8": 2, "suboffsets": 1, "PyArray_ITEMSIZE": 1, "PyArray_ISWRITEABLE": 1, "__pyx_v_f": 31, "descr": 2, "__pyx_v_descr": 10, "PyDataType_HASFIELDS": 2, "__pyx_L11": 7, "type_num": 2, "byteorder": 4, "__pyx_k_tuple_10": 1, "__pyx_L13": 2, "NPY_BYTE": 2, "__pyx_L14": 18, "NPY_UBYTE": 2, "NPY_SHORT": 2, "NPY_USHORT": 2, "NPY_INT": 2, "NPY_UINT": 2, "NPY_LONG": 1, "NPY_ULONG": 1, "NPY_LONGLONG": 1, "NPY_ULONGLONG": 1, "NPY_FLOAT": 1, "NPY_LONGDOUBLE": 1, "NPY_CFLOAT": 1, "NPY_CDOUBLE": 1, "NPY_CLONGDOUBLE": 1, "NPY_OBJECT": 1, "__pyx_t_8": 16, "PyNumber_Remainder": 1, "__pyx_kp_u_11": 1, "format": 6, "__pyx_L12": 2, "__pyx_t_9": 7, "__pyx_f_5numpy__util_dtypestring": 1, "__pyx_L2": 2, "PyArray_HASFIELDS": 1, "*__pyx_v_a": 5, "PyArray_MultiIterNew": 5, "__pyx_v_a": 5, "*__pyx_v_b": 4, "__pyx_v_b": 4, "*__pyx_v_c": 3, "__pyx_v_c": 3, "*__pyx_v_d": 2, "__pyx_v_d": 2, "*__pyx_v_e": 1, "__pyx_v_e": 1, "*__pyx_v_end": 1, "*__pyx_v_offset": 1, "*__pyx_v_child": 1, "*__pyx_v_fields": 1, "*__pyx_v_childname": 1, "*__pyx_v_new_offset": 1, "*__pyx_v_t": 1, "*__pyx_t_5": 1, "__pyx_t_10": 7, "*__pyx_t_11": 1, "__pyx_v_child": 8, "__pyx_v_fields": 7, "__pyx_v_childname": 4, "__pyx_v_new_offset": 5, "names": 2, "PyTuple_GET_SIZE": 2, "PyTuple_GET_ITEM": 3, "PyObject_GetItem": 1, "fields": 4, "PyTuple_CheckExact": 1, "tuple": 3, "__pyx_ptype_5numpy_dtype": 1, "__pyx_v_end": 2, "PyNumber_Subtract": 2, "PyObject_RichCompare": 8, "__pyx_int_15": 1, "Py_LT": 2, "__pyx_builtin_RuntimeError": 2, "__pyx_k_tuple_13": 1, "__pyx_k_tuple_14": 1, "elsize": 1, "__pyx_k_tuple_16": 1, "__pyx_L10": 2, "Py_EQ": 6, "__P": 1, "": 1, "": 1, "*env_instance": 1, "*Env": 1, "instance": 3, "env_instance": 3, "QCoreApplication": 1, "**envp": 1, "**env": 1, "envvar": 2, "indexOfEquals": 1, "env": 2, "": 1, "": 1, "": 1, "Person_descriptor_": 5, "GeneratedMessageReflection*": 1, "Person_reflection_": 3, "FileDescriptor*": 1, "DescriptorPool": 3, "generated_pool": 2, "FindFileByName": 1, "GOOGLE_CHECK": 1, "message_type": 1, "Person_offsets_": 2, "GeneratedMessageReflection": 1, "MessageFactory": 3, "generated_factory": 1, "GOOGLE_PROTOBUF_DECLARE_ONCE": 1, "protobuf_AssignDescriptors_once_": 2, "protobuf_AssignDescriptorsOnce": 3, "GoogleOnceInit": 1, "protobuf_RegisterTypes": 2, "InternalRegisterGeneratedMessage": 1, "already_here": 3, "GOOGLE_PROTOBUF_VERIFY_VERSION": 1, "InternalAddGeneratedFile": 1, "InternalRegisterGeneratedFile": 1, "OnShutdown": 1, "*default_instance_": 1, "DO_": 4, "EXPRESSION": 2, "ReadTag": 1, "WireFormatLite": 9, "GetTagFieldNumber": 1, "GetTagWireType": 2, "WIRETYPE_LENGTH_DELIMITED": 1, "ReadString": 1, "WireFormat": 10, "VerifyUTF8String": 3, ".data": 3, ".length": 3, "PARSE": 1, "handle_uninterpreted": 2, "ExpectAtEnd": 1, "WIRETYPE_END_GROUP": 1, "SkipField": 1, "SERIALIZE": 2, "WriteString": 1, ".empty": 5, "SerializeUnknownFields": 1, "target": 6, "WriteStringToArray": 1, "SerializeUnknownFieldsToArray": 1, "total_size": 5, "StringSize": 1, "ComputeUnknownFieldsSize": 1, "GOOGLE_CHECK_NE": 1, "dynamic_cast_if_available": 1, "ReflectionOps": 1, "Merge": 1, "V8_SCANNER_H_": 2, "ParsingFlags": 1, "kNoParsingFlags": 1, "kLanguageModeMask": 4, "kAllowLazy": 1, "kAllowNativesSyntax": 1, "kAllowModules": 1, "STATIC_ASSERT": 6, "CLASSIC_MODE": 2, "STRICT_MODE": 2, "EXTENDED_MODE": 2, "HexValue": 2, "uc32": 20, "detect": 1, "0x11..0x16": 1, "0x31..0x36.": 1, "Utf16CharacterStream": 3, "pos_": 2, "Advance": 46, "buffer_cursor_": 1, "buffer_end_": 1, "ReadBlock": 1, "": 1, "ENTITY_H": 2, "///": 19, "@namespace": 1, "Whitedrop": 2, "Entity": 7, "mesh": 1, "Ogre": 7, "Vector3": 4, "dimensions": 1, "position": 1, "material": 1, "ref": 2, "ent": 1, "SceneManager*": 1, "sceneMgr": 1, "mMesh": 1, "mId": 1, "mMaterial": 1, "mDimensions": 1, "mPosition": 1, "Entity*": 1, "mEntity": 1, "SceneNode*": 1, "mNode": 1, "marker": 3, "*text": 1, "*start": 1, "text": 8, "*marker": 2, "*token": 1, "do_scan": 5, "expect": 2, "res": 4, "cerr": 2, "void**": 1, "Memory16F88": 2, "memory": 12, "map": 1, "MemoryLocation": 1, "memoryMap": 1, "Dereference": 1, "bank": 2, "*Reference": 1, "*operator": 1, "": 1, "": 1, "": 1, "CCrypter": 6, "SetKeyFromPassphrase": 1, "SecureString": 1, "strKeyData": 2, "chSalt": 2, "nRounds": 3, "nDerivationMethod": 2, "chSalt.size": 1, "WALLET_CRYPTO_SALT_SIZE": 1, "EVP_BytesToKey": 1, "EVP_aes_256_cbc": 3, "EVP_sha512": 1, "strKeyData.size": 1, "chKey": 7, "chIV": 13, "WALLET_CRYPTO_KEY_SIZE": 7, "OPENSSL_cleanse": 2, "fKeySet": 4, "SetKey": 1, "CKeyingMaterial": 8, "chNewKey": 2, "chNewIV": 2, "chNewKey.size": 1, "chNewIV.size": 1, "Encrypt": 1, "vchPlaintext": 10, "vchCiphertext": 10, "nLen": 6, "vchPlaintext.size": 1, "nCLen": 5, "AES_BLOCK_SIZE": 1, "nFLen": 6, "EVP_CIPHER_CTX": 2, "ctx": 38, "fOk": 19, "EVP_CIPHER_CTX_init": 2, "EVP_EncryptInit_ex": 1, "EVP_EncryptUpdate": 1, "EVP_EncryptFinal_ex": 1, "EVP_CIPHER_CTX_cleanup": 2, "vchCiphertext.resize": 1, "Decrypt": 1, "vchCiphertext.size": 1, "nPLen": 5, "EVP_DecryptInit_ex": 1, "EVP_DecryptUpdate": 1, "EVP_DecryptFinal_ex": 1, "vchPlaintext.resize": 1, "EncryptSecret": 1, "vMasterKey": 4, "nIV": 4, "cKeyCrypter": 2, "cKeyCrypter.SetKey": 2, "cKeyCrypter.Encrypt": 1, "DecryptSecret": 1, "cKeyCrypter.Decrypt": 1, "CKeyingMaterial*": 1, "LIBCANIH": 2, "": 2, "int64": 2, "//#define": 1, "dout": 2, "libcanister": 2, "//the": 9, "canmem": 22, "object": 3, "generic": 1, "container": 2, "commonly": 1, "//throughout": 1, "canister": 18, "framework": 1, "hold": 1, "uncertain": 1, "//length": 1, "may": 3, "or": 4, "not": 7, "contain": 1, "null": 3, "bytes.": 1, "raw": 2, "block": 5, "absolute": 1, "//creates": 3, "unallocated": 1, "allocsize": 1, "allocated": 1, "blank": 1, "strdata": 1, "//automates": 1, "creation": 1, "zero": 5, "limited": 2, "canmems": 1, "//cleans": 1, "zeromem": 1, "//overwrites": 2, "fragmem": 1, "fragment": 3, "notation": 1, "countlen": 1, "//counts": 1, "strings": 1, "stores": 3, "trim": 2, "//removes": 1, "nulls": 1, "//returns": 2, "singleton": 2, "//contains": 2, "information": 1, "caninfo": 2, "path": 8, "//physical": 1, "internalname": 1, "//a": 1, "numfiles": 1, "files": 7, "//necessary": 1, "use": 2, "as": 7, "canfile": 6, "//this": 2, "holds": 2, "within": 2, "//canister": 1, "canister*": 1, "parent": 1, "that": 4, "//internal": 1, "isfrag": 1, "//0": 2, "probably": 1, "definitely": 1, "ignore": 1, "cfid": 1, "unique": 1, "dsize": 1, "//ondisk": 1, "compressed": 1, "form": 1, "cachestate": 1, "needs": 2, "flush": 3, "check": 3, "cache": 6, "//pull": 1, "cachedump": 2, "//deletes": 2, "contents": 4, "assuring": 1, "on": 3, "copy": 2, "date": 1, "cachedumpfinal": 1, "fstream": 1, "infile": 1, "//same": 1, "but": 5, "more": 1, "efficient": 1, "during": 1, "closing": 3, "procedures": 1, "//updates": 1, "retains": 1, "primary": 2, "defines": 1, "controls": 1, "single": 2, "//table": 1, "//absolutely": 1, "worthless": 1, "control": 1, "//but": 1, "quite": 1, "useful": 2, "programs": 2, "API": 1, "they": 1, "//desire": 1, "enumerate": 1, "user": 1, "//use": 1, "their": 1, "own.": 1, "newline": 2, "delimited": 2, "list": 2, "container.": 1, "TOC": 1, "general": 1, "canfiles": 1, "recommended": 1, "modify": 1, "//these": 1, "directly": 1, "enforced.": 1, "canfile*": 1, "//if": 1, "then": 1, "no": 2, "write": 1, "routines": 1, "anything": 1, "//maximum": 1, "have": 3, "given": 4, "//time": 1, "change": 1, "whatever": 1, "suits": 1, "application.": 1, "cachemax": 2, "cachecnt": 1, "//number": 1, "should": 2, "modified": 1, "//both": 1, "physical": 1, "fspath": 3, "//destroys": 1, "flushing": 1, "modded": 1, "buffers": 2, "course": 1, "//open": 1, "//does": 1, "exist": 2, "open": 5, "//close": 1, "inside": 1, "delFile": 1, "//pulls": 1, "returns": 2, "getFile": 1, "does": 1, "otherwise": 1, "overwrites": 1, "whether": 2, "operation": 2, "writeFile": 2, "//get": 1, "containing": 1, "//list": 1, "paths": 1, "getTOC": 1, "//brings": 1, "back": 1, "limit": 4, "//important": 1, "sCFID": 2, "safe": 1, "CFID": 2, "we": 9, "uncaching": 1, "//really": 1, "just": 1, "internally": 1, "can": 2, "cacheclean": 1, "dFlush": 1, "rpc_init": 1, "rpc_server_loop": 1, "": 1, "BOOST_ASIO_HAS_EPOLL": 1, "": 1, "": 1, "": 1, "BOOST_ASIO_HAS_TIMERFD": 19, "boost": 73, "asio": 13, "detail": 4, "epoll_reactor": 40, "io_service": 6, "service_base": 1, "": 1, "io_service_": 1, "use_service": 1, "": 1, "mutex_": 13, "interrupter_": 5, "epoll_fd_": 20, "do_epoll_create": 3, "timer_fd_": 21, "do_timerfd_create": 3, "shutdown_": 10, "epoll_event": 10, "ev": 21, "ev.events": 13, "EPOLLIN": 8, "EPOLLERR": 8, "EPOLLET": 5, "ev.data.ptr": 10, "epoll_ctl": 12, "EPOLL_CTL_ADD": 7, "interrupter_.read_descriptor": 3, "interrupter_.interrupt": 2, "shutdown_service": 1, "mutex": 16, "scoped_lock": 16, "lock.unlock": 1, "op_queue": 6, "": 6, "ops": 10, "descriptor_state*": 6, "registered_descriptors_.first": 2, "max_ops": 6, "ops.push": 5, "op_queue_": 12, "registered_descriptors_.free": 2, "timer_queues_.get_all_timers": 1, "io_service_.abandon_operations": 1, "fork_service": 1, "fork_event": 1, "fork_ev": 2, "fork_child": 1, "interrupter_.recreate": 1, "update_timeout": 2, "descriptors_lock": 3, "registered_descriptors_mutex_": 3, "next_": 2, "registered_events_": 8, "descriptor_": 5, "system": 4, "error_code": 4, "ec": 5, "errno": 10, "get_system_category": 3, "throw_error": 2, "init_task": 1, "io_service_.init_task": 1, "register_descriptor": 1, "socket_type": 7, "per_descriptor_data": 8, "descriptor_data": 60, "allocate_descriptor_state": 3, "descriptor_lock": 7, "reactor_": 7, "EPOLLHUP": 3, "EPOLLPRI": 3, "register_internal_descriptor": 1, "op_type": 8, "reactor_op*": 5, ".push": 2, "move_descriptor": 1, "target_descriptor_data": 2, "source_descriptor_data": 3, "start_op": 1, "is_continuation": 5, "allow_speculative": 2, "ec_": 4, "bad_descriptor": 1, "post_immediate_completion": 2, "read_op": 1, "except_op": 1, "perform": 2, "descriptor_lock.unlock": 4, "write_op": 2, "EPOLLOUT": 4, "EPOLL_CTL_MOD": 3, "io_service_.work_started": 2, "cancel_ops": 1, ".front": 3, "operation_aborted": 2, ".pop": 3, "deregister_descriptor": 1, "EPOLL_CTL_DEL": 2, "free_descriptor_state": 3, "deregister_internal_descriptor": 1, "run": 1, "timeout": 4, "get_timeout": 5, "events": 8, "num_events": 2, "epoll_wait": 1, "check_timers": 6, ".data.ptr": 1, "": 2, "set_ready_events": 1, ".events": 1, "common_lock": 1, "timer_queues_.get_ready_timers": 1, "itimerspec": 5, "new_timeout": 6, "old_timeout": 4, "flags": 4, "timerfd_settime": 2, "interrupt": 2, "EPOLL_CLOEXEC": 4, "epoll_create1": 1, "EINVAL": 4, "ENOSYS": 1, "epoll_create": 1, "epoll_size": 1, "fcntl": 2, "F_SETFD": 2, "FD_CLOEXEC": 2, "timerfd_create": 2, "CLOCK_MONOTONIC": 2, "TFD_CLOEXEC": 1, "registered_descriptors_.alloc": 1, "do_add_timer_queue": 1, "timer_queue_base": 2, "queue": 6, "timer_queues_.insert": 1, "do_remove_timer_queue": 1, "timer_queues_.erase": 1, "timer_queues_.wait_duration_msec": 1, "ts": 1, "ts.it_interval.tv_sec": 1, "ts.it_interval.tv_nsec": 1, "usec": 5, "timer_queues_.wait_duration_usec": 1, "ts.it_value.tv_sec": 1, "ts.it_value.tv_nsec": 1, "TFD_TIMER_ABSTIME": 1, "perform_io_cleanup_on_block_exit": 4, "epoll_reactor*": 2, "first_op_": 3, "ops_.empty": 1, "ops_": 2, "operation*": 4, "descriptor_state": 5, "do_complete": 2, "perform_io": 2, "mutex_.lock": 1, "io_cleanup": 1, "adopt_lock": 1, "flag": 2, "j": 10, "io_cleanup.ops_.push": 1, "io_cleanup.first_op_": 2, "io_cleanup.ops_.front": 1, "io_cleanup.ops_.pop": 1, "io_service_impl*": 1, "owner": 2, "base": 4, "bytes_transferred": 2, "complete": 1, "NINJA_METRICS_H_": 3, "For": 2, "int64_t.": 1, "The": 3, "Metrics": 2, "module": 1, "debug": 1, "dumps": 1, "timing": 2, "stats": 2, "various": 1, "actions.": 1, "To": 1, "see": 1, "METRIC_RECORD": 4, "below.": 1, "A": 3, "metrics": 2, "Metric": 1, "Number": 3, "times": 1, "count": 1, "Total": 1, "time": 3, "micros": 1, "sum": 1, "scoped": 1, "recording": 1, "metric": 2, "across": 1, "body": 1, "function.": 2, "macro.": 1, "ScopedMetric": 4, "Metric*": 4, "metric_": 1, "Timestamp": 1, "when": 1, "measurement": 1, "started.": 1, "platform": 1, "dependent.": 1, "start_": 1, "prints": 1, "report.": 1, "NewMetric": 2, "Print": 1, "summary": 1, "report": 2, "stdout.": 1, "Report": 1, "": 1, "metrics_": 1, "Get": 1, "some": 1, "epoch.": 1, "Epoch": 1, "varies": 1, "between": 1, "platforms": 1, "only": 2, "measuring": 1, "elapsed": 1, "time.": 1, "GetTimeMillis": 1, "simple": 1, "stopwatch": 1, "seconds": 1, "since": 2, "Restart": 3, "called.": 1, "Stopwatch": 2, "started_": 4, "Seconds": 1, "call.": 1, "Elapsed": 1, "Now": 3, "interface": 1, "metrics.": 1, "function": 1, "get": 1, "recorded": 1, "each": 1, "call": 1, "metrics_h_metric": 2, "g_metrics": 3, "metrics_h_scoped": 1, "Metrics*": 1, "UnicodeCache*": 1, "unicode_cache": 2, "unicode_cache_": 17, "octal_pos_": 3, "invalid": 1, "harmony_scoping_": 2, "harmony_modules_": 2, "Utf16CharacterStream*": 1, "source_": 3, "has_line_terminator_before_next_": 7, "SkipWhiteSpace": 3, "Scan": 4, "ScanHexNumber": 4, "expected_length": 3, "prevent": 1, "overflow": 1, "digits": 6, "c0_": 103, "PushBack": 7, "NUM_TOKENS": 1, "byte": 1, "one_char_tokens": 2, "ILLEGAL": 128, "LPAREN": 2, "RPAREN": 2, "COMMA": 2, "COLON": 2, "SEMICOLON": 2, "CONDITIONAL": 2, "LBRACK": 2, "RBRACK": 2, "LBRACE": 2, "RBRACE": 2, "BIT_NOT": 2, "Next": 1, "": 1, "source_pos": 13, "next_.token": 2, "next_.location.beg_pos": 4, "next_.location.end_pos": 5, "current_.token": 2, "IsByteOrderMark": 2, "start_position": 2, "IsWhiteSpace": 1, "IsLineTerminator": 7, "SkipSingleLineComment": 5, "undo": 4, "WHITESPACE": 6, "SkipMultiLineComment": 2, "ScanHtmlComment": 2, "LT": 2, "next_.literal_chars": 3, "ScanString": 2, "Select": 30, "LTE": 1, "ASSIGN_SHL": 1, "SHL": 1, "GTE": 1, "ASSIGN_SAR": 1, "ASSIGN_SHR": 1, "SHR": 1, "SAR": 1, "GT": 1, "EQ_STRICT": 1, "EQ": 1, "ASSIGN": 1, "NE_STRICT": 1, "NE": 1, "NOT": 2, "INC": 1, "ASSIGN_ADD": 1, "ADD": 1, "DEC": 1, "ASSIGN_SUB": 1, "SUB": 1, "ASSIGN_MUL": 1, "MUL": 1, "ASSIGN_MOD": 1, "MOD": 1, "ASSIGN_DIV": 1, "DIV": 1, "AND": 1, "ASSIGN_BIT_AND": 1, "BIT_AND": 1, "OR": 1, "ASSIGN_BIT_OR": 1, "BIT_OR": 1, "ASSIGN_BIT_XOR": 1, "BIT_XOR": 1, "IsDecimalDigit": 6, "ScanNumber": 3, "PERIOD": 1, "IsIdentifierStart": 4, "ScanIdentifierOrKeyword": 2, "EOS": 1, "SeekForward": 2, "current_pos": 4, "ASSERT_EQ": 1, "ScanEscape": 2, "IsCarriageReturn": 2, "IsLineFeed": 2, "fall": 9, "through": 10, "ScanOctalEscape": 2, "AddLiteralChar": 10, "nx": 3, "quote": 5, "consume": 3, "LiteralScope": 5, "literal": 9, "literal.Complete": 5, "STRING": 1, "ScanDecimalDigits": 5, "AddLiteralCharAdvance": 12, "seen_period": 2, "digit": 2, "fraction": 1, "DECIMAL": 4, "HEX": 3, "OCTAL": 3, "kind": 7, "know": 1, "least": 1, "one": 1, "start_pos": 2, "reporting": 1, "octal": 1, "positions.": 1, "IsHexDigit": 3, "optional": 2, "must": 1, "scanned": 1, "part": 1, "hex": 1, "exponent": 1, "octals": 1, "allowed": 1, "NUMBER": 1, "ScanIdentifierUnicodeEscape": 3, "KEYWORDS": 2, "KEYWORD_GROUP": 16, "KEYWORD": 48, "CATCH": 1, "FUTURE_RESERVED_WORD": 6, "DEBUGGER": 1, "DELETE": 1, "harmony_modules": 3, "EXPORT": 1, "FALSE_LITERAL": 1, "FINALLY": 1, "FUTURE_STRICT_RESERVED_WORD": 9, "IMPORT": 1, "IN": 1, "INSTANCEOF": 1, "harmony_scoping": 2, "LET": 1, "NEW": 1, "NULL_LITERAL": 1, "THIS": 1, "THROW": 1, "TRUE_LITERAL": 1, "TRY": 1, "TYPEOF": 1, "VAR": 1, "WITH": 1, "KeywordOrIdentifierToken": 2, "input_length": 5, "kMinLength": 3, "kMaxLength": 3, "IDENTIFIER": 4, "KEYWORD_GROUP_CASE": 2, "keyword": 11, "keyword_length": 12, "No": 1, "recursive": 1, "escapes.": 1, "ScanIdentifierSuffix": 3, "first_char": 2, "IsIdentifierPart": 4, "next_char": 2, "is_ascii": 1, "Vector": 1, "chars": 1, "ascii_literal": 1, "chars.start": 1, "chars.length": 1, "LiteralScope*": 1, "Complete": 1, "ScanRegExpPattern": 1, "seen_equal": 4, "in_character_class": 4, "Escape": 1, "sequence.": 1, "Unescaped": 1, "character.": 1, "ScanLiteralUnicodeEscape": 2, "chars_read": 4, "ScanRegExpFlags": 1, "HEADER_INCLUDES": 3, "SET_SYMBOL": 3, "ALL_STAGES": 2, "llvmo": 820, "APFloat_O": 16, "___set_static_ClassSymbol": 66, "LOOKUP_SYMBOL": 66, "static_packageName": 66, "static_className": 179, "APInt_O": 16, "Attribute_O": 16, "Builder_O": 16, "DebugLoc_O": 16, "EngineBuilder_O": 16, "ExecutionEngine_O": 16, "IRBuilderBase_O": 16, "InsertPoint_O": 16, "LLVMContext_O": 16, "Module_O": 16, "PassManagerBase_O": 16, "Pass_O": 16, "Type_O": 16, "Value_O": 16, "Argument_O": 16, "BasicBlock_O": 16, "CompositeType_O": 16, "FunctionPassManager_O": 16, "FunctionPass_O": 16, "FunctionType_O": 16, "IRBuilder_O": 16, "IntegerType_O": 16, "MDNode_O": 16, "MDString_O": 16, "ModulePass_O": 16, "User_O": 16, "Constant_O": 16, "ImmutablePass_O": 16, "Instruction_O": 16, "SequentialType_O": 16, "StructType_O": 16, "ArrayType_O": 16, "AtomicCmpXchgInst_O": 16, "AtomicRMWInst_O": 16, "CallInst_O": 16, "ConstantArray_O": 16, "ConstantDataSequential_O": 16, "ConstantExpr_O": 16, "ConstantFP_O": 16, "ConstantInt_O": 16, "ConstantPointerNull_O": 16, "DataLayout_O": 16, "FenceInst_O": 16, "GlobalValue_O": 16, "LandingPadInst_O": 16, "PHINode_O": 16, "PointerType_O": 16, "StoreInst_O": 16, "TerminatorInst_O": 16, "UnaryInstruction_O": 16, "UndefValue_O": 16, "VectorType_O": 16, "AllocaInst_O": 16, "BranchInst_O": 16, "ConstantDataArray_O": 16, "Function_O": 10, "GlobalVariable_O": 3, "IndirectBrInst_O": 3, "InvokeInst_O": 3, "LoadInst_O": 3, "ResumeInst_O": 3, "ReturnInst_O": 3, "SwitchInst_O": 3, "UnreachableInst_O": 3, "VAArgInst_O": 3, "CREATE_CLASS": 1, "core": 115, "MetaClass_sp": 1, "undefinedMetaClass": 114, "undefinedMetaClass.reset": 1, "LOG": 170, "BF": 170, "BuiltInClass_sp": 57, "classllvmo__APFloat_Oval": 8, "BuiltInClass_O": 57, "create": 57, "_lisp": 114, "static_classSymbol": 114, "___staticMetaClass": 57, "setf_findClass": 57, "AllocatorCallback": 57, "cb": 114, "new_Nil": 57, "": 113, "___set_static_newNil_callback": 57, "static_newNil_callback": 113, "setInstance_newNil_callback": 57, "nil_for_class": 280, "__setWeakThis": 56, "_nil": 56, "setInstanceNil": 56, "setSupportsSlots": 56, "static_supportsSlots": 56, "classllvmo__APInt_Oval": 8, "classllvmo__Attribute_Oval": 8, "classllvmo__Builder_Oval": 8, "classllvmo__DebugLoc_Oval": 8, "classllvmo__EngineBuilder_Oval": 8, "classllvmo__ExecutionEngine_Oval": 8, "classllvmo__IRBuilderBase_Oval": 8, "classllvmo__InsertPoint_Oval": 8, "classllvmo__LLVMContext_Oval": 8, "classllvmo__Module_Oval": 8, "classllvmo__PassManagerBase_Oval": 8, "classllvmo__Pass_Oval": 8, "classllvmo__Type_Oval": 8, "classllvmo__Value_Oval": 8, "classllvmo__Argument_Oval": 8, "classllvmo__BasicBlock_Oval": 8, "classllvmo__CompositeType_Oval": 8, "classllvmo__FunctionPass_Oval": 8, "classllvmo__FunctionType_Oval": 8, "classllvmo__IRBuilder_Oval": 8, "classllvmo__IntegerType_Oval": 8, "classllvmo__MDNode_Oval": 8, "classllvmo__MDString_Oval": 8, "classllvmo__ModulePass_Oval": 8, "classllvmo__User_Oval": 8, "classllvmo__Constant_Oval": 8, "classllvmo__ImmutablePass_Oval": 8, "classllvmo__Instruction_Oval": 8, "classllvmo__SequentialType_Oval": 8, "classllvmo__StructType_Oval": 8, "classllvmo__ArrayType_Oval": 8, "classllvmo__AtomicRMWInst_Oval": 8, "classllvmo__CallInst_Oval": 8, "classllvmo__ConstantArray_Oval": 8, "classllvmo__ConstantExpr_Oval": 8, "classllvmo__ConstantFP_Oval": 8, "classllvmo__ConstantInt_Oval": 8, "classllvmo__DataLayout_Oval": 8, "classllvmo__FenceInst_Oval": 8, "classllvmo__GlobalValue_Oval": 8, "classllvmo__LandingPadInst_Oval": 8, "classllvmo__PHINode_Oval": 8, "classllvmo__PointerType_Oval": 8, "classllvmo__StoreInst_Oval": 8, "classllvmo__TerminatorInst_Oval": 8, "classllvmo__UndefValue_Oval": 8, "classllvmo__VectorType_Oval": 8, "classllvmo__AllocaInst_Oval": 8, "classllvmo__BranchInst_Oval": 8, "classllvmo__Function_Oval": 6, "DEFAULT_DELIMITER": 1, "CsvStreamer": 5, "ofstream": 1, "File": 1, "row_buffer": 1, "row": 12, "columns": 2, "rows": 3, "records": 2, "including": 2, "header": 4, "delimiter": 2, "Delimiter": 1, "character": 2, "comma": 2, "sanitize": 1, "Returns": 1, "ready": 1, "into": 2, "Empty": 1, "CSV": 4, "streamer...": 1, "before": 1, "writing": 1, "Same": 1, "...": 1, "Opens": 3, "path/name": 3, "Ensures": 1, "closed": 1, "saved": 1, "delimiting": 1, "add_field": 1, "If": 1, "still": 1, "adds": 1, "field": 5, "save_fields": 1, "Call": 1, "save": 1, "writes": 2, "append": 10, "Appends": 5, "quoted": 1, "leading/trailing": 1, "spaces": 3, "trimmed": 1, "Like": 1, "specify": 1, "either": 1, "keep": 1, "writeln": 1, "Flushes": 1, "what": 1, "Saves": 1, "closes": 1, "field_count": 1, "Gets": 2, "row_count": 1, "__THREADED_QUEUE_H__": 2, "": 1, "T": 2, "ThreadedQueue": 3, "": 2, "pthread_mutex_t": 1, "queueMutex": 8, "pthread_cond_t": 1, "queueCond": 5, "pthread_mutexattr_t": 1, "mutexAttrs": 5, "pthread_condattr_t": 1, "condAttrs": 5, "pthread_mutexattr_init": 1, "pthread_mutexattr_settype": 1, "PTHREAD_MUTEX_ERRORCHECK": 1, "pthread_mutex_init": 1, "pthread_mutexattr_destroy": 1, "pthread_condattr_init": 1, "pthread_condattr_setpshared": 1, "PTHREAD_PROCESS_PRIVATE": 1, "pthread_cond_init": 1, "pthread_condattr_destroy": 1, "pthread_cond_destroy": 1, "pthread_mutex_destroy": 1, "waitItems": 1, "pthread_mutex_lock": 2, "pthread_cond_wait": 1, "pthread_mutex_unlock": 2, "signalItems": 2, "pthread_cond_broadcast": 1, "item": 2, "APPEND": 1, "outsize": 8, "*output": 2, "*pText": 2, "*pSize": 3, "*pbChanged": 2, "*limit": 1, "insize": 3, "__OG_MATH_INL__": 2, "og": 1, "OG_INLINE": 41, "Math": 41, "Abs": 1, "MASK_SIGNED": 2, "Fabs": 1, "f": 81, "uInt": 1, "*pf": 1, "": 1, "pf": 1, "fabsf": 1, "Round": 1, "floorf": 2, "Floor": 1, "Ceil": 1, "ceilf": 1, "Ftoi": 1, "@todo": 1, "testing": 1, "OG_ASM_MSVC": 4, "OG_FTOI_USE_SSE": 2, "SysInfo": 2, "cpu.general.SSE": 2, "__asm": 8, "cvttss2si": 1, "eax": 5, "mov": 6, "fld": 4, "fistp": 3, "//__asm": 3, "need": 3, "O_o": 3, "OG_ASM_GNU": 4, "__asm__": 4, "__volatile__": 4, "FtoiFast": 2, "Ftol": 1, "": 1, "Fmod": 1, "numerator": 2, "denominator": 2, "fmodf": 1, "Modf": 2, "modff": 2, "Sqrt": 2, "sqrtf": 2, "InvSqrt": 1, "OG_ASSERT": 4, "RSqrt": 1, "*reinterpret_cast": 2, "Log": 1, "logf": 3, "Log2": 1, "INV_LN_2": 1, "Log10": 1, "INV_LN_10": 1, "Pow": 1, "exp": 2, "powf": 1, "Exp": 1, "expf": 1, "IsPowerOfTwo": 4, "HigherPowerOfTwo": 4, "LowerPowerOfTwo": 2, "FloorPowerOfTwo": 1, "CeilPowerOfTwo": 1, "ClosestPowerOfTwo": 1, "high": 4, "low": 3, "Digits": 1, "step": 3, "Sin": 2, "sinf": 1, "ASin": 1, "HALF_PI": 2, "asinf": 1, "Cos": 2, "cosf": 1, "ACos": 1, "PI": 1, "acosf": 1, "Tan": 1, "tanf": 1, "ATan": 2, "atanf": 1, "f1": 2, "f2": 2, "atan2f": 1, "SinCos": 1, "_asm": 1, "fsincos": 1, "ecx": 2, "edx": 2, "fstp": 2, "dword": 2, "asm": 1, "faster": 1, "than": 1, "calling": 1, "Deg2Rad": 1, "DEG_TO_RAD": 1, "Rad2Deg": 1, "RAD_TO_DEG": 1, "Square": 1, "Cube": 1, "Sec2Ms": 1, "sec": 2, "Ms2Sec": 1, "ms": 2, "": 1, "": 1, "EC_KEY_regenerate_key": 1, "*eckey": 2, "BIGNUM": 9, "*priv_key": 1, "BN_CTX": 2, "*ctx": 2, "EC_POINT": 4, "*pub_key": 1, "eckey": 7, "EC_GROUP": 2, "*group": 2, "EC_KEY_get0_group": 2, "BN_CTX_new": 2, "err": 26, "pub_key": 6, "EC_POINT_new": 4, "group": 12, "EC_POINT_mul": 3, "priv_key": 2, "EC_KEY_set_private_key": 1, "EC_KEY_set_public_key": 2, "EC_POINT_free": 4, "BN_CTX_free": 2, "ECDSA_SIG_recover_key_GFp": 3, "ECDSA_SIG": 3, "*ecsig": 1, "msglen": 2, "recid": 3, "*e": 1, "*order": 1, "*sor": 1, "*eor": 1, "*field": 1, "*R": 1, "*O": 1, "*Q": 1, "*rr": 1, "*zero": 1, "BN_CTX_start": 1, "order": 8, "BN_CTX_get": 8, "EC_GROUP_get_order": 1, "BN_copy": 1, "BN_mul_word": 1, "BN_add": 1, "ecsig": 3, "EC_GROUP_get_curve_GFp": 1, "BN_cmp": 1, "R": 6, "O": 5, "EC_POINT_is_at_infinity": 1, "Q": 5, "EC_GROUP_get_degree": 1, "BN_bin2bn": 3, "msg": 1, "8*msglen": 1, "BN_rshift": 1, "BN_zero": 1, "BN_mod_sub": 1, "BN_mod_inverse": 1, "sor": 3, "BN_mod_mul": 2, "eor": 3, "BN_CTX_end": 1, "EC_KEY_set_conv_form": 1, "POINT_CONVERSION_COMPRESSED": 1, "EC_KEY_new_by_curve_name": 2, "NID_secp256k1": 2, "throw": 4, "EC_KEY_dup": 1, "b.pkey": 2, "b.fSet": 2, "EC_KEY_copy": 1, "nSize": 2, "vchSig.clear": 2, "vchSig.resize": 2, "Shrink": 1, "fit": 1, "actual": 1, "*sig": 2, "ECDSA_do_sign": 1, "sig": 11, "nBitsR": 3, "BN_num_bits": 2, "nBitsS": 3, "nRecId": 4, "<4>": 1, "keyRec": 5, "BN_bn2bin": 2, "/8": 2, "ECDSA_SIG_free": 2, "vchSig.size": 2, "nV": 6, "<27>": 1, "ECDSA_SIG_new": 1, "EC_KEY_free": 1, "ECDSA_verify": 1, "key": 1, "key.SetCompactSignature": 1, "key.GetPubKey": 1, "fCompr": 3, "secret": 2, "key2": 1, "key2.SetSecret": 1, "key2.GetPubKey": 1, "Q_OS_LINUX": 2, "": 1, "QT_VERSION": 1, "QT_VERSION_CHECK": 1, "Something": 1, "wrong": 1, "setup.": 1, "mailing": 1, "argc": 2, "char**": 2, "argv": 2, "google_breakpad": 1, "ExceptionHandler": 1, "eh": 1, "qInstallMsgHandler": 1, "QApplication": 1, "STATIC_BUILD": 1, "Q_INIT_RESOURCE": 2, "WebKit": 1, "InspectorBackendStub": 1, "app.setWindowIcon": 1, "QIcon": 1, "app.setApplicationName": 1, "app.setOrganizationName": 1, "app.setOrganizationDomain": 1, "app.setApplicationVersion": 1, "PHANTOMJS_VERSION_STRING": 1, "Phantom": 1, "phantom": 1, "phantom.execute": 1, "app.exec": 1, "phantom.returnValue": 1, "constexpr": 3, "VERSION_NUMBER": 1, "FRAME_RATE": 1, "MIN_FRAME_RATE": 1 }, "CLIPS": { ";": 135, "http": 6, "//www.angusj.com/sudoku/hints": 1, "-": 65, "overview": 1, "index": 1, "of": 1, "sudoku": 1, "strategies/": 1, "#######################": 2, "DEFTEMPLATES": 1, "&": 10, "DEFFACTS": 2, "(": 583, "deftemplate": 5, "possible": 10, "slot": 15, "row": 7, ")": 586, "column": 7, "value": 69, "group": 4, "id": 10, "impossible": 4, "priority": 19, "reason": 2, "technique": 7, "employed": 1, "name": 1, "deffacts": 3, "startup": 1, "phase": 14, "grid": 1, "values": 4, "size": 60, "###########": 4, "SETUP": 1, "RULES": 2, "***********": 4, "stress": 3, "test": 3, "defrule": 9, "declare": 9, "salience": 9, "match": 8, "last": 11, "not": 18, "p": 12, "next": 12, "<": 2, "assert": 10, "*****************": 6, "enable": 2, "techniques": 2, "any": 12, "**********": 2, "expand": 7, "f": 11, "<->": 6, "r": 6, "c": 6, "g": 3, "id2": 2, "s": 4, "as": 4, "v": 6, "and": 85, "v2": 3, "position": 4, "expanded": 2, "retract": 5, "PHASE": 1, "***************": 2, "done": 2, "initial": 2, "output": 5, "print": 2, "begin": 6, "elimination": 3, "*************": 2, "************": 2, "final": 1, "***************************": 2, "*": 2, "KNOWLEDGE": 1, "BASE": 1, "MAIN": 1, "knowledge": 1, "base": 1, "welcome": 1, "message": 1, "WelcomeMessage": 1, "goal": 1, "variable": 44, "type.animal": 45, "legalanswers": 1, "yes": 43, "no": 44, "displayanswers": 1, "rule": 83, "if": 83, "backbone": 6, "is": 249, "then": 83, "superphylum": 6, "jellyback": 3, "question": 42, "query": 42, "backbone.query": 1, "warm.blooded": 3, "phylum": 12, "warm": 3, "cold": 3, "warm.blooded.query": 1, "live.prime.in.soil": 3, "soil": 3, "elsewhere": 3, "live.prime.in.soil.query": 1, "has.breasts": 3, "class": 15, "breasts": 3, "bird": 1, "has.breasts.query": 1, "always.in.water": 3, "water": 6, "dry": 6, "always.in.water.query": 1, "flat.bodied": 3, "flatworm": 1, "worm.leech": 1, "flat.bodied.query": 1, "body.in.segments": 3, "segments": 3, "unified": 3, "body.in.segments.query": 1, "can.eat.meat": 3, "order": 21, "meat": 3, "vegy": 3, "can.eat.meat.query": 1, "boney": 3, "fish": 1, "shark.ray": 1, "boney.query": 1, "scaly": 3, "scales": 3, "soft": 3, "scaly.query": 1, "shell": 6, "centipede.millipede.insect": 1, "shell.query": 1, "digest.cells": 3, "cells": 3, "stomach": 3, "digest.cells.query": 1, "fly": 3, "bat": 1, "family": 18, "nowings": 3, "fly.query": 1, "hooves": 6, "feet": 3, "hooves.query": 1, "rounded.shell": 3, "turtle": 1, "noshell": 6, "rounded.shell.query": 1, "jump": 3, "frog": 1, "salamander": 1, "jump.query": 1, "tail": 3, "lobster": 1, "crab": 1, "tail.query": 1, "stationary": 6, "jellyfish": 1, "stationary.query": 1, "multicelled": 6, "protozoa": 1, "multicelled.query": 1, "opposing.thumb": 3, "genus": 21, "thumb": 3, "nothumb": 3, "opposing.thumb.query": 1, "two.toes": 3, "twotoes": 3, "onetoe": 3, "two.toes.query": 1, "live.in.water": 3, "live.in.water.query": 1, "limbs": 3, "crocodile.alligator": 1, "snake": 1, "limbs.query": 1, "spikes": 3, "sea.anemone": 1, "coral.sponge": 1, "spikes.query": 1, "spiral.shell": 3, "snail": 1, "spiral.shell.query": 1, "prehensile.tail": 3, "monkey": 1, "species": 22, "notail": 3, "prehensile.tail.query": 1, "over.400": 3, "under400": 3, "over.400.query": 1, "horns": 6, "nohorns": 4, "horns.query": 1, "plating": 3, "rhinoceros": 1, "horse.zebra": 1, "plating.query": 1, "hunted": 3, "whale": 1, "dolphin.porpoise": 1, "hunted.query": 1, "front.teeth": 3, "teeth": 3, "noteeth": 3, "front.teeth.query": 1, "bivalve": 3, "clam.oyster": 1, "squid.octopus": 1, "bivalve.query": 1, "nearly.hairless": 3, "man": 1, "subspecies": 3, "hair": 3, "nearly.hairless.query": 1, "land.based": 3, "bear.tiger.lion": 1, "walrus": 1, "land.based.query": 1, "thintail": 3, "cat": 1, "coyote.wolf.fox.dog": 1, "thintail.query": 1, "lives.in.desert": 4, "camel": 1, "semi.aquatic": 3, "giraffe": 1, "hippopotamus": 1, "lives.in.desert.query": 1, "semi.aquatic.query": 1, "large.ears": 3, "rabbit": 1, "large.ears.query": 1, "pouch": 3, "kangaroo.koala.bear": 1, "mole.shrew.elephant": 1, "pouch.query": 1, "long.powerful.arms": 3, "orangutan.gorilla.chimpanzee": 1, "baboon": 1, "long.powerful.arms.query": 1, "fleece": 3, "sheep.goat": 1, "subsubspecies": 3, "nofleece": 3, "fleece.query": 1, "domesticated": 3, "cow": 1, "deer.moose.antelope": 1, "domesticated.query": 1, "answer": 1, "prefix": 1, "postfix": 1 }, "CMake": { "cmake_minimum_required": 4, "(": 118, "VERSION": 5, ")": 118, "enable_testing": 1, "set": 6, "CMAKE_BUILD_TYPE": 1, "debug": 1, "include_directories": 2, "find_library": 1, "ssl_LIBRARY": 2, "NAMES": 1, "ssl": 1, "PATHS": 1, "add_custom_command": 1, "OUTPUT": 2, "COMMAND": 3, "./ver.sh": 1, "add_executable": 4, "foo": 5, "foo.c": 2, "bar.c": 1, "baz.c": 1, "ver.c": 1, "target_link_libraries": 4, "{": 37, "}": 37, "#": 3, "CMAKE_MINIMUM_REQUIRED": 1, "FIND_FILE": 1, "SPHINX": 1, "sphinx": 1, "-": 5, "build.exe": 1, "IF": 13, "WIN32": 3, "SET": 17, "SPHINX_MAKE": 4, "make.bat": 1, "ELSE": 5, "make": 1, "ENDIF": 13, "ADD_CUSTOM_TARGET": 2, "doc_usr": 1, "html": 2, "WORKING_DIRECTORY": 2, "CMAKE_CURRENT_SOURCE_DIR": 2, "/usr": 1, "doc_dev": 1, "/dev": 1, "MACRO": 1, "CHECK_STDCALL_FUNCTION_EXISTS": 2, "FUNCTION_DECLARATION": 3, "VARIABLE": 7, "MATCHES": 2, "#get": 1, "includes": 2, "CHECK_STDCALL_FUNCTION_PREMAIN": 7, "FOREACH": 2, "def": 2, "CMAKE_EXTRA_INCLUDE_FILES": 1, "ENDFOREACH": 2, "#add": 2, "some": 1, "default": 1, "HAVE_WINDOWS_H": 2, "HAVE_UNISTD_H": 2, "HAVE_DIRECT_H": 2, "HAVE_IO_H": 2, "HAVE_SYS_TIMEB_H": 2, "STRING": 3, "REGEX": 2, "REPLACE": 2, "MESSAGE": 7, "STATUS": 5, "CMAKE_REQUIRED_LIBRARIES": 3, "CMAKE_REQUIRED_INCLUDES": 3, "CONFIGURE_FILE": 1, "IMMEDIATE": 1, "@ONLY": 1, "FILE": 4, "READ": 2, "CHECK_STDCALL_FUNCTION_CONTENT": 1, "TRY_COMPILE": 1, "CMAKE_BINARY_DIR": 3, "COMPILE_DEFINITIONS": 1, "CMAKE_REQUIRED_DEFINITIONS": 1, "CMAKE_FLAGS": 1, "DCOMPILE_DEFINITIONS": 1, "OUTPUT_VARIABLE": 2, "CACHE": 2, "INTERNAL": 2, "APPEND": 3, "CMAKE_FILES_DIRECTORY": 2, "/CMakeOutput.log": 1, "/CMakeError.log": 1, "ENDMACRO": 1, "FATAL_ERROR": 3, "project": 3, "PCLVisualizer": 4, "PCL_LIBRARIES": 1, "#it": 1, "seems": 1, "it": 1, "find_package": 4, "GLEW": 1, "REQUIRED": 4, "CMAKE_CXX_FLAGS": 1, "PCL": 1, "PCL_INCLUDE_DIRS": 1, "link_directories": 2, "PCL_LIBRARY_DIRS": 1, "add_definitions": 2, "PCL_DEFINITIONS": 1, "PCL_BUILD_TYPE": 1, "Release": 1, "file": 3, "GLOB": 1, "PCL_openni_viewer_SRC": 2, "this": 1, "line": 1, "to": 1, "solve": 1, "probem": 1, "in": 1, "mac": 1, "os": 1, "x": 1, "PCL_COMMON_LIBRARIES": 1, "PCL_IO_LIBRARIES": 1, "PCL_VISUALIZATION_LIBRARIES": 1, "PCL_FEATURES_LIBRARIES": 1, "NOT": 4, "EXISTS": 5, "files": 3, "EXEC_PROGRAM": 1, "ARGS": 1, "rm_out": 1, "RETURN_VALUE": 1, "rm_retval": 1, "STREQUAL": 2, "CMAKE_RUNTIME_OUTPUT_DIRECTORY": 1, "list": 1, "CMAKE_MODULE_PATH": 1, "CMAKE_SOURCE_DIR": 1, "/cmake/vala": 1, "Vala": 1, "include": 2, "ValaPrecompile": 1, "ValaVersion": 1, "ensure_vala_version": 1, "MINIMUM": 1, "template": 1, "C": 1, "PkgConfig": 1, "pkg_check_modules": 1, "GOBJECT": 1, "gobject": 1, "GOBJECT_CFLAGS": 1, "GOBJECT_CFLAGS_OTHER": 1, "link_libraries": 1, "GOBJECT_LIBRARIES": 1, "GOBJECT_LIBRARY_DIRS": 1, "vala_precompile": 1, "VALA_C": 2, "src/template.vala": 1, "PACKAGES": 1, "OPTIONS": 1, "thread": 1, "CUSTOM_VAPIS": 1, "GENERATE_VAPI": 1, "GENERATE_HEADER": 1, "DIRECTORY": 1, "gen": 1, "Foo": 1, "CMAKE_SKIP_RPATH": 1, "TRUE": 1, "CMAKE_INSTALL_PREFIX": 1, "add_subdirectory": 1, "bar": 1, "pthread": 1, "install": 1, "TARGETS": 1, "DESTINATION": 1, "bin": 1 }, "COBOL": { "COBOL": 7, "-": 19, "TEST": 2, "RECORD.": 1, "USAGES.": 1, "COMP": 5, "PIC": 5, "S9": 4, "(": 5, ")": 5, "COMP.": 3, "COMP2": 2, "IDENTIFICATION": 2, "DIVISION.": 4, "PROGRAM": 2, "ID.": 2, "hello.": 3, "PROCEDURE": 2, "DISPLAY": 2, ".": 3, "STOP": 2, "RUN.": 2, "program": 1, "id.": 1, "procedure": 1, "division.": 1, "display": 1, "stop": 1, "run.": 1 }, "CSON": { "[": 18, "{": 18, "}": 18, "]": 18, "name": 30, "scopeName": 1, "fileTypes": 1, "firstLineMatch": 1, "patterns": 8, "include": 17, "repository": 1, "main": 1, "punctuation": 1, "match": 20, "private": 1, "begin": 5, "end": 5, "beginCaptures": 5, "endCaptures": 4, "image": 1, "contentName": 1, "pickleData": 1, "sections": 1, "control": 1, "colour": 6, "captures": 2, "encoding": 1, "copyright": 1, "address": 1, "property": 1, "directoryIcons": 1, "Atom": 1, "icon": 11, "/": 16, ".atom": 1, "Bower": 1, "bower": 1, "-": 3, "_": 1, "components": 1, "Dropbox": 2, "(": 3, "|": 3, ".dropbox": 1, ".cache": 1, ")": 3, "Git": 1, ".git": 1, "GitHub": 1, ".github": 1, "Meteor": 1, ".meteor": 1, "NodeJS": 1, "node_modules": 1, "Package": 1, ".bundle": 1, "/i": 2, "TextMate": 1, "fileIcons": 1, "ABAP": 1, "scope": 2, "ActionScript": 1, "#": 1, "Or": 1, "Flash": 1, "related": 1, ".": 2, "flex": 1, "config": 1, "actionscript": 1, "d": 1, "+": 1, "alias": 1, "/ActionScript": 1, "s": 1, "as3/i": 1 }, "CSS": { ".clearfix": 8, "{": 844, "*zoom": 26, ";": 2027, "}": 843, "before": 25, "after": 47, "display": 70, "table": 23, "content": 33, "line": 49, "-": 4257, "height": 72, "clear": 17, "both": 16, ".hide": 7, "text": 67, "font": 72, "0/0": 2, "a": 138, "color": 326, "transparent": 25, "shadow": 125, "none": 65, "background": 351, "border": 436, ".input": 109, "block": 69, "level": 2, "width": 100, "%": 118, "min": 8, "30px": 7, "webkit": 170, "box": 131, "sizing": 15, "moz": 151, "article": 2, "aside": 2, "details": 2, "figcaption": 2, "figure": 2, "footer": 2, "header": 7, "hgroup": 2, "nav": 2, "section": 2, "audio": 4, "canvas": 2, "video": 3, "inline": 60, "*display": 11, "not": 4, "(": 283, "[": 196, "controls": 2, "]": 196, ")": 283, "html": 4, "size": 53, "adjust": 5, "ms": 8, "focus": 120, "outline": 19, "thin": 5, "dotted": 6, "#333": 4, "5px": 43, "auto": 28, "ring": 4, "offset": 4, "2px": 48, "hover": 73, "active": 24, "sub": 4, "sup": 4, "position": 169, "relative": 10, "vertical": 31, "align": 38, "baseline": 3, "top": 170, "0.5em": 2, "bottom": 146, "0.25em": 2, "img": 10, "max": 10, "middle": 12, "interpolation": 2, "mode": 2, "bicubic": 2, "#map_canvas": 2, ".google": 2, "maps": 2, "button": 13, "input": 174, "select": 46, "textarea": 39, "margin": 199, "*overflow": 2, "visible": 4, "normal": 9, "inner": 20, "padding": 82, "type": 90, "appearance": 3, "cursor": 15, "pointer": 6, "label": 10, "textfield": 1, "search": 33, "decoration": 16, "cancel": 1, "overflow": 10, "@media": 1, "print": 2, "*": 1, "important": 9, "#000": 1, "visited": 1, "underline": 3, "href": 14, "attr": 2, "abbr": 3, "title": 4, ".ir": 1, "pre": 8, "blockquote": 7, "1px": 209, "solid": 44, "#999": 1, "page": 3, "break": 6, "inside": 2, "avoid": 3, "thead": 19, "group": 60, "tr": 46, "@page": 1, "0.5cm": 1, "p": 7, "h2": 7, "h3": 7, "orphans": 1, "widows": 1, "body": 1, "family": 5, "Helvetica": 3, "Arial": 3, "sans": 3, "serif": 3, "14px": 48, "20px": 60, "#333333": 13, "#ffffff": 65, "#0088cc": 12, "#005580": 4, ".img": 3, "rounded": 1, "radius": 261, "6px": 86, "polaroid": 1, "4px": 196, "#fff": 5, "#ccc": 6, "rgba": 160, "3px": 48, "circle": 9, "500px": 4, ".row": 63, "left": 229, "class*": 50, "float": 42, ".container": 16, ".navbar": 166, "static": 7, "fixed": 17, "940px": 3, ".span12": 2, ".span11": 2, "860px": 1, ".span10": 2, "780px": 1, ".span9": 2, "700px": 1, ".span8": 2, "620px": 1, ".span7": 2, "540px": 1, ".span6": 2, "460px": 1, ".span5": 2, "380px": 1, ".span4": 2, "300px": 1, ".span3": 2, "220px": 2, ".span2": 2, "140px": 1, ".span1": 2, "60px": 2, ".offset12": 3, "980px": 1, ".offset11": 3, "900px": 1, ".offset10": 3, "820px": 1, ".offset9": 3, "740px": 1, ".offset8": 3, "660px": 1, ".offset7": 3, "580px": 1, ".offset6": 3, ".offset5": 3, "420px": 1, ".offset4": 3, "340px": 2, ".offset3": 3, "260px": 1, ".offset2": 3, "180px": 5, ".offset1": 3, "100px": 1, "fluid": 63, "*margin": 35, "first": 89, "child": 150, ".controls": 14, "row": 10, "+": 52, "*width": 13, ".pull": 7, "right": 123, "10px": 28, ".lead": 1, "21px": 3, "weight": 13, "small": 33, "strong": 1, "bold": 7, "em": 1, "style": 9, "italic": 2, "cite": 1, ".muted": 1, "#999999": 25, "a.muted": 2, "#808080": 1, ".text": 7, "warning": 15, "#c09853": 7, "a.text": 8, "#a47e3c": 2, "error": 5, "#b94a48": 10, "#953b39": 3, "info": 17, "#3a87ad": 9, "#2d6987": 3, "success": 16, "#468847": 9, "#356635": 3, "center": 8, "h1": 5, "h4": 10, "h5": 3, "h6": 3, "inherit": 3, "rendering": 1, "optimizelegibility": 1, "40px": 10, "38.5px": 1, "31.5px": 1, "24.5px": 2, "17.5px": 6, "11.9px": 4, ".page": 1, "9px": 11, "#eeeeee": 15, "ul": 42, "ol": 5, "25px": 2, "li": 102, "ul.unstyled": 1, "ol.unstyled": 1, "list": 21, "ul.inline": 2, "ol.inline": 2, "dl": 1, "dt": 3, "dd": 3, ".dl": 6, "horizontal": 30, "160px": 2, "hidden": 4, "ellipsis": 1, "white": 12, "space": 11, "nowrap": 7, "hr": 1, "data": 1, "original": 1, "help": 1, "abbr.initialism": 1, "transform": 2, "uppercase": 2, "15px": 22, "blockquote.pull": 5, "q": 2, "address": 1, "code": 3, "Monaco": 1, "Menlo": 1, "Consolas": 1, "monospace": 1, "12px": 9, "#d14": 1, "#f7f7f9": 1, "#e1e1e8": 1, "9.5px": 1, "13px": 3, "word": 3, "all": 5, "wrap": 3, "#f5f5f5": 13, "pre.prettyprint": 1, ".pre": 1, "scrollable": 1, "y": 1, "scroll": 1, ".label": 15, ".badge": 15, "11.844px": 1, "empty": 3, "a.label": 2, "a.badge": 2, "#f89406": 11, "#c67605": 2, "inverse": 55, "#1a1a1a": 1, ".btn": 253, "mini": 17, "collapse": 6, "spacing": 1, ".table": 90, "th": 35, "td": 33, "8px": 20, "#dddddd": 8, "caption": 9, "colgroup": 9, "tbody": 34, "condensed": 2, "bordered": 38, "separate": 2, "*border": 4, "topleft": 8, "last": 59, "topright": 8, "tfoot": 6, "bottomleft": 8, "bottomright": 8, "striped": 2, "nth": 2, "odd": 2, "#f9f9f9": 6, "cell": 1, "td.span1": 1, "th.span1": 1, "44px": 1, "td.span2": 1, "th.span2": 1, "124px": 1, "td.span3": 1, "th.span3": 1, "204px": 1, "td.span4": 1, "th.span4": 1, "284px": 1, "td.span5": 1, "th.span5": 1, "364px": 1, "td.span6": 1, "th.span6": 1, "444px": 1, "td.span7": 1, "th.span7": 1, "524px": 1, "td.span8": 1, "th.span8": 1, "604px": 1, "td.span9": 1, "th.span9": 1, "684px": 1, "td.span10": 1, "th.span10": 1, "764px": 1, "td.span11": 1, "th.span11": 1, "844px": 1, "td.span12": 1, "th.span12": 1, "924px": 1, "tr.success": 2, "#dff0d8": 3, "tr.error": 2, "#f2dede": 3, "tr.warning": 2, "#fcf8e3": 3, "tr.info": 2, "#d9edf7": 3, "#d0e9c6": 1, "#ebcccc": 1, "#faf2cc": 1, "#c4e3f3": 1, "form": 19, "fieldset": 1, "legend": 3, "#e5e5e5": 14, ".uneditable": 40, "#555555": 9, "206px": 2, "#cccccc": 9, "inset": 63, "transition": 16, "linear": 77, ".2s": 8, "o": 18, ".075": 6, ".6": 3, "multiple": 1, "#fcfcfc": 1, "allowed": 2, "placeholder": 9, ".radio": 13, ".checkbox": 13, ".radio.inline": 3, ".checkbox.inline": 3, "90px": 1, "medium": 1, "150px": 1, "large": 20, "210px": 1, "xlarge": 1, "270px": 1, "xxlarge": 1, "530px": 1, "append": 60, "prepend": 41, "input.span12": 2, "textarea.span12": 1, "926px": 1, "input.span11": 2, "textarea.span11": 1, "846px": 1, "input.span10": 2, "textarea.span10": 1, "766px": 1, "input.span9": 2, "textarea.span9": 1, "686px": 1, "input.span8": 2, "textarea.span8": 1, "606px": 1, "input.span7": 2, "textarea.span7": 1, "526px": 1, "input.span6": 2, "textarea.span6": 1, "446px": 1, "input.span5": 2, "textarea.span5": 1, "366px": 1, "input.span4": 2, "textarea.span4": 1, "286px": 1, "input.span3": 2, "textarea.span3": 1, "input.span2": 2, "textarea.span2": 1, "126px": 1, "input.span1": 2, "textarea.span1": 1, "46px": 1, "disabled": 18, "readonly": 5, ".control": 75, "group.warning": 16, ".help": 22, "#dbc59e": 3, ".add": 18, "on": 18, "group.error": 16, "#d59392": 3, "group.success": 16, "#7aba7b": 3, "group.info": 16, "#7ab5d3": 3, "invalid": 6, "#ee5f5b": 6, "#e9322d": 1, "#f8b9b7": 3, ".form": 66, "actions": 5, "19px": 5, "#595959": 1, ".dropdown": 63, "menu": 21, ".popover": 3, "z": 4, "index": 5, "16px": 4, "toggle": 42, ".active": 43, "#a9dba9": 1, "#46a546": 1, "prepend.input": 11, "input.search": 1, "query": 11, ".search": 11, "*padding": 18, "image": 71, "gradient": 65, "#e6e6e6": 10, "from": 18, "to": 31, "repeat": 29, "x": 13, "filter": 25, "progid": 22, "startColorstr": 13, "endColorstr": 13, "GradientType": 13, "#bfbfbf": 2, "*background": 18, "enabled": 9, "false": 9, "#b3b3b3": 1, ".3em": 3, ".2": 6, ".05": 12, ".btn.active": 4, ".btn.disabled": 2, "#d9d9d9": 2, "0.1s": 4, ".15": 9, "default": 6, "opacity": 4, "alpha": 2, "11px": 3, "class": 13, "10.5px": 3, "primary.active": 3, "warning.active": 3, "danger.active": 3, "success.active": 3, "info.active": 3, "inverse.active": 3, "primary": 7, "#006dcc": 1, "#0044cc": 10, "#002a80": 1, "primary.disabled": 1, "#003bb3": 1, "#003399": 1, "#faa732": 1, "#fbb450": 5, "#ad6704": 1, "warning.disabled": 1, "#df8505": 1, "danger": 9, "#da4f49": 1, "#bd362f": 10, "#802420": 1, "danger.disabled": 1, "#a9302a": 1, "#942a25": 1, "#5bb75b": 1, "#62c462": 5, "#51a351": 10, "#387038": 1, "success.disabled": 1, "#499249": 1, "#408140": 1, "#49afcd": 1, "#5bc0de": 5, "#2f96b4": 10, "#1f6377": 1, "info.disabled": 1, "#2a85a0": 1, "#24748c": 1, "#363636": 1, "#444444": 5, "#222222": 16, "#000000": 4, "inverse.disabled": 1, "#151515": 6, "#080808": 1, "button.btn": 2, "button.btn.btn": 3, ".btn.btn": 3, "7px": 11, "link": 14, "url": 2, "no": 1, ".icon": 144, ".nav": 154, "pills": 14, "submenu": 4, "glass": 1, "music": 1, "24px": 26, "48px": 27, "envelope": 1, "72px": 27, "heart": 1, "96px": 27, "star": 2, "120px": 24, "144px": 27, "user": 1, "168px": 6, "film": 1, "192px": 7, "216px": 7, "240px": 7, "264px": 7, "ok": 3, "288px": 5, "remove": 3, "312px": 6, "zoom": 2, "in": 5, "336px": 7, "out": 5, "360px": 7, "off": 2, "384px": 7, "signal": 1, "408px": 7, "cog": 1, "432px": 6, "trash": 1, "456px": 7, "home": 1, "file": 1, "time": 1, "road": 1, "download": 2, "alt": 3, "upload": 1, "inbox": 1, "play": 2, "refresh": 1, "lock": 1, "287px": 1, "flag": 1, "headphones": 1, "volume": 3, "down": 6, "up": 6, "qrcode": 1, "barcode": 1, "tag": 1, "tags": 1, "book": 1, "bookmark": 1, "camera": 1, "167px": 1, "justify": 1, "indent": 2, "facetime": 1, "picture": 1, "pencil": 1, "map": 1, "marker": 1, "tint": 1, "edit": 1, "share": 2, "check": 1, "move": 1, "step": 2, "backward": 3, "fast": 2, "pause": 1, "stop": 1, "forward": 3, "eject": 1, "chevron": 4, "plus": 2, "sign": 8, "minus": 2, "question": 1, "screenshot": 1, "ban": 1, "arrow": 8, "289px": 1, "resize": 4, "full": 1, "433px": 1, "asterisk": 1, "exclamation": 1, "gift": 1, "leaf": 1, "fire": 1, "eye": 2, "open": 2, "close": 2, "plane": 1, "calendar": 1, "random": 1, "comment": 1, "magnet": 1, "313px": 1, "119px": 2, "retweet": 1, "shopping": 1, "cart": 1, "folder": 2, "118px": 1, "hdd": 1, "bullhorn": 1, "bell": 1, "certificate": 1, "thumbs": 2, "hand": 4, "globe": 1, "wrench": 1, "tasks": 1, "briefcase": 1, "fullscreen": 1, "toolbar": 4, ".btn.large": 2, ".large.dropdown": 1, "group.open": 9, ".125": 3, ".btn.dropdown": 1, "primary.dropdown": 1, "warning.dropdown": 1, "danger.dropdown": 1, "success.dropdown": 1, "info.dropdown": 1, "inverse.dropdown": 1, ".caret": 35, ".dropup": 1, ".divider": 4, "tabs": 47, "#ddd": 19, "stacked": 12, "tabs.nav": 6, "pills.nav": 2, ".dropdown.active": 2, ".open": 4, "li.dropdown.open.active": 7, "li.dropdown.open": 7, ".tabs": 31, ".tabbable": 4, ".tab": 4, "below": 9, "pane": 2, ".pill": 3, "74px": 1, ".disabled": 11, "*position": 1, "*z": 1, "#fafafa": 1, "#f2f2f2": 11, "#d4d4d4": 1, "collapse.collapse": 1, ".brand": 7, "#777777": 6, ".1": 12, ".nav.pull": 1, "navbar": 14, "#ededed": 1, "navbar.active": 4, "navbar.disabled": 2, "bar": 8, "18px": 1, "absolute": 2, "li.dropdown": 6, "li.dropdown.active": 4, "menu.pull": 4, "#1b1b1b": 1, "#111111": 9, "#252525": 1, "#515151": 1, "query.focused": 1, "#0e0e0e": 1, "#040404": 9, ".breadcrumb": 4, ".pagination": 39, "span": 19, "centered": 1, ".pager": 17, ".next": 2, ".previous": 2, ".thumbnails": 6, ".thumbnail": 3, "0.2s": 4, "ease": 4, "a.thumbnail": 2, ".caption": 1, ".alert": 17, "35px": 1, "#fbeed5": 1, ".close": 1, "#d6e9c6": 1, "#eed3d7": 1, "#bce8f1": 1, "@": 4, "keyframes": 4, "progress": 5, "stripes": 5, "@keyframes": 1, ".progress": 2, "#f7f7f7": 1, ".bar": 1, "#0e90d2": 1, "#149bdf": 5, "#0480be": 5, "webki": 1 }, "CSV": { "Year": 1, "Make": 1, "Model": 1, "Length": 1, "Ford": 1, "E350": 1, "Mercury": 1, "Cougar": 1 }, "CWeb": { "datethis": 1, "@*Intro.": 1, "This": 1, "program": 1, "generates": 1, "clauses": 10, "for": 29, "the": 52, "transition": 1, "relation": 1, "from": 6, "time": 10, "t": 13, "to": 17, "+": 69, "in": 6, "Conway": 1, "all": 3, "of": 27, "potentially": 1, "live": 3, "cells": 3, "at": 11, "belong": 1, "a": 14, "pattern": 4, "that": 14, "lines": 1, "representing": 1, "rows": 1, "where": 3, "each": 2, "line": 4, "has": 2, "..": 1, "cell": 11, ".": 31, "The": 11, "is": 21, "specified": 1, "separately": 1, "as": 2, "command": 3, "-": 31, "parameter.": 1, "Boolean": 1, "variable": 4, "(": 193, "x": 136, "y": 142, ")": 188, "named": 1, "by": 10, "its": 1, "so": 1, "called": 2, "xty": 4, "code": 7, "namely": 1, "decimal": 2, "value": 3, "followed": 2, "letter": 1, "For": 3, "example": 3, "if": 49, "and": 22, "indicates": 2, "liveness": 1, "{": 52, "10a11": 1, "}": 44, ";": 111, "corresponding": 1, "10b11": 1, "Up": 1, "auxiliary": 6, "variables": 7, "are": 11, "used": 2, "together": 1, "with": 2, "order": 2, "construct": 1, "define": 4, "successor": 1, "state.": 1, "names": 1, "these": 2, "obtained": 1, "appending": 1, "one": 3, "following": 1, "two": 4, "character": 2, "combinations": 1, "A2": 1, "A3": 1, "A4": 1, "B1": 1, "B2": 1, "B3": 1, "B4": 1, "C1": 1, "C2": 1, "C3": 1, "C4": 1, "D1": 1, "D2": 1, "E1": 1, "E2": 1, "F1": 1, "F2": 1, "G1": 1, "G2": 1, "These": 1, "derived": 1, "Bailleux": 1, "Boufkhad": 1, "method": 1, "encoding": 1, "cardinality": 1, "constraints": 1, "A": 3, "k": 70, "stands": 2, "condition": 1, "least": 3, "eight": 2, "neighbors": 9, "alive.": 2, "Similarly": 1, "B": 1, "first": 1, "four": 4, "alive": 3, "C": 1, "accounts": 1, "other": 2, "neighbors.": 2, "Codes": 1, ".D": 2, ".E": 1, ".F": 1, ".G": 1, "refer": 1, "pairs": 1, "Thus": 1, "instance": 1, "10a11C2": 1, "means": 2, "last": 2, "Those": 1, "receive": 1, "values": 1, "up": 2, "per": 2, "cell.": 1, "u": 5, "v": 5, "z": 11, "correspond": 1, "pairing": 1, "type": 2, "there": 1, "six": 2, "bar": 51, "d_1": 6, "quad": 19, "d_2": 5, "d_2.": 1, "sixteen": 3, "displaylines": 1, "hfill": 4, "d_1b_1": 1, "e_1b_1": 1, "d_2b_2": 1, "e_1b_2": 1, "e_2b_2": 1, "e_1b_3": 1, "e_2b_3": 1, "e_2b_4": 1, "cr": 1, "d_1e_1": 1, "b_1": 1, "d_1e_2": 1, "b_2": 2, "d_2e_1": 1, "b_3": 3, "d_2e_2": 1, "e_1": 1, "b_4": 2, "e_2": 1, "b": 4, "d": 10, "s": 4, "another": 1, "c": 16, "g": 7, "similar": 1, "set": 2, "will": 2, "Once": 1, "next": 4, "state": 1, "a_4": 2, "a_2": 2, "a_3z": 1, "a_3a_4z": 1, "a_2a_4": 1, "zz": 1, "states": 1, "i.e.": 1, "be": 6, "ge2": 1, "but": 1, "not": 3, "ge4": 1, "Nearby": 1, "can": 5, "share": 1, "according": 1, "tricky": 1, "scheme": 1, "worked": 1, "out": 1, "below.": 1, "In": 1, "consequence": 1, "actual": 1, "number": 1, "reduced": 1, "respectively": 1, "except": 1, "boundaries.": 1, "@": 26, "So": 1, "here": 2, "@d": 2, "maxx": 9, "maxy": 11, "@c": 1, "#include": 2, "": 1, "": 1, "char": 7, "p": 21, "[": 55, "]": 55, "have_b": 3, "have_d": 3, "have_e": 3, "have_f": 3, "int": 28, "tt": 16, "xmax": 7, "ymax": 8, "xmin": 3, "ymin": 4, "timecode": 4, "|": 16, "@q": 1, "buf": 6, "unsigned": 2, "clause": 18, "clauseptr": 7, "": 1, "main": 1, "argc": 2, "char*argv": 1, "register": 9, "j": 48, "": 2, "": 2, "<": 5, "": 2, "obviously": 2, "dead": 2, "1": 13, "continue": 3, "zprime": 2, "||": 4, "sscanf": 1, "argv": 2, "&": 11, "fprintf": 5, "stderr": 5, "exit": 5, "<0>": 1, "fgets": 1, "stdin": 1, "break": 1, "": 3, "ymin=": 1, "": 3, "xmin=": 1, "else": 8, "Unexpected": 1, "found": 1, "n": 1, "5": 10, "pp": 6, "xx": 25, "yy": 26, "&&": 7, "<3>": 4, "Clauses": 1, "assembled": 1, "array": 2, "surprise": 1, "we": 6, "put": 1, "encoded": 1, "literals": 2, "literal": 6, "an": 3, "32": 1, "bit": 4, "quantity": 1, "leading": 1, "should": 2, "complemented": 2, "three": 2, "bits": 2, "specify": 3, "0": 2, "thru": 1, "7": 5, "plain": 1, "G": 1, "integer": 1, "zero": 2, "That": 1, "leaves": 1, "room": 1, "12": 3, "fields": 1, "which": 3, "Type": 1, "have": 1, "k=": 8, "ordinary": 1, "However": 1, "instead": 2, "And": 2, "denotes": 2, "special": 1, "tautology": 2, "always": 4, "true": 1, "If": 3, "omit": 2, "it": 3, "otherwise": 1, "entire": 1, "Finally": 2, "avoid": 3, "length": 1, "4": 4, "Here": 1, "subroutine": 6, "outputs": 1, "current": 1, "resets": 1, "taut": 4, "2": 5, "25": 3, "sign": 5, "1U": 1, "31": 1, "Sub": 5, "void": 11, "outclause": 41, "": 1, "goto": 1, "done": 2, "p=": 1, "printf": 6, "": 4, "applit": 42, "<<": 3, "e": 4, "subroutines": 1, "only": 1, "fourth": 1, "addresses": 1, "Indeed": 1, "show": 1, "odd": 2, "bmod4": 1, "<2>": 1, "Therefore": 1, "remember": 1, "ve": 2, "seen": 1, "before": 1, "Slight": 1, "trick": 1, "range": 1, "generating": 1, "d_k": 1, "twice": 1, "newlit": 28, "28": 2, "newcomplit": 29, "x1": 25, "x2": 17, "@#": 1, "f": 5, "do": 1, "save": 1, "factor": 1, "because": 1, "even.": 1, "y1": 24, "y2": 16, "cleans": 1, "dregs": 1, "somewhat": 1, "tediously": 1, "locating": 1, "weren": 1, "No": 1, "sharing": 1, "possible": 1, "here.": 1, "Fortunately": 1, "/": 1, "shared": 1, "since": 1, "thus": 1, "saving": 1, "half": 1, "generated.": 1, "3": 19, "d_j": 1, "e_k": 1, "b_": 2, "d_": 1, "e_": 1, "unshared": 1, "handles": 1, "working": 1, "y=": 1, "overlap": 1, "rules": 1, "y1=": 1, "problematic": 1, "I": 2, "decided": 1, "this": 1, "case": 1, "omitting": 1, "when": 1, "guaranteed": 1, "": 1, "equal": 2, "6": 2, "f_j": 1, "g_k": 3, "c_": 2, "f_": 1, "g_": 1, "Set": 1, "lor": 2, "c_k": 4, "c_3": 1, "c_4": 1, "Totals": 1, "over": 1, "then": 1, "deduced": 1, "<5>": 2, "b_j": 2, "a_": 2, "j=": 1, "<6>": 1, "mentioned": 1, "beginning": 1, "determined": 1, "a_3": 1, "actually": 1, "generate": 1, "five": 1, "stick": 1, "mc": 1, "3SAT": 1, "@*Index.": 1 }, "Cabal Config": { "name": 2, "line2pdf": 2, "version": 4, "copyright": 1, "Audrey": 3, "Tang": 3, "license": 4, "BSD3": 1, "-": 221, "file": 4, "LICENSE": 2, "author": 2, "": 2, "audreyt": 2, "org": 2, "maintainer": 2, "synopsis": 2, "Simple": 3, "command": 2, "line": 2, "utility": 2, "to": 2, "convert": 2, "text": 3, "into": 2, "PDF": 2, "description": 2, "stability": 1, "experimental": 1, "build": 7, "type": 1, "cabal": 2, "category": 2, "Text": 1, "extra": 3, "source": 6, "files": 2, "README": 1, "flag": 3, "small_base": 3, "Choose": 1, "the": 1, "new": 1, "smaller": 1, "split": 2, "up": 1, "base": 12, "package.": 1, "library": 2, "exposed": 1, "modules": 1, "Text.LineToPDF": 1, "Text.LineToPDF.Internals": 1, "extensions": 2, "ImplicitParams": 2, "ExistentialQuantification": 2, "if": 2, "(": 2, ")": 2, "depends": 6, "containers": 5, "bytestring": 6, "else": 2, "<": 2, "hs": 5, "dirs": 4, "src": 4, "executable": 2, "main": 2, "is": 2, "line2pdf.hs": 1, ".": 1, "constraints": 1, "DRBG": 1, "HTTP": 1, "HUnit": 1, "MissingH": 1, "MonadRandom": 1, "StateVar": 1, "aeson": 1, "ansi": 2, "terminal": 1, "wl": 1, "pprint": 1, "appar": 1, "array": 1, "attoparsec": 1, "auto": 1, "update": 1, "base16": 1, "base64": 1, "bifunctors": 1, "binary": 1, "blaze": 1, "builder": 2, "byteable": 1, "byteorder": 1, "case": 1, "insensitive": 1, "cereal": 1, "cipher": 3, "aes": 1, "aes128": 1, "comonad": 1, "contravariant": 1, "crypto": 2, "api": 1, "types": 2, "cryptohash": 2, "cryptoapi": 1, "data": 6, "default": 8, "class": 1, "instances": 4, "dlist": 2, "old": 3, "locale": 2, "deepseq": 1, "directory": 1, "distributive": 1, "easy": 1, "either": 1, "entropy": 1, "exceptions": 1, "fast": 1, "logger": 2, "filepath": 2, "free": 1, "ghc": 1, "prim": 1, "hashable": 1, "hslogger": 1, "http": 2, "date": 1, "integer": 1, "gmp": 1, "iproute": 1, "lifted": 1, "mmorph": 1, "monad": 1, "control": 1, "mtl": 1, "nats": 1, "network": 2, "uri": 1, "time": 3, "optparse": 1, "applicative": 1, "parallel": 1, "parsec": 1, "prelude": 1, "extras": 1, "pretty": 1, "prettyclass": 1, "primitive": 1, "process": 1, "profunctors": 1, "random": 1, "regex": 3, "compat": 3, "posix": 1, "resourcet": 1, "rts": 1, "scientific": 1, "scotty": 1, "securemem": 1, "semigroupoids": 1, "semigroups": 1, "simple": 1, "sendfile": 1, "stm": 1, "streaming": 1, "commons": 1, "stringsearch": 1, "syb": 1, "system": 2, "fileio": 1, "tagged": 1, "template": 1, "haskell": 1, "temporary": 1, "transformers": 3, "unix": 3, "unordered": 1, "vault": 1, "vector": 1, "void": 1, "wai": 4, "middleware": 1, "static": 1, "warp": 1, "word8": 1, "zlib": 1, "flags": 18, "overloaded": 54, "methods": 18, "signals": 18, "properties": 18, "optional": 1, "packages": 1, "*": 1, "package": 17, "gi": 17, "atk": 1, "cairo": 1, "gdk": 1, "gdkpixbuf": 1, "gio": 1, "glib": 1, "gobject": 1, "gtk": 2, "gtkosxapplication": 1, "gtksource": 1, "javascriptcore": 1, "pango": 1, "pangocairo": 1, "soup": 1, "webkit": 1, "webkit2": 1, "linguist": 2, "sample": 2, "Example": 1, "of": 1, "a": 1, "Cabal": 1, "configuration": 1, "for": 1, "GitHub": 1, "Linguist": 1, "homepage": 1, "https": 1, "//github.com/github/linguist": 1, "ISC": 1, "Alhadis": 1, "foo@bar.com": 1, "Language": 1, "CHANGELOG.md": 1, "language": 2, "Haskell2010": 2, "Main.hs": 1 }, "CartoCSS": { "@marina": 3, "-": 2547, "text": 835, "#576ddf": 1, ";": 1091, "//": 1, "also": 1, "swimming_pool": 1, "@wetland": 2, "darken": 43, "(": 177, "#017fff": 1, "%": 43, ")": 177, "@mud": 2, "#aea397": 1, "@shop": 6, "icon": 9, "#ac39ac": 1, "@transportation": 6, "#0092da": 1, "#0066ff": 6, "@airtransport": 5, "#8461C4": 1, "@landcover": 312, "font": 135, "size": 446, "big": 90, "bigger": 90, "wrap": 340, "width": 353, "face": 127, "name": 214, "@oblique": 8, "fonts": 45, "@standard": 36, ".points": 1, "{": 430, "[": 784, "feature": 223, "]": 784, "zoom": 237, "point": 126, "file": 92, "url": 92, "placement": 167, "interior": 166, "}": 430, "marker": 97, "fill": 145, "#0a0a0a": 1, "#969494": 1, "line": 6, "clip": 15, "false": 15, "access": 6, "opacity": 1, "religion": 8, "denomination": 1, "aeroway": 4, "<": 3, "man_made": 3, "natural": 6, "#d08f55": 2, "#d40000": 1, "ignore": 1, "true": 1, "#239c45": 1, "color": 1, "#8ef2ab": 1, "power": 2, "power_source": 1, ".amenity": 1, "low": 2, "priority": 1, "railway": 2, "highway": 2, "barrier": 6, "#3f3f3f": 1, "#7d7c7c": 1, ".text": 2, "way_pixels": 224, "#000": 1, "halo": 127, "radius": 85, "#734a08": 7, "dy": 43, "@bold": 5, "@book": 32, "#66ccaf": 1, "#000033": 2, "is_building": 66, "@wood": 1, "rgba": 42, "brown": 7, "ele/text": 30, "way_area": 10, "@water": 1, "@stadium": 1, "@track": 1, "@pitch": 1, "@park": 3, "@quarry": 1, "@vineyard": 1, "@cemetery": 1, "@residential": 1, "@garages": 1, "@field": 1, "@grass": 1, "@allotments": 1, "@forest": 1, "@farmyard": 1, "@farmland": 1, "@retail": 1, "@industrial": 1, "@commercial": 1, "@construction": 1, "#6699cc": 6, "black": 1, "@campsite": 1, "@theme_park": 1, "#660033": 1, "@school": 3, "#da0092": 2, "#939": 2, "@danger_area": 1, "@military": 1, "#aa66cc": 1, "@barracks": 1, "@zoo": 1, "@power": 1, "@desert": 1, "@sand": 1, "@heath": 1, "@grassland": 1, "@scrub": 1, "@apron": 1, "@beach": 1, "@rest_area": 1, "@glacier": 1 }, "Ceylon": { "by": 1, "(": 5, ")": 5, "shared": 5, "void": 1, "test": 1, "{": 3, "print": 1, ";": 4, "}": 3, "class": 1, "Test": 2, "name": 3, "satisfies": 1, "Comparable": 1, "": 1, "String": 2, "actual": 2, "string": 1, "Comparison": 1, "compare": 1, "other": 1, "return": 1, "<": 1, "other.name": 1 }, "Chapel": { "use": 5, "Time": 2, "//": 169, "to": 8, "get": 1, "timing": 6, "routines": 1, "for": 49, "benchmarking": 1, "BlockDist": 2, ";": 644, "block": 1, "-": 329, "distributed": 1, "arrays": 5, "luleshInit": 1, "initialization": 1, "code": 1, "data": 1, "set": 3, "config": 10, "param": 17, "useBlockDist": 5, "(": 736, "CHPL_COMM": 1, ")": 733, "use3DRepresentation": 6, "false": 4, "useSparseMaterials": 3, "true": 5, "printWarnings": 3, "if": 122, "&&": 10, "luleshInit.filename": 1, "then": 101, "halt": 13, "const": 69, "initialEnergy": 2, "initial": 1, "energy": 5, "value": 1, "showProgress": 3, "print": 5, "time": 10, "and": 4, "dt": 14, "values": 1, "on": 10, "each": 1, "step": 1, "debug": 8, "various": 1, "info": 1, "doTiming": 4, "the": 9, "main": 3, "timestep": 1, "loop": 1, "printCoords": 2, "final": 1, "computed": 1, "coordinates": 2, "XI_M": 2, "XI_M_SYMM": 4, "XI_M_FREE": 3, "XI_P": 2, "XI_P_SYMM": 3, "XI_P_FREE": 3, "ETA_M": 2, "ETA_M_SYMM": 4, "ETA_M_FREE": 3, "ETA_P": 2, "ETA_P_SYMM": 3, "ETA_P_FREE": 3, "ZETA_M": 2, "ZETA_M_SYMM": 4, "ZETA_M_FREE": 3, "ZETA_P": 2, "ZETA_P_SYMM": 3, "ZETA_P_FREE": 3, "numElems": 2, "numNodes": 1, "initProblemSize": 1, "ElemSpace": 4, "{": 169, "0..#elemsPerEdge": 3, "}": 169, "else": 20, "0..#numElems": 1, "NodeSpace": 4, "0..#nodesPerEdge": 3, "0..#numNodes": 1, "Elems": 52, "dmapped": 8, "Block": 4, "Nodes": 17, "var": 87, "x": 116, "y": 112, "z": 112, "[": 1026, "]": 1026, "real": 68, "nodesPerElem": 1, "elemToNode": 7, "nodesPerElem*index": 1, "lxim": 3, "lxip": 3, "letam": 3, "letap": 3, "lzetam": 3, "lzetap": 3, "index": 4, "XSym": 4, "YSym": 4, "ZSym": 4, "sparse": 3, "subdomain": 3, "u_cut": 6, "hgcoef": 3, "qstop": 2, "monoq_max_slope": 7, "monoq_limiter_mult": 7, "e_cut": 3, "p_cut": 6, "ss4o3": 1, "4.0/3.0": 2, "q_cut": 2, "v_cut": 2, "qlc_monoq": 2, "qqc_monoq": 2, "2.0/3.0": 3, "qqc": 1, "qqc2": 2, "*": 258, "qqc**2": 1, "eosvmax": 14, "eosvmin": 9, "pmin": 7, "emin": 7, "dvovmax": 2, "refdens": 3, "deltatimemultlb": 2, "deltatimemultub": 3, "dtmax": 3, "stoptime": 3, "maxcycles": 3, "max": 6, "int": 21, "dtfixed": 2, "MatElems": 11, "MatElemsType": 2, "enumerateMatElems": 2, "proc": 61, "type": 1, "numLocales": 5, "writeln": 52, "return": 19, "Elems.type": 1, "iter": 3, "i": 273, "in": 99, "do": 70, "yield": 3, "elemBC": 16, "e": 43, "p": 11, "pressure": 1, "q": 14, "ql": 3, "linear": 1, "term": 2, "qq": 3, "quadratic": 1, "v": 12, "//relative": 1, "volume": 18, "vnew": 8, "volo": 6, "reference": 1, "delv": 3, "m_vnew": 1, "m_v": 1, "vdov": 6, "derivative": 1, "over": 1, "arealg": 3, "elem": 3, "characteristic": 2, "length": 2, "ss": 4, "elemMass": 5, "mass": 12, "xd": 9, "yd": 9, "zd": 9, "velocities": 2, "xdd": 4, "ydd": 4, "zdd": 4, "acceleration": 1, "fx": 13, "fy": 13, "fz": 13, "atomic": 5, "forces": 2, "nodalMass": 6, "current": 1, "deltatime": 13, "variable": 1, "increment": 1, "dtcourant": 4, "1.0e20": 3, "courant": 1, "constraint": 2, "dthydro": 4, "change": 2, "cycle": 6, "iteration": 1, "count": 1, "simulation": 1, "initLulesh": 2, "st": 4, "getCurrentTime": 4, "while": 4, "<": 57, "iterTime": 2, "TimeIncrement": 2, "LagrangeLeapFrog": 2, "deprintatomic": 2, "deprint": 3, "writef": 5, "+": 332, "et": 3, "/cycle": 1, "outfile": 1, "open": 1, "iomode.cw": 1, "writer": 1, "outfile.writer": 1, "fmtstr": 2, "writer.writef": 1, "writer.close": 1, "outfile.close": 1, "initCoordinates": 1, "initElemToNodeMapping": 1, "initGreekVars": 1, "initXSyms": 1, "initYSyms": 1, "initZSyms": 1, "//calculated": 1, "fly": 1, "using": 1, "elemToNodes": 3, "initMasses": 2, "octantCorner": 2, "initBoundaryConditions": 2, "massAccum": 3, "forall": 52, "eli": 42, "x_local": 15, "y_local": 15, "z_local": 15, "8*real": 47, "localizeNeighborNodes": 9, "CalcElemVolume": 3, "neighbor": 2, ".add": 7, ".read": 4, "/": 36, "surfaceNode": 8, "n": 11, "mask": 16, "1..nodesPerElem": 5, "<<": 2, "&": 18, "|": 14, "check": 3, "loc": 4, "maxloc": 1, "reduce": 4, "zip": 2, "freeSurface": 3, "initFreeSurface": 1, "b": 4, "inline": 11, "ref": 19, "noi": 22, "TripleProduct": 4, "x1": 5, "y1": 5, "z1": 5, "x2": 1, "y2": 1, "z2": 1, "x3": 1, "y3": 1, "z3": 1, "x1*": 1, "y2*z3": 1, "z2*y3": 1, "x2*": 1, "z1*y3": 1, "y1*z3": 1, "x3*": 1, "y1*z2": 1, "z1*y2": 1, "dx61": 2, "dy61": 2, "dz61": 2, "dx70": 2, "dy70": 2, "dz70": 2, "dx63": 2, "dy63": 2, "dz63": 2, "dx20": 2, "dy20": 2, "dz20": 2, "dx50": 2, "dy50": 2, "dz50": 2, "dx64": 2, "dy64": 2, "dz64": 2, "dx31": 2, "dy31": 2, "dz31": 2, "dx72": 2, "dy72": 2, "dz72": 2, "dx43": 2, "dy43": 2, "dz43": 2, "dx57": 2, "dy57": 2, "dz57": 2, "dx14": 2, "dy14": 2, "dz14": 2, "dx25": 2, "dy25": 2, "dz25": 2, "InitStressTermsForElems": 2, "sigxx": 7, "sigyy": 7, "sigzz": 7, "D": 11, "CalcElemShapeFunctionDerivatives": 3, "b_x": 22, "b_y": 22, "b_z": 22, "fjxxi": 5, ".125": 9, "fjxet": 6, "fjxze": 5, "fjyxi": 5, "fjyet": 6, "fjyze": 5, "fjzxi": 5, "fjzet": 6, "fjzze": 5, "cjxxi": 5, "cjxet": 6, "cjxze": 5, "cjyxi": 5, "cjyet": 6, "cjyze": 5, "cjzxi": 5, "cjzet": 6, "cjzze": 5, "CalcElemNodeNormals": 2, "pfx": 16, "pfy": 16, "pfz": 16, "ElemFaceNormal": 7, "n1": 23, "n2": 23, "n3": 23, "n4": 23, "bisectX0": 3, "bisectY0": 3, "bisectZ0": 3, "bisectX1": 3, "bisectY1": 3, "bisectZ1": 3, "areaX": 5, "areaY": 5, "areaZ": 5, "rx": 6, "ry": 6, "rz": 6, "//results": 1, "SumElemStressesToNodeForces": 2, "stress_xx": 2, "stress_yy": 2, "stress_zz": 2, "CalcElemVolumeDerivative": 2, "VoluDer": 9, "n0": 13, "n5": 13, "ox": 1, "oy": 1, "oz": 1, "ox/12.0": 1, "oy/12.0": 1, "oz/12.0": 1, "dvdx": 15, "dvdy": 15, "dvdz": 15, "CalcElemFBHourglassForce": 2, "hourgam": 10, "8*": 2, "4*real": 3, "coefficient": 7, "hgfx": 5, "hgfy": 5, "hgfz": 5, "hx": 3, "hy": 3, "hz": 3, "j": 38, "shx": 3, "shy": 3, "shz": 3, "CalcElemCharacteristicLength": 2, "AreaFace": 7, "p0": 7, "p1": 7, "p2": 7, "p3": 7, "gx": 5, "gy": 5, "gz": 5, "area": 2, "charLength": 2, "sqrt": 11, "CalcElemVelocityGradient": 2, "xvel": 25, "yvel": 25, "zvel": 25, "detJ": 5, "d": 12, "6*real": 2, "inv_detJ": 10, "dyddx": 2, "dxddy": 2, "dzddx": 2, "dxddz": 2, "dzddy": 2, "dyddz": 2, "CalcPressureForElems": 4, "p_new": 17, "bvc": 15, "pbvc": 14, "e_old": 7, "compression": 10, "vnewc": 22, "c1s": 3, "abs": 9, "//impossible": 1, "targetdt": 6, "//don": 1, "olddt": 4, "newdt": 11, "ratio": 4, "LagrangeNodal": 2, "LagrangeElements": 2, "CalcTimeConstraintsForElems": 2, "CalcForceForNodes": 2, "CalcAccelerationForNodes": 2, "CalcVelocityForNodes": 2, "CalcPositionForNodes": 2, "CalcLagrangeElements": 2, "CalcQForElems": 2, "ApplyMaterialPropertiesForElems": 2, "UpdateVolumesForElems": 2, "CalcCourantConstraintForElems": 2, "CalcHydroConstraintForElems": 2, "computeDTF": 2, "indx": 10, "myvdov": 6, "myarealg": 2, "dtf": 7, "**2": 7, "myarealg**2": 1, "myvdov**2": 1, "val": 6, "min": 2, "calcDtHydroTmp": 2, "//zero": 1, "out": 2, "all": 1, "x.write": 1, "y.write": 1, "z.write": 1, "CalcVolumeForceForElems": 2, "determ": 13, "IntegrateStressForElems": 2, "CalcHourglassControlForElems": 2, "k": 27, "fx_local": 3, "fy_local": 3, "fz_local": 3, "local": 11, "t": 4, "elemToNodesTuple": 3, "x8n": 5, "y8n": 5, "z8n": 5, "CalcFBHourglassForceForElems": 2, "gammaCoef": 5, "4*": 1, "WAS": 1, "volinv": 2, "ss1": 3, "mass1": 3, "volume13": 3, "xd1": 3, "yd1": 3, "zd1": 3, "hourmodx": 3, "hourmody": 3, "hourmodz": 3, "cbrt": 1, "xdtmp": 4, "ydtmp": 4, "zdtmp": 4, "ijk": 7, "dxx": 6, "dyy": 6, "dzz": 6, "CalcKinematicsForElems": 2, "vdovthird": 4, "//get": 2, "nodal": 2, "from": 2, "global": 2, "copy": 2, "into": 2, "xd_local": 4, "yd_local": 4, "zd_local": 4, "dt2": 4, "//wish": 1, "this": 2, "was": 1, "too...": 1, "//volume": 1, "calculations": 1, "relativeVolume": 3, "//set": 1, "delv_xi": 12, "delv_eta": 12, "delv_zeta": 12, "delx_xi": 7, "delx_eta": 7, "delx_zeta": 7, "CalcMonotonicQGradientsForElems": 2, "CalcMonotonicQForElems": 2, "c": 6, "matelm": 2, "vc": 6, "exit": 1, "EvalEOSForElems": 2, "tmpV": 4, "ptiny": 9, "xl": 26, "yl": 26, "zl": 26, "xvl": 26, "yvl": 26, "zvl": 26, "vol": 5, "norm": 20, "ax": 7, "ay": 7, "az": 7, "dxv": 4, "dyv": 4, "dzv": 4, "dxj": 1, "0.25*": 18, "dyj": 1, "dzj": 1, "dxi": 1, "dyi": 1, "dzi": 1, "dxk": 1, "dyk": 1, "dzk": 1, "dyi*dzj": 1, "dzi*dyj": 1, "dzi*dxj": 1, "dxi*dzj": 1, "dxi*dyj": 1, "dyi*dxj": 1, "ax*ax": 3, "ay*ay": 3, "az*az": 3, "ax*dxv": 3, "ay*dyv": 3, "az*dzv": 3, "dyj*dzk": 1, "dzj*dyk": 1, "dzj*dxk": 1, "dxj*dzk": 1, "dxj*dyk": 1, "dyj*dxk": 1, "dyk*dzi": 1, "dzk*dyi": 1, "dzk*dxi": 1, "dxk*dzi": 1, "dxk*dyi": 1, "dyk*dxi": 1, "//got": 1, "rid": 1, "of": 3, "call": 1, "through": 1, "bcMask": 7, "delvm": 27, "delvp": 27, "select": 6, "when": 18, "phixi": 10, "phieta": 10, "phizeta": 10, "qlin": 4, "qquad": 4, "delvxxi": 4, "delvxeta": 4, "delvxzeta": 4, "rho": 3, "delvxxi**2": 1, "phixi**2": 1, "delvxeta**2": 1, "phieta**2": 1, "delvxzeta**2": 1, "phizeta**2": 1, "rho0": 8, "delvc": 11, "p_old": 8, "q_old": 7, "compHalfStep": 8, "qq_old": 7, "ql_old": 7, "work": 5, "e_new": 25, "q_new": 11, "vchalf": 2, "CalcEnergyForElems": 2, "CalcSoundSpeedForElems": 2, "sixth": 2, "pHalfStep": 5, "vhalf": 1, "ssc": 18, "vhalf**2": 1, "3.0*": 1, "4.0*": 1, "q_tilde": 4, "7.0*": 1, "8.0*": 1, "enewc": 2, "pnewc": 2, "ssTmp": 4, "title": 4, "string": 2, "idx3DTo1D": 2, "D.dim": 2, ".size": 2, ".peek": 3, "console": 1, "CyclicDist": 1, "BlockCycDist": 1, "ReplicatedDist": 2, "DimensionalDist2D": 2, "ReplicatedDim": 2, "BlockCycDim": 1, "Space": 12, "1..n": 4, "BlockSpace": 2, "boundingBox": 2, "BA": 5, "ba": 4, "here.id": 7, "BA.hasSingleLocalSubdomain": 1, "L": 6, "Locales": 9, "indices": 6, "BA.localSubdomain": 1, "L.id": 2, "MyLocaleView": 5, "0..#numLocales": 1, "MyLocales": 6, "locale": 1, "reshape": 2, "BlockSpace2": 2, "targetLocales": 1, "BA2": 3, "ML": 2, "BA2.targetLocales": 1, "CyclicSpace": 2, "Cyclic": 1, "startIdx": 2, "Space.low": 5, "CA": 4, "ca": 2, "CA.localSubdomain": 1, "BlkCycSpace": 2, "BlockCyclic": 1, "blocksize": 1, "BCA": 4, "bca": 2, "BCA.hasSingleLocalSubdomain": 1, "verifyID": 3, "Data": 2, "Data.localSubdomains": 1, "ReplicatedSpace": 2, "RA": 11, "ra": 4, "RA.numElements": 1, "A": 13, "i*100": 1, "here": 2, "LocaleSpace.high": 3, "nl1": 2, "nl2": 2, "numLocales/2": 1, "0..#nl1": 2, "0..#nl2": 1, "0..#nl1*nl2": 1, "DimReplicatedBlockcyclicSpace": 2, "new": 7, "BlockCyclicDim": 1, "lowIdx": 1, "blockSize": 1, "DRBA": 3, "locId1": 2, "drba": 2, "Helper": 2, "Random": 1, "random": 1, "number": 1, "generation": 1, "Timer": 2, "class": 1, "timer": 2, "sort": 1, "2**15": 1, "size": 1, "array": 3, "be": 1, "sorted": 1, "thresh": 6, "recursive": 1, "depth": 1, "serialize": 1, "verbose": 5, "many": 1, "elements": 1, "bool": 1, "disable": 1, "numbers": 1, "fillRandom": 1, "1..verbose": 2, "timer.start": 1, "pqsort": 4, "timer.stop": 1, "timer.elapsed": 1, "2..n": 1, "arr": 32, "low": 12, "arr.domain.low": 1, "high": 14, "arr.domain.high": 1, "where": 2, "arr.rank": 2, "bubbleSort": 2, "pivotVal": 9, "findPivot": 2, "pivotLoc": 3, "partition": 2, "serial": 1, "cobegin": 1, "mid": 7, "ilo": 9, "ihi": 6, "low..high": 2, "pi": 1, "solarMass": 7, "pi**2": 1, "daysPerYear": 13, "record": 1, "body": 6, "pos": 5, "3*real": 2, "does": 1, "not": 1, "after": 1, "it": 1, "is": 1, "up": 1, "bodies": 8, "numbodies": 1, "bodies.numElements": 1, "initSun": 2, "advance": 2, "b.v": 2, "b.mass": 1, ".v": 1, "1..numbodies": 4, "updateVelocities": 2, "b1": 2, "b2": 2, "dpos": 4, "b1.pos": 2, "b2.pos": 2, "mag": 3, "sumOfSquares": 4, "**3": 1, "b1.v": 2, "b2.mass": 2, "b2.v": 1, "b1.mass": 3, "b.pos": 1 }, "Charity": { "%": 2, "data": 1, "LA": 1, "(": 1, "A": 2, ")": 1, "-": 3, "D": 2, "ss": 1, "|": 1, "ff": 1, "D.": 1 }, "Cirru": { "print": 38, "array": 14, "int": 36, "string": 7, "set": 12, "a": 22, "(": 20, ")": 20, "self": 2, "c": 9, "child": 1, "under": 2, "parent": 1, "get": 4, "x": 2, "just": 4, "-": 4, "code": 4, "eval": 2, "require": 1, "./stdio.cr": 1, "float": 1, "f": 3, "block": 1, "b": 7, "call": 1, "nothing": 1, "map": 8, "container": 3, "bool": 6, "true": 1, "false": 1, "yes": 1, "no": 1, "m": 3 }, "Clarion": { "MEMBER": 1, "(": 141, ")": 140, "INCLUDE": 1, "ONCE": 6, "MAP": 2, "END": 12, "HelloClass.Construct": 1, "PROCEDURE": 26, "CODE": 27, "HelloClass.Destruct": 1, "VIRTUAL": 4, "HelloClass.SayHello": 1, "MESSAGE": 2, "Member": 2, "Include": 5, "Map": 2, "MODULE": 1, "General": 1, "functions": 2, "GetLastError": 6, "DWORD": 2, "PASCAL": 4, "Console": 1, "GetStdHandle": 3, "HANDLE": 1, "PROC": 10, "RAW": 3, "WriteConsole": 2, "Handle": 4, "Long": 5, "Dword": 2, "long": 4, "bool": 2, "Raw": 4, "Pascal": 4, "name": 4, "ReadConsole": 2, "SetConsoleTitle": 1, "Bool": 2, "GetConsoleTitle": 1, "dword": 1, "SetConsoleMode": 2, "dWord": 1, "BOOL": 2, "GetConsoleMode": 1, "End": 8, "ConsoleSupport.Construct": 1, "ConsoleSupport.Destruct": 1, "ConsoleSupport.Init": 1, "BYTE": 7, "SELF.OutputHandle": 3, "STD_OUTPUT_HANDLE": 1, "If": 3, "INVALID_HANDLE_VALUE": 4, "Halt": 5, "&": 20, "RETURN": 26, "SELF.InputHandle": 4, "STD_INPUT_HANDLE": 1, "if": 6, "ENABLE_PROCESSED_INPUT": 1, "INVALID_OTHER": 1, "FALSE": 6, "ConsoleSupport.WriteLine": 1, "STRING": 13, "pText": 2, "SELF.TextBuffer": 3, "SELF.Prefix": 1, "ADDRESS": 2, "LEN": 1, "SELF.BytesWritten": 1, "NULL": 2, "-": 81, "Consolesupport.ReadKey": 1, "SELF.WriteLine": 1, "Clear": 1, "SELF.InBuffer": 3, "Loop": 1, "IF": 10, "Address": 2, "SELF.BytesRead": 2, "THEN": 1, "Break": 1, "Until": 1, "PROGRAM": 1, "omit": 1, "_VER_C55": 1, "_ABCDllMode_": 1, "EQUATE": 2, "_ABCLinkMode_": 1, "***": 2, "map": 1, "CStringClass.Construct": 1, "Declare": 18, "Procedure": 18, "SELF.bufferSize": 5, "DEFAULT_CS_BUFFER_SIZE": 1, "SELF.CS": 16, "New": 4, "CSTRING": 6, "CStringClass.Destruct": 1, "Dispose": 4, "SELF.cs": 1, "CStringClass.Cat": 1, "pStr": 10, "*CSTRING": 7, "newLen": 7, "LONG": 8, "AUTO": 2, "oldCS": 5, "Len": 7, "+": 17, "SELF.strLength": 9, "SELF.newStrSize": 6, "Only": 2, "grow": 1, "the": 28, "internal": 2, "string": 12, "result": 1, "of": 7, "cat": 1, "will": 1, "be": 4, "larger": 1, "than": 1, "currently": 1, "is.": 1, "The": 1, "reason": 1, "for": 3, "is": 13, "because": 1, "this": 6, "used": 2, "in": 3, "slicing": 1, "outside": 1, "IF.": 1, "Without": 1, "matching": 1, "there": 1, "potential": 1, "an": 1, "out": 1, "bounds": 1, "slice": 1, "which": 1, "would": 1, "bad": 1, "Save": 1, "a": 7, "temporary": 1, "copy": 2, "old": 2, "so": 2, "we": 4, "can": 1, "us": 1, "it": 6, "concatination": 1, "after": 1, "have": 1, "grown": 1, "Append": 1, "new": 2, "directly": 1, "to": 6, "end": 2, "one.": 1, "[": 2, "]": 2, "And": 1, "terminate": 1, "manually": 1, "This": 4, "same": 1, "as": 1, "doing": 1, "but": 2, "_really_": 1, "slow": 1, "on": 2, "large": 2, "strings.": 1, "much": 1, "faster": 1, "what": 1, "SELF.Str": 20, "s": 1, "It": 1, "nice": 1, "and": 3, "neat": 1, "solution": 1, "performance": 2, "especially": 1, "strings": 1, "was": 1, "terrible": 1, "CStringClass.Str": 2, "Dispose/New": 1, "one": 1, "requires": 1, "it.": 1, "might": 1, "slightly": 1, "innefficient": 1, "terms": 1, "memory": 1, "usage": 1, "when": 2, "gets": 2, "smaller": 1, "But": 1, "_vasty_": 1, "better": 1, "added": 1, "lot.": 1, "CStringClass.Len": 1, "CStringClass.Replace": 1, "pFind": 6, "pReplace": 3, "FindString": 1, "ReplaceWith": 1, "locate": 6, "lastLocate": 3, "LOOP": 1, "InString": 5, "Upper": 3, "BREAK": 1, "So": 1, "dont": 1, "up": 1, "having": 1, "recursive": 1, "replacement.": 1, "Sub": 3, "|": 3, "SELF.Len": 1, "CStringClass.Contains": 1, "pCaseSensitive": 6, "TRUE": 10, "Returns": 4, "value": 1, "indicating": 1, "whether": 1, "specified": 1, "String": 1, "occurs": 1, "within": 3, "string.": 1, "Second": 1, "parameter": 3, "defaults": 1, "case": 1, "sensitive": 1, "search.": 1, "ELSE": 4, "Lower": 3, "SELF.Lower": 3, "CStringClass.Lower": 1, "version": 1, "self.cs": 2, "doesnt": 1, "change": 1, "CStringClass.SubString": 1, "pPosition": 2, "pLength": 2, "CStringClass.ToLower": 1, "Converts": 2, "lowercase": 1, "returns": 2, "converted": 2, "CStringClass.ToUpper": 1, "uppercase": 1, "SELF.Upper": 1, "CStringClass.Trim": 1, "Left": 1, "Clip": 1, "CStringClass.Upper": 1, "CStringClass.IndexOf": 1, "pLookIn": 7, "index": 1, "first": 2, "found": 3, "zero": 1, "not": 1, "CStringClass.FoundIn": 1, "no": 1, "SELF.IndexOf": 1, "CStringClass.SetBuffer": 1, "pNewBuffer": 2, "CStringClass.EscapeXml": 1, "": 1, "CS": 1, "CStringClass": 1, "Omitted": 1, "CS.Str": 2, "Make": 1, "don": 1, "CS.Replace": 5 }, "Clean": { "definition": 4, "module": 9, "streams": 2, "import": 10, "StdEnv": 4, "instance": 12, "zero": 4, "[": 96, "Real": 28, "]": 96, "one": 5, "+": 14, "-": 69, "*": 13, "/": 3, "X": 3, "invert": 5, "pow": 5, "Int": 32, "(": 101, "shuffle": 6, ")": 101, "infixl": 4, "monadicSemantics": 1, "StdGeneric": 4, "GenMap": 4, "GenHylo": 2, "Op": 4, "Plus": 2, "|": 45, "Minus": 2, "Times": 2, "Rem": 1, "Equal": 1, "LessThan": 1, "Var": 7, "String": 1, "ExpP": 3, "a": 55, "Exp": 4, "Fix": 9, "StmP": 3, "Assign": 1, "If": 1, "While": 1, "Seq": 1, "Cont": 1, "Stm": 1, "derive": 4, "gMap": 19, "Env": 3, "Sem": 11, "empty": 2, "v": 8, ".": 2, "rtn": 2, "i": 14, "e.": 4, "e": 8, "x": 26, "y": 5, "e2": 2, ".y": 1, "_.": 1, "read": 2, "write": 2, "w.": 1, "if": 1, "w": 4, "class": 1, "sem": 1, "operator": 4, "implementation": 3, "where": 7, "//Infinite": 1, "row": 1, "of": 2, "zeroes": 1, "represented": 1, "as": 1, "list": 2, "to": 2, "ease": 1, "computation": 1, "s": 47, "t": 23, "_": 4, "1.0/s": 2, "n": 8, "s*t": 1, "fsieve": 1, "StdClass": 2, ";": 1, "//": 3, "RWS": 1, "StdInt": 2, "StdReal": 1, "NrOfPrimes": 3, "The": 1, "sieve": 1, "algorithm": 1, "generate": 1, "an": 1, "infinite": 1, "all": 1, "primes.": 1, "Primes": 3, "pr": 6, "Sieve": 8, "g": 8, "prs": 6, "IsPrime": 4, "toInt": 1, "sqrt": 1, "toReal": 1, "Bool": 1, "f": 26, "r": 5, "bd": 3, "True": 1, "rem": 1, "False": 1, "Select": 6, "is": 1, "used": 1, "get": 1, "the": 1, "Start": 2, "generic": 2, "b": 2, ".a": 11, ".b": 5, "c": 2, "UNIT": 2, "PAIR": 4, "EITHER": 3, "CONS": 4, "FIELD": 4, "OBJECT": 4, "{": 17, "}": 17, "stack": 2, "Stack": 28, "newStack": 3, "push": 3, "pushes": 3, "pop": 4, "abort": 2, "popn": 3, "drop": 1, "top": 4, "topn": 3, "take": 1, "elements": 3, "count": 3, "length": 1, "In": 1, "Out": 1, "u": 6, "<": 1, "hylo": 1, ".f": 2, "cata": 1, "ana": 1, "StdArray": 1, "StdFunc": 1, "_Array": 1, "fx": 2, "fy": 2, "fl": 3, "fr": 3, "LEFT": 2, "RIGHT": 2, "xs": 4, "mapArray": 2 }, "Click": { "//": 14, "AddressInfo": 1, "(": 54, "eth0": 18, "-": 125, "in": 8, "192.168.1.0/24": 1, "0d": 2, "9d": 2, "1c": 2, "e9": 2, "ex": 9, "gw": 7, "addr": 3, "c2": 1, ")": 54, ";": 79, "elementclass": 2, "SniffGatewayDevice": 2, "{": 2, "device": 9, "|": 2, "from": 2, "FromDevice": 1, "t1": 2, "Tee": 2, "output": 8, "input": 3, "q": 1, "Queue": 1, "t2": 2, "PullTee": 1, "to": 4, "ToDevice": 1, "[": 72, "]": 72, "ToHostSniffers": 2, "ScheduleInfo": 1, ".1": 1, "}": 2, "arpq_in": 3, "ARPQuerier": 1, "ip_to_extern": 3, "GetIPAddress": 2, "CheckIPHeader": 4, "EtherEncap": 2, "ip_to_host": 8, "ToHost": 2, "ip_to_intern": 4, "arp_class": 5, "Classifier": 2, "12/0806": 2, "20/0001": 1, "ARP": 7, "requests": 1, "20/0002": 1, "replies": 1, "host": 5, "12/0800": 1, "IP": 7, "packets": 2, "ARPResponder": 1, "arp_t": 3, "Strip": 1, "ipclass": 4, "IPClassifier": 9, "dst": 11, "src": 3, "net": 6, "iprw": 1, "IPRewriterPatterns": 1, "NAT": 2, "rw": 6, "IPRewriter": 1, "pattern": 1, "pass": 1, "irw": 6, "ICMPPingRewriter": 1, "icmp_me_or_intern": 5, "ierw": 4, "ICMPRewriter": 1, "established_class": 3, "firewall": 9, "tcp": 4, "port": 6, "ssh": 2, "smtp": 2, "domain": 4, "udp": 2, "icmp": 5, "type": 2, "echo": 2, "reply": 2, "proto": 1, "t": 1, "u": 1, "other": 1, "probably": 1, "for": 1, "connection": 1, "Discard": 5, "don": 1, "inter_class": 3, "ip_udp_class": 3, "or": 1, "rates": 2, "AvailableRates": 1, "sr2": 2, "sr2_ip": 10, "sr2_nm": 3, "wireless_mac": 7, "gateway": 2, "probes": 2, "arp": 6, "ARPTable": 1, "lt": 7, "LinkTable": 1, "SR2GatewaySelector": 1, "ETHTYPE": 5, "ETH": 6, "LT": 6, "PERIOD": 2, "GW": 1, "SR2SetChecksum": 4, "set_gw": 3, "SR2SetGateway": 1, "SEL": 1, "es": 3, "SR2ETTStat": 1, "TAU": 1, "PROBES": 1, "ETT": 1, "metric": 2, "RT": 1, "SR2ETTMetric": 1, "forwarder": 5, "SR2Forwarder": 1, "querier": 5, "SR2Querier": 1, "SR": 1, "ROUTE_DAMPENING": 1, "true": 3, "TIME_BEFORE_SWITCH": 1, "DEBUG": 3, "query_forwarder": 5, "SR2MetricFlood": 1, "false": 2, "query_responder": 4, "SR2QueryResponder": 1, "SR2Print": 1, "forwarding": 1, "data_ck": 3, "host_cl": 2, "mask": 2, "dt": 2, "DecIPTTL": 1, "Print": 1, "ttl": 1, "error": 1, "ICMPError": 1, "timeexceeded": 1, "SetTimestamp": 1, "//ip": 1, "me": 1, "SR2StripHeader": 1, "from_gw_cl": 2, "ncl": 6, "12/0643": 1, "//sr2_forwarder": 1, "12/0644": 1, "//sr2": 1, "12/0645": 1, "//replies": 1, "12/0641": 1, "//sr2_es": 1, "12/062c": 1, "//sr2_gw": 1, "SR2CheckHeader": 4, "PrintSR": 1, "query": 1, "Idle": 2, "s": 5 }, "Clojure": { "[": 69, "html": 2, "head": 2, "meta": 3, "{": 21, "charset": 2, "}": 21, "]": 69, "link": 2, "rel": 2, "href": 6, "script": 1, "src": 1, "body": 2, "div.nav": 1, "p": 4, ";": 359, "from": 2, "https": 1, "//github.com/boot": 1, "-": 76, "clj/boot#configure": 1, "task": 2, "options": 2, "(": 267, "set": 1, "env": 1, "source": 1, "paths": 1, "#": 15, "dependencies": 1, "pom": 2, "project": 1, "version": 1, "jar": 2, "manifest": 1, ")": 264, "deftask": 1, "build": 1, "comp": 2, "install": 1, "clj": 1, "ns": 2, "c2.svg": 2, "use": 3, "c2.core": 2, "only": 4, "unify": 2, "c2.maths": 2, "Pi": 2, "Tau": 2, "radians": 2, "per": 2, "degree": 2, "sin": 2, "cos": 2, "mean": 2, "cljs": 3, "require": 2, "c2.dom": 1, "as": 1, "dom": 1, "Stub": 1, "for": 5, "float": 2, "fn": 3, "which": 2, "does": 1, "not": 9, "exist": 1, "on": 11, "runtime": 1, "def": 4, "identity": 1, "defn": 14, "xy": 1, "coordinates": 7, "cond": 2, "and": 8, "vector": 1, "count": 5, "map": 3, "x": 11, "y": 1, "prime": 3, "n": 9, "any": 3, "zero": 2, "rem": 2, "%": 6, "range": 4, "when": 5, "continues": 1, "through": 1, "the": 7, "collection": 2, "even": 1, "if": 4, "some": 1, "have": 1, "condition": 1, "evaluate": 1, "to": 3, "false": 7, "like": 2, "filter": 3, "while": 3, "stops": 1, "at": 2, "first": 2, "element": 1, "that": 1, "evaluates": 1, "take": 1, "into": 3, "array": 3, "aseq": 8, "nil": 3, "type": 8, "let": 3, "a": 7, "make": 1, "loop": 2, "seq": 1, "i": 20, "<": 1, "do": 15, "aset": 1, "recur": 1, "next": 1, "inc": 2, "Copyright": 1, "c": 1, "Alan": 1, "Dipert": 1, "Micha": 1, "Niskin.": 1, "All": 1, "rights": 1, "reserved.": 1, "The": 1, "distribution": 1, "terms": 2, "this": 6, "software": 2, "are": 2, "covered": 1, "by": 4, "Eclipse": 1, "Public": 1, "License": 1, "http": 2, "1.0.php": 1, "can": 1, "be": 2, "found": 1, "in": 4, "file": 1, "epl": 1, "v10.html": 1, "root": 1, "of": 2, "distribution.": 1, "By": 1, "using": 1, "fashion": 1, "you": 1, "agreeing": 1, "bound": 1, "license.": 1, "You": 1, "must": 1, "remove": 3, "notice": 1, "or": 2, "other": 1, "software.": 1, "page": 2, "refer": 4, "clojure": 1, "exclude": 1, "nth": 2, "tailrecursion.hoplon.reload": 1, "reload": 2, "all": 5, "tailrecursion.hoplon.util": 1, "name": 1, "pluralize": 2, "tailrecursion.hoplon.storage": 1, "atom": 1, "local": 3, "storage": 2, "utility": 1, "functions": 2, "declare": 1, "route": 11, "state": 15, "editing": 13, "mapvi": 2, "vec": 2, "indexed": 1, "dissocv": 2, "v": 15, "z": 4, "dec": 1, "neg": 1, "pop": 1, "pos": 1, "subvec": 2, "decorate": 2, "todo": 10, "done": 12, "completed": 12, "text": 14, "assoc": 4, "visible": 2, "empty": 8, "persisted": 1, "cell": 12, "AKA": 1, "stem": 1, "store": 1, "cells": 2, "defc": 6, "loaded": 1, "formula": 1, "computed": 1, "active": 5, "plural": 1, "item": 1, "todos": 2, "list": 1, "transition": 1, "t": 5, "destroy": 3, "swap": 6, "clear": 2, "&": 1, "_": 4, "new": 5, "conj": 1, "mapv": 1, "reset": 1, "lang": 1, "equiv": 1, "content": 1, "title": 1, "noscript": 1, "div": 3, "id": 20, "section": 2, "header": 1, "h1": 1, "form": 2, "submit": 2, "val": 4, "value": 3, "input": 4, "autofocus": 1, "true": 5, "placeholder": 1, "blur": 2, "toggle": 4, "attr": 2, "checked": 2, "click": 4, "label": 2, "ul": 2, "tpl": 1, "reverse": 1, "bind": 1, "ids": 1, "done#": 3, "edit#": 3, "bindings": 1, "edit": 3, "show": 2, "li": 4, "class": 8, "dblclick": 1, "@i": 6, "button": 2, "focus": 1, "@edit": 2, "change": 1, "footer": 2, "span": 2, "strong": 1, "selected": 3, "rand": 1, "default": 2, "exclusive": 1, ".": 1, "scm*": 1, "random": 1, "real": 1, "deftest": 1, "function": 1, "tests": 1, "is": 7, "contains": 1, "foo": 6, "bar": 4, "select": 1, "keys": 2, "baz": 4, "vals": 1, "defprotocol": 1, "ISound": 4, "sound": 5, "deftype": 2, "Cat": 1, "Dog": 1, "extend": 1 }, "Closure Templates": { "{": 15, "namespace": 1, "Exmaple": 1, "}": 15, "template": 1, ".foo": 1, "@param": 2, "count": 4, "string": 1, "name": 3, "int": 1, "if": 1, "isNonnull": 1, "(": 1, ")": 1, "

": 1, "

": 1, "/if": 1, "
": 1, "class=": 1, "switch": 1, "case": 1, "call": 1, "Empty.view": 1, "param": 1, "/": 1, "/call": 1, "default": 1, "

": 1, "Wow": 1, "so": 1, "many": 1, "

": 1, "/switch": 1, "
": 1, "/template": 1 }, "Cloud Firestore Security Rules": { "service": 1, "cloud.firestore": 1, "{": 22, "match": 4, "/databases/": 1, "database": 1, "}": 22, "/documents": 1, "/activities/": 1, "activity": 4, "allow": 9, "create": 3, "if": 9, "isSignedIn": 10, "(": 98, ")": 98, "&&": 40, "isOwner": 10, "incomingData": 16, ".authorId": 9, "isValidActivity": 3, ";": 22, "read": 3, "delete": 3, "existingData": 7, "update": 3, "/skills/": 1, "skill": 4, "isValidSkill": 3, "hasAllowedSkillFieldsForCreate": 2, "hasAllowedSkillFieldsForUpdate": 2, "/activities": 1, "-": 1, "skills/": 1, "activitySkill": 4, "isValidActivitySkill": 3, "///": 2, "Functions": 1, "function": 13, "return": 13, "request.auth": 1, "null": 5, "userId": 2, "request.auth.uid": 1, "resource.data": 1, "request.resource.data": 1, "activity.title": 1, "is": 12, "string": 6, "activity.title.size": 2, "<": 2, "activity.summary": 1, "activity.audienceCountMin": 2, "int": 4, "||": 4, "activity.audienceCountMax": 2, "activity.audienceAgeMin": 2, "activity.audienceAgeMax": 2, "activity.lastUpdateDate.date": 1, "timestamp": 2, "activity.keys": 4, ".size": 6, ".hasAll": 6, "[": 6, "]": 6, "skill.title": 1, "skill.title.size": 2, "skill.summary": 1, "skill.lastUpdateDate.date": 1, "skill.keys": 4, "activitySkill.skillId": 1, "activitySkill.activityId": 1, "activitySkill.keys": 4 }, "CoNLL-U": { "PT": 9, "PROPN": 24, "PROP": 6, "|": 519, "M": 40, "S": 41, "@NPHR": 1, "Gender": 49, "Masc": 31, "Number": 95, "Sing": 77, "root": 25, "_": 761, "-": 54, "no": 1, "em": 6, "ADP": 24, "": 8, "PRP": 14, "@N": 10, "<": 22, "case": 36, "o": 33, "DET": 29, "<-sam>": 9, "": 11, "ART": 16, "@": 33, "N": 77, "Definite": 23, "Def": 16, "PronType": 42, "Art": 23, "det": 38, "governo": 5, "NOUN": 68, "": 12, "@P": 11, "nmod": 28, "BRAS": 1, "LIA": 1, "Bras": 1, "lia": 1, "F": 19, "@ADVL": 3, "Fem": 16, "dep": 1, "Pesquisa": 2, "nsubj": 30, "ChangedBy": 15, "Issue119": 4, "MWE": 2, "Pesquisa_Datafolha": 1, "MWEPOS": 2, "Datafolha": 2, "flat": 7, "name": 3, "publicada": 1, "publicar": 1, "VERB": 37, "": 8, "V": 34, "PCP": 2, "@ICL": 5, "VerbForm": 21, "Part": 3, "acl": 8, "hoje": 2, "ADV": 25, "": 3, "4": 3, "advmod": 30, "6": 5, "revela": 1, "revelar": 1, "mv": 5, "PR": 7, "3S": 5, "IND": 9, "@FS": 9, "STA": 7, "Mood": 13, "Ind": 22, "Person": 17, "Tense": 13, "Pres": 8, "Fin": 14, "um": 6, "": 2, "dado": 2, "": 6, "": 6, "Gender=": 11, "Number=": 13, "obj": 18, "9": 2, "supreendente": 1, "surpreendente": 1, "ADJ": 23, "8": 3, "amod": 17, "ChangedBy=": 8, "SpaceAfter=": 8, "10": 2, "PUNCT": 55, "PU": 25, "26": 4, "punct": 73, "11": 4, "recusando": 1, "recusar": 1, "GER": 2, "ADVL": 1, "Ger": 1, "advcl": 9, "uma": 1, "postura": 2, "14": 1, "radical": 2, "13": 3, "15": 1, "16": 1, "a": 12, "artd": 3, "esmagadora": 1, "esmagador": 1, "maioria": 2, "@SUBJ": 6, "(": 6, "@PU": 7, "Issue165": 7, "SpaceAfter": 48, "No": 48, "NUM": 6, "": 1, "P": 17, "NumType": 1, "Card": 1, "nummod": 2, "Issue168": 1, "%": 2, "SYM": 1, "": 3, "18": 1, "appos": 3, "22": 4, "21": 2, "23": 3, "24": 1, "dos": 1, "de": 14, "sam": 3, "os": 2, "Plur": 18, "eleitores": 1, "eleitor": 1, "quer": 1, "querer": 1, "Mood=": 2, "Person=": 2, "Tense=": 2, "VerbForm=": 4, "relcl": 5, "27": 1, "29": 1, "participando": 1, "participar": 1, "": 2, "xcomp": 2, "30": 2, "31": 2, "do": 7, "": 2, "32": 1, "Governo": 1, "": 1, "obl": 18, "Fernando": 2, "Fernando_Henrique_Cardoso": 1, "Henrique": 2, "Cardoso": 2, ".": 33, "Tem": 1, "ter": 1, "sentido": 4, "1": 7, "3": 2, "ali": 2, "s": 5, "kc": 1, "5": 4, "7": 2, "muit": 2, "ssimo": 2, "quant": 2, "": 1, "2": 1, "text": 2, "Muito": 2, "mais": 3, "que": 5, "nos": 2, "tempos": 2, "na": 2, "ditadura": 3, "solidez": 3, "est": 2, "agora": 3, "amea": 3, "ada": 2, "source": 2, "CETENFolha": 2, "n=": 2, "cad=": 2, "sec=": 2, "sem=": 2, "sent_id": 2, "CF1": 2, "id": 2, "muito": 2, "A": 12, "": 2, "": 1, "": 1, "@COM": 1, "PRON": 22, "": 1, "Dem": 5, "fixed": 2, "": 1, "INDP": 2, "Rel": 3, "": 4, "@KOMP": 1, "tempo": 1, "estar": 1, "AUX": 9, "cop": 9, "Issue167": 1, "": 1, "20": 1, "ar": 1, "": 1, "0": 1, "Nem": 2, "Lula": 3, "nem": 4, "partido": 3, "ainda": 5, "encontraram": 2, "discurso": 3, "para": 3, "se": 5, "diferenciar": 3, "CCONJ": 8, "parkc": 1, "KC": 3, "@CO": 3, "cc": 11, "": 1, "": 1, "": 2, "conj": 12, "encontrar": 1, "PS/MQP": 2, "3P": 7, "12": 2, "PERS": 3, "ACC": 3, "PASS": 2, "Case": 5, "Acc": 2, "Prs": 6, "expl": 2, "Issue135": 2, "Inf": 3, "Eles": 1, "eles": 1, "NOM": 1, "Nom": 3, "@ACC": 2, "dizem": 1, "dizer": 1, "": 1, "oposi": 2, "mas": 2, "co": 1, "fcl": 1, "n": 4, "Polarity": 1, "Neg": 1, "informaram": 1, "informar": 1, "": 1, "Int": 3, "v": 1, "ir": 1, "": 1, "aux": 6, "combater": 2, "INF": 1, "ccomp": 3, "Muitas": 1, "das": 1, "as": 2, "prioridades": 2, "prioridade": 2, "novo": 2, "coincidem": 1, "coincidir": 1, "com": 2, "csubj": 1, "Translit": 103, "asmanni": 1, "orphan": 2, "k": 8, "pk": 1, "Y": 21, "poss": 10, "derya": 1, "l": 1, "sulirini": 1, "ps": 1, "z": 1, "turushqa": 1, "D": 2, "compound": 18, "redup": 2, "del": 1, "derexlerni": 1, "b": 2, "baraqsan": 1, "bolushqa": 1, "haywanlarni": 1, "erkin": 1, "azade": 2, "yashashqa": 1, "ige": 1, "qilish": 1, "bizning": 1, "ortaq": 1, "arzuyimiz": 1, "bu": 1, "lektiki": 1, "t": 1, "kistlerni": 1, "oqush": 1, "R": 3, "arqiliq": 1, "kishilerning": 1, "haywanlar": 1, "C": 2, "we": 3, "ml": 1, "klerge": 1, "qandaq": 2, "muamile": 1, "qilghanliqi": 1, "aqiwitining": 1, "bolghanliqini": 1, "r": 1, "p": 1, "baqayli": 2, "yene": 1, "etrapimizdiki": 1, "muhitni": 2, "yaxshi": 1, "zitip": 1, "qoghdash": 1, "ch": 2, "milerni": 1, "qilalaydighanliqimiz": 1, "toghruluq": 1, "oylinip": 1, "bir": 3, "tmod": 2, "yili": 1, "bahar": 1, "part": 1, "nlirining": 1, "biride": 1, "shiw": 1, "tsariyining": 1, "wogzalida": 1, "hawa": 1, "tengshig": 1, "ornitilghan": 1, "chirayliq": 1, "poyiz": 1, "qozghilish": 1, "aldida": 1, "turatti": 1, "wogzal": 1, "supisi": 1, "uzatquchilar": 1, "bilen": 1, "tolup": 1, "ketkenidi": 1, "ularning": 1, "uzatmaqchi": 1, "bolghini": 1, "zgiche": 1, "mihman": 1, "qarlighachlar": 1, "idi": 1, "What": 2, "what": 2, "WP": 2, "if": 4, "SCONJ": 3, "IN": 12, "mark": 6, "Google": 8, "NNP": 11, "Morphed": 1, "morph": 1, "VBD": 3, "Past": 5, "Into": 1, "into": 3, "GoogleOS": 2, "expanded": 1, "expand": 1, "on": 2, "its": 2, "Neut": 2, "Poss": 1, "Yes": 1, "search": 4, "NN": 15, "HYPH": 3, "engine": 4, "LRB": 3, "and": 3, "CC": 3, "now": 2, "RB": 7, "e": 2, "mail": 2, ")": 4, "RRB": 3, "wares": 2, "NNS": 2, "DT": 9, "full": 2, "fledged": 2, "JJ": 5, "Degree": 6, "Pos": 6, "operating": 2, "system": 2, "[": 2, "via": 2, "Microsoft": 2, "Watch": 2, "from": 2, "Mary": 2, "Jo": 2, "Foley": 2, "]": 2, "And": 1, "by": 2, "the": 4, "way": 2, "is": 2, "be": 3, "VBZ": 3, "anybody": 2, "else": 2, "just": 2, "little": 2, "npmod": 2, "nostalgic": 2, "for": 2, "days": 1, "day": 1, "when": 2, "WRB": 1, "that": 4, "was": 1, "good": 2, "thing": 2, "This": 1, "this": 3, "BuzzMachine": 2, "post": 4, "argues": 1, "argue": 1, "PART": 1, "POS": 1, "rush": 2, "toward": 2, "ubiquity": 2, "might": 2, "MD": 1, "backfire": 2, "VB": 1, "which": 2, "WDT": 1, "all": 2, "heard": 1, "hear": 1, "VBN": 2, "before": 2, "but": 2, "it": 2, "pass": 2, "particularly": 2, "well": 2, "put": 2, "in": 2, "nice": 2 }, "CoffeeScript": { "dnsserver": 1, "require": 24, "exports.Server": 1, "class": 9, "Server": 2, "extends": 5, "dnsserver.Server": 1, "NS_T_A": 3, "NS_T_NS": 2, "NS_T_CNAME": 1, "NS_T_SOA": 2, "NS_C_IN": 5, "NS_RCODE_NXDOMAIN": 2, "constructor": 6, "(": 236, "domain": 6, "@rootAddress": 2, ")": 235, "-": 155, "super": 3, "@domain": 3, "domain.toLowerCase": 1, "@soa": 2, "createSOA": 2, "@on": 1, "@handleRequest": 1, "handleRequest": 1, "req": 4, "res": 3, "question": 5, "req.question": 1, "subdomain": 10, "@extractSubdomain": 1, "question.name": 3, "if": 140, "and": 32, "isARequest": 2, "res.addRR": 2, "subdomain.getAddress": 1, "else": 68, ".isEmpty": 1, "isNSRequest": 2, "true": 7, "res.header.rcode": 1, "res.send": 1, "extractSubdomain": 1, "name": 6, "Subdomain.extract": 1, "question.type": 2, "is": 65, "question.class": 2, "mname": 2, "rname": 2, "serial": 2, "parseInt": 5, "new": 12, "Date": 1, ".getTime": 1, "/": 18, "refresh": 2, "retry": 2, "expire": 2, "minimum": 2, "dnsserver.createSOA": 1, "exports.createServer": 1, "address": 4, "exports.Subdomain": 1, "Subdomain": 4, "@extract": 1, "return": 37, "unless": 30, "name.toLowerCase": 1, "offset": 4, "name.length": 1, "domain.length": 1, "name.slice": 2, "then": 30, "null": 14, "@for": 2, "IPAddressSubdomain.pattern.test": 1, "IPAddressSubdomain": 2, "EncodedSubdomain.pattern.test": 1, "EncodedSubdomain": 2, "@subdomain": 1, "@address": 2, "@labels": 2, ".split": 1, "[": 156, "]": 156, "@length": 3, "@labels.length": 1, "isEmpty": 1, "getAddress": 3, "@pattern": 2, "///": 8, "|": 11, ".": 6, "{": 29, "}": 29, "@labels.slice": 1, ".join": 2, "a": 3, "z0": 2, "decode": 2, "exports.encode": 1, "encode": 1, "ip": 2, "value": 36, "for": 15, "byte": 2, "index": 8, "in": 36, "ip.split": 1, "+": 44, "<<": 1, "*": 7, ".toString": 3, "PATTERN": 1, "exports.decode": 1, "string": 9, "PATTERN.test": 1, "i": 19, "ip.push": 1, "&": 1, "ip.join": 1, "console.log": 1, "#": 30, "Rewriter": 2, "INVERSES": 2, "count": 6, "starts": 1, "compact": 1, "last": 9, "exports.Lexer": 1, "Lexer": 4, "tokenize": 1, "code": 22, "opts": 1, "WHITESPACE.test": 1, "code.replace": 1, "r/g": 1, ".replace": 3, "TRAILING_SPACES": 1, "@code": 1, "The": 7, "remainder": 1, "of": 7, "the": 4, "source": 5, "code.": 1, "@line": 10, "opts.line": 1, "or": 25, "current": 5, "line.": 1, "@indent": 10, "indentation": 3, "level.": 3, "@indebt": 5, "over": 1, "at": 2, "@outdebt": 11, "under": 1, "outdentation": 1, "@indents": 7, "stack": 5, "all": 1, "levels.": 1, "@ends": 2, "pairing": 1, "up": 1, "tokens.": 1, "@tokens": 11, "Stream": 1, "parsed": 1, "tokens": 11, "form": 1, "line": 6, "while": 7, "@chunk": 13, "i..": 3, "@identifierToken": 1, "@commentToken": 1, "@whitespaceToken": 1, "@lineToken": 1, "@heredocToken": 1, "@stringToken": 1, "@numberToken": 1, "@regexToken": 1, "@jsToken": 1, "@literalToken": 1, "@closeIndentation": 1, "@error": 13, "tag": 45, "@ends.pop": 2, "opts.rewrite": 1, "off": 3, ".rewrite": 1, "identifierToken": 1, "match": 35, "IDENTIFIER.exec": 1, "input": 1, "id": 16, "colon": 3, "@tag": 6, "@token": 23, "id.length": 1, "forcedIdentifier": 4, "prev": 26, "not": 6, "prev.spaced": 3, "JS_KEYWORDS": 3, "COFFEE_KEYWORDS": 4, "id.toUpperCase": 1, "LINE_BREAK": 1, "@seenFor": 5, "yes": 7, "UNARY": 2, "RELATION": 1, "isnt": 8, "no": 5, "@value": 4, "@tokens.pop": 4, "JS_FORBIDDEN": 3, "String": 1, "id.reserved": 1, "RESERVED": 5, "COFFEE_ALIAS_MAP": 3, "COFFEE_ALIASES": 3, "switch": 6, "when": 16, "input.length": 1, "numberToken": 1, "NUMBER.exec": 1, "number": 13, "BOX": 1, "/.test": 4, "/E/.test": 1, "0x/.test": 1, "d*": 2, "d": 3, "lexedLength": 2, "number.length": 1, "octalLiteral": 2, "0o": 2, "/.exec": 2, "binaryLiteral": 2, "0b": 2, "stringToken": 1, "@chunk.charAt": 5, "SIMPLESTR.exec": 1, "MULTILINER": 2, "@balancedString": 2, "<": 8, "string.indexOf": 1, "@interpolateString": 3, "@escapeLines": 2, "octalEsc": 1, "string.length": 1, "heredocToken": 1, "HEREDOC.exec": 1, "heredoc": 9, "quote": 12, "heredoc.charAt": 1, "doc": 10, "@sanitizeHeredoc": 2, "indent": 9, "doc.indexOf": 2, "@makeString": 3, "heredoc.length": 1, "commentToken": 1, "@chunk.match": 1, "COMMENT": 1, "comment": 2, "here": 3, "herecomment": 4, "Array": 1, "comment.length": 1, "jsToken": 1, "JSTOKEN.exec": 1, "script": 7, "script.length": 1, "regexToken": 1, "HEREGEX.exec": 2, "length": 3, "@heregexToken": 1, "NOT_REGEX": 1, "NOT_SPACED_REGEX": 1, "REGEX.exec": 2, "regex": 7, "flags": 4, "..1": 1, "match.length": 1, "heregexToken": 1, "heregex": 1, "body": 7, "body.indexOf": 1, "re": 1, "body.replace": 3, "HEREGEX_OMIT": 2, "//g": 1, "re.match": 1, "*/": 1, "heregex.length": 2, "@tokens.push": 6, "tokens.push": 6, "value...": 2, "continue": 6, "value.replace": 2, "/g": 2, "tokens.pop": 1, "tokens...": 1, "lineToken": 1, "MULTI_DENT.exec": 1, "size": 10, "indent.length": 5, "indent.lastIndexOf": 1, "noNewlines": 6, "@unfinished": 1, "@suppressNewlines": 2, "@newlineToken": 1, "diff": 3, "@indents.push": 1, "@ends.push": 2, "@outdentToken": 3, "outdentToken": 1, "moveOut": 7, "len": 8, "@indents.length": 1, "undefined": 1, "dent": 4, "@indents.pop": 1, "@pair": 3, "this": 9, "whitespaceToken": 1, "WHITESPACE.exec": 1, "nline": 1, ".length": 2, "newlineToken": 1, "suppressNewlines": 1, "literalToken": 1, "OPERATOR.exec": 1, "@tagParameters": 1, "CODE.test": 1, ".reserved": 1, "value.length": 2, "MATH": 1, "COMPARE": 1, "COMPOUND_ASSIGN": 1, "SHIFT": 1, "LOGIC": 1, ".spaced": 1, "CALLABLE": 1, "INDEXABLE": 1, "sanitizeHeredoc": 1, "options": 18, "HEREDOC_ILLEGAL.test": 1, "HEREDOC_INDENT.exec": 1, "attempt": 2, "attempt.length": 1, "doc.replace": 2, "n": 2, "///g": 2, "n/": 1, "tagParameters": 1, "tokens.length": 3, "tok": 11, "stack.push": 4, "stack.length": 3, "stack.pop": 2, "closeIndentation": 1, "balancedString": 1, "str": 9, "end": 11, "continueCount": 5, "1...str.length": 1, "letter": 10, "str.charAt": 3, "0..i": 1, "interpolateString": 1, "pi": 4, "expr": 2, "pi...i": 1, "inner": 2, "inner.length": 1, "nested": 3, ".tokenize": 1, "rewrite": 1, "nested.pop": 1, "nested.shift": 1, "nested.length": 1, "nested.unshift": 1, "nested.push": 1, "expr.length": 1, "pi..": 1, "str.length": 1, "tokens.unshift": 1, "interpolated": 2, "pair": 1, "wanted": 2, "token": 1, "val": 3, "unfinished": 1, "LINE_CONTINUER.test": 1, "escapeLines": 1, "str.replace": 1, "makeString": 1, "s": 3, "S": 2, "contents": 5, "error": 1, "message": 1, "throw": 3, "SyntaxError": 1, "on": 4, "key": 2, "COFFEE_KEYWORDS.concat": 1, "STRICT_PROSCRIBED": 4, "JS_KEYWORDS.concat": 1, ".concat": 3, "exports.RESERVED": 2, "RESERVED.concat": 1, "exports.STRICT_PROSCRIBED": 1, "IDENTIFIER": 1, "A": 1, "Za": 1, "z_": 1, "x7f": 2, "uffff": 2, "w": 1, "Is": 1, "property": 1, "NUMBER": 1, "binary": 1, "octal": 1, "0x": 1, "da": 1, "f": 1, "hex": 1, "e": 1, "decimal": 1, "///i": 1, "HEREDOC": 1, "fs": 3, "path": 3, "parser": 1, "vm": 1, "require.extensions": 3, "module": 1, "filename": 6, "content": 4, "compile": 5, "fs.readFileSync": 1, "module._compile": 1, "require.registerExtension": 2, "exports.VERSION": 1, "exports.helpers": 2, "exports.compile": 1, "merge": 1, "try": 2, "js": 5, "parser.parse": 3, "lexer.tokenize": 3, ".compile": 1, "options.header": 1, "catch": 1, "err": 20, "err.message": 2, "options.filename": 5, "header": 1, "exports.tokens": 1, "exports.nodes": 1, "typeof": 1, "exports.run": 1, "mainModule": 1, "require.main": 1, "mainModule.filename": 4, "process.argv": 1, "fs.realpathSync": 2, "mainModule.moduleCache": 1, "mainModule.paths": 1, "._nodeModulePaths": 1, "path.dirname": 2, "path.extname": 1, "mainModule._compile": 2, "exports.eval": 1, "code.trim": 1, "Script": 2, "vm.Script": 1, "options.sandbox": 4, "instanceof": 1, "Script.createContext": 2, ".constructor": 1, "sandbox": 8, "k": 4, "v": 4, "own": 2, "sandbox.global": 1, "sandbox.root": 1, "sandbox.GLOBAL": 1, "global": 3, "sandbox.__filename": 3, "||": 2, "sandbox.__dirname": 1, "sandbox.module": 2, "sandbox.require": 2, "Module": 2, "_module": 3, "options.modulename": 1, "_require": 2, "Module._load": 1, "_module.filename": 1, "r": 4, "Object.getOwnPropertyNames": 1, "_require.paths": 1, "_module.paths": 1, "Module._nodeModulePaths": 1, "process.cwd": 1, "_require.resolve": 1, "request": 2, "Module._resolveFilename": 1, "o": 3, "o.bare": 1, "ensure": 1, "vm.runInThisContext": 1, "vm.runInContext": 1, "lexer": 1, "parser.lexer": 1, "lex": 1, "@yytext": 1, "@yylineno": 1, "@pos": 2, "setInput": 1, "upcomingInput": 1, "parser.yy": 1, "CoffeeScript": 1, "CoffeeScript.require": 1, "CoffeeScript.eval": 1, "options.bare": 2, "eval": 1, "CoffeeScript.compile": 2, "CoffeeScript.run": 3, "Function": 1, "window": 1, "CoffeeScript.load": 2, "url": 2, "callback": 37, "xhr": 2, "window.ActiveXObject": 1, "XMLHttpRequest": 1, "xhr.open": 1, "xhr.overrideMimeType": 1, "xhr.onreadystatechange": 1, "xhr.readyState": 1, "xhr.status": 1, "xhr.responseText": 1, "Error": 1, "xhr.send": 1, "runScripts": 3, "scripts": 2, "document.getElementsByTagName": 1, "coffees": 2, "s.type": 1, "coffees.length": 1, "do": 1, "execute": 3, ".type": 1, "script.src": 2, "script.innerHTML": 1, "window.addEventListener": 1, "addEventListener": 1, "attachEvent": 1, "print": 3, "spawn": 2, "build": 2, "coffee": 1, "coffee.stderr.on": 1, "data": 2, "process.stderr.write": 1, "data.toString": 2, "coffee.stdout.on": 1, "coffee.on": 1, "task": 1, "opposite": 2, "square": 4, "x": 6, "list": 2, "math": 1, "root": 1, "Math.sqrt": 1, "cube": 1, "race": 1, "winner": 2, "runners...": 1, "runners": 1, "alert": 4, "elvis": 1, "cubes": 1, "math.cube": 1, "num": 2, "Animal": 3, "@name": 2, "move": 3, "meters": 2, "Snake": 2, "Horse": 2, "sam": 1, "tom": 1, "sam.move": 1, "tom.move": 1, "async": 1, "nack": 1, "bufferLines": 3, "pause": 2, "sourceScriptEnv": 3, "join": 8, "exists": 5, "basename": 2, "resolve": 2, "module.exports": 1, "RackApplication": 1, "@configuration": 1, "@root": 8, "@firstHost": 1, "@logger": 1, "@configuration.getLogger": 1, "@readyCallbacks": 3, "@quitCallbacks": 3, "@statCallbacks": 3, "ready": 1, "@state": 11, "@readyCallbacks.push": 1, "@initialize": 2, "quit": 1, "@quitCallbacks.push": 1, "@terminate": 2, "queryRestartFile": 1, "fs.stat": 1, "stats": 1, "@mtime": 5, "false": 1, "lastMtime": 2, "stats.mtime.getTime": 1, "setPoolRunOnceFlag": 1, "@statCallbacks.length": 1, "alwaysRestart": 2, "@pool.runOnce": 1, "statCallback": 2, "@statCallbacks.push": 1, "loadScriptEnvironment": 1, "env": 18, "async.reduce": 1, "scriptExists": 2, "loadRvmEnvironment": 1, "rvmrcExists": 2, "rvm": 1, "@configuration.rvmPath": 1, "rvmExists": 2, "libexecPath": 1, "before": 2, ".trim": 1, "loadEnvironment": 1, "@queryRestartFile": 2, "@loadScriptEnvironment": 1, "@configuration.env": 1, "@loadRvmEnvironment": 1, "initialize": 1, "@quit": 3, "@loadEnvironment": 1, "@logger.error": 3, "@pool": 2, "nack.createPool": 1, ".POW_WORKERS": 1, "@configuration.workers": 1, "idle": 1, ".POW_TIMEOUT": 1, "@configuration.timeout": 1, "@pool.stdout": 1, "@logger.info": 1, "@pool.stderr": 1, "@logger.warning": 1, "@pool.on": 2, "process": 2, "@logger.debug": 2, "readyCallback": 2, "terminate": 1, "@ready": 3, "@pool.quit": 1, "quitCallback": 2, "handle": 1, "next": 3, "resume": 2, "@setPoolRunOnceFlag": 1, "@restartIfNecessary": 1, "req.proxyMetaVariables": 1, "SERVER_PORT": 1, "@configuration.dstPort.toString": 1, "@pool.proxy": 1, "finally": 1, "restart": 1, "restartIfNecessary": 1, "mtimeChanged": 2, "@restart": 1, "writeRvmBoilerplate": 1, "powrc": 3, "boilerplate": 2, "@constructor.rvmBoilerplate": 1, "fs.readFile": 1, "contents.indexOf": 1, "fs.writeFile": 1, "@rvmBoilerplate": 1, "###*": 1, "@cjsx": 1, "React.DOM": 1, "###": 1, "define": 1, "React": 1, "ExampleStore": 3, "ExampleActions": 1, "ReactExampleTable": 1, "ReactExampleComponent": 1, "React.createClass": 1, "mixins": 1, "ListenMixin": 1, "getInitialState": 1, "rows": 3, "ExampleStore.getRows": 2, "meta": 3, "ExampleStore.getMeta": 2, "componentWillMount": 1, "@listenTo": 1, "componentDidMount": 1, "ExampleActions.getExampleData": 1, "onStoreChange": 1, "this.isMounted": 1, "@setState": 1, "componentWillUnmount": 1, "@stopListening": 1, "render": 1, "
": 1, "className=": 1, "
": 2, "": 1, "@state.title": 1, "": 1, "": 1, "rows=": 1, "state": 2, "meta=": 1, "
": 1 }, "ColdFusion": { "": 4, "cfcomment": 3, "nested": 3, "-": 12, "multi": 1, "line": 1, "": 1, "": 1, "": 1, "Date": 1, "Functions": 1, "": 1, "": 1, "": 1, "": 15, "RightNow": 7, "Now": 1, "": 3, "#RightNow#": 1, "
": 8, "#DateFormat": 2, "(": 8, ")": 8, "#": 8, "#TimeFormat": 2, "#IsDate": 3, "#DaysInMonth": 1, "": 3, "x=": 1, "y=": 1, "z=": 1, "group=": 1, "#x#": 1, "#y#": 1, "#z#": 1, "": 1, "": 1, "person": 2, "Paul": 1, "greeting": 2, "Hello": 2, "world": 1, "a": 7, "5": 1, "b": 7, "10": 1, "c": 6, "MOD": 1, "another": 1, "comment": 1 }, "ColdFusion CFC": { "component": 1, "extends": 1, "singleton": 1, "{": 22, "property": 10, "name": 10, "inject": 10, ";": 55, "ContentService": 1, "function": 12, "init": 1, "(": 58, "entityName": 2, ")": 58, "super.init": 1, "arguments.entityName": 1, "useQueryCaching": 1, "true": 11, "this.colorTestVar": 1, "cookie.colorTestVar": 1, "client.colorTestVar": 1, "session.colorTestVar": 1, "application.colorTestVar": 1, "return": 11, "this": 10, "}": 22, "clearAllCaches": 1, "boolean": 6, "async": 7, "false": 7, "var": 15, "settings": 6, "settingService.getAllSettings": 6, "asStruct": 6, "cache": 6, "cacheBox.getCache": 6, "settings.cb_content_cacheName": 6, "cache.clearByKeySnippet": 3, "keySnippet": 3, "arguments.async": 3, "clearAllPageWrapperCaches": 1, "clearPageWrapperCaches": 1, "required": 5, "any": 5, "slug": 2, "clearPageWrapper": 1, "cache.clear": 3, "searchContent": 1, "searchTerm": 1, "numeric": 2, "max": 2, "offset": 2, "asQuery": 2, "sortOrder": 2, "isPublished": 1, "searchActiveContent": 1, "results": 2, "c": 1, "newCriteria": 1, "if": 4, "isBoolean": 1, "arguments.isPublished": 3, "c.isEq": 1, "javaCast": 1, "c.isLt": 1, "now": 2, ".": 1, "or": 2, "c.restrictions.isNull": 1, "c.restrictions.isGT": 1, ".isEq": 1, "len": 1, "arguments.searchTerm": 1, "c.createAlias": 1, "arguments.searchActiveContent": 1, "c.": 1, "c.restrictions.like": 2, "else": 1, "c.like": 1, "results.count": 1, "c.count": 1, "results.content": 1, "c.resultTransformer": 1, "c.DISTINCT_ROOT_ENTITY": 1, ".list": 1, "arguments.offset": 1, "arguments.max": 1, "arguments.sortOrder": 1, "arguments.asQuery": 1, "private": 4, "syncUpdateHits": 1, "contentID": 1, "q": 1, "new": 1, "Query": 1, "sql": 1, ".execute": 1, "closureTest": 1, "methodCall": 1, "param1": 2, "arg1": 4, "arg2": 2, "StructliteralTest": 1, "foo": 3, "bar": 1, "brad": 3, "func": 1, "array": 1, "[": 2, "wood": 2, "null": 2, "]": 2, "last": 1, "arrayliteralTest": 1, "": 1, "": 2, "name=": 4, "access=": 2, "returntype=": 2, "": 2, "type=": 2, "required=": 2, "": 2, "myVariable": 1, "arguments": 2, "": 1, "": 2, "": 1, "structKeyExists": 1, "writeoutput": 1, "Argument": 1, "exists": 1, "": 1, "": 1 }, "Common Lisp": { ";": 535, "-": 814, "*": 6, "lisp": 8, "(": 2595, "in": 38, "package": 6, "foo": 4, ")": 2415, "Header": 2, "comment.": 8, "defvar": 6, "*foo*": 2, "eval": 24, "when": 37, "execute": 2, "compile": 2, "toplevel": 4, "load": 11, "defun": 148, "add": 4, "x": 108, "&": 111, "optional": 15, "y": 21, "key": 141, "z": 4, "declare": 11, "ignore": 2, "Inline": 2, "+": 36, "or": 15, "#": 92, "|": 22, "Multi": 2, "line": 4, "defmacro": 47, "body": 25, "b": 5, "if": 103, "After": 2, "common.l": 1, "commonLisp": 1, "features": 1, "for": 5, "eus": 1, "Copyright": 1, "c": 5, "Toshihiro": 1, "MATSUI": 1, "Electrotechnical": 1, "Laboratory": 1, "Aug": 1, "Feb": 1, "Jun": 2, "defclass": 4, "setf": 20, "list": 93, "export": 9, "pop": 16, "push": 34, "pushnew": 2, "inc": 13, "dec": 3, "incf": 8, "decf": 2, "dotimes": 13, "dolist": 15, "do": 26, "symbols": 9, "external": 2, "all": 11, "psetq": 3, "do*": 2, "prog": 2, "prog*": 2, "case": 6, "classcase": 2, "otherwise": 1, "string": 8, "alias": 7, "caaar": 2, "caadr": 2, "cadar": 2, "cdaar": 2, "cdadr": 2, "cddar": 2, "cdddr": 6, "fourth": 2, "fifth": 2, "sixth": 2, "seventh": 2, "eighth": 2, "cadddr": 5, "cddddr": 4, "caaddr": 2, "cdaddr": 2, "caddddr": 2, "flatten": 4, "insert": 2, "delete": 14, "adjoin": 2, "union": 2, "intersection": 2, "set": 8, "difference": 2, "exclusive": 2, "rotate": 2, "last": 2, "copy": 9, "tree": 2, "nreconc": 2, "rassoc": 3, "acons": 2, "member": 23, "assoc": 2, "subsetp": 2, "maplist": 2, "mapcon": 2, "count": 43, "not": 62, "pairlis": 3, "make": 19, "sequence": 3, "fill": 12, "replace": 6, "transpose": 2, "remove": 12, "substitute": 9, "nsubstitute": 9, "unique": 4, "duplicates": 3, "extream": 2, "send": 22, "super": 21, "lexpr": 4, "resend": 2, "super*": 2, "send*": 3, "instance": 4, "instance*": 2, "defclassmethod": 2, "method": 4, "class": 17, "defstruct": 2, "readtablep": 4, "readtable": 25, "syntax": 7, "from": 38, "char": 9, "collect": 6, "instances": 2, "compiled": 7, "function": 18, "p": 61, "input": 4, "stream": 13, "output": 3, "io": 5, "special": 2, "form": 8, "macro": 21, "ecase": 2, "every": 5, "some": 3, "reduce": 2, "merge": 5, "expt": 2, "signum": 1, "defsetf": 1, "define": 2, "multiple": 3, "value": 32, "bind": 1, "setq": 95, "first": 6, "second": 3, "third": 2, "bye": 1, "version": 6, "implementation": 6, "type": 47, "format": 4, "nil": 130, "car": 69, "*OS": 1, "VERSION*": 1, "cadr": 17, "caddr": 9, "euserror": 1, "basic": 1, "macros": 4, "macroexpand": 3, "let": 47, "r": 31, "macroexpand2": 2, "while": 23, "and": 43, "listp": 10, "fname": 1, "rest": 48, "fdef": 1, "progn": 10, "lambda": 1, "remprop": 1, "builtin": 1, "entry": 1, "prog1": 2, "args": 18, "gensym": 25, ".": 67, "cdr": 46, "loop": 3, "forms": 13, "tag": 9, "block": 5, "tagbody": 5, "@forms": 4, "go": 3, "unless": 19, "pred": 41, "until": 1, "condition": 2, "s": 32, "item": 41, "place": 7, "cons": 28, "test": 83, "var": 37, "h": 14, "init": 3, "doc": 6, "symbolp": 15, "error": 16, "eql": 2, "boundp": 2, "deflocal": 1, "defparameter": 1, "defconstant": 4, "sym": 6, "val": 1, "vars": 39, "endvar": 4, "integer": 2, "<": 10, "lists": 7, "decl": 15, "consp": 6, "eq": 19, "let*": 11, "v": 32, "pkg": 4, "pkgv": 6, "i": 43, "size": 16, "svec": 8, "find": 12, "intsymvector": 1, "length": 47, "elt": 16, "symvector": 1, "apackage": 3, "packages": 1, "varvals": 4, "vals": 4, "gvars": 4, "nreverse": 19, "mapcar": 11, "mapcan": 7, "endtest": 6, "return": 15, "@body": 9, "casebody": 3, "casehead": 2, "keyvar": 10, "head": 9, "atom": 7, "memq": 5, "t": 39, "quote": 2, "case1": 2, "clauses": 13, "caar": 5, "cdar": 7, "result": 39, "classcasehead": 2, "derivedp": 10, "classcase1": 3, "kv": 3, "stringp": 1, "seq": 87, "pname": 1, "numberp": 2, "more": 14, "functions": 5, "new": 10, "old": 14, "setslot": 2, "symbol": 13, "cddr": 8, "l": 20, "accumulator": 4, "cond": 25, "null": 19, "pos": 6, "is": 14, "bigger": 2, "than": 2, "the": 57, "of": 18, "nconc": 7, "tail": 2, "nthcdr": 7, "rplacd": 2, "lst": 6, "n": 22, "identity": 7, "list1": 13, "list2": 21, "funcall": 33, "reverse": 3, "l1": 15, "result1": 3, "result2": 3, "l2": 11, "append": 2, "subst": 4, "alist": 9, "a": 19, "equal": 6, "datum": 2, "supermember": 1, "superassoc": 1, "sub": 2, "func": 12, "arg": 29, "aux": 11, "arglist": 10, "margs": 16, "apply": 13, "start": 61, "end": 65, "system": 25, "raw": 20, "position": 8, "klass": 4, "dlist": 2, "leng": 3, "initial": 29, "element": 38, "integerp": 3, "array": 61, "dest": 12, "src": 15, "start1": 6, "end1": 3, "start2": 7, "end2": 3, "min": 1, "aref": 6, "vector": 15, "aset": 3, "universal": 3, "newitem": 12, "olditem": 4, "ext": 7, "equivalent": 1, "pairs": 7, "WINSTON": 1, "coalesce": 4, "classes": 16, "absorb": 3, "stick": 3, "pair": 7, "LEO": 1, "selector": 4, "msgs": 5, "metaclass": 9, "target": 1, "message": 5, "self": 1, "@msgs": 1, "receivers": 2, "mesg": 3, "obj": 31, "cls": 6, "instantiate": 10, "@message": 2, "inst": 3, "classname": 2, "methods": 5, "defmethod": 1, "name": 21, "classobj": 19, "methodname": 2, "cache": 1, "T.Matsui": 1, "object": 2, "include": 2, "printer": 1, "constructor": 1, "predicate": 1, "copier": 1, "metaklass": 11, "slots": 5, "varlist": 2, "documentation": 6, "variables": 18, "types": 9, "forwards": 9, "etype": 5, "index": 8, "accessor": 3, "classp": 2, "coerce": 7, "forward": 1, "assq": 1, "INTEGER": 1, "FLOAT": 1, "FOREIGN": 1, "subclassp": 2, "vectorclass": 4, "cix": 1, "enter": 1, "proclaim": 1, "global": 1, "putprop": 1, "slot": 1, "access": 1, "intern": 1, "concatenate": 1, "READTABLES": 1, "*readtable*": 2, "to": 40, "*default": 2, "readtable*": 2, "dispatch": 3, "syn": 6, "predicates": 1, "keywordp": 2, "homepkg": 1, "*keyword": 1, "package*": 1, "constantp": 1, "vtype": 1, "functionp": 2, "code": 5, "fboundp": 3, "direction": 2, "zerop": 3, "plusp": 1, "minusp": 3, "oddp": 1, "logbitp": 2, "evenp": 1, "/": 3, "n1": 2, "n2": 2, "logandc1": 1, "logand": 2, "lognot": 2, "logandc2": 1, "p1": 10, "e1": 5, "e2": 7, "pp1": 3, "pp2": 3, "seq1": 6, "seq2": 6, "i1": 6, "i2": 6, "j": 8, "e": 6, "arithmetics": 1, "ix": 4, "Mode": 1, "Lisp": 2, "Package": 1, "LISP": 1, "This": 2, "file": 1, "part": 1, "xyzzy.": 1, "provide": 1, "upgraded": 4, "adjust": 2, "extended": 2, "character": 2, "si": 5, "canonicalize": 1, "check": 3, "initialize": 3, "option": 3, "ies": 6, "ics": 10, "displaced": 16, "contents": 6, "pointer": 9, "adjustable": 7, "offset": 5, "*make": 2, "*copy": 1, "into": 2, "dimensions": 7, "dims": 9, "rank": 9, "stack": 7, "total": 2, "row": 1, "major": 1, "dimension": 3, "nth": 5, "bounds": 1, "subscripts": 4, "ets": 2, "fps": 2, "has": 3, "partially": 2, "*replace": 1, "dst": 1, "DEFUN": 1, "HELLO": 1, "PRINT": 1, "TURTLE": 1, "@PREFIX": 5, "TRIPLES": 10, "URIREF": 30, "PREDICATE": 44, "OBJECT": 44, "LIST": 44, "#1": 1, "OBJECTS": 44, "QNAME": 48, "STRING": 20, "#1#": 9, "@file": 1, "advanced.cl": 1, "@breif": 1, "Advanced": 1, "practices": 1, "defining": 1, "your": 1, "own": 1, "Macro": 2, "definition": 1, "skeleton": 1, "parameter*": 1, "form*": 1, "Note": 2, "that": 9, "backquote": 1, "expression": 2, "most": 1, "often": 1, "used": 3, "primep": 4, "number": 2, "prime": 14, "mod": 1, "sqrt": 1, "next": 13, "specified": 1, "The": 4, "recommended": 1, "procedures": 1, "writting": 2, "are": 7, "as": 3, "follows": 1, "Write": 2, "sample": 2, "call": 3, "it": 2, "should": 1, "expand": 1, "primes": 5, "Expected": 1, "expanded": 1, "codes": 1, "generate": 1, "hardwritten": 1, "expansion": 7, "arguments": 1, "range": 4, "More": 1, "concise": 1, "implementations": 1, "with": 8, "synonym": 1, "also": 1, "emits": 1, "friendly": 1, "messages": 1, "on": 1, "incorrent": 1, "input.": 1, "Test": 1, "Make": 1, "sure": 2, "abstraction": 1, "does": 1, "Rules": 1, "observe": 1, "avoid": 1, "common": 1, "possible": 2, "leaks": 1, "a.": 1, "any": 1, "subforms": 3, "positions": 1, "will": 1, "be": 3, "evaluated": 2, "same": 1, "order": 2, "appear": 1, "b.": 1, "only": 3, "once": 1, "by": 1, "creating": 1, "variable": 5, "hold": 1, "evaluating": 1, "argument": 1, "then": 10, "using": 3, "anywhere": 1, "else": 1, "needed": 1, "c.": 1, "use": 1, "at": 1, "time": 1, "create": 1, "names": 3, "Appendix": 1, "I.": 1, "guranttee": 1, "rule": 21, "gets": 1, "observed.": 1, "Example": 1, "usage": 1, "gensyms": 3, "Define": 1, "note": 1, "how": 1, "comma": 1, "interpolate": 1, "exe_name": 1, "hello": 2, "link_order": 1, "world": 1, "ESCUELA": 1, "POLITECNICA": 1, "SUPERIOR": 1, "UNIVERSIDAD": 1, "AUTONOMA": 1, "DE": 1, "MADRID": 1, "INTELIGENCIA": 1, "ARTIFICIAL": 1, "Motor": 1, "de": 1, "inferencia": 2, "Basado": 1, "en": 2, "parte": 1, "Common": 1, "Global": 1, "*hypothesis": 4, "list*": 19, "*rule": 6, "*fact": 9, "Constants": 1, "fail": 6, "no": 6, "bindings": 17, "*mundo": 1, "abierto*": 1, "Functions": 1, "user": 4, "Resets": 1, "NIL": 3, "erase": 1, "facts": 4, "hypothesis": 25, "Returns": 5, "solutions": 5, "each": 2, "one": 2, "satisfying": 1, "contained": 1, "motor": 1, "consulta": 4, "Auxiliary": 1, "FUNCTION": 6, "CONSULTA": 2, "COMMENTS": 6, "receives": 1, "": 1, "returns": 9, "binding": 7, "being": 1, "solution": 1, "EXAMPLES": 5, "hypotheses": 5, "brothers": 6, "neighbours": 1, "juan": 1, "That": 5, "we": 1, "searching": 1, "neighbors": 2, "Juan.": 1, "can": 4, "this": 2, "sergio": 2, "javier": 2, "julian": 3, "mario": 1, "pedro": 2, "Juan": 1, "Sergio": 2, "Julian": 2, "have": 2, "Javier": 2, "Mario": 2, "Pedro": 2, "FIND": 4, "HYPOTHESIS": 1, "VALUE": 3, "manages": 1, "query": 8, "single": 2, "given": 5, "list.": 1, "It": 1, "tries": 1, "following": 1, "Answer": 2, "rules": 13, "Ask": 1, "If": 1, "maria": 1, "alberto": 1, "Means": 1, "Alberto": 1, "brothers.": 1, "equality": 2, "good": 2, "ask": 2, "une": 2, "con": 2, "takes": 1, "two": 1, "Assumes": 1, "b1": 5, "b2": 5, "T": 1, "FROM": 2, "FACTS": 1, "": 5, "obtained": 1, "directly": 1, "X": 3, "LUIS": 1, "PEDRO": 1, "DANIEL": 1, "RULES": 4, "whose": 1, "THENs": 1, "unify": 6, "term": 1, "satisfy": 1, "requirement": 1, "renamed.": 1, "R2": 6, "pertenece": 4, "E": 4, "_": 7, "Xs": 4, "Then": 2, "PERTENECE": 13, "E.1": 2, "XS.2": 2, "THEN": 2, "However": 1, "R1": 2, "E.6": 2, "E.7": 2, "XS.8": 2, "So": 1, "both": 1, "renamed": 2, "found": 2, "": 1, "solutions.": 1, "limpia": 2, "vinculos": 2, "termino": 3, "EVAL": 3, "RULE": 3, "argument.": 1, "E.42": 2, "proven": 2, "necessary": 1, "fact": 9, "On": 1, "other": 1, "hand": 1, "E.49": 2, "XS.50": 2, "R2.": 1, "ifs": 2, "question": 3, "expresion": 3, "EOF": 1 }, "Common Workflow Language": { "SHEBANG#!cwl": 1, "cwlVersion": 1, "v1.0": 1, "class": 1, "CommandLineTool": 1, "doc": 1, "Trunk": 1, "scores": 1, "in": 1, "ENCODE": 1, "bed6": 1, "+": 1, "files": 1, "hints": 1, "DockerRequirement": 1, "dockerPull": 1, "dukegcb/workflow": 1, "-": 5, "utils": 1, "inputs": 1, "peaks": 1, "type": 3, "File": 1, "sep": 1, "string": 1, "default": 1, "t": 1, "outputs": 1, "trunked_scores_peaks": 1, "stdout": 2, "baseCommand": 1, "awk": 1, "arguments": 1, "F": 1, "(": 4, "inputs.sep": 1, ")": 4, "BEGIN": 1, "{": 3, "OFS": 1, "FS": 1, "}": 3, "print": 1, "inputs.peaks.path": 1, "inputs.peaks.nameroot": 1, ".trunked_scores": 1, "inputs.peaks.nameext": 1 }, "Component Pascal": { "MODULE": 2, "ObxFact": 1, ";": 124, "IMPORT": 2, "Stores": 1, "Models": 1, "TextModels": 1, "TextControllers": 1, "Integers": 1, "PROCEDURE": 12, "Read": 3, "(": 96, "r": 5, "TextModels.Reader": 2, "VAR": 9, "x": 15, "Integers.Integer": 3, ")": 96, "i": 17, "len": 5, "beg": 11, "INTEGER": 10, "ch": 14, "CHAR": 3, "buf": 5, "POINTER": 2, "TO": 2, "ARRAY": 2, "OF": 2, "BEGIN": 13, "r.ReadChar": 6, "WHILE": 3, "r.eot": 5, "&": 9, "<": 9, "DO": 4, "END": 31, "ASSERT": 1, "OR": 4, "r.Pos": 2, "-": 1, "REPEAT": 3, "INC": 4, "UNTIL": 3, "NEW": 2, "+": 1, "r.SetPos": 2, "[": 13, "]": 13, "0X": 1, "Integers.ConvertFromString": 1, "Write": 3, "w": 4, "TextModels.Writer": 2, "IF": 11, "Integers.Sign": 2, "THEN": 12, "w.WriteChar": 3, "Integers.Digits10Of": 1, "#": 3, "DEC": 1, "Integers.ThisDigit10": 1, "ELSE": 3, "Compute*": 1, "end": 6, "n": 3, "s": 3, "Stores.Operation": 1, "attr": 3, "TextModels.Attributes": 1, "c": 3, "TextControllers.Controller": 1, "TextControllers.Focus": 1, "NIL": 3, "c.HasSelection": 1, "c.GetSelection": 1, "c.text.NewReader": 1, "r.ReadPrev": 2, "r.attr": 1, "Integers.Compare": 1, "Integers.Long": 3, "MAX": 1, "LONGINT": 1, "SHORT": 1, "Integers.Short": 1, "Integers.Product": 1, "Models.BeginScript": 1, "c.text": 2, "c.text.Delete": 1, "c.text.NewWriter": 1, "w.SetPos": 1, "w.SetAttr": 1, "Models.EndScript": 1, "Compute": 1, "ObxFact.": 1, "ObxControls": 1, "Dialog": 1, "Ports": 1, "Properties": 1, "Views": 1, "CONST": 1, "beginner": 5, "advanced": 3, "expert": 1, "guru": 2, "TYPE": 1, "View": 6, "RECORD": 2, "Views.View": 2, "size": 1, "data*": 1, "class*": 1, "list*": 1, "Dialog.List": 1, "width*": 1, "predef": 12, "SetList": 4, "data.class": 5, "data.list.SetLen": 3, "data.list.SetItem": 11, "ELSIF": 1, "v": 6, "CopyFromSimpleView": 2, "source": 2, "v.size": 10, ".size": 1, "Restore": 2, "f": 1, "Views.Frame": 1, "l": 1, "t": 1, "b": 1, "f.DrawRect": 1, "Ports.fill": 1, "Ports.red": 1, "HandlePropMsg": 2, "msg": 2, "Views.PropMessage": 1, "WITH": 1, "Properties.SizePref": 1, "msg.w": 1, "msg.h": 1, "ClassNotify*": 1, "op": 4, "from": 2, "to": 5, "Dialog.changed": 2, "data.list.index": 3, "data.width": 4, "Dialog.Update": 2, "data": 2, "Dialog.UpdateList": 1, "data.list": 1, "ClassNotify": 1, "ListNotify*": 1, "ListNotify": 1, "ListGuard*": 1, "par": 2, "Dialog.Par": 2, "par.disabled": 1, "ListGuard": 1, "WidthGuard*": 1, "par.readOnly": 1, "WidthGuard": 1, "Open*": 1, "*": 1, "Ports.mm": 1, "Views.OpenAux": 1, "Open": 1, "ObxControls.": 1 }, "Cool": { "class": 7, "Sample": 5, "{": 18, "testCondition": 1, "(": 23, "x": 3, "Int": 15, ")": 21, "Bool": 5, "if": 3, "then": 3, "false": 3, "else": 3, "<": 1, "+": 1, "*": 1, "true": 2, "fi": 2, "}": 12, ";": 20, "testLoop": 1, "y": 7, "while": 1, "loop": 1, "not": 1, "condition": 1, "<->": 3, "2": 3, "1": 2, "pool": 1, "testAssign": 1, "z": 2, "i": 7, "testCase": 1, "var": 2, "SELF_TYPE": 2, "io": 1, "IO": 3, "new": 3, "case": 1, "of": 2, "a": 4, "A": 3, "io.out_string": 4, "b": 3, "B": 2, "s": 1, "o": 1, "Object": 1, "esac": 1, "testLet": 2, "let": 2, "in": 3, "3": 1, "c": 2, "4": 1, "Used": 1, "to": 1, "test": 1, "subclasses": 1, "inherits": 4, "C": 1, "main": 2, "Hello": 2, "world": 1, "example": 1, "Main": 1, "out_string": 1, "World": 1, "n": 1, "List": 8, "isNil": 2, "head": 2, "abort": 2, "tail": 2, "self": 3, "cons": 1, "Cons": 2, ".init": 1, "car": 3, "-": 4, "The": 2, "element": 1, "this": 1, "list": 2, "cell": 1, "cdr": 3, "rest": 3, "the": 1, "init": 1 }, "Coq": { "Require": 33, "Export": 12, "Imp.": 1, "Relations.": 1, "Inductive": 55, "tm": 54, "Type": 168, "|": 1793, "tm_const": 81, "nat": 59, "-": 2438, "tm_plus": 64, "tm.": 3, "Tactic": 51, "Notation": 85, "tactic": 12, "(": 1861, "first": 23, ")": 1852, "ident": 25, "c": 91, ";": 358, "[": 275, "Case_aux": 44, "]": 255, ".": 629, "Module": 21, "SimpleArith0.": 2, "Fixpoint": 35, "eval": 8, "t": 202, "match": 90, "with": 134, "n": 227, "a1": 12, "a2": 12, "+": 57, "end.": 74, "End": 19, "SimpleArith1.": 2, "Reserved": 6, "at": 31, "level": 31, "left": 5, "associativity": 6, "Prop": 38, "E_Const": 2, "forall": 343, "E_Plus": 2, "t1": 127, "t2": 115, "n1": 39, "n2": 29, "plus": 18, "where": 10, "SimpleArith2.": 1, "step": 23, "ST_PlusConstConst": 7, "ST_Plus1": 7, "ST_Plus2": 7, "Example": 38, "test_step_1": 1, "Proof.": 257, "apply": 314, "ST_Plus1.": 5, "ST_PlusConstConst.": 9, "Qed.": 197, "test_step_2": 1, "ST_Plus2.": 8, "simpl.": 74, "Theorem": 104, "step_deterministic": 3, "partial_function": 8, "step.": 7, "unfold": 75, "partial_function.": 7, "intros": 208, "x": 309, "y1": 14, "y2": 12, "Hy1": 16, "Hy2.": 9, "generalize": 10, "dependent": 11, "y2.": 7, "step_cases": 8, "induction": 74, "Case": 75, "inversion": 155, "Hy2": 6, "SCase.": 4, "SCase": 53, "reflexivity.": 161, "H2.": 21, "rewrite": 151, "<->": 30, "H0": 13, "in": 300, "IHHy1": 5, "0": 8, "reflexivity": 31, "assumption": 12, "H": 228, "H1": 12, "H2": 8, "Qed": 23, "SimpleArith2": 1, "value": 347, "v_const": 6, "v1": 33, "subst.": 70, "assumption.": 45, "H3.": 14, "subst": 61, "H3": 2, "strong_progress": 3, "exists": 151, "tm_cases": 4, "Case.": 3, "left.": 11, "v_const.": 8, "right.": 12, "IHt1.": 3, "IHt2.": 1, "SSCase": 11, "H.": 101, "H0.": 12, "n0": 2, "as": 146, "H1.": 29, "Definition": 100, "normal_form": 8, "{": 36, "X": 263, "}": 36, "R": 229, "relation": 17, "Lemma": 120, "value_is_nf": 1, "t.": 14, "normal_form.": 5, "contra.": 46, "nf_is_value": 1, "assert": 23, "G": 1, "/": 146, "strong_progress.": 1, "G.": 1, "ex_falso_quodlibet.": 2, "Corollary": 2, "nf_same_as_value": 4, "split.": 12, "nf_is_value.": 1, "value_is_nf.": 1, "Temp1.": 2, "v_funny": 1, "value_not_same_as_normal_form": 3, "intros.": 15, "v_funny.": 1, "not.": 4, "Temp2.": 2, "ST_Funny": 1, "intro": 4, "ST_Funny.": 1, "Temp3.": 2, "H4.": 2, "Temp4.": 2, "tm_true": 23, "tm_false": 11, "tm_if": 32, "v_true": 1, "v_false": 1, "tm_false.": 4, "ST_IfTrue": 3, "ST_IfFalse": 3, "ST_If": 3, "t3": 20, "bool_step_prop3": 1, "ST_If.": 5, "ST_IfTrue.": 4, "constructor.": 7, "t2.": 5, "t3.": 4, "ST_IfFalse.": 3, "Hy1.": 3, "Temp5.": 2, "ST_ShortCut": 1, "v": 182, "bool_step_prop4": 1, "bool_step_prop4_holds": 1, "bool_step_prop4.": 2, "ST_ShortCut.": 1, "stepmany": 4, "refl_step_closure": 12, "test_stepmany_1": 1, "*": 52, "eapply": 22, "rsc_step.": 7, "rsc_refl.": 12, "test_stepmany_2": 1, "test_stepmany_3": 1, "test_stepmany_4": 1, "step_normal_form": 1, "normal_form_of": 1, "normalizing": 2, "stepmany_congr_1": 2, "rsc_cases": 1, "rsc_step": 8, "y": 348, "IHrefl_step_closure.": 2, "stepmany_congr2": 2, "step_normalizing": 1, "normalizing.": 1, "nf_same_as_value.": 1, "destruct": 224, "IHt1": 3, "H11": 3, "H12": 2, "H21": 3, "H22": 2, "H12.": 1, "H22.": 1, "split": 27, "l": 285, "rsc_trans": 4, "rsc_R": 2, "r": 45, "eval__value": 1, "HE.": 1, "eval_cases": 1, "HE": 1, "Import": 24, "Coq.Lists.List.": 1, "Coq.Strings.Ascii.": 1, "FunctionNinjas.All.": 2, "ListString.All.": 3, "Computation.": 2, "ListNotations.": 1, "Local": 2, "Open": 2, "Scope": 2, "char.": 1, "Run.": 2, "C.t": 13, "Ret": 5, "C.Ret": 3, "Call": 9, "command": 18, "Command.t": 11, "answer": 9, "Command.answer": 9, "handler": 3, "C.Call": 6, "trace": 2, "run": 87, "list": 261, "&": 192, "_": 1825, "existT": 1, "Temporal.": 2, "All.": 2, "P": 53, "h": 38, "a": 88, "One.": 2, "CallThis": 1, "CallOther": 1, "Then.": 2, "P1": 9, "P2": 9, "CallThen": 1, "One.t": 1, "CardBeforeMoney.": 2, "SfLib.": 2, "AExp.": 1, "aexp": 17, "ANum": 13, "APlus": 10, "AMinus": 4, "AMult": 4, "aexp.": 1, "bexp": 10, "BTrue": 2, "BFalse": 2, "BEq": 2, "BLe": 2, "BNot": 2, "BAnd": 2, "bexp.": 1, "aeval": 18, "e": 43, "test_aeval1": 1, "beval": 4, "bool": 143, "true": 41, "false": 27, "beq_nat": 28, "ble_nat": 5, "b1": 8, "negb": 5, "b2": 5, "andb": 4, "optimize_0plus": 12, "e2": 8, "e1": 12, "test_optimize_0plus": 1, "optimize_0plus_sound": 4, "e.": 14, "e1.": 1, "n.": 23, "IHe2.": 7, "simpl": 18, "IHe1.": 8, "try": 64, "IHe1": 6, "IHe2": 6, "c.": 2, "Lists.": 1, "Basics.": 2, "Playground1.": 3, "nil": 63, "cons": 24, "X.": 5, "length": 27, "O": 190, "S": 900, "app": 8, "l1": 53, "l2": 43, "snoc": 17, "rev": 20, "Implicit": 88, "Arguments": 13, "list123": 1, "right": 23, "nil.": 3, "..": 4, "repeat": 20, "count": 20, "test_repeat1": 1, "nil_app": 2, "l.": 35, "rev_snoc": 2, "s": 60, "s.": 11, "IHs.": 2, "snoc_with_append": 1, "v.": 11, "l1.": 7, "IHl1.": 3, "prod": 3, "Y": 67, "pair": 7, "Y.": 2, "type_scope.": 1, "fst": 7, "p": 65, "snd": 7, "combine": 5, "lx": 4, "ly": 4, "tx": 2, "ty": 13, "tp": 2, "end": 18, "option": 66, "Some": 242, "None": 287, "index": 8, "xs": 9, "hd_opt": 8, "test_hd_opt1": 2, "test_hd_opt2": 2, "plus3": 2, "prod_curry": 3, "Z": 14, "f": 77, "prod_uncurry": 3, "uncurry_uncurry": 1, "y.": 22, "curry_uncurry": 1, "p.": 15, "filter": 7, "test": 11, "if": 23, "then": 26, "else": 26, "countoddmembers": 4, "oddb": 5, "partition": 2, "fun": 20, "el": 2, "test_partition1": 1, "map": 8, "test_map1": 1, "map_rev_1": 1, "x.": 11, "IHl.": 10, "map_rev": 1, "IHl": 5, "map_rev_1.": 1, "flat_map": 2, "map_option": 1, "xo": 2, "fold": 5, "b": 83, "fold_example": 1, "false.": 8, "constfun": 3, "k": 23, "ftrue": 3, "true.": 13, "constfun_example": 1, "override": 14, "fmostlytrue": 5, "override_example1": 1, "override_example2": 1, "override_example3": 1, "override_example4": 1, "override_example": 1, "b.": 12, "unfold_example_bad": 1, "m": 88, "m.": 19, "plus3.": 1, "override_eq": 1, "f.": 3, "override.": 5, "beq_nat_refl": 5, "override_neq": 1, "x1": 21, "x2": 14, "k1": 24, "k2": 20, "x1.": 3, "eq1": 11, "eq2.": 18, "eq1.": 16, "eq_add_S": 1, "eq.": 33, "silly4": 1, "o": 813, "silly5": 1, "sillyex1": 1, "z": 17, "j": 6, "j.": 1, "symmetry.": 2, "silly6": 1, "silly7": 1, "sillyex2": 1, "z.": 6, "beq_nat_eq": 2, "Hl.": 3, "IHn": 5, "IHm": 1, "length_snoc": 2, "eq": 10, "Proof": 10, "of": 4, "assertion": 1, "beq_nat_O_l": 1, "beq_nat_O_r": 1, "double_injective": 1, "double": 2, "silly3": 2, "symmetry": 9, "plus_n_n_injective": 1, "plus_n_Sm": 2, "override_shadow": 1, "k2.": 3, "combine_split": 1, "l2.": 10, "IHy.": 1, "split_combine": 1, "IHl1": 4, "sillyfun1": 1, "beq_equal": 6, "a.": 14, "IHa": 1, "override_same": 1, "remember": 14, "Heqa": 2, "Heqa.": 2, "filter_exercise": 1, "lf": 2, "test.": 1, "lf.": 3, "x0": 18, "trans_eq": 2, "o.": 59, "trans_eq_example": 1, "d": 10, "trans_eq_exercise": 1, "minustwo": 2, "beq_nat_trans": 1, "eq2": 2, "override_permute": 1, "k3": 5, "k3.": 1, "b0.": 1, "Heqb.": 2, "Heqb0.": 3, "Heqb": 1, "Heqb0": 2, "k1.": 2, "beq_nat_refl.": 1, "contra": 2, "b0": 1, "fold_length": 3, "O.": 10, "test_fold_length1": 1, "fold_length_correct": 1, "fold_length.": 1, "fold_map": 2, "total": 2, "fold_map_correct": 1, "fold_map.": 1, "forallb": 4, "existsb": 3, "orb": 1, "existsb2": 2, "existsb_correct": 1, "existsb2.": 1, "index_okx": 1, "None.": 3, "mumble": 5, "mumble.": 1, "grumble": 3, "Logic.": 1, "Prop.": 1, "next_nat_partial_function": 1, "next_nat.": 1, "Q.": 2, "P.": 20, "le_not_a_partial_function": 1, "le": 1, "Nonsense.": 4, "le_n.": 6, "le_S.": 6, "total_relation": 1, "total_relation1.": 2, "empty_relation.": 1, "reflexive": 5, "le_reflexive": 1, "le.": 4, "reflexive.": 1, "transitive": 7, "le_trans": 4, "Hnm": 3, "Hmo.": 5, "Hnm.": 4, "IHHmo.": 1, "lt_trans": 2, "lt.": 4, "transitive.": 2, "le_S": 1, "Hmo": 1, "IHHm": 1, "le_Sn_le": 1, "<": 27, "le_S_n": 2, "Sn_le_Sm__n_le_m.": 1, "le_Sn_n": 1, "not": 3, "IHn.": 2, "symmetric": 2, "antisymmetric": 3, "le_antisymmetric": 1, "Sn_le_Sm__n_le_m": 2, "IHb": 1, "*.": 3, "equivalence": 1, "order": 2, "preorder": 1, "le_order": 1, "order.": 1, "le_reflexive.": 1, "le_antisymmetric.": 1, "le_trans.": 1, "clos_refl_trans": 8, "A": 45, "rt_step": 1, "rt_refl": 1, "rt_trans": 3, "next_nat_closure_is_le": 1, "next_nat": 1, "rt_refl.": 2, "IHle.": 1, "rt_step.": 2, "nn.": 1, "IHclos_refl_trans1.": 2, "IHclos_refl_trans2.": 2, "rsc_refl": 1, "r.": 3, "IHrefl_step_closure": 2, "rtc_rsc_coincide": 1, "Set": 5, "Arguments.": 4, "JsSyntax": 3, "JsInterpreterMonads": 2, "JsInterpreter": 2, "JsInit.": 1, "LibFix": 2, "LibList.": 2, "Shared.": 3, "LibTactics": 1, "LibLogic": 1, "LibReflect": 1, "LibList": 1, "LibOperation": 1, "LibStruct": 1, "LibNat": 1, "LibEpsilon": 1, "LibFunc": 1, "LibHeap.": 1, "Flocq.Appli.Fappli_IEEE": 2, "Flocq.Appli.Fappli_IEEE_bits.": 2, "Extraction": 9, "Language": 1, "Ocaml.": 1, "ExtrOcamlBasic.": 1, "ExtrOcamlNatInt.": 1, "ExtrOcamlString.": 1, "Inline": 5, "FixFun3": 1, "FixFun3Mod": 1, "FixFun4": 1, "FixFun4Mod": 1, "FixFunMod": 1, "curry3": 1, "uncurry3": 1, "curry4": 1, "uncurry4.": 1, "epsilon": 1, "epsilon_def": 1, "classicT": 1, "arbitrary": 3, "indefinite_description": 1, "Inhab_witness": 1, "Fix": 1, "isTrue.": 1, "Extract": 81, "positive": 1, "float": 4, "f1": 1, "mod_float": 3, "f2p": 1, "floor": 5, "/.": 2, "f2p1": 1, "N": 16, "Constant": 77, "Z.add": 1, "Z.succ": 1, "Z.pred": 1, "Z.sub": 1, "Z.mul": 1, "Z.opp": 1, "Z.abs": 1, "Z.min": 1, "Z.max": 1, "Z.compare": 1, "Pos.add": 1, "Pos.succ": 1, "Pos.pred": 1, "Pos.sub": 1, "Pos.mul": 1, "Pos.min": 1, "Pos.max": 1, "Pos.compare": 1, "Pos.compare_cont": 1, "N.add": 1, "N.succ": 1, "N.pred": 1, "N.sub": 1, "N.mul": 1, "N.min": 1, "N.max": 1, "N.div": 1, "N.modulo": 1, "N.compare": 1, "Fappli_IEEE.binary_float": 1, "JsNumber.of_int": 1, "JsNumber.nan": 1, "JsNumber.zero": 1, "JsNumber.neg_zero": 1, "JsNumber.one": 1, "JsNumber.infinity": 1, "JsNumber.neg_infinity": 1, "JsNumber.max_value": 1, "JsNumber.min_value": 1, "JsNumber.pi": 1, "JsNumber.e": 1, "JsNumber.ln2": 1, "JsNumber.floor": 1, "JsNumber.absolute": 1, "JsNumber.from_string": 1, "let": 111, "String.concat": 2, "Failure": 1, "float_of_string": 1, "nan": 3, "JsNumber.to_string": 2, "prerr_string": 1, "Warning": 1, "called.": 1, "This": 1, "might": 1, "be": 1, "responsible": 1, "for": 1, "errors.": 1, "Argument": 1, "string_of_float": 3, "prerr_newline": 1, "string_of_number": 2, "sfn": 4, "inf": 2, "Infinity": 2, "NaN": 1, "inum": 3, "int_of_float": 2, "float_of_int": 1, "string_of_int": 1, "ret": 12, "ref": 7, "String.iter": 1, "List.rev": 2, "JsNumber.add": 1, "JsNumber.sub": 1, "JsNumber.mult": 1, "JsNumber.div": 1, "JsNumber.fmod": 1, "JsNumber.neg": 1, "JsNumber.sign": 1, "JsNumber.number_comparable": 1, "JsNumber.lt_bool": 1, "JsNumber.to_int32": 1, "classify_float": 2, "FP_normal": 2, "FP_subnormal": 2, "i32": 10, "**": 5, "i31": 4, "posint": 4, "abs_float": 2, "int32bit": 6, "smod": 8, "JsNumber.to_uint32": 1, "JsNumber.modulo_32": 1, "JsNumber.int32_bitwise_not": 1, "JsNumber.int32_bitwise_and": 1, "JsNumber.int32_bitwise_or": 1, "JsNumber.int32_bitwise_xor": 1, "JsNumber.int32_left_shift": 1, "JsNumber.int32_right_shift": 1, "JsNumber.uint32_right_shift": 1, "newx": 2, "Int32.to_float": 1, "Int32.shift_right_logical": 1, "Int32.of_float": 1, "int_of_char": 1, "ascii_comparable": 1, "lt_int_decidable": 1, "le_int_decidable": 1, "ge_nat_decidable": 1, "prop_eq_decidable": 1, "env_loc_global_env_record": 1, "Fappli_IEEE.Bplus": 1, "Fappli_IEEE.binary_normalize": 2, "Fappli_IEEE_bits.b64_plus.": 1, "Fappli_IEEE.Bmult": 1, "Fappli_IEEE.Bmult_FF": 1, "Fappli_IEEE_bits.b64_mult.": 1, "Fappli_IEEE.Bdiv": 1, "Fappli_IEEE_bits.b64_div.": 1, "AccessOpaque.": 1, "object_prealloc_global_proto": 1, "object_prealloc_global_class": 1, "rec": 1, "aux": 2, "function": 1, "aux2": 2, "String.length": 1, "GlobalClass": 1, "parse_pickable": 1, "str": 52, "Inlined": 3, "not_yet_implemented_because": 1, "print_endline": 3, "__LOC__": 3, "Not": 1, "implemented": 1, "because": 2, "Prheap.string_of_char_list": 3, "Coq_result_not_yet_implemented": 1, "impossible_because": 1, "Stuck": 2, "Coq_result_impossible": 2, "impossible_with_heap_because": 1, "nState": 1, "Prheap.prstate": 1, "nMessage": 1, "message": 4, "Blacklist": 1, "string": 75, "bool.": 4, "Separate": 1, "runs": 134, "run_javascript.": 1, "JsSyntaxAux": 2, "JsPreliminary.": 2, "number.": 21, "int.": 13, "string.": 3, "i": 4, "literal.": 2, "object_loc.": 2, "w": 23, "prim.": 2, "value.": 3, "ref.": 2, "type.": 3, "rt": 5, "restype.": 2, "rv": 65, "resvalue.": 2, "lab": 5, "label.": 2, "labs": 18, "label_set.": 2, "res.": 3, "out.": 2, "prop_name.": 2, "strictness_flag.": 2, "mutability.": 2, "Ad": 8, "attributes_data.": 2, "Aa": 10, "attributes_accessor.": 2, "attributes.": 2, "Desc": 21, "descriptor.": 2, "D": 2, "full_descriptor.": 2, "L": 31, "env_loc.": 2, "E": 93, "env_record.": 2, "Ed": 2, "decl_env_record.": 2, "lexical_env.": 2, "object.": 2, "state.": 2, "C": 232, "execution_ctx.": 2, "object_properties_type.": 2, "expr.": 2, "prog.": 2, "stat.": 2, "ext_expr": 451, "expr_basic": 4, "expr": 63, "expr_identifier_1": 2, "specret": 120, "expr_object_0": 2, "out": 222, "propdefs": 8, "expr_object_1": 2, "object_loc": 307, "expr_object_2": 2, "propbody": 1, "expr_object_3_val": 2, "expr_object_3_get": 2, "expr_object_3_set": 2, "expr_object_4": 2, "descriptor": 76, "expr_object_5": 2, "expr_array_0": 2, "expr_array_1": 2, "expr_array_2": 2, "int": 123, "expr_array_3": 3, "expr_array_3_1": 2, "expr_array_3_2": 2, "expr_array_3_3": 2, "expr_array_3_4": 2, "expr_array_3_5": 2, "expr_array_add_length": 2, "expr_array_add_length_0": 2, "expr_array_add_length_1": 2, "expr_array_add_length_2": 2, "expr_array_add_length_3": 2, "expr_array_add_length_4": 2, "expr_function_1": 2, "funcbody": 9, "env_loc": 47, "lexical_env": 18, "expr_function_2": 2, "expr_function_3": 2, "expr_access_1": 2, "expr_access_2": 2, "expr_access_3": 2, "expr_access_4": 2, "expr_new_1": 2, "expr_new_2": 2, "expr_call_1": 2, "expr_call_2": 2, "res": 22, "expr_call_3": 2, "expr_call_4": 2, "expr_call_5": 2, "spec_eval": 2, "expr_unary_op_1": 2, "unary_op": 5, "expr_unary_op_2": 2, "expr_delete_1": 2, "expr_delete_2": 2, "expr_delete_3": 2, "expr_delete_4": 2, "expr_typeof_1": 2, "expr_typeof_2": 2, "expr_prepost_1": 2, "expr_prepost_2": 2, "expr_prepost_3": 2, "expr_prepost_4": 2, "expr_unary_op_neg_1": 2, "expr_unary_op_bitwise_not_1": 2, "expr_unary_op_not_1": 2, "expr_conditional_1": 4, "expr_conditional_2": 2, "expr_binary_op_1": 2, "binary_op": 7, "expr_binary_op_2": 2, "expr_binary_op_3": 3, "expr_binary_op_add_1": 2, "value*value": 4, "expr_binary_op_add_string_1": 2, "expr_puremath_op_1": 2, "number": 29, "expr_shift_op_1": 2, "expr_shift_op_2": 2, "expr_inequality_op_1": 2, "expr_inequality_op_2": 2, "expr_binary_op_in_1": 2, "expr_binary_op_disequal_1": 2, "spec_equal": 3, "spec_equal_1": 2, "type": 5, "spec_equal_2": 2, "spec_equal_3": 2, "spec_equal_4": 2, "expr_bitwise_op_1": 2, "expr_bitwise_op_2": 2, "expr_lazy_op_1": 2, "expr_lazy_op_2": 2, "expr_lazy_op_2_1": 2, "expr_assign_1": 2, "expr_assign_2": 2, "expr_assign_3": 4, "expr_assign_4": 2, "expr_assign_5": 2, "spec_to_primitive": 4, "preftype": 6, "spec_to_boolean": 3, "spec_to_number": 5, "spec_to_number_1": 2, "spec_to_integer": 4, "spec_to_integer_1": 2, "spec_to_string": 6, "spec_to_string_1": 2, "spec_to_object": 4, "spec_check_object_coercible": 2, "spec_eq": 2, "spec_eq0": 2, "spec_eq1": 2, "spec_eq2": 2, "spec_object_get": 4, "prop_name": 111, "spec_object_get_1": 5, "builtin_get": 1, "spec_object_get_2": 2, "full_descriptor": 37, "spec_object_get_3": 2, "spec_object_can_put": 3, "spec_object_can_put_1": 2, "builtin_can_put": 1, "spec_object_can_put_2": 2, "spec_object_can_put_4": 2, "spec_object_can_put_5": 2, "spec_object_can_put_6": 2, "attributes_data": 4, "spec_object_put": 4, "spec_object_put_1": 3, "builtin_put": 1, "spec_object_put_2": 2, "spec_object_put_3": 3, "spec_object_put_4": 2, "spec_object_put_5": 2, "spec_object_has_prop": 3, "spec_object_has_prop_1": 2, "builtin_has_prop": 1, "spec_object_has_prop_2": 2, "spec_object_delete": 3, "spec_object_delete_1": 2, "builtin_delete": 1, "spec_object_delete_2": 2, "spec_object_delete_3": 2, "spec_object_default_value": 3, "spec_object_default_value_1": 2, "builtin_default_value": 1, "spec_object_default_value_2": 2, "spec_object_default_value_3": 2, "spec_object_default_value_4": 2, "spec_object_default_value_sub_1": 3, "spec_object_default_value_sub_2": 2, "spec_object_default_value_sub_3": 2, "spec_object_define_own_prop": 3, "spec_object_define_own_prop_1": 5, "builtin_define_own_prop": 1, "spec_object_define_own_prop_2": 2, "spec_object_define_own_prop_3": 2, "spec_object_define_own_prop_4": 2, "attributes": 17, "spec_object_define_own_prop_5": 2, "spec_object_define_own_prop_6a": 2, "spec_object_define_own_prop_6b": 2, "spec_object_define_own_prop_6c": 2, "spec_prim_value_get": 3, "spec_prim_value_get_1": 2, "spec_prim_value_put": 3, "spec_prim_value_put_1": 2, "prim": 3, "spec_put_value": 3, "resvalue": 45, "spec_env_record_has_binding": 2, "spec_env_record_has_binding_1": 2, "env_record": 6, "spec_env_record_delete_binding": 2, "spec_env_record_delete_binding_1": 2, "spec_from_descriptor": 2, "spec_from_descriptor_1": 2, "spec_from_descriptor_2": 2, "spec_from_descriptor_3": 2, "attributes_accessor": 2, "spec_from_descriptor_4": 2, "spec_from_descriptor_5": 2, "spec_from_descriptor_6": 2, "spec_entering_eval_code": 2, "spec_entering_eval_code_1": 2, "spec_entering_eval_code_2": 2, "spec_call_global_eval": 2, "spec_call_global_eval_1": 2, "spec_call_global_eval_2": 2, "prog": 16, "spec_call_global_eval_3": 3, "spec_entering_func_code": 2, "spec_entering_func_code_1": 2, "strictness_flag": 35, "spec_entering_func_code_2": 2, "spec_entering_func_code_3": 2, "spec_entering_func_code_4": 2, "spec_binding_inst_formal_params": 2, "spec_binding_inst_function_decls": 2, "funcdecl": 14, "spec_binding_inst_arg_obj": 2, "spec_binding_inst_arg_obj_1": 2, "spec_binding_inst_arg_obj_2": 2, "spec_binding_inst_var_decls": 2, "spec_binding_inst_var_decls_1": 2, "spec_binding_inst_var_decls_2": 2, "spec_binding_inst": 2, "codetype": 7, "spec_binding_inst_1": 2, "spec_binding_inst_2": 2, "spec_binding_inst_3": 2, "spec_binding_inst_4": 2, "spec_binding_inst_5": 2, "spec_binding_inst_6": 2, "spec_binding_inst_7": 2, "spec_binding_inst_8": 2, "spec_make_arg_getter": 2, "spec_make_arg_setter": 2, "spec_args_obj_get_1": 2, "spec_args_obj_define_own_prop_1": 2, "spec_args_obj_define_own_prop_2": 2, "spec_args_obj_define_own_prop_3": 2, "spec_args_obj_define_own_prop_4": 3, "spec_args_obj_define_own_prop_5": 2, "spec_args_obj_define_own_prop_6": 3, "spec_args_obj_delete_1": 2, "spec_args_obj_delete_2": 2, "spec_args_obj_delete_3": 2, "spec_args_obj_delete_4": 2, "spec_arguments_object_map": 2, "spec_arguments_object_map_1": 2, "spec_arguments_object_map_2": 2, "spec_arguments_object_map_3": 2, "spec_arguments_object_map_4": 2, "spec_arguments_object_map_5": 2, "spec_arguments_object_map_6": 2, "spec_arguments_object_map_7": 2, "spec_arguments_object_map_8": 2, "spec_create_arguments_object": 2, "spec_create_arguments_object_1": 2, "spec_create_arguments_object_2": 2, "spec_create_arguments_object_3": 2, "spec_create_arguments_object_4": 2, "spec_object_has_instance": 2, "spec_object_has_instance_1": 4, "builtin_has_instance": 1, "spec_function_has_instance_1": 2, "spec_function_has_instance_2": 4, "spec_function_has_instance_3": 2, "spec_function_get_1": 2, "spec_function_proto_apply": 2, "spec_function_proto_apply_1": 2, "spec_function_proto_apply_2": 2, "spec_function_proto_apply_3": 2, "spec_function_proto_bind_1": 2, "spec_function_proto_bind_2": 2, "spec_function_proto_bind_3": 2, "spec_function_proto_bind_4": 2, "spec_function_proto_bind_5": 2, "spec_function_proto_bind_6": 2, "spec_function_proto_bind_7": 2, "spec_error": 5, "native_error": 6, "spec_error_1": 2, "spec_error_or_cst": 4, "spec_error_or_void": 3, "spec_init_throw_type_error": 2, "spec_init_throw_type_error_1": 2, "spec_build_error": 3, "spec_build_error_1": 2, "spec_build_error_2": 2, "spec_new_object": 2, "spec_new_object_1": 2, "spec_prim_new_object": 3, "spec_creating_function_object": 2, "spec_creating_function_object_1": 2, "spec_creating_function_object_2": 2, "spec_creating_function_object_3": 2, "spec_creating_function_object_4": 2, "spec_create_new_function_in": 2, "execution_ctx": 2, "spec_call": 3, "spec_call_1": 2, "call": 8, "spec_call_prealloc": 3, "prealloc": 3, "spec_call_default": 2, "spec_call_default_1": 2, "spec_call_default_2": 2, "spec_call_default_3": 3, "spec_construct": 2, "spec_construct_1": 3, "construct": 1, "spec_construct_prealloc": 3, "spec_construct_default": 2, "spec_construct_default_1": 2, "spec_construct_default_2": 2, "spec_construct_1_after_bind": 2, "spec_call_global_is_nan_1": 2, "spec_call_global_is_finite_1": 2, "spec_call_object_call_1": 2, "spec_call_object_new_1": 2, "spec_call_object_get_proto_of_1": 2, "spec_call_object_is_extensible_1": 2, "spec_call_object_create_1": 2, "spec_call_object_create_2": 2, "spec_call_object_create_3": 2, "spec_call_object_define_props_1": 2, "spec_call_object_define_props_2": 2, "spec_call_object_define_props_3": 2, "spec_call_object_define_props_4": 2, "spec_call_object_define_props_5": 2, "spec_call_object_define_props_6": 2, "spec_call_object_define_props_7": 2, "spec_call_object_seal_1": 2, "spec_call_object_seal_2": 2, "spec_call_object_seal_3": 2, "spec_call_object_seal_4": 2, "spec_call_object_is_sealed_1": 2, "spec_call_object_is_sealed_2": 2, "spec_call_object_is_sealed_3": 2, "spec_call_object_freeze_1": 2, "spec_call_object_freeze_2": 2, "spec_call_object_freeze_3": 2, "spec_call_object_freeze_4": 2, "spec_call_object_freeze_5": 2, "spec_call_object_is_frozen_1": 2, "spec_call_object_is_frozen_2": 2, "spec_call_object_is_frozen_3": 2, "spec_call_object_is_frozen_4": 2, "spec_call_object_is_frozen_5": 2, "spec_call_object_define_prop_1": 2, "spec_call_object_define_prop_2": 2, "spec_call_object_define_prop_3": 2, "spec_call_object_define_prop_4": 2, "spec_call_array_new_1": 2, "spec_call_array_new_2": 2, "spec_call_array_new_3": 3, "spec_call_array_new_single_1": 2, "spec_call_array_new_single_2": 2, "spec_call_array_new_single_3": 2, "spec_call_array_new_single_4": 2, "spec_call_array_is_array_1": 2, "spec_call_array_is_array_2_3": 2, "class_name": 1, "spec_call_array_proto_to_string": 2, "spec_call_array_proto_join": 2, "spec_call_array_proto_join_1": 2, "spec_call_array_proto_join_2": 2, "spec_call_array_proto_join_3": 2, "spec_call_array_proto_join_4": 2, "spec_call_array_proto_join_5": 2, "spec_call_array_proto_pop_1": 2, "spec_call_array_proto_pop_2": 2, "spec_call_array_proto_pop_3": 2, "spec_call_array_proto_push_1": 2, "spec_call_array_proto_push_2": 2, "spec_call_array_proto_push_3": 2, "spec_call_array_proto_push_4": 2, "spec_call_array_proto_push_5": 2, "spec_call_array_proto_push_6": 2, "spec_call_string_non_empty": 2, "spec_construct_string_1": 2, "spec_construct_string_2": 2, "spec_construct_bool_1": 2, "spec_call_bool_proto_to_string_1": 2, "spec_call_bool_proto_value_of_1": 2, "spec_call_bool_proto_value_of_2": 2, "spec_construct_number_1": 2, "spec_returns": 2, "ext_stat": 67, "stat_basic": 4, "stat": 52, "stat_expr_1": 3, "stat_block_1": 2, "stat_block_2": 3, "stat_label_1": 3, "label": 1, "stat_var_decl_1": 2, "stat_var_decl_item": 2, "stat_var_decl_item_1": 2, "stat_var_decl_item_2": 2, "stat_var_decl_item_3": 2, "stat_if_1": 2, "stat_while_1": 3, "label_set": 25, "stat_while_2": 2, "stat_while_3": 3, "stat_while_4": 2, "stat_while_5": 2, "stat_while_6": 2, "stat_do_while_1": 3, "stat_do_while_2": 3, "stat_do_while_3": 2, "stat_do_while_4": 2, "stat_do_while_5": 2, "stat_do_while_6": 2, "stat_do_while_7": 2, "stat_for_1": 2, "stat_for_2": 3, "stat_for_3": 2, "stat_for_4": 2, "stat_for_5": 2, "stat_for_6": 3, "stat_for_7": 3, "stat_for_8": 2, "stat_for_9": 2, "stat_for_var_1": 2, "stat_switch_1": 2, "switchbody": 1, "stat_switch_2": 3, "stat_switch_nodefault_1": 2, "switchclause": 26, "stat_switch_nodefault_2": 2, "stat_switch_nodefault_3": 2, "stat_switch_nodefault_4": 2, "stat_switch_nodefault_5": 2, "stat_switch_nodefault_6": 3, "stat_switch_default_1": 2, "stat_switch_default_A_1": 2, "stat_switch_default_A_2": 2, "stat_switch_default_A_3": 2, "stat_switch_default_A_4": 2, "stat_switch_default_A_5": 3, "stat_switch_default_B_1": 2, "stat_switch_default_B_2": 2, "stat_switch_default_B_3": 2, "stat_switch_default_B_4": 2, "stat_switch_default_5": 2, "stat_switch_default_6": 2, "stat_switch_default_7": 2, "stat_switch_default_8": 3, "stat_with_1": 2, "stat_throw_1": 2, "stat_return_1": 2, "stat_try_1": 3, "string*stat": 1, "stat_try_2": 2, "stat_try_3": 3, "stat_try_4": 2, "stat_try_5": 2, "ext_prog": 7, "prog_basic": 4, "javascript_1": 2, "prog_1": 2, "element": 1, "prog_2": 3, "ext_spec": 75, "spec_to_int32": 3, "spec_to_int32_1": 2, "spec_to_uint32": 3, "spec_to_uint32_1": 2, "spec_expr_get_value_conv": 4, "spec_expr_get_value_conv_1": 2, "spec_expr_get_value_conv_2": 2, "spec_convert_twice": 5, "spec_convert_twice_1": 2, "spec_convert_twice_2": 2, "spec_list_expr": 2, "spec_list_expr_1": 2, "spec_list_expr_2": 2, "spec_to_descriptor": 2, "spec_to_descriptor_1a": 2, "spec_to_descriptor_1b": 2, "spec_to_descriptor_1c": 2, "spec_to_descriptor_2a": 2, "spec_to_descriptor_2b": 2, "spec_to_descriptor_2c": 2, "spec_to_descriptor_3a": 2, "spec_to_descriptor_3b": 2, "spec_to_descriptor_3c": 2, "spec_to_descriptor_4a": 2, "spec_to_descriptor_4b": 2, "spec_to_descriptor_4c": 2, "spec_to_descriptor_5a": 2, "spec_to_descriptor_5b": 2, "spec_to_descriptor_5c": 2, "spec_to_descriptor_6a": 2, "spec_to_descriptor_6b": 2, "spec_to_descriptor_6c": 2, "spec_to_descriptor_7": 2, "spec_object_get_own_prop": 4, "spec_object_get_own_prop_1": 3, "builtin_get_own_prop": 1, "spec_object_get_own_prop_2": 2, "spec_object_get_prop": 4, "spec_object_get_prop_1": 2, "builtin_get_prop": 1, "spec_object_get_prop_2": 2, "spec_object_get_prop_3": 2, "spec_get_value": 4, "spec_get_value_ref_b_1": 2, "spec_get_value_ref_c_1": 2, "spec_expr_get_value": 5, "spec_expr_get_value_1": 2, "spec_error_spec": 3, "spec_error_spec_1": 2, "spec_args_obj_get_own_prop_1": 2, "spec_args_obj_get_own_prop_2": 2, "spec_args_obj_get_own_prop_3": 2, "spec_args_obj_get_own_prop_4": 3, "spec_string_get_own_prop_1": 2, "spec_string_get_own_prop_2": 2, "spec_string_get_own_prop_3": 2, "spec_string_get_own_prop_4": 2, "spec_string_get_own_prop_5": 2, "spec_string_get_own_prop_6": 2, "spec_function_proto_bind_length": 2, "spec_call_array_proto_join_vtsfj": 2, "Coercion": 3, "ext_expr.": 1, "ext_stat.": 1, "ext_prog.": 1, "spec_to_primitive_auto": 3, "out_of_specret": 94, "T": 132, "specret_out": 28, "specret_val": 13, "out_of_ext_expr": 1, "out_of_ext_stat": 1, "out_of_ext_prog": 1, "out_of_ext_spec": 1, "es": 2, "res_is_normal": 1, "res_type": 31, "restype_normal.": 1, "abort": 29, "abort_div": 1, "out_div": 6, "abort_not_normal": 1, "abrupt_res": 4, "out_ter": 47, "abort_intercepted_prog": 3, "abort_intercepted_prog_block_2": 1, "abort_intercepted_stat": 14, "abort_intercepted_stat_block_2": 1, "abort_intercepted_stat_label_1": 1, "res_intro": 5, "restype_break": 6, "abort_intercepted_do_while_2": 1, "res_label_in": 3, "restype_continue": 2, "abort_intercepted_while_3": 1, "abort_intercepted_stat_try_1": 1, "cb": 2, "fo": 4, "restype_throw": 11, "abort_intercepted_stat_try_3": 1, "abort_intercepted_stat_switch_2": 1, "scs": 6, "vi": 2, "ts1": 2, "scs2": 2, "abort_intercepted_stat_for_6": 1, "S0": 5, "eo2": 7, "eo3": 7, "abort_intercepted_stat_for_7": 1, "abort_intercepted_expr": 4, "restype_return": 3, "abort_intercepted_spec": 1, "spec_identifier_resolution": 1, "lex": 2, "execution_ctx_lexical_env": 1, "strict": 1, "execution_ctx_strict": 1, "strict.": 1, "arguments_from": 11, "arguments_from_nil": 1, "Vs": 5, "arguments_from_undef": 1, "undef": 2, "arguments_from_cons": 1, "Vs1": 3, "Vs2": 3, "arguments_first_and_rest": 4, "arguments_f_a_r_from_nil": 1, "arguments_f_a_r_from_cons": 1, "lv": 13, "Hint": 21, "Constructors": 13, "arguments_first_and_rest.": 1, "search_proto_chain": 6, "state": 16, "search_proto_chain_found": 1, "object_has_property": 3, "search_proto_chain_not_found": 1, "object_proto": 2, "prim_null": 1, "search_proto_chain_inductive": 1, "value_object": 4, "make_delete_event": 2, "event": 1, "make_delete_event_intro": 1, "ev": 2, "delete_event": 1, "ev.": 1, "implementation_prealloc": 1, "vret": 1, "dret": 1, "Coq.NArith.NArith.": 1, "Command.": 2, "AskCard": 2, "AskPIN": 2, "CheckPIN": 2, "pin": 5, "AskAmount": 2, "CheckAmount": 2, "amount": 5, "GiveCard": 2, "GiveAmount": 2, "ShowError": 2, "LString.t": 2, "unit": 1, "C.": 2, "Ret.": 2, "_.": 1, "Notations.": 2, "B": 44, "STLC.": 1, "ty_Bool": 35, "ty_arrow": 21, "ty.": 2, "tm_var": 14, "id": 6, "tm_app": 24, "tm_abs": 17, "Id": 3, "idB": 2, "idBB": 2, "idBBBB": 2, "v_abs": 1, "t_true": 1, "t_false": 1, "beq_id": 9, "ST_AppAbs": 1, "t12": 9, "v2": 21, "ST_App1": 1, "ST_App2": 1, "step_example3": 1, "idB.": 1, "ST_App1.": 4, "ST_AppAbs.": 4, "v_abs.": 3, "context": 4, "partial_map": 6, "Context.": 2, "A.": 4, "empty": 11, "extend": 6, "Gamma": 38, "extend_eq": 2, "ctxt": 5, "T.": 9, "extend.": 9, "beq_id_refl": 1, "auto": 17, "extend_neq": 3, "auto.": 18, "has_type": 27, "T_Var": 1, "T_Abs": 2, "T11": 16, "T12": 8, "T_App": 8, "T_True": 1, "T_False": 1, "T_If": 1, "has_type.": 1, "Unfold": 3, "typing_example_2_full": 1, "T_Abs.": 6, "T_Var.": 6, "typing_example_3": 1, "coiso": 1, "reptrans": 1, "appears_free_in": 17, "afi_var": 1, "afi_app1": 1, "afi_app2": 1, "afi_abs": 2, "afi_if1": 1, "afi_if2": 1, "afi_if3": 1, "appears_free_in.": 1, "closed": 2, "free_in_context": 3, "Gamma.": 5, "afi_cases": 1, "solve": 11, "eauto": 5, "IHappears_free_in": 1, "H7.": 1, "not_eq_beq_id_false": 1, "H7": 1, "typable_empty__closed": 1, "@empty": 3, "HeqGamma": 2, "context_invariance": 1, "has_type_cases": 1, "IHhas_type": 2, "Hafi": 1, "beq_id_false_not_eq": 1, "Heqe": 1, "substitution_preserves_typing": 2, "U": 4, "eauto.": 1, "Ht": 2, "Hv.": 1, "simpl...": 1, "rename": 15, "into": 16, "beq_id_eq": 4, "Heqe.": 4, "clear": 45, "context_invariance...": 3, "Hcontra.": 1, "Hcontra": 1, "...": 1, "HT": 22, "Hafi.": 2, "IHt.": 1, "Coiso1.": 2, "Coiso2.": 3, "HeqCoiso1.": 1, "HeqCoiso2.": 1, "beq_id_false_not_eq.": 1, "preservation": 1, "HT.": 1, "T11.": 4, "HT1.": 1, "IHHT1.": 2, "IHHT2.": 1, "T_If.": 1, "progress": 2, "IHhas_type1.": 2, "IHhas_type2.": 1, "ST_App2.": 2, "Ht.": 3, "IHt2": 2, "T0": 2, "ty_Bool.": 1, "IHt3": 1, "types_unique": 1, "T1": 1, "IHhas_type1": 1, "IHhas_type2": 1, "C.Notations.": 1, "error": 8, "do_call": 1, "Command.ShowError": 1, "ret.": 1, "main": 1, "card_is_valid": 2, "Command.AskCard": 1, "Command.AskPIN": 1, "@@": 7, "LString.s": 7, "pin_is_valid": 2, "Command.CheckPIN": 1, "ask_amount": 2, "Command.AskAmount": 1, "amount_is_valid": 2, "Command.CheckAmount": 1, "card_is_given": 2, "Command.GiveCard": 1, "amount_is_given": 2, "Command.GiveAmount": 1, "JsCommon": 1, "JsCommonAux": 1, "JsPrettyInterm": 1, "JsPrettyRules.": 1, "Ltac": 37, "tryfalse_nothing": 1, "goal": 15, "nothing": 12, "tryfalse.": 52, "ct": 1, "codetype.": 1, "W": 81, "result.": 1, "Type.": 1, "Record": 1, "runs_type_correct": 37, "make_runs_type_correct": 1, "runs_type_correct_expr": 2, "runs_type_expr": 2, "red_expr": 67, "runs_type_correct_stat": 2, "runs_type_stat": 2, "red_stat": 7, "runs_type_correct_prog": 2, "runs_type_prog": 2, "red_prog": 4, "runs_type_correct_call": 2, "vs": 7, "runs_type_call": 2, "runs_type_correct_call_prealloc": 1, "args": 36, "runs_type_call_prealloc": 1, "result_some": 59, "runs_type_correct_construct": 2, "co": 5, "runs_type_construct": 2, "lo": 7, "runs_type_function_has_instance": 2, "array": 3, "runs_type_get_args_for_apply": 1, "red_spec": 23, "runs_type_object_has_instance": 2, "runs_type_correct_stat_while": 2, "ls": 6, "runs_type_stat_while": 2, "runs_type_correct_stat_do_while": 2, "runs_type_stat_do_while": 2, "runs_type_correct_stat_for_loop": 2, "runs_type_stat_for_loop": 2, "runs_type_correct_object_delete": 2, "runs_type_object_delete": 2, "sp": 8, "runs_type_object_get_own_prop": 2, "runs_type_object_get_prop": 2, "runs_type_correct_object_get": 2, "runs_type_object_get": 2, "lthis": 4, "runs_type_correct_object_put": 2, "runs_type_object_put": 2, "runs_type_correct_equal": 2, "runs_type_equal": 2, "runs_type_correct_to_integer": 2, "runs_type_to_integer": 2, "runs_type_correct_to_string": 2, "runs_type_to_string": 2, "oes": 10, "runs_type_array_element_list": 2, "newLen": 7, "oldLen": 6, "newLenDesc": 12, "newWritable": 12, "throw": 6, "def": 7, "specres": 6, "def_correct": 2, "res_out": 29, "builtin_define_own_prop_default": 3, "sep": 3, "runs_type_array_join_elements": 1, "absurd_neg": 2, "fresh": 77, "introv": 108, "inverts": 56, "abort.": 6, "arguments_from_spec_1": 1, "get_arg": 10, "arguments_from.": 1, "undef.": 1, "splits*.": 6, "res_overwrite_value_if_empty": 5, "resvalue_empty": 2, "R.": 13, "introv.": 4, "unfolds.": 23, "cases_if": 20, "simpls": 11, "res_overwrite_value_if_empty.": 3, "res_label": 6, "rv1": 3, "rv2": 3, "rv3": 4, "res_normal": 3, "unfolds": 102, "cases_if*.": 4, "get_arg_correct": 1, "num": 5, "LibList.nth": 1, "vs.": 1, "I.": 3, "lets": 18, "I": 4, "destruct*": 8, "num.": 1, "nth_succ.": 1, "IHA": 2, "nth_def_nil": 1, "length_cons": 2, "nat_math": 2, "nth_succ": 1, "nth_def_succ": 1, "get_arg_correct_0": 1, "do": 4, "2": 2, "constructors": 4, "get_arg_correct_1": 1, "1": 2, "3": 1, "get_arg_correct_2": 1, "4": 2, "get_arg_first_and_rest_correct": 1, "get_arg_first_and_rest": 2, "splits": 22, "Hyp": 8, "Hyp.": 6, "and_impl_left": 3, "P3": 2, "P3.": 1, "auto*.": 12, "applys_and_base": 5, "applys": 84, "constr": 85, "A1": 6, "A2": 4, "A3": 2, "constructors_and": 1, "exact": 3, "run_callable_correct": 2, "run_callable": 1, "callable": 1, "co.": 1, "E.": 72, "sets_eq": 8, "pick_option": 1, "object_binds": 1, "tryfalse": 8, "o0": 2, "forwards": 47, "pick_option_correct": 4, "EQB": 1, "Monadic": 1, "Lemmas": 1, "Shared": 1, "defs": 1, "eqabort": 11, "o1": 110, "that": 3, "and": 3, "are": 1, "equal": 1, "satisfy": 1, "the": 1, "predicate": 1, "prove_abort": 5, "constructor": 1, "isout": 17, "Pred": 4, "asserts": 16, "is": 1, "fact": 1, "an": 1, "outcome": 1, "satisfies": 1, "o1.": 20, "isout.": 1, "eqabort.": 1, "if_empty_label_out": 5, "K": 152, "if_empty_label": 2, "label_empty": 4, "tt": 9, "eexists": 3, "if_some_out": 2, "oa": 9, "if_some": 2, "if_result_some_out": 2, "resultof": 1, "if_result_some": 1, "if_some_or_default_out": 2, "if_some_or_default": 2, "if_ter_post": 3, "result": 22, "if_ter_out": 8, "if_ter": 3, "tryfalse_nothing.": 3, "inverts*": 9, "jauto.": 3, "if_success_state_post": 3, "rv0": 3, "restype_normal": 3, "ifb": 1, "if_success_state_out": 2, "if_success_state": 2, "WE": 20, "rm": 53, "W.": 3, "eexists.": 8, "inversion_clear": 20, "branch": 16, "substs.": 10, "discriminate": 4, "simpls.": 18, "if_success_post": 3, "if_success_out": 4, "if_success": 3, "if_void_post": 3, "out_void": 2, "if_void_out": 3, "if_void": 2, "left*": 16, "S.": 3, "Admitted.": 38, "if_not_throw_post": 3, "Extern": 4, "restype": 1, "congruence.": 5, "if_not_throw_out": 2, "if_not_throw": 2, "substs": 7, "if_any_or_throw_post": 3, "K1": 10, "K2": 10, "res_value": 3, "if_any_or_throw_out": 2, "if_any_or_throw": 2, "simple*.": 5, "split*.": 1, "forwards*": 5, "if_empty_label_out.": 3, "if_success_or_return_post": 3, "if_success_or_return_out": 2, "if_success_or_return": 2, "if_break_post": 3, "if_break_out": 2, "if_break": 2, "if_value_post": 3, "res_val": 7, "if_value_out": 7, "if_value": 3, "exists___*.": 16, "if_bool_post": 3, "prim_bool": 2, "if_bool_out": 2, "if_bool": 3, "if_object_post": 3, "if_object_out": 2, "if_object": 4, "if_string_post": 3, "prim_string": 1, "if_string_out": 2, "if_string": 3, "if_number_post": 3, "prim_number": 1, "if_number_out": 2, "if_number": 3, "if_prim_post": 3, "value_prim": 5, "if_prim_out": 2, "if_prim": 3, "if_abort_out": 2, "if_abort": 1, "if_spec_post": 5, "if_spec_out": 2, "if_spec": 2, "if_ter_spec_post": 3, "if_ter_spec": 3, "if_success_spec_post": 3, "if_success_spec": 3, "if_value_spec_post": 3, "if_value_spec": 7, "if_prim_spec_post": 3, "if_prim_spec": 2, "if_bool_spec_post": 3, "if_bool_spec": 2, "if_number_spec_post": 3, "if_number_spec": 2, "if_string_spec_post": 3, "if_string_spec": 2, "if_object_spec_post": 3, "if_object_spec": 2, "prove_not_intercept": 2, "prove_not_intercept.": 3, "abort_tactic": 5, "congruence": 1, "red_expr_abort.": 1, "red_stat_abort.": 1, "red_prog_abort.": 1, "red_spec_abort.": 1, "abort_expr": 1, "abort_stat": 1, "abort_prog": 1, "abort_spec": 1, "run_select_extra": 2, "fail.": 9, "run_select_ifres": 2, "@if_ter": 1, "@if_success": 1, "@if_value": 1, "@if_void": 1, "@if_object": 1, "@if_bool": 1, "@if_string": 1, "@if_number": 1, "@if_prim": 1, "run_select_proj_extra_error": 3, "run_select_proj_extra_ref": 3, "run_select_proj_extra_construct": 2, "run_select_proj_extra_get_value": 2, "run_select_proj": 2, "get_head": 1, "prove_runs_type_correct": 2, "run_hyp_core": 3, "Proj": 5, "prove_runs_type_correct.": 1, "select_ind_hyp": 1, "IH": 37, "hyp": 4, "simple_intropattern": 1, "run_hyp": 11, "run_pre_ifres": 4, "R1": 27, "run_pre_core": 4, "O1": 35, "K.": 4, "result_some_out": 4, "res_to_res_void": 4, "result_out": 4, "run_pre": 4, "R1.": 6, "Red": 28, "o1orR1": 1, "o1orR1.": 1, "run_post_run_expr_get_value": 2, "run_post_extra": 2, "run_post_core": 1, "Er": 15, "Ab": 15, "go": 17, "subst_hyp": 21, "W1": 1, "E1": 10, "E2": 9, "run_post_core.": 1, "run_inv": 10, "out_retn": 1, "resvalue_value": 4, "res_spec": 4, "res_ter": 4, "ret_void": 4, "res_void": 5, "out_from_retn": 4, "runs_inv": 1, "run_get_current_out": 3, "red_javascript": 2, "run_check_current_out": 3, "idtac": 7, "run_step": 2, "ltac_wild": 2, "run_apply": 3, "run_post": 3, "run_step_using": 2, "Lem": 7, "run_simpl_run_error": 3, "run_simpl_base": 2, "run_simpl_core": 3, "run_inv.": 36, "Red.": 1, "Lem.": 1, "using": 30, "run_simpl.": 9, "or": 2, "run_pre_lemma": 1, "__my_red_lemma__": 1, "run_post.": 6, "type_of_prim_not_object": 1, "type_of": 1, "type_object.": 1, "Resolve": 2, "type_of_prim_not_object.": 1, "is_lazy_op_correct": 1, "op": 24, "is_lazy_op": 1, "regular_binary_op": 1, "lazy_op": 1, "lazy_op.": 1, "regular_binary_op.": 1, "run_object_method_correct": 11, "run_object_method": 2, "object_method": 1, "B.": 9, "Bi": 1, "LibOption.map_on_inv": 2, "@pick_option_correct": 10, "Bi.": 1, "exists*": 1, "run_object_heap_set_extensible": 1, "object_heap_set_extensible": 1, "build_error_correct": 2, "vproto": 3, "vmsg": 3, "build_error": 1, "object_alloc": 6, "red_spec_build_error": 1, "EQX.": 1, "red_spec_build_error_1_no_msg.": 1, "run_error_correct": 11, "run_error": 7, "ne": 19, "R0": 1, "applys_and": 3, "red_spec_error": 1, "R0.": 1, "red_spec_error_1.": 1, "applys*": 154, "run_error_correct_2": 2, "apply*": 9, "run_error_correct.": 2, "run_error_correct_2.": 1, "run_error_not_some_out_res": 1, "native_error_type": 1, "@specret_out": 1, "set": 1, "execution_ctx_intro": 1, "Hred": 1, "Habort": 1, "Hred.": 1, "H9.": 1, "Habort.": 1, "abrupt_res.": 1, "out_error_or_void_correct": 5, "out_error_or_void": 1, "cases_if.": 9, "red_spec_error_or_void_true.": 1, "RC": 2, "Cr": 2, "red_spec_error_or_void_false.": 1, "out_error_or_cst_correct": 6, "out_error_or_cst": 2, "red_spec_error_or_cst_true.": 2, "red_spec_error_or_cst_false.": 2, "HR.": 110, "case_if.": 28, "object_has_prop_correct": 2, "object_has_prop": 1, "M.": 10, "red_spec_object_has_prop": 1, "x0.": 7, "red_spec_object_has_prop_2.": 1, "decide_def.": 3, "run_object_get_prop_correct": 1, "run_object_get_prop": 1, "run.": 33, "red_spec_object_get_prop.": 1, "run_object_method_correct.": 8, "red_spec_object_get_prop_3_null.": 1, "run_hyp*.": 2, "object_get_builtin_correct": 1, "vthis": 11, "object_get_builtin": 1, "let_name": 20, "Mdefault.": 1, "Mdefault_correct": 1, "Mdefault": 1, "builtin_get_default": 1, "HR": 23, "red_spec_object_get_1_default.": 1, "red_spec_object_get_2_undef.": 1, "red_spec_object_get_2_data.": 1, "red_spec_object_get_2_accessor.": 1, "attributes_accessor_get": 1, "EQMdefault.": 1, "Mfunction.": 1, "Mfunction_correct": 1, "Mfunction": 1, "builtin_get_function": 1, "run*": 11, "red_spec_object_get_1_function.": 1, "red_spec_function_get_1_error.": 1, "red_spec_function_get_1_normal.": 1, "EQMfunction.": 1, "Mdefault_correct.": 1, "Mfunction_correct.": 1, "obpm": 3, "red_spec_object_get_args_obj.": 1, "run_hyp.": 1, "run_object_get_correct": 2, "run_object_get": 1, "red_spec_object_get.": 1, "object_get_builtin_correct.": 2, "object_can_put_correct": 1, "object_can_put": 1, "CP.": 2, "red_spec_object_can_put": 1, "red_spec_object_can_put_2_undef": 1, "lproto": 2, "red_spec_object_can_put_4_null.": 1, "run_object_get_prop_correct.": 2, "red_spec_object_can_put_5_undef.": 1, "red_spec_object_can_put_5_data": 1, "red_spec_object_can_put_2_data.": 1, "object_default_value_correct": 1, "pref": 3, "object_default_value": 1, "red_spec_object_default_value": 1, "M_correct": 3, "F": 10, "M": 6, "clears": 4, "HK.": 1, "run_object_get_correct.": 4, "EQM.": 2, "let_name.": 17, "red_spec_object_default_value_2.": 1, "M_correct.": 4, "red_spec_object_default_value_3.": 1, "red_spec_object_default_value_4.": 1, "to_primitive_correct": 2, "prefo": 3, "to_primitive": 2, "red_spec_to_primitive_pref_prim.": 1, "object_default_value_correct.": 1, "run_pre.": 3, "to_number_correct": 2, "to_number": 2, "red_spec_to_number_prim.": 2, "red_spec_to_number_object": 1, "to_primitive_correct.": 2, "red_spec_to_number_1.": 1, "to_string_correct": 2, "to_string": 3, "red_spec_to_string_prim.": 1, "red_spec_to_string_object": 1, "red_spec_to_string_1.": 1, "to_integer_correct": 1, "to_integer": 1, "red_spec_to_integer": 1, "to_number_correct.": 3, "red_spec_to_integer_1.": 1, "to_int32_correct": 2, "to_int32": 3, "red_spec_to_int32": 1, "red_spec_to_int32_1.": 1, "to_uint32_correct": 2, "to_uint32": 3, "red_spec_to_uint32": 1, "red_spec_to_uint32_1.": 2, "IH.": 1, "EQoldLen": 2, "eassumption": 2, "EQnewLenDesc": 4, "newLenDesc0": 2, "object_define_own_prop_correct": 4, "object_define_own_prop": 2, "rej.": 1, "Rej": 1, "rej": 1, "out_error_or_cst_correct.": 1, "def.": 1, "Def": 1, "case_if": 17, "case_if*.": 4, "wri.": 1, "Wri": 1, "wri": 1, "EQwri.": 1, "HC1.": 1, "EQdef.": 1, "red_spec_object_define_own_prop.": 1, "Def.": 1, "oldLen.": 1, "attributes_data_value": 1, "descValueOpt.": 1, "red_spec_to_uint32.": 1, "descriptor_value": 4, "Step": 4, "3b": 1, "EQv": 2, "a0": 8, "newLenN": 2, "HnW": 1, "EQnewWritable": 3, "descriptor_writable": 2, "jauto": 2, "replace": 2, "by": 3, "3a": 1, "Branching": 1, "between": 1, "5": 1, "ilen": 1, "slen": 1, "arguments": 1, "object": 2, "Follow": 2, "follow": 5, "RES.": 8, "EQfollow": 3, "EQfollow.": 2, "next.": 1, "Next": 1, "next": 1, "EQnext": 1, "EQnext.": 1, "dvDesc": 2, "Admitted": 1, "faster": 1, "prim_new_object_correct": 1, "prim_new_object": 1, "let_simpl": 3, "red_spec_prim_new_object_bool.": 1, "red_spec_prim_new_object_number.": 1, "red_spec_prim_new_object_string.": 1, "to_object_correct": 2, "to_object": 2, "hint": 1, "prim_new_object_correct.": 1, "w.": 1, "red_spec_to_object_prim.": 3, "rew_logic*.": 3, "red_spec_to_object_object.": 1, "run_object_prim_value_correct": 1, "run_object_prim_value": 1, "object_prim_value": 1, "runs.": 1, "prim_value_get_correct": 1, "prim_value_get": 1, "red_spec_prim_value_get": 1, "to_object_correct.": 5, "red_spec_prim_value_get_1.": 1, "object_put_complete_correct": 1, "object_put_complete": 1, "red_spec_object_put_1_default": 1, "object_can_put_correct.": 1, "red_spec_object_put_2_true.": 1, "follows_correct": 4, "full_descriptor_undef": 2, "attributes_accessor_of": 1, "S2": 1, "red_spec_object_put_3_not_data": 1, "N.": 2, "tests": 1, "Acc": 3, "va": 2, "red_spec_object_put_4_accessor.": 1, "EQva": 1, "red_spec_object_put_5_return": 3, "wthis": 1, "red_spec_object_put_3_data_prim": 1, "red_spec_object_put_2_false": 1, "prim_value_put_correct": 1, "prim_value_put": 1, "red_spec_prim_value_put": 1, "red_spec_prim_value_put_1.": 1, "object_put_complete_correct.": 2, "rn": 3, "rs": 3, "env_record_get_binding_value": 1, "Heap": 3, "binds_equiv_read_option": 2, "mu": 2, "red_spec_returns": 2, "throw_result_run_error_correct": 1, "throw_result": 1, "throw_result.": 1, "red_spec_error_spec.": 1, "ref_kind_env_record_inv": 2, "ref_kind_of": 6, "ref_kind_env_record": 1, "ref_base": 8, "ref_base_type_env_loc": 1, "L.": 1, "ref_kind_of.": 3, "ref_kind_base_object_inv": 2, "ref_kind_primitive_base": 2, "ref_kind_object": 2, "ref_base_type_value": 2, "exists___*": 1, "ref_get_value_correct": 1, "ref_get_value": 1, "red_spec_ref_get_value_value.": 1, "EQ": 2, "ref_is_property": 3, "EQ.": 2, "Ev": 2, "ref_has_primitive_base.": 1, "prim_value_get_correct.": 1, "red_spec_ref_get_value_ref_b_1.": 2, "red_spec_ref_get_value_ref_a.": 1, "unfolds*.": 1, "throw_result_run_error_correct.": 1, "EQL": 2, "sym_eq": 1, "EQk": 1, "red_spec_ref_get_value_ref_c": 1, "red_spec_ref_get_value_ref_c_1.": 1, "object_put_correct": 3, "object_put": 2, "red_spec_object_put.": 1, "env_record_set_mutable_binding": 1, "ref_is_unresolvable": 2, "v0.": 1, "ref_put_value_correct": 2, "ref_put_value": 2, "red_spec_ref_put_value_value.": 1, "red_spec_ref_put_value_ref_a_1.": 1, "red_spec_ref_put_value_ref_a_2.": 1, "object_put_correct.": 2, "cases": 2, "v0": 2, "prim_value_put_correct.": 1, "red_spec_ref_put_value_ref_c.": 1, "run_expr_get_value_correct": 2, "run_expr_get_value": 2, "red_spec_expr_get_value.": 1, "red_spec_expr_get_value_1.": 1, "ref_get_value_correct.": 1, "deletable_opt": 6, "let_simpl.": 3, "object_has_prop_correct.": 2, "if_spec_ter_post_bool": 2, "run_post_if_spec_ter_post_bool": 1, "Eq": 1, "S1": 6, "if_spec_post_to_bool": 1, "HP.": 2, "y1.": 2, "splits.": 3, "red_spec_expr_get_value_conv.": 5, "convert_value_to_boolean": 1, "red_spec_expr_get_value_conv_1.": 3, "red_spec_to_boolean.": 2, "red_spec_expr_get_value_conv_2.": 2, "__.": 1, "if_spec_ter_post_object": 2, "if_spec_post_to_object": 1, "lets*": 1, "lift2": 4, "convert_twice_primitive_correct": 1, "convert_twice_primitive": 1, "red_spec_convert_twice.": 3, "red_spec_convert_twice_1.": 3, "lift2.": 3, "red_spec_convert_twice_2.": 3, "convert_twice_number_correct": 1, "convert_twice_number": 1, "convert_twice_string_correct": 1, "convert_twice_string": 1, "get_puremath_op_correct": 1, "get_puremath_op": 1, "puremath_op": 1, "F.": 3, "puremath_op.": 1, "get_inequality_op_correct": 1, "get_inequality_op": 1, "inequality_op": 1, "b2.": 1, "inequality_op.": 1, "get_shift_op_correct": 1, "get_shift_op": 1, "shift_op": 1, "shift_op.": 1, "get_bitwise_op_correct": 1, "get_bitwise_op": 1, "bitwise_op": 1, "bitwise_op.": 1, "run_object_get_own_prop_correct": 1, "run_object_get_own_prop": 1, "red_spec_object_get_own_prop.": 1, "builtin_get_own_prop_default": 1, "Ao": 2, "read_option": 1, "EQAo": 1, "EQM": 1, "default": 1, "argument": 1, "LTAC": 1, "ARTHUR": 1, "this": 1, "has": 1, "been": 1, "defined": 1, "tactics": 1, "to_int32_correct.": 1, "EQo": 1, "Opv": 1, "run_object_prim_value_correct.": 1, "EQo.": 1, "Opv.": 1, "math.": 2, "run_function_has_instance": 1, "red_spec_function_has_instance_2": 1, "run_object_has_instance_correct": 1, "run_object_has_instance": 1, "eassumption.": 3, "run_binary_op_correct": 1, "run_binary_op": 1, "red_expr_binary_op_add": 1, "convert_twice_primitive_correct.": 2, "w1": 2, "w2": 2, "red_expr_binary_op_add_1_string": 1, "convert_twice_string_correct.": 1, "s1": 3, "s2": 4, "red_expr_binary_op_add_string_1.": 1, "red_expr_binary_op_add_1_number": 1, "convert_twice_number_correct.": 2, "red_expr_puremath_op_1.": 2, "red_expr_puremath_op": 1, "get_puremath_op_correct.": 1, "red_expr_shift_op": 1, "get_shift_op_correct.": 2, "red_expr_shift_op_1.": 2, "red_expr_shift_op_2.": 2, "red_expr_bitwise_op.": 1, "get_bitwise_op_correct.": 1, "red_expr_bitwise_op_1.": 1, "red_expr_bitwise_op_2.": 1, "red_expr_inequality_op.": 1, "get_inequality_op_correct.": 1, "red_expr_inequality_op_1": 1, "wa": 2, "wb": 2, "wr": 1, "inequality_test_primitive": 1, "applys_eq*": 1, "red_expr_inequality_op_2": 1, "EQp": 1, "EQwr": 1, "fequals.": 1, "case_if*": 5, "v2.": 2, "red_spec_object_has_instance.": 1, "run_object_has_instance_correct.": 1, "red_expr_binary_op_in_object.": 1, "red_expr_binary_op_in_1.": 1, "red_expr_binary_op_equal.": 1, "runs_type_correct_equal.": 1, "red_expr_binary_op_disequal.": 1, "red_expr_binary_op_disequal_1.": 1, "red_expr_binary_op_strict_equal.": 1, "red_expr_binary_op_coma.": 1, "array_args_map_loop_no_abort": 1, "array_args_map_loop": 2, "res_empty.": 1, "inductions": 1, "IHoes": 1, "array_args_map_loop_correct": 1, "red_spec_call_array_new_3_empty.": 2, "res_void.": 1, "run_construct_prealloc_correct": 1, "run_construct_prealloc": 1, "discriminate.": 45, "red_spec_call_object_new.": 1, "get_arg_correct_0.": 3, "call_object_new": 1, "red_spec_call_object_new_1_prim.": 3, "red_spec_construct_bool.": 1, "red_spec_construct_bool_1.": 1, "red_spec_construct_number_nil.": 1, "red_spec_construct_number_1.": 2, "arg_len.": 1, "args.": 2, "red_spec_call_array_new_no_args.": 1, "red_spec_call_array_new_1": 1, "red_spec_call_array_new_2.": 1, "get_arg.": 1, "nth_def.": 1, "Fappli_IEEE_bits.binary64.": 1, "Parameter": 31, "zero": 1, "neg_zero": 1, "one": 1, "eq_refl": 2, "Fappli_IEEE.mode_NE": 1, "infinity": 1, "neg_infinity": 1, "max_value": 1, "min_value": 1, "pi": 1, "ln2": 1, "from_string": 1, "neg": 1, "absolute": 1, "sign": 1, "lt_bool": 1, "add": 4, "Fappli_IEEE_bits.b64_plus": 1, "Fappli_IEEE.mode_NE.": 3, "sub": 1, "fmod": 1, "mult": 1, "Fappli_IEEE_bits.b64_mult": 1, "div": 1, "Fappli_IEEE_bits.b64_div": 1, "Global": 1, "Instance": 1, "number_comparable": 1, "Comparable": 1, "of_int": 1, "to_int16": 1, "modulo_32": 1, "int32_bitwise_not": 1, "int32_bitwise_and": 1, "int32_bitwise_or": 1, "int32_bitwise_xor": 1, "int32_left_shift": 1, "int32_right_shift": 1, "uint32_right_shift": 1, "NatList.": 2, "natprod": 8, "natprod.": 1, "swap_pair": 3, "surjective_pairing": 2, "snd_fst_is_swap": 1, "fst_swap_is_snd": 1, "natlist": 39, "natlist.": 2, "l_123": 1, "head": 2, "tl": 2, "nonzeros": 7, "test_nonzeros": 1, "oddmembers": 5, "test_oddmembers": 1, "test_countoddmembers2": 1, "test_countoddmembers3": 1, "alternate": 3, "r1": 4, "r2": 4, "test_alternative1": 1, "bag": 17, "test_count1": 1, "sum": 2, "app.": 1, "test_sum1": 1, "test_add1": 1, "member": 4, "test_member1": 1, "test_member2": 1, "remove_one": 4, "test_remove_one1": 1, "remove_all": 3, "test_remove_all1": 1, "subset": 4, "test_subset1": 1, "test_subset2": 1, "bag_count_add": 1, "tl_length_pred": 1, "pred": 1, "app_ass": 2, "l3": 10, "app_length": 1, "test_rev1": 1, "rev_length": 1, "length_snoc.": 1, "app_nil_end": 1, "rev_involutive": 1, "rev_snoc.": 1, "app_ass4": 1, "l4": 2, "l4.": 2, "app_ass.": 3, "snoc_append": 1, "nonzeros_length": 1, "distr_rev": 1, "app_nil_end.": 1, "snoc_append.": 2, "count_number_nonzero": 1, "ble_n_Sn": 1, "remove_decreases_count": 1, "ble_n_Sn.": 1, "natoption": 5, "natoption.": 1, "option_elim": 2, "option_elim_hd": 1, "beq_natlist": 5, "test_beq_natlist1": 1, "test_beq_natlist2": 1, "beq_natlist_refl": 1, "silly1": 1, "silly2a": 1, "q": 4, "silly_ex": 1, "evenb": 2, "rev_exercise": 1, "rev_involutive.": 1, "beq_nat_sym": 1, "l3.": 1 }, "Creole": { "Creole": 6, "is": 3, "a": 2, "-": 5, "to": 2, "HTML": 1, "converter": 2, "for": 1, "the": 5, "lightweight": 1, "markup": 1, "language": 1, "(": 5, "http": 4, "//wikicreole.org/": 1, ")": 5, ".": 1, "Github": 1, "uses": 1, "this": 1, "render": 1, "*.creole": 1, "files.": 1, "Project": 1, "page": 1, "on": 2, "github": 1, "*": 5, "//github.com/minad/creole": 1, "Travis": 1, "CI": 1, "https": 1, "//travis": 1, "ci.org/minad/creole": 1, "RDOC": 1, "INSTALLATION": 1, "{": 6, "gem": 1, "install": 1, "creole": 1, "}": 6, "SYNOPSIS": 1, "require": 1, "html": 1, "Creole.creolize": 1, "BUGS": 1, "If": 1, "you": 1, "found": 1, "bug": 1, "please": 1, "report": 1, "it": 1, "at": 1, "project": 1, "GitHub": 1, "//github.com/minad/creole/issues": 1, "AUTHORS": 1, "Lars": 2, "Christensen": 2, "larsch": 1, "Daniel": 2, "Mendler": 1, "minad": 1, "LICENSE": 1, "Copyright": 1, "c": 1, "Mendler.": 1, "It": 1, "free": 1, "software": 1, "and": 1, "may": 1, "be": 1, "redistributed": 1, "under": 1, "terms": 1, "specified": 1, "in": 1, "README": 1, "file": 1, "of": 1, "Ruby": 1, "distribution.": 1 }, "Crystal": { "SHEBANG#!bin": 2, "require": 3, "describe": 2, "do": 24, "it": 21, "run": 14, "(": 201, ")": 187, ".to_i.should": 5, "eq": 8, "end": 164, "class": 14, "Foo": 14, "A": 16, "def": 97, "foo": 12, "Foo.new.foo": 4, "2.5_f32": 2, "+": 1, "module": 2, "B": 1, "C": 1, "B.new": 1, ";": 1, "C.foo": 1, "initialize": 2, "@x": 7, "x": 2, "begin": 2, "f": 4, "Foo.new": 2, "A.x": 1, "BAR": 2, "a": 2, "while": 1, "b": 1, "compile": 1, "Foo.new.compile": 1, "CONST": 2, "raise": 1, "doit": 1, "rescue": 1, "doit.nil": 1, "assert_type": 7, "{": 5, "int32": 7, "}": 5, "union_of": 1, "char": 1, "result": 3, "Int32": 4, "mod": 1, "result.program": 1, "mod.types": 1, "[": 8, "]": 8, "as": 4, "NonGenericClassType": 1, "foo.instance_vars": 1, ".type.should": 3, "mod.int32": 1, "T": 5, ".new": 2, "types": 2, "GenericClassType": 2, "foo_i32": 4, "foo.instantiate": 2, "of": 3, "Type": 2, "|": 8, "ASTNode": 4, "foo_i32.lookup_instance_var": 2, "Foo.new.x": 1, "Crystal": 1, "transform": 81, "transformer": 1, "transformer.before_transform": 1, "self": 77, "node": 164, "transformer.transform": 1, "transformer.after_transform": 1, "Transformer": 1, "before_transform": 1, "after_transform": 1, "Expressions": 2, "exps": 6, "node.expressions.each": 1, "exp": 3, "new_exp": 3, "exp.transform": 3, "if": 23, "new_exp.is_a": 1, "exps.concat": 1, "new_exp.expressions": 1, "else": 2, "<<": 1, "exps.length": 1, "node.expressions": 3, "Call": 1, "node_obj": 1, "node.obj": 9, "node_obj.transform": 1, "transform_many": 23, "node.args": 3, "node_block": 1, "node.block": 2, "node_block.transform": 1, "node_block_arg": 1, "node.block_arg": 6, "node_block_arg.transform": 1, "And": 1, "node.left": 3, "node.left.transform": 3, "node.right": 3, "node.right.transform": 3, "Or": 1, "StringInterpolation": 1, "ArrayLiteral": 1, "node.elements": 1, "node_of": 1, "node.of": 2, "node_of.transform": 1, "HashLiteral": 1, "node.keys": 1, "node.values": 2, "of_key": 1, "node.of_key": 2, "of_key.transform": 1, "of_value": 1, "node.of_value": 2, "of_value.transform": 1, "If": 1, "node.cond": 5, "node.cond.transform": 5, "node.then": 3, "node.then.transform": 3, "node.else": 5, "node.else.transform": 3, "Unless": 1, "IfDef": 1, "MultiAssign": 1, "node.targets": 1, "SimpleOr": 1, "Def": 1, "node.body": 12, "node.body.transform": 10, "receiver": 2, "node.receiver": 4, "receiver.transform": 2, "block_arg": 2, "block_arg.transform": 2, "Macro": 1, "PointerOf": 1, "node.exp": 3, "node.exp.transform": 3, "SizeOf": 1, "InstanceSizeOf": 1, "IsA": 1, "node.obj.transform": 5, "node.const": 1, "node.const.transform": 1, "RespondsTo": 1, "Case": 1, "node.whens": 1, "node_else": 1, "node_else.transform": 1, "When": 1, "node.conds": 1, "ImplicitObj": 1, "ClassDef": 1, "superclass": 1, "node.superclass": 2, "superclass.transform": 1, "ModuleDef": 1, "While": 1, "Generic": 1, "node.name": 5, "node.name.transform": 5, "node.type_vars": 1, "ExceptionHandler": 1, "node.rescues": 1, "node_ensure": 1, "node.ensure": 2, "node_ensure.transform": 1, "Rescue": 1, "node.types": 2, "Union": 1, "Hierarchy": 1, "Metaclass": 1, "Arg": 1, "default_value": 1, "node.default_value": 2, "default_value.transform": 1, "restriction": 1, "node.restriction": 2, "restriction.transform": 1, "BlockArg": 1, "node.fun": 1, "node.fun.transform": 1, "Fun": 1, "node.inputs": 1, "output": 1, "node.output": 2, "output.transform": 1, "Block": 1, "node.args.map": 1, "Var": 2, "FunLiteral": 1, "node.def.body": 1, "node.def.body.transform": 1, "FunPointer": 1, "obj": 1, "obj.transform": 1, "Return": 1, "node.exps": 5, "Break": 1, "Next": 1, "Yield": 1, "scope": 1, "node.scope": 2, "scope.transform": 1, "Include": 1, "Extend": 1, "RangeLiteral": 1, "node.from": 1, "node.from.transform": 1, "node.to": 2, "node.to.transform": 2, "Assign": 1, "node.target": 1, "node.target.transform": 1, "node.value": 3, "node.value.transform": 3, "Nop": 1, "NilLiteral": 1, "BoolLiteral": 1, "NumberLiteral": 1, "CharLiteral": 1, "StringLiteral": 1, "SymbolLiteral": 1, "RegexLiteral": 1, "MetaVar": 1, "InstanceVar": 1, "ClassVar": 1, "Global": 1, "Require": 1, "Path": 1, "Self": 1, "LibDef": 1, "FunDef": 1, "body": 1, "body.transform": 1, "TypeDef": 1, "StructDef": 1, "UnionDef": 1, "EnumDef": 1, "ExternalVar": 1, "IndirectRead": 1, "IndirectWrite": 1, "TypeOf": 1, "Primitive": 1, "Not": 1, "TypeFilteredNode": 1, "TupleLiteral": 1, "Cast": 1, "DeclareVar": 1, "node.var": 1, "node.var.transform": 1, "node.declared_type": 1, "node.declared_type.transform": 1, "Alias": 1, "TupleIndexer": 1, "Attribute": 1, "exps.map": 1 }, "Csound": { "sr": 3, "kr": 3, "ksmps": 3, "nchnls": 3, ";": 8, "pvanal": 5, "-": 22, "n": 7, "w": 5, "allglass1": 4, "L.wav": 2, "L.pvc": 2, "R.wav": 2, "R.pvc": 2, "instr": 12, "ktime": 3, "line": 2, "p3": 4, "arL": 2, "pvoc": 2, "arR": 2, "out": 3, "endin": 12, "...or": 1, "a": 3, "semicolon.": 1, "nchnls_i": 1, "0dbfs": 4, "N_a_M_e_": 1, "+": 6, "Name": 1, "aSignal": 9, "oscil": 2, "prints": 25, "comment": 1, "(": 19, ")": 19, "kNote": 3, "if": 7, "then": 4, "kFrequency": 4, "elseif": 1, "//": 2, "Parentheses": 1, "around": 1, "binary": 1, "expressions": 1, "are": 1, "optional.": 1, "endif": 2, "iIndex": 19, "while": 2, "<": 4, "do": 3, "print": 11, "od": 2, "until": 1, "enduntil": 1, "{": 6, "hello": 1, "world": 1, "}": 6, "outc": 2, "opcode": 1, "anOscillator": 2, "kk": 1, "kAmplitude": 2, "xin": 1, "vco2": 1, "xout": 1, "endop": 1, "TestOscillator": 1, "pyruni": 1, "import": 1, "random": 1, "pool": 4, "[": 2, "i": 12, "/": 1, "**": 1, "for": 1, "in": 1, "range": 1, "]": 2, "def": 1, "get_number_from_pool": 1, "p": 2, "random.random": 2, "int": 1, "*": 1, "len": 1, "return": 1, "random.choice": 1, "#ifdef": 1, "DEBUG": 2, "#undef": 1, "#include": 1, "#endif": 2, "#define": 5, "A_HZ": 1, "#440#": 1, "OSCIL_MACRO": 4, "VOLUME": 5, "TABLE": 2, "#oscil": 3, "FREQUENCY": 3, "TABLE#": 3, "TestMacro": 1, "TestBitwiseNOT": 1, "TestBitwiseXOR": 1, "#": 4, "TestGoto": 1, "goto": 4, "if_label": 2, "else_label": 2, "endif_label": 2, "else": 1, "loop_label": 2, "loop_lt_label": 2, "loop_lt": 1, "TestPrints": 1, "VOLUME#FREQUENCY#TABLE": 1, "TestMacroPeriodSuffix": 1, "OSCIL_MACRO.": 1, "TestAt": 1, "@0": 1, "@@0": 1, "@1": 1, "@@1": 1, "@2": 1, "@@2": 1, "@3": 1, "@@3": 1, "@4": 1, "@@4": 1, "@5": 1, "@@5": 1, "@6": 1, "@@6": 1, "@7": 1, "@@7": 1, "@8": 1, "@@8": 1, "@9": 1, "@@9": 1, "MacroAbuse": 1, "FOO#": 1, "BAR": 1, "This": 1, "ends": 1, "the": 1, "block.": 1, "It": 1, "is": 1, "not": 1, "preprocessor": 1, "directive.": 1, "scoreline_i": 1, "f": 1, "e": 1, "partA": 4, "partB.wav": 1, "partB.pvc": 1, "iscale": 1, "ktimpnt1": 3, "iscale*": 2, "82196/44100": 2, "ktimpnt2": 3, "linseg": 6, "iscale*1.25": 1, "103518/44100": 2, "kfreqscale": 3, "iscale*0.5": 3, "iscale*1.6": 3, "kfreqinterpL": 2, "iscale*0.25": 2, "kampinterpL": 2, "kfreqinterpR": 2, "iscale*1.2": 2, "kampinterpR": 2, "pvbufread": 2, "apvcL": 1, "pvinterp": 2, "apvcR": 1, "outs": 1, "apvcL*0.8": 1, "apvcR*0.8": 1 }, "Csound Document": { "": 3, "": 3, "sr": 3, "kr": 3, "ksmps": 3, "nchnls": 3, ";": 8, "pvanal": 5, "-": 22, "n": 7, "w": 5, "partA": 4, "L.wav": 2, "L.pvc": 2, "R.wav": 2, "R.pvc": 2, "partB.wav": 1, "partB.pvc": 1, "instr": 12, "iscale": 1, "ktimpnt1": 3, "line": 2, "iscale*": 2, "(": 19, "82196/44100": 2, ")": 19, "ktimpnt2": 3, "linseg": 6, "iscale*1.25": 1, "103518/44100": 2, "kfreqscale": 3, "iscale*0.5": 3, "iscale*1.6": 3, "kfreqinterpL": 2, "iscale*0.25": 2, "kampinterpL": 2, "kfreqinterpR": 2, "iscale*1.2": 2, "kampinterpR": 2, "pvbufread": 2, "apvcL": 1, "pvinterp": 2, "apvcR": 1, "outs": 1, "apvcL*0.8": 1, "apvcR*0.8": 1, "endin": 12, "": 3, "": 3, "i": 14, "e": 3, "": 3, "": 3, "...or": 1, "a": 3, "semicolon.": 1, "nchnls_i": 1, "0dbfs": 4, "N_a_M_e_": 1, "+": 6, "Name": 1, "aSignal": 9, "oscil": 2, "prints": 25, "comment": 1, "kNote": 3, "p3": 4, "if": 7, "then": 4, "kFrequency": 4, "elseif": 1, "//": 2, "Parentheses": 1, "around": 1, "binary": 1, "expressions": 1, "are": 1, "optional.": 1, "endif": 2, "iIndex": 19, "while": 2, "<": 4, "do": 3, "print": 11, "od": 2, "until": 1, "enduntil": 1, "{": 4, "hello": 1, "world": 1, "}": 4, "outc": 2, "opcode": 1, "anOscillator": 2, "kk": 1, "kAmplitude": 2, "xin": 1, "vco2": 1, "xout": 1, "endop": 1, "TestOscillator": 1, "pyruni": 1, "import": 1, "random": 1, "pool": 4, "[": 2, "/": 1, "**": 1, "for": 1, "in": 1, "range": 1, "]": 2, "def": 1, "get_number_from_pool": 1, "p": 2, "random.random": 2, "int": 1, "*": 1, "len": 1, "return": 1, "random.choice": 1, "#ifdef": 1, "DEBUG": 2, "#undef": 1, "#include": 1, "#endif": 2, "#define": 5, "A_HZ": 1, "#440#": 1, "OSCIL_MACRO": 4, "VOLUME": 5, "TABLE": 2, "#oscil": 3, "FREQUENCY": 3, "TABLE#": 3, "TestMacro": 1, "out": 3, "TestBitwiseNOT": 1, "TestBitwiseXOR": 1, "#": 4, "TestGoto": 1, "goto": 4, "if_label": 2, "else_label": 2, "endif_label": 2, "else": 1, "loop_label": 2, "loop_lt_label": 2, "loop_lt": 1, "TestPrints": 1, "VOLUME#FREQUENCY#TABLE": 1, "TestMacroPeriodSuffix": 1, "OSCIL_MACRO.": 1, "TestAt": 1, "@0": 1, "@@0": 1, "@1": 1, "@@1": 1, "@2": 1, "@@2": 1, "@3": 1, "@@3": 1, "@4": 1, "@@4": 1, "@5": 1, "@@5": 1, "@6": 1, "@@6": 1, "@7": 1, "@@7": 1, "@8": 1, "@@8": 1, "@9": 1, "@@9": 1, "MacroAbuse": 1, "FOO#": 1, "BAR": 1, "This": 1, "ends": 1, "the": 1, "block.": 1, "It": 1, "is": 1, "not": 1, "preprocessor": 1, "directive.": 1, "f": 1, "allglass1": 4, "ktime": 3, "arL": 2, "pvoc": 2, "arR": 2 }, "Csound Score": { "i": 10, "e": 3, "f": 1 }, "Cuda": { "__global__": 2, "void": 3, "scalarProdGPU": 1, "(": 20, "float": 8, "*d_C": 1, "*d_A": 1, "*d_B": 1, "int": 14, "vectorN": 2, "elementN": 3, ")": 20, "{": 8, "//Accumulators": 1, "cache": 1, "__shared__": 1, "accumResult": 5, "[": 11, "ACCUM_N": 4, "]": 11, ";": 30, "for": 5, "vec": 5, "blockIdx.x": 2, "<": 5, "+": 12, "gridDim.x": 1, "vectorBase": 3, "IMUL": 1, "vectorEnd": 2, "iAccum": 10, "threadIdx.x": 4, "blockDim.x": 3, "sum": 3, "pos": 5, "d_A": 2, "*": 2, "d_B": 2, "}": 8, "stride": 5, "/": 2, "__syncthreads": 1, "if": 3, "d_C": 2, "#include": 2, "": 1, "": 1, "vectorAdd": 2, "const": 2, "*A": 1, "*B": 1, "*C": 1, "numElements": 4, "i": 5, "C": 1, "A": 1, "B": 1, "main": 1, "cudaError_t": 1, "err": 5, "cudaSuccess": 2, "threadsPerBlock": 4, "blocksPerGrid": 1, "-": 1, "<<": 1, "": 1, "cudaGetLastError": 1, "fprintf": 1, "stderr": 1, "cudaGetErrorString": 1, "exit": 1, "EXIT_FAILURE": 1, "cudaDeviceReset": 1, "return": 1 }, "Cycript": { "(": 246, "function": 18, "utils": 2, ")": 246, "{": 70, "var": 80, "shouldLoadCFuncs": 2, "true": 7, ";": 189, "shouldExposeCFuncs": 2, "shouldExposeConsts": 2, "shouldExposeFuncs": 2, "funcsToExpose": 2, "[": 47, "]": 47, "CFuncsDeclarations": 3, "utils.exec": 4, "str": 13, "mkdir": 2, "@encode": 28, "int": 11, "const": 13, "char": 17, "*": 37, "dlsym": 13, "RTLD_DEFAULT": 13, "tempnam": 2, "fopen": 2, "void": 17, "fclose": 2, "fwrite": 2, "symlink": 2, "unlink": 3, "getenv": 2, "setenv": 3, "libdir": 3, "dir": 4, "+": 45, "old_tmpdir": 2, "f": 7, "if": 32, "return": 29, "false": 5, "}": 70, "handle": 3, "str.length": 1, "r": 6, "except": 4, "null": 11, "try": 3, "require": 1, "f.replace": 1, "catch": 3, "e": 3, "throw": 4, "r.result": 1, "utils.applyTypedefs": 5, "typedefs": 3, "for": 7, "k": 6, "in": 3, "str.replace": 1, "new": 7, "RegExp": 1, "utils.include": 3, "load": 3, "re": 1, "/": 6, "s*": 6, "s": 3, "|": 7, "w*": 1, "match": 10, "re.exec": 1, "-": 10, "rType": 2, "name": 11, "args": 8, "argsRe": 1, "/g": 3, "argsTypes": 1, "while": 2, "argsRe.exec": 1, "type": 12, "argsTypes.push": 1, "encodeString": 6, "argsTypes.join": 1, "fun": 9, "else": 3, "utils.funcs": 2, "utils.loadfuncs": 2, "expose": 2, "i": 20, "<": 4, "CFuncsDeclarations.length": 1, "o": 5, "Cycript.all": 3, "system.print": 2, "e2": 1, "utils.sizeof": 4, "typeof": 5, "type.toString": 4, ".slice": 1, "float": 1, ".toString": 4, "double": 4, "typeInstance": 3, "instanceof": 2, "Object": 1, "typeInstance.length": 1, "typeInstance.type": 1, "typeInstance.toString": 1, "typeStr": 6, "arrayTypeStr": 2, "arrayType": 2, "Type": 2, "arrayInstance": 3, "&": 6, "maxSigned": 4, "Math.pow": 3, "utils.logify": 1, "cls": 3, "sel": 2, "@import": 2, "com.saurik.substrate.MS": 1, "org.cycript.NSLog": 1, "oldm": 4, "MS.hookMessage": 1, ".slice.call": 1, "arguments": 2, "selFormat": 2, "sel.toString": 1, ".replace": 1, ".trim": 1, "logFormat": 2, "standardArgs": 1, "class_isMetaClass": 1, "cls.toString": 1, "this": 2, ".valueOf": 1, "logArgs": 2, "standardArgs.concat": 1, "NSLog.apply": 1, "apply": 1, "undefined": 1, "NSLog": 1, "utils.apply": 5, "Array": 1, "argc": 2, "args.length": 1, "voidPtr": 7, "argTypes": 2, "argType": 4, "arg": 4, "&&": 2, "%": 1, "argTypes.push": 1, "voidPtr.functionWith.apply": 1, ".apply": 1, "utils.str2voidPtr": 1, "strdup": 4, "utils.voidPtr2str": 1, "utils.double2voidPtr": 1, "n": 3, "doublePtr": 3, "*doublePtr": 2, "voidPtrPtr": 3, "**": 6, "*voidPtrPtr": 2, "utils.voidPtr2double": 1, "utils.isMemoryReadable": 3, "ptr": 3, "fds": 5, "result": 2, "utils.isObject": 1, "obj": 21, "lastObj": 5, "objc_isa_ptr": 5, "objc_debug_isa_class_mask": 2, "ptrValue": 5, "obj.valueOf": 1, "foundMetaClass": 3, "*@encode": 1, "break": 1, "||": 1, "obj_class": 4, "metaclass": 2, "superclass": 2, "utils.makeStruct": 1, "fieldRe": 1, "Math.floor": 1, "Math.random": 1, "fieldRe.exec": 1, "fieldType": 2, "fieldName": 2, "encodedType": 2, "utils.constants": 2, "VM_PROT_NONE": 1, "VM_PROT_READ": 1, "VM_PROT_WRITE": 1, "VM_PROT_EXECUTE": 1, "VM_PROT_NO_CHANGE": 1, "VM_PROT_COPY": 1, "VM_PROT_WANTS_COPY": 1, "VM_PROT_IS_MASK": 1, "c": 3, "c.VM_PROT_DEFAULT": 1, "c.VM_PROT_READ": 2, "c.VM_PROT_WRITE": 2, "c.VM_PROT_ALL": 1, "c.VM_PROT_EXECUTE": 1, "funcsToExpose.length": 1, "exports": 1 }, "D": { "import": 8, "std.stdio": 2, ";": 360, "void": 19, "main": 2, "(": 403, ")": 409, "{": 113, "writeln": 1, "}": 113, "template": 4, "Fib": 5, "size_t": 28, "N": 12, "static": 12, "if": 30, "<": 9, "enum": 20, "else": 8, "-": 109, "+": 23, "foo": 1, "unittest": 5, "module": 2, "core.aa": 1, "core.memory": 1, "GC": 1, "private": 4, "GROW_NUM": 6, "GROW_DEN": 7, "SHRINK_NUM": 5, "SHRINK_DEN": 6, "GROW_FAC": 5, "assert": 17, "*": 42, "INIT_NUM": 1, "/": 12, "INIT_DEN": 1, "HASH_EMPTY": 2, "HASH_DELETED": 3, "HASH_FILLED_MARK": 2, "<<": 17, "size_t.sizeof": 1, "INIT_NUM_BUCKETS": 5, "struct": 7, "AA": 11, "Key": 13, "Val": 12, "this": 16, "sz": 6, "impl": 14, "new": 11, "Impl": 8, "nextpow2": 3, "@property": 8, "bool": 7, "empty": 4, "const": 28, "pure": 17, "nothrow": 17, "@safe": 2, "@nogc": 13, "return": 53, "length": 5, "is": 6, "null": 10, "impl.length": 1, "opIndexAssign": 1, "val": 10, "in": 18, "key": 27, "immutable": 8, "hash": 28, "calcHash": 6, "auto": 23, "p": 18, "impl.findSlotLookup": 3, "p.entry.val": 6, "findSlotInsert": 7, "p.deleted": 3, "deleted": 10, "used": 7, "dim": 14, "grow": 4, "p.empty": 3, "firstUsed": 8, "min": 6, "cast": 14, "uint": 35, "buckets.ptr": 3, "p.hash": 4, "p.entry": 4, "Impl.Entry": 3, "//": 8, "TODO": 2, "move": 2, "ref": 7, "inout": 16, "opIndex": 3, "@trusted": 3, "opIn_r": 3, "*p": 2, "findSlotLookup": 3, "&": 20, "remove": 1, "false": 2, "shrink": 2, "true": 1, "get": 1, "lazy": 2, "getOrSet": 1, "[": 82, "]": 82, "toBuiltinAA": 1, "_aaFromCoreAA": 2, "rtInterface": 2, "this.impl": 1, "getLValue": 1, "buckets": 10, "allocBuckets": 3, "buckets.length": 1, "mask": 5, "Bucket": 5, "for": 4, "i": 18, "j": 6, ".filled": 1, ".hash": 1, "&&": 3, ".entry.key": 1, ".empty": 1, "resize": 4, "ndim": 2, "obuckets": 2, "foreach": 12, "b": 12, "b.filled": 1, "*findSlotInsert": 1, "b.hash": 1, "GC.free": 1, "obuckets.ptr": 1, "safe": 1, "to": 2, "free": 3, "b/c": 1, "impossible": 1, "reference": 1, "Entry": 1, "Entry*": 1, "entry": 1, "filled": 1, "ptrdiff_t": 1, "attr": 2, "GC.BlkAttr.NO_INTERIOR": 1, "Bucket.sizeof": 1, "Bucket*": 1, "GC.calloc": 1, "..": 6, "RTInterface*": 3, "aaLen": 2, "void*": 14, "pimpl": 7, "aa": 18, "aa.length": 5, "aaGetY": 2, "void**": 1, "pkey": 9, "Impl*": 3, "*pimpl": 2, "res": 4, "aa.getLValue": 1, "aa.impl": 1, "might": 1, "have": 1, "changed": 1, "aaInX": 2, "aa.opIn_r": 1, "aaDelX": 2, "aa.remove": 1, "vtbl": 2, "RTInterface": 2, "hashOf": 1, "|": 12, "alias": 6, "package": 1, "extern": 3, "C": 2, "rtIntf": 1, "function": 4, "len": 5, "AA*": 1, "getY": 1, "inX": 1, "delX": 1, "int": 33, "core.stdc.stdio": 1, "rtaa": 4, "aa.toBuiltinAA": 1, "rtaa.length": 1, "puts": 1, "n": 8, "core.bitop": 1, "bsr": 2, "pow2": 2, "T": 24, "a": 15, "max": 1, "mpq": 1, "std.string": 2, "format": 3, "and": 1, "toStringz": 3, "std.traits": 1, "ParameterTypeTuple": 2, "long": 2, "off_t": 15, "LIBMPQ_ERROR_OPEN": 1, "LIBMPQ_ERROR_CLOSE": 1, "LIBMPQ_ERROR_SEEK": 1, "LIBMPQ_ERROR_READ": 1, "LIBMPQ_ERROR_WRITE": 1, "LIBMPQ_ERROR_MALLOC": 1, "LIBMPQ_ERROR_FORMAT": 1, "LIBMPQ_ERROR_NOT_INITIALIZED": 1, "LIBMPQ_ERROR_SIZE": 1, "LIBMPQ_ERROR_EXIST": 2, "LIBMPQ_ERROR_DECRYPT": 1, "LIBMPQ_ERROR_UNPACK": 1, "mpq_archive_s": 22, "char": 24, "*libmpq__version": 1, "libmpq__archive_open": 1, "**mpq_archive": 1, "*mpq_filename": 1, "archive_offset": 1, "libmpq__archive_close": 1, "*mpq_archive": 19, "libmpq__archive_packed_size": 1, "*packed_size": 2, "libmpq__archive_unpacked_size": 1, "*unpacked_size": 3, "libmpq__archive_offset": 1, "*offset": 2, "libmpq__archive_version": 1, "*version_": 1, "libmpq__archive_files": 1, "*files": 1, "libmpq__file_packed_size": 1, "file_number": 12, "libmpq__file_unpacked_size": 1, "libmpq__file_offset": 1, "libmpq__file_blocks": 1, "*blocks": 1, "libmpq__file_encrypted": 1, "*encrypted": 1, "libmpq__file_compressed": 1, "*compressed": 1, "libmpq__file_imploded": 1, "*imploded": 1, "libmpq__file_number": 1, "*filename": 1, "*number": 1, "libmpq__file_read": 1, "ubyte": 5, "*out_buf": 2, "out_size": 2, "*transferred": 2, "libmpq__block_open_offset": 1, "libmpq__block_close_offset": 1, "libmpq__block_unpacked_size": 1, "block_number": 2, "libmpq__block_read": 1, "class": 3, "MPQException": 5, "Exception": 1, "string": 6, "Errors": 2, "public": 1, "errno": 7, "fnname": 2, "this.errno": 1, "Errors.length": 1, "super": 1, "std.string.format": 1, "MPQ_CHECKERR": 1, "Fn": 4, "args": 2, "result": 4, "throw": 2, ".stringof": 1, "MPQ_FUNC": 22, "func_name": 3, "libmpq__version": 1, "libversion": 1, "mixin": 35, "MPQ_A_GET": 7, "type": 6, "name": 7, "name2": 4, "Archive": 4, "*m": 1, "File": 6, "listfile": 5, "listfiledata": 5, "archivename": 2, "offset": 2, "archive_open": 1, "m": 3, "archive_close": 1, "mpq_archive_s*": 2, "archive": 1, "fname": 2, "fno": 2, "filelist": 1, "try": 2, "listfile.read": 2, ".splitlines": 2, "catch": 2, "e": 2, "filenumber": 1, "filename": 6, "MPQ_F_GET": 9, "am": 3, "fileno": 8, "this.a": 2, "this.am": 2, "a.archive": 2, "a.files": 1, "this.filename": 2, "this.fileno": 2, "mpq.file_number": 1, "no": 1, "read": 1, "content": 2, "content.length": 3, "this.unpacked_size": 1, "trans": 3, "mpq.file_read": 1, "content.ptr": 1, "bar": 1, "t": 1, "core.cpuid": 1, "std.algorithm": 1, "std.datetime": 1, "std.meta": 1, "std.range": 1, "float": 7, "getLatencies": 2, "op": 12, "T.sizeof": 8, "Array": 7, "c": 4, "latencies": 6, "float.max": 2, "latency": 6, "_": 2, "sw": 2, "StopWatch": 2, "AutoStart.yes": 2, "off": 8, "op.replace": 2, ".replace": 6, "sw.peek.nsecs": 2, "getThroughput": 2, "lengths": 3, ".sizeof": 1, "nsecs": 2, "runMasked": 3, "throughputs": 3, "genOps": 2, "ops": 6, "op1": 5, "op2": 3, "runOp": 2, "AliasSeq": 1, "ushort": 1, "ulong": 1, "byte": 1, "short": 1, "double": 1, "writefln": 2, "T.stringof": 1, "core.stdc.stdlib": 1, "malloc": 2, "ary": 3, "T*": 1, "ary.ptr": 1, "version": 5, "X86": 1, "SSE": 3, "X86_64": 1, "mxcsr": 9, "ret": 3, "asm": 2, "stmxcsr": 1, "ldmxcsr": 1, "FPU_EXCEPTION_MASKS": 3, "FPU_EXCEPTION_FLAGS": 3, "maskFPUExceptions": 3, "unmaskFPUExceptions": 3, "FPUExceptionFlags": 2, "clearFPUExceptionFlags": 2, "scope": 1, "delegate": 1, "dg": 2, "iota": 1, ".map": 1, ".format": 1 }, "DIGITAL Command Language": { "Compiling": 2, "with": 8, "VAXC": 1, "is": 15, "said": 1, "to": 25, "work": 8, "but": 2, "it": 9, "requires": 2, "the": 45, "usual": 1, "cruft": 1, "(": 270, "vaxcrtl": 1, "and": 15, "all": 4, ")": 265, "avoid": 1, "hair": 1, "we": 3, "don": 2, "CC/DECC/PREFIX": 3, "VMSBACKUP.C/DEFINE": 1, "HAVE_MT_IOCTLS": 1, "HAVE_UNIXIO_H": 1, "DCLMAIN.C": 1, "Probably": 1, "t": 1, "implement": 1, "VMS": 3, "-": 1474, "style": 1, "matching": 1, "I": 5, "haven": 1, "match": 1, "LINK/exe": 1, "VMSBACKUP.EXE": 1, "vmsbackup.obj": 1, "dclmain.obj": 1, "match.obj": 1, "sys": 64, "input/opt": 1, "identification": 1, "BUILD_XSLT.COM": 1, "Build": 3, "XSLT": 1, "library": 17, "Arguments": 1, "p1": 4, "you": 4, "want": 1, "build": 5, "debug": 4, "This": 4, "package": 3, "libxml": 4, "have": 2, "already": 1, "been": 2, "installed.": 1, "You": 1, "need": 2, "ensure": 1, "that": 2, "logical": 2, "name": 8, "LIBXML": 3, "defined": 3, "points": 1, "directory": 7, "containing": 2, "procedure": 2, "creates": 1, "object": 2, "libraries": 2, "XML_LIBDIR": 9, "LIBXSLT.OLB": 1, "LIBEXSLT.OLB": 1, "program": 5, "XSLTPROC": 3, "After": 1, "built": 4, "can": 1, "link": 9, "these": 1, "routines": 2, "into": 6, "your": 2, "code": 2, "command": 7, "LINK": 2, "your_modules": 1, "LIBEXSLT/LIB": 1, "LIBXSLT/LIBRARY": 1, "LIBXML/LIB": 1, "Change": 1, "History": 1, "Command": 2, "file": 11, "author": 1, "John": 1, "A": 1, "Fotheringham": 1, "jaf@jafsoft.com": 1, "Last": 1, "update": 3, "Nov": 1, "configuration": 4, "compile": 3, "command.": 1, "cc_opts": 1, "if": 123, "p1.eqs.": 1, "then": 124, "cc_command": 3, "else": 27, "endif": 70, "configure": 3, "multiple": 2, "passes": 2, "for": 23, "each": 5, "library.": 2, "For": 1, "pass": 6, "of": 18, "or": 6, "module": 7, "being": 2, "created": 2, "list": 2, "sources": 2, "be": 5, "should": 1, "compared": 1, "definition": 1, "in": 12, "MAKEFILE.IN": 1, "corresponding": 1, "directory.": 1, "num_passes": 1, "two": 1, "a": 14, "LIBXSLT": 1, "libname_1": 1, "h_file_1": 1, "progname_1": 1, "see": 3, "[": 14, ".libxslt": 1, "]": 14, "makefile.in": 6, "src_1": 7, "+": 52, "LIBEXSLT": 1, "libname_2": 1, "h_file_2": 1, "progname_2": 1, ".libexslt": 1, "src_2": 1, "libname_3": 1, "h_file_3": 1, "progname_3": 1, ".xsltproc": 1, "src_3": 1, "set": 13, "up": 6, "check": 2, "logicals": 2, "XML_SRCDIR": 2, "top": 1, "level": 1, "needed": 4, "config.h": 1, "trio.h": 1, "source": 4, ".h": 2, "files": 1, "f": 164, "trnlnm": 14, ".eqs.": 38, "on": 17, "error": 11, "continue": 6, "globfile": 12, "search": 13, "globfile.eqs.": 5, "write": 99, "output": 55, "exit": 9, "srcdir": 4, "parse": 10, "define/process": 5, "look": 3, "globals.h": 1, "installed": 1, "paralle": 1, "this": 5, "one": 3, "element": 17, "some": 1, "working": 1, "pass_no": 6, "set_pass_logical": 2, "pass_no.le.num_passes": 2, "Libname": 2, "libname_": 2, "progname": 2, "progname_": 2, "libname.nes.": 5, "logname": 4, "findfile": 1, "src_": 2, "target": 3, "parallel": 2, "subdirectory": 2, "h_file": 1, "h_file_": 1, "includedir": 1, "goto": 40, "handling": 3, "such": 1, "as": 5, "exit_status": 2, "saved_default": 1, "environment": 2, "ERROR_OUT": 3, "control_y": 1, "start_here": 2, "move": 2, "line": 29, "debug/rerun": 1, "parts": 1, "modules": 1, "make": 7, "three": 1, "pass_loop": 2, "pass_description": 2, "src": 4, "create": 5, "library/create": 1, ".OLB": 1, "def": 2, "define": 5, "commands": 1, "not": 7, "used": 3, "lib_command": 3, "link_command": 3, "s_no": 3, "edit": 15, "source_loop": 2, "next_source": 1, "S_no": 1, "next_source.nes.": 2, ".and.": 8, "call": 15, "Th": 1, "th": 6, "EXIT_OUT": 2, "status": 6, "BUILD": 2, "subroutine.": 1, "Compile": 1, "insert": 2, "required": 5, "subroutine": 1, "warning": 2, "EXIT_BUILD": 2, "source_file": 3, "object_file": 1, "fao": 17, "p2": 2, "/object": 1, "lib_command.nes.": 1, "delete/nolog": 4, ";": 17, "*": 13, "link_command.nes.": 1, "text": 3, "lose": 1, "dbgopts": 2, "libexslt/lib": 1, "libxslt/lib": 1, "libxml/library": 1, "endsubroutine": 2, "libz": 1, "under": 2, "written": 1, "by": 5, "Martin": 1, "P.J.": 1, "Zinser": 1, "In": 1, "case": 1, "problems": 1, "install": 1, "might": 3, "contact": 1, "me": 1, "at": 1, "zinser@zinser.no": 1, "ip.info": 1, "preferred": 1, "martin.zinser@eurexchange.com": 1, "Make": 9, "history": 8, "Zlib": 2, "Version": 7, "First": 7, "version": 12, "receive": 5, "number": 6, "Adapt": 1, "new": 4, "Makefile.in": 1, "Add": 5, "support": 1, "large": 1, "gzclose": 1, "gzlib": 1, "gzread": 1, "gzwrite": 1, "Exchange": 1, "zlibdefs.h": 1, "zconf.h.in": 1, "Fix": 1, "missing": 2, "amiss_err": 1, "zconf_h.in": 1, "fix": 1, "exmples": 1, "subdir": 1, "path": 1, "Triggered": 1, "done": 1, "Alexey": 1, "Chupahin": 1, "completly": 1, "redesigned": 1, "shared": 2, "image": 5, "creation": 1, "VAX": 2, "again": 1, "pre": 2, "load": 2, "symbols": 2, "SMS.": 3, "P1": 7, "sets": 1, "builder": 1, ".": 1, "automatic": 1, "preference": 1, "MMK": 2, "MMS": 1, "in.": 1, "err_exit": 5, "true": 12, "false": 16, "tmpnam": 4, "getjpi": 1, "tt": 1, "tc": 1, "define/nolog": 2, "tconfig": 1, "its_decc": 9, "its_vaxc": 8, "its_gnuc": 7, "s_case": 3, "False": 1, "Setup": 1, "variables": 1, "holding": 1, "information": 1, "v_string": 2, "v_file": 1, "ccopt": 14, "lopts": 6, "dnsrl": 1, "aconf_in_file": 2, "conf_check_string": 1, "linkonly": 2, "optfile": 1, "mapfile": 1, "libdefs": 7, "vax": 2, "getsyi": 5, ".lt.1024": 1, "axp": 5, ".ge.1024": 1, ".lt.4096": 1, "ia64": 4, ".ge.4096": 1, "Why": 3, "And": 2, "why": 2, "simply": 2, ".or.": 16, "proc/parse": 1, "extended": 1, "whoami": 5, "mydef": 1, "F": 28, "mydir": 1, "myproc": 1, "Check": 6, "MMK/MMS": 1, "If": 11, "Search": 4, ".nes.": 24, "Then": 9, "Type": 1, "gosub": 11, "find_version": 1, "open/write": 7, "topt": 7, "tmp.opt": 2, "optf": 7, "check_opts": 1, "Look": 2, "compiler": 6, "check_compiler": 1, "close": 10, "decc": 3, "library_include": 1, "/NAMES": 1, "AS_IS": 1, "fake": 1, "input": 4, "header": 1, "conf_hin": 3, "config.hin": 1, "i": 19, "FIND_ACONF": 1, "fname": 3, "AMISS_ERR": 2, "find_aconf": 1, "open/read/err": 1, "aconf_err": 1, "aconf_in": 4, "aconf": 24, "zconf.h": 33, "ACONF_LOOP": 1, "read/end_of_file": 1, "aconf_exit": 1, "extract": 14, "cdef": 18, "check_config": 1, "aconf_loop": 1, "ACONF_EXIT": 1, "delete": 4, "thing": 1, "plain": 1, "mms": 1, "make.eqs.": 1, "example.obj": 4, "minigzip.obj": 4, "CALL": 18, "MAKE": 19, "adler32.OBJ": 1, "adler32.c": 2, "zlib.h": 32, "compress.OBJ": 1, "compress.c": 2, "crc32.OBJ": 1, "crc32.c": 2, "deflate.OBJ": 1, "deflate.c": 2, "deflate.h": 4, "zutil.h": 24, "gzclose.OBJ": 1, "gzclose.c": 2, "gzlib.OBJ": 1, "gzlib.c": 2, "gzread.OBJ": 1, "gzread.c": 2, "gzwrite.OBJ": 1, "gzwrite.c": 2, "infback.OBJ": 1, "infback.c": 2, "inftrees.h": 5, "inflate.h": 2, "inffast.h": 4, "inffixed.h": 2, "inffast.OBJ": 1, "inffast.c": 2, "inflate.OBJ": 1, "inflate.c": 2, "infblock.h": 1, "inftrees.OBJ": 1, "inftrees.c": 2, "trees.OBJ": 1, "trees.c": 2, "uncompr.OBJ": 1, "uncompr.c": 2, "zutil.OBJ": 1, "zutil.c": 2, "libz.OLB": 1, "*.OBJ": 1, "example.OBJ": 1, ".test": 4, "example.c": 2, "example.exe": 2, "libz.olb": 7, "minigzip.OBJ": 1, "minigzip.c": 2, "minigzip.exe": 2, "crea_mms": 1, "Create": 5, "shareable": 3, "crea_olist": 2, "map_2_shopt": 1, "LINK_": 1, "/SHARE": 1, "libzshr.exe": 1, "modules.opt/opt": 1, "/opt": 1, "CC_ERR": 2, "ERR_EXIT": 1, "message/facil/ident/sever/text": 1, "close/nolog": 14, "out": 9, "min": 5, "mod": 4, "h_in": 4, "SUBROUTINE": 3, "TO": 1, "CHECK": 1, "DEPENDENCIES": 1, "V": 2, "What": 2, "are": 2, "trying": 1, "P2": 2, "P3": 1, "P8": 1, "depends": 1, ".Eqs.": 5, "Goto": 9, "Makeit": 3, "Time": 2, "CvTime": 2, "File": 5, "arg": 4, "Loop": 2, "Argument": 3, "P": 1, "Exit": 4, "El": 4, "Loop2": 2, "Element": 1, "Endl": 1, "AFile": 6, "Loop3": 2, "OFile": 2, ".Or.": 1, "NextEl": 1, ".Ges.": 1, "NextEL": 1, "EndL": 1, ".Le.": 1, "VV": 2, "VERIFY": 2, "Set": 1, "Verify": 1, "ENDSUBROUTINE": 2, "options": 2, "accordingly": 1, "CHECK_OPTS": 1, "OPT_LOOP": 1, ".lt.": 17, "cparm": 25, "p": 1, "parameter": 1, "actually": 1, "contains": 3, "something": 1, "locate": 20, "length": 24, "start": 12, "len": 8, "cc_com": 7, "mmks": 4, "bhelp": 1, "opt_loop": 1, "return": 11, "Save/set": 1, "value": 2, "no_rooted_search_lists": 2, "Extend": 1, "GNU": 1, "C": 2, "Compaq": 1, "hp": 1, "CHECK_COMPILER": 1, ".not.": 10, "no": 1, "available": 3, "dnrsl": 1, "cc": 3, "MMS/MMK": 1, "dump": 1, "descrip.mms": 3, "CREA_MMS": 1, "open/append": 4, "copy": 3, "deck": 3, "OBJS": 2, "adler32.obj": 2, "compress.obj": 2, "crc32.obj": 2, "gzclose.obj": 2, "gzlib.obj": 2, "gzread.obj": 2, "gzwrite.obj": 2, "uncompr.obj": 2, "infback.obj": 2, "deflate.obj": 2, "trees.obj": 2, "zutil.obj": 2, "inflate.obj": 2, "inftrees.obj": 2, "inffast.obj": 2, "eod": 3, "@": 4, "LOPTS": 2, "example": 1, "libz.olb/lib": 2, "minigzip": 1, "clean": 1, "*.obj": 1, "*.opt": 1, "*.exe": 1, "Read": 1, "core": 1, "from": 6, "CREA_OLIST": 1, "open/read": 5, "modules.opt": 1, "src_check_list": 2, "MRLOOP": 1, "read/end": 7, "mrdone": 2, "rec": 14, "SRC_CHECK_LOOP": 1, "src_check": 4, "mrloop": 1, "src_check_loop": 1, "extra_filnam": 2, "MRSLOOP": 1, "MRDONE": 1, "Take": 1, "record": 1, "extracted": 1, "split": 1, "single": 1, "filenames": 1, "EXTRA_FILNAM": 1, "myrec": 2, "trim": 1, "compress": 1, "FELOOP": 1, "srcfil": 3, "feloop": 1, "Find": 1, "current": 1, "FIND_VERSION": 1, "hloop": 4, "hdone": 3, "CHECK_CONFIG": 1, "in_ldef": 5, "type": 13, "check_cc_def": 1, "relating": 1, "properties": 3, "C/C": 3, "CHECK_CC_DEF": 1, "#include": 2, "#define": 1, "_LARGEFILE": 1, "": 1, "int": 1, "main": 1, "{": 1, "FILE": 1, "*fp": 1, "fp": 3, "fopen": 1, "fseeko": 1, "SEEK_SET": 1, "fclose": 1, "}": 1, "test_inv": 2, "comm_h": 2, "cc_prop_check": 1, "Added": 1, "logic": 2, "defines": 1, "sure": 1, "local": 1, "config": 2, "gets": 1, "deleted": 1, "Also": 1, "include": 1, "run": 1, "processing": 1, "CC_PROP_CHECK": 1, "cc_prop": 10, "is_need": 4, ".eq.": 1, "The": 3, "headers": 2, "lie": 2, "about": 3, "capabilities": 2, "RTL": 2, "tmp.opt/opt": 2, "message/fac/ident/sever/text": 2, ".*": 2, "*/exclude": 1, "_yes": 6, "write_config": 11, "string": 1, "_no": 5, "result": 1, "values": 1, "Reconcile": 1, "changes": 1, "CC_MPROP_CHECK": 1, "idel": 4, "MT_LOOP": 1, "result_": 1, "_": 3, "mdef_": 5, "msym_clean": 2, "mt_loop": 1, "MSYM_CLEAN": 1, ".le.": 1, "msym_max": 1, "delete/sym": 1, "Write": 1, "both": 1, "permanent": 1, "temporary": 1, "WRITE_CONFIG": 1, "confh": 3, "Analyze": 1, "project": 1, "map": 5, "symbol": 1, "vector": 1, "MAP_2_SHOPT": 1, "Subroutine": 1, "SAY": 3, "IF": 45, "SEARCH": 1, ".EQS.": 8, "THEN": 49, "exit_m2s": 2, "ENDIF": 24, "module1": 1, "module2": 1, "module3": 1, "module4": 1, "aopt": 8, "a.opt": 3, "bopt": 8, "b.opt": 3, "mod_sym_num": 6, "MOD_SYM_LOOP": 1, "mod_in": 8, "MOD_SYM_IN": 1, "shared_proc": 22, "mod_sym_in": 1, "mod_sym_loop": 1, "MAP_LOOP": 1, "map_end": 1, "proc": 8, "map_loop": 2, "chop_semi": 6, "MAP_END": 1, "libopt": 9, "ALOOP": 1, "aloop_end": 1, "aloop": 1, "ALOOP_END": 1, "sv": 5, "BLOOP": 1, "bloop_end": 1, "svn": 2, "svn.nes.": 1, "sv.nes.": 1, "bloop": 1, "BLOOP_END": 1, "delete/nolog/noconf": 1, "VMOD_SYM_LOOP": 1, "VMOD_SYM_IN": 1, "vmod_sym_in": 1, "vmod_sym_loop": 1, "VMAP_LOOP": 1, "vmap_end": 1, "vmap_loop": 2, "VMAP_END": 1, "EXIT_M2S": 1, "Copyright": 1, "Fidelity": 1, "Information": 1, "Services": 1, "Inc": 1, "intellectual": 1, "property": 1, "its": 2, "copyright": 1, "holder": 1, "s": 1, "made": 1, "license.": 1, "do": 2, "know": 1, "terms": 1, "license": 1, "please": 1, "stop": 1, "read": 1, "further.": 1, "KITINSTAL.COM": 1, "PROCEDURE": 1, "FOR": 1, "THE": 1, "GT.M": 4, "PRODUCT": 1, "ON": 5, "CONTROL_Y": 4, "VMI": 58, "CALLBACK": 38, "WARNING": 1, "EXIT": 9, "STATUS": 2, "allow": 1, "errors": 1, "INSTALL": 10, "REPLACE": 1, "GOTO": 4, "POSTINSTALL": 3, "IVP": 6, "_UNSUPPORTED": 1, "TYPE": 4, "SYS": 20, "INPUT": 4, "c": 1, "COPYRIGHT": 1, "Sanchez": 1, "Computer": 1, "Associates": 1, "ALL": 1, "RIGHTS": 1, "RESERVED": 1, "following": 1, "lines": 1, "must": 3, "maintained": 3, "GTM": 132, "VMS_VERSION": 4, "Minimum": 1, "ALPHA": 3, "DISK_SPACE": 2, "Minumum": 2, "disk": 6, "space": 2, "system": 4, "ELSE": 12, "ELEMENT": 2, "VMS_IS": 4, ".LTS.": 1, "MESSAGE": 6, "E": 2, "VMSMISMATCH": 1, "_FAILURE": 4, "WRITE": 103, "OUTPUT": 8, ".GES.": 1, "T1": 17, "KIT_DEBUG": 1, "CHECK_NET_UTILIZATION": 1, "ROOM": 2, ".NOT.": 6, "NOSPACE": 1, "setup": 1, "default": 1, "answers": 1, "DOPURGE": 4, "YES": 15, "RUN_IVP": 7, "STD_CNF": 3, "DST_OWN": 6, "SYSTEM": 1, "IDENTIFIER": 1, ".EQ.": 1, "SYS_DST": 4, "DST_DIR": 9, "GTM_DIST": 1, "DST_CRE": 3, "DST_DEV": 4, "STARTDB": 5, "MGR_COM": 6, "HLP_DIR": 5, "NO": 2, "DEF_DCL": 5, "DEF_SYS": 5, "LNK_LOG": 6, "DEF_GLD": 5, "GBL_DIR": 2, "MUMPS.GLD": 1, "DEF_RTN": 6, "RTN_DIR": 2, "DIST": 3, "PCT_RTN": 7, "ASK": 20, "B": 15, "SET": 11, "PURGE": 2, "DST_LOG": 6, "COMMON": 6, "DIR_TYPE": 3, "Not": 2, "standard": 2, "S": 7, "USER": 1, ".OR.": 5, "tell": 1, "them": 1, "what": 1, "GTMINSTALL.COM": 3, "GTMLOGICALS.COM": 3, "GTMLOGIN.COM": 3, "GTMSTART.COM": 4, "GTMSTOP.COM": 1, "Each": 1, "own": 1, "user": 1, "documentation.": 1, "All": 1, "questions": 1, "asked.": 1, "Installation": 3, "now": 1, "proceeds": 1, "without": 1, "manual": 1, "intervention": 1, "minutes.": 1, "CREATE_DIRECTORY": 1, "RESTORE_SAVESET": 2, "CRECOM": 1, "OPEN": 6, "/WRITE": 6, "OUFILE": 109, "KWD": 9, "CLOSE": 6, "HLP_LOG": 4, "HELP": 1, "N1": 6, "DN": 5, "TRNLNM": 2, "LOCATE": 4, ".NE.": 4, "LENGTH": 4, "lnk": 1, "use": 1, "LNK_LOOP": 2, ".AND.": 1, ".LT.": 1, "gtmlib": 2, "placed": 1, "NOLNKLOG": 1, "setting": 1, "LNK": 1, "LIBRARYs": 1, "PREINS": 1, "GTMFILES.KIT": 3, "kit": 2, "contents": 2, "change": 3, "ROOT": 1, "SYSHLP": 1, "GTMIMAGES.KIT": 3, "Provide": 1, "file.KITs": 1, "PROVIDE_FILE": 1, "T": 2, "PROVIDE_IMAGE": 1, "FININS": 1, "PROVIDE_DCL_COMMAND": 1, "GTMCOMMANDS.CLD": 1, "MODIFY_STARTUP_DB": 1, "ADD": 1, "LPMAIN": 1, "TRUE": 1, "_SUCCESS": 2, "remove": 1, "MUPIP": 3, "tables": 1, "V2.4": 1, "V2.5": 1, "NOON": 1, "DEFINE": 4, "/USER_MODE": 4, "NL": 4, "ERROR": 2, "COMMAND": 2, "/TABLE": 1, "SYSLIB": 2, "DCLTABLES": 2, "/OUTPUT": 2, "/DELETE": 2, "MANAGER": 1, "GTMSTART": 1, "GTMLOGIN": 1, "DEFAULT": 2, "T2": 1, "ENVIRONMENT": 1, "PROTECTION": 2, "REWD": 3, "O": 1, "G": 1, "W": 1, "RE": 1, "/DEFAULT": 2, "MUMPS": 2, "DMOD.M": 1, "GTMLIB.OLB/LIB": 1, "GTMSHR.OLB/LIB": 1, "DMOD.OBJ/NOTRACE": 1, "percent": 2, "%": 1, "routines.": 1, "*.*": 1, "real": 1, "Verification": 2, "Procedure.": 1, "Procedure": 1, "Extract": 1, ".COM": 1, "LIBRARIAN": 1, "/EXTRACT": 1, "IVP.COM": 1, "IVP.TLB": 1, "@GTM": 1 }, "DM": { "#define": 4, "PI": 6, "#if": 1, "G": 1, "#elif": 1, "I": 1, "#else": 1, "K": 1, "#endif": 1, "var/GlobalCounter": 1, "var/const/CONST_VARIABLE": 1, "var/list/MyList": 1, "list": 3, "(": 15, "new": 1, "/datum/entity": 2, ")": 15, "var/list/EmptyList": 1, "[": 2, "]": 2, "//": 6, "creates": 1, "a": 1, "of": 1, "null": 2, "entries": 1, "var/list/NullList": 1, "var/name": 1, "var/number": 1, "/datum/entity/proc/myFunction": 1, "world.log": 5, "<<": 5, "/datum/entity/New": 1, "number": 2, "GlobalCounter": 1, "+": 3, "/datum/entity/unit": 1, "name": 1, "/datum/entity/unit/New": 1, "..": 1, "calls": 1, "the": 2, "parent": 1, "rand": 1, "/datum/entity/unit/myFunction": 1, "/proc/ReverseList": 1, "var/list/input": 1, "var/list/output": 1, "for": 1, "var/i": 1, "input.len": 1, ";": 2, "i": 3, "-": 2, "IMPORTANT": 1, "List": 1, "Arrays": 1, "count": 1, "from": 1, "output": 2, "input": 1, "is": 2, "return": 3, "/proc/DoStuff": 1, "var/bitflag": 2, "bitflag": 4, "|": 1, "/proc/DoOtherStuff": 1, "bits": 1, "maximum": 1, "amount": 1, "&": 1, "/proc/DoNothing": 1, "var/pi": 1, "if": 2, "pi": 2, "else": 2, "CONST_VARIABLE": 1, "#undef": 1, "Undefine": 1 }, "DNS Zone": { "ORIGIN": 1, "TTL": 3, "@": 2, "IN": 5, "SOA": 2, "ns": 1, "root": 1, "(": 2, ";": 11, "SERIAL": 1, "REFRESH": 1, "RETRY": 1, "EXPIRE": 1, "MINIMUM": 1, ")": 2, "NS": 3, "ns.example.com.": 1, "c.a.7.e.d.7.e.f.f.f.0.2.8.0.a.0": 1, "PTR": 1, "sip01.example.com.": 1, "3d": 2, "root.localhost.": 2, "root.sneaky.net.": 1, "serial": 1, "refresh": 1, "1h": 1, "retry": 1, "12d": 1, "expire": 1, "2h": 1, "negative": 1, "response": 1, "localhost.": 1, "secondary": 1, "name": 1, "server": 1, "is": 1, "preferably": 1, "externally": 1, "maintained": 1, "www": 1, "A": 1 }, "DTrace": { "#pragma": 2, "D": 2, "option": 2, "quiet": 1, "self": 4, "int": 38, "tottime": 3, ";": 109, "BEGIN": 1, "{": 15, "timestamp": 6, "}": 16, "php": 1, "target": 1, "function": 1, "-": 16, "entry": 2, "@counts": 2, "[": 20, "copyinstr": 1, "(": 98, "arg0": 5, ")": 98, "]": 20, "count": 3, "END": 2, "printf": 18, "/": 1, "printa": 6, "SHEBANG#!dtrace": 1, "specsize": 1, "32m": 1, "linuxulator*": 33, "futex": 33, "futex_get": 1, "error": 1, "futex_sleep": 2, "requeue_error": 1, "sleep_error": 2, "futex_wait": 3, "copyin_error": 5, "itimerfix_error": 1, "futex_atomic_op": 3, "missing_access_check": 1, "unimplemented_op": 1, "unimplemented_cmp": 1, "linux_sys_futex": 11, "unimplemented_clockswitch": 1, "unhandled_efault": 1, "unimplemented_lock_pi": 1, "unimplemented_unlock_pi": 1, "unimplemented_trylock_pi": 1, "unimplemented_wait_requeue_pi": 1, "unimplemented_cmp_requeue_pi": 1, "unknown_operation": 1, "linux_get_robust_list": 1, "copyout_error": 1, "handle_futex_death": 1, "fetch_robust_entry": 1, "release_futexes": 1, "probename": 2, "probeprov": 5, "probemod": 2, "probefunc": 20, "stack": 5, "ustack": 3, "invalid_cmp_requeue_use": 1, "deprecated_requeue": 1, "linux_set_robust_list": 1, "size_error": 1, "execname": 3, "create": 1, "+": 4, "futex_count": 4, "@max_futexes": 2, "max": 2, "destroy": 2, "/futex_count": 1, "0/": 3, "locks": 3, "futex_mtx": 3, "locked": 1, "check": 2, "@stats": 2, "ts": 2, "spec": 5, "speculation": 1, "unlock": 2, "/check": 1, "discard": 1, "tick": 1, "10s": 1, "/spec": 1, "&&": 1, "9999999000/": 1, "commit": 1, "time": 4, "@calls": 2, "return": 1, "/self": 1, "this": 3, "timediff": 3, "@timestats": 2, "quantize": 1, "@longest": 2, "#define": 8, "LocalTransactionId": 4, "unsigned": 15, "LWLockId": 7, "LWLockMode": 6, "LOCKMODE": 3, "BlockNumber": 11, "Oid": 31, "ForkNumber": 11, "bool": 15, "char": 10, "provider": 1, "postgresql": 1, "probe": 55, "transaction__start": 1, "transaction__commit": 1, "transaction__abort": 1, "lwlock__acquire": 1, "lwlock__release": 1, "lwlock__wait__start": 1, "lwlock__wait__done": 1, "lwlock__condacquire": 1, "lwlock__condacquire__fail": 1, "lock__wait__start": 1, "lock__wait__done": 1, "query__parse__start": 1, "const": 7, "*": 7, "query__parse__done": 1, "query__rewrite__start": 1, "query__rewrite__done": 1, "query__plan__start": 1, "query__plan__done": 1, "query__execute__start": 1, "query__execute__done": 1, "query__start": 1, "query__done": 1, "statement__status": 1, "sort__start": 1, "sort__done": 1, "long": 1, "buffer__read__start": 1, "buffer__read__done": 1, "buffer__flush__start": 1, "buffer__flush__done": 1, "buffer__checkpoint__start": 1, "buffer__checkpoint__sync__start": 1, "buffer__checkpoint__done": 1, "buffer__sync__start": 1, "buffer__sync__written": 1, "buffer__sync__done": 1, "buffer__write__dirty__start": 1, "buffer__write__dirty__done": 1, "deadlock__found": 1, "checkpoint__start": 1, "checkpoint__done": 1, "clog__checkpoint__start": 1, "clog__checkpoint__done": 1, "subtrans__checkpoint__start": 1, "subtrans__checkpoint__done": 1, "multixact__checkpoint__start": 1, "multixact__checkpoint__done": 1, "twophase__checkpoint__start": 1, "twophase__checkpoint__done": 1, "smgr__md__read__start": 1, "smgr__md__read__done": 1, "smgr__md__write__start": 1, "smgr__md__write__done": 1, "xlog__insert": 1, "xlog__switch": 1, "wal__buffer__write__dirty__start": 1, "wal__buffer__write__dirty__done": 1 }, "Dart": { "import": 1, "as": 1, "math": 1, ";": 9, "class": 1, "Point": 5, "{": 3, "num": 2, "x": 2, "y": 2, "(": 7, "this.x": 1, "this.y": 1, ")": 7, "distanceTo": 1, "other": 1, "var": 4, "dx": 3, "-": 2, "other.x": 1, "dy": 3, "other.y": 1, "return": 1, "math.sqrt": 1, "*": 2, "+": 1, "}": 3, "void": 1, "main": 1, "p": 1, "new": 2, "q": 1, "print": 1 }, "DataWeave": { "{": 32, "a": 7, "in0.phones": 1, "map": 4, "match": 5, "case": 13, "matches": 3, "/": 6, "+": 21, "(": 59, "d": 13, ")": 59, "s": 8, "-": 67, "country": 1, "[": 11, "]": 11, "area": 3, "number": 7, "}": 32, "phone": 3, "b": 5, "in0.object": 1, "is": 3, "Object": 1, "object": 1, "Number": 4, "y": 5, "Boolean": 1, "boolean": 1, "c": 5, "in0.value": 3, "string": 1, "value": 2, "name": 6, "x": 8, "if": 2, "biggerThan30": 1, "nine": 1, "e": 3, "else": 1, "fun": 6, "SQL": 9, "literals": 1, "parts": 1, "SELECT": 1, "*": 1, "FROM": 1, "table": 1, "WHERE": 1, "id": 1, "AND": 1, "bbb": 2, "aaa": 2, "%": 3, "dw": 3, "var": 7, "foo": 2, "func": 6, "input": 1, "payload": 1, "application/test": 1, "arg": 1, "output": 1, "application/json": 1, "true": 1, "false": 1, "/foo/": 1, "|": 32, "W14": 1, "f": 3, "30Z": 1, "g": 2, "h": 2, "Z": 1, "i": 1, "j": 1, "02T15": 3, "k": 1, "16Z": 1, "l": 1, "m": 1, "P12Y7M11D": 1, "n": 1, "P12Y5M": 1, "o": 1, "P45DT9H20M8S": 1, "p": 1, "PT9H20M8S": 1, "param1": 4, "param2": 8, "toUser": 3, "user": 5, "user.name": 1, "lastName": 1, "user.lastName": 1, "z": 2, "applyFirst": 2, "array": 5, "to": 1, "nested": 1, "f2": 2, "a1": 5, "a2": 3, "f3": 1, "String": 4, "f4": 1, "result": 1, "users": 1, "in1": 1, "a.toUser": 2, ".name": 1, "upper": 2 }, "Diff": { "diff": 1, "-": 5, "git": 1, "a/lib/linguist.rb": 2, "b/lib/linguist.rb": 2, "index": 1, "d472341..8ad9ffb": 1, "+": 3 }, "Dockerfile": { "docker": 1, "-": 27, "version": 1, "from": 1, "ubuntu": 1, "maintainer": 1, "Solomon": 1, "Hykes": 1, "": 1, "dotcloud": 1, "com": 1, "run": 13, "apt": 6, "get": 6, "install": 6, "y": 5, "q": 2, "curl": 2, "git": 7, "s": 1, "https": 1, "amd64.tar.gz": 1, "|": 1, "tar": 1, "v": 2, "C": 1, "/usr/local": 1, "xz": 1, "env": 4, "PATH": 2, "/usr/local/go/bin": 2, "/usr/local/bin": 2, "/usr/local/sbin": 2, "/usr/bin": 2, "/usr/sbin": 2, "/bin": 2, "/sbin": 2, "GOPATH": 1, "/go": 1, "CGO_ENABLED": 1, "cd": 5, "/tmp": 1, "&&": 9, "echo": 2, "t.go": 1, "go": 2, "test": 1, "a": 1, "i": 1, "PKG": 12, "github.com/kr/pty": 1, "REV": 6, "27435c699": 1, ";": 3, "clone": 3, "http": 3, "//": 3, "/go/src/": 6, "checkout": 3, "f": 3, "github.com/gorilla/context/": 1, "708054d61e5": 1, "github.com/gorilla/mux/": 1, "9b36453141c": 1, "iptables": 1, "/etc/apt/sources.list": 1, "update": 1, "lxc": 1, "aufs": 1, "tools": 1, "add": 1, ".": 1, "ldflags": 1, "/go/bin": 1, "cmd": 1, "[": 1, "]": 1 }, "Dogescript": { "quiet": 1, "wow": 4, "such": 2, "language": 3, "very": 1, "syntax": 1, "github": 1, "recognized": 1, "loud": 1, "much": 1, "friendly": 2, "rly": 1, "is": 2, "true": 1, "plz": 2, "console.loge": 2, "with": 2, "but": 1, "module.exports": 1 }, "E": { "pragma.syntax": 2, "(": 107, ")": 107, "to": 33, "send": 1, "message": 5, "{": 68, "when": 3, "friend": 4, "<-receive>": 1, "chatUI.showMessage": 4, "}": 65, "catch": 2, "prob": 2, "receive": 1, "receiveFriend": 2, "friendRcvr": 2, "bind": 3, "save": 1, "file": 3, "file.setText": 1, "makeURIFromObject": 1, "chatController": 2, "load": 1, "getObjectFromURI": 1, "file.getText": 1, "<->": 2, "SHEBANG#!rune": 1, "def": 53, "pi": 2, "-": 3, ".acos": 1, "makeEPainter": 3, "": 2, "com": 1, "zooko": 1, "tray": 1, "colors": 4, "": 1, "makeColor": 1, "doWhileUnresolved": 3, "indicator": 2, "task": 3, "loop": 3, "if": 5, "Ref.isResolved": 2, "The": 3, "data": 1, "structure": 1, "specified": 1, "for": 5, "the": 4, "makeBuckets": 2, "size": 5, "values": 6, "100": 1, "diverge": 1, "storage": 1, "buckets": 11, "int": 7, "return": 23, "get": 4, "current": 2, "quantity": 1, "in": 3, "bucket": 3, "i": 18, "transfer": 2, "amount": 4, "units": 1, "as": 2, "much": 1, "possible": 1, "from": 1, "j": 11, "or": 1, "vice": 1, "versa": 1, "is": 3, "negative": 1, "amountLim": 3, "min": 1, "max": 1, "A": 1, "view": 1, "of": 2, "state": 1, "makeDisplayComponent": 2, "c": 6, "paintCallback": 1, "paintComponent": 1, "g": 7, "pixelsW": 4, "getWidth": 1, "pixelsH": 3, "getHeight": 1, "bucketsW": 4, "setColor": 3, "getWhite": 1, "fillRect": 2, "0": 4, "getDarkGray": 1, "var": 9, "sum": 3, "value": 3, "x0": 3, "floor": 2, "x1": 2, "1": 3, "getBlack": 1, "drawString": 1, "String": 2, "Total": 1, "2": 1, "20": 1, "setPreferredSize": 1, "awt": 1, "makeDimension": 1, "done": 6, "#": 1, "Promise": 1, "indicating": 1, "window": 1, "closed": 1, "frame": 1, "javax": 1, "swing": 1, "makeJFrame": 1, "frame.setContentPane": 1, "display": 1, "frame.addWindowListener": 1, "mainWindowListener": 1, "windowClosing": 1, "event": 2, "void": 6, "null": 2, "match": 5, "_": 6, "frame.setLocation": 1, "frame.pack": 1, "ni": 4, "fn": 2, "+": 3, "%": 6, "buckets.size": 4, "buckets.transfer": 2, "[": 13, "]": 13, "//": 1, "mi": 3, "entropy.nextInt": 2, "#entropy.nextInt": 1, "/": 1, ".floor": 1, "clock": 1, "timer.every": 1, "clock.stop": 1, "else": 2, "display.repaint": 1, "clock.start": 1, "frame.show": 1, "interp.waitAtTop": 1, "#File": 1, "objects": 1, "hardwired": 1, "files": 1, "file1": 1, "": 4, "myFile": 5, "txt": 5, "file2": 1, "home": 1, "marcs": 1, "#Using": 2, "a": 4, "variable": 1, "name": 4, "filePath": 2, "file3": 1, "single": 1, "character": 1, "specify": 1, "Windows": 1, "drive": 1, "file4": 1, "docs": 3, "file5": 1, "": 2, "file6": 1, "makeCar": 4, "x": 3, "y": 3, "car": 8, "moveTo": 1, "newX": 2, "newY": 2, "getX": 1, "getY": 1, "setName": 1, "newName": 2, "getName": 1, "sportsCar": 1, "sportsCar.moveTo": 1, "println": 2, "sportsCar.getName": 1, "at": 1, "X": 1, "location": 1, "sportsCar.getX": 1, "makeVOCPair": 1, "brandName": 6, "near": 6, "myTempContents": 6, "none": 2, "brand": 5, "__printOn": 4, "out": 4, "TextWriter": 4, "out.print": 4, "ProveAuth": 2, "<": 3, "prover": 1, "getBrand": 4, "coerce": 2, "specimen": 2, "optEjector": 3, "sealedBox": 2, "offerContent": 1, "CheckAuth": 2, "checker": 3, "template": 1, "authList": 2, "any": 2, "specimenBox": 2, "specimenBox.__respondsTo": 1, "specimenBox.offerContent": 1, "auth": 3, "throw.eject": 1, "Unmatched": 1, "authorization": 1, "__respondsTo": 2, "true": 1, "false": 1, "__getAllegedType": 1, "null.__getAllegedType": 1, "makeVehicle": 3, "self": 1, "vehicle": 2, "milesTillEmpty": 1, "self.milesPerGallon": 1, "*": 1, "self.getFuelRemaining": 1, "fuelRemaining": 4, "extends": 2, "milesPerGallon": 2, "getFuelRemaining": 2, "makeJet": 1, "jet": 3, "can": 1, "go": 1, "car.milesTillEmpty": 1, "miles.": 1, "tempVow": 2, "#...use": 1, "#....": 1, "report": 1, "problem": 1, "finally": 1, "#....log": 1 }, "EBNF": { "Statement": 1, "(": 1, "NamedFunction": 2, "|": 22, "AnonymousFunction": 4, "Assignment": 2, "Expr": 6, ")": 1, ";": 41, "Term": 4, "{": 6, "}": 6, "Symbol": 4, "FunctionRHS": 2, "FunctionParams": 2, "FunctionBody": 2, "FunctionParam": 3, "Number": 1, "SingleWordString": 2, "name": 4, "string": 4, "diffuse": 2, "real": 22, "ambient": 2, "specular": 2, "shininess": 2, "alpha": 2, "mapping": 2, "texture": 2, "material": 1, "[": 3, "]": 3, "vertex_p3n3_name": 3, "vertex_p3n3t2_name": 3, "vertex_type": 2, "vertex_position": 3, "vertex_normal": 3, "vertex_uv": 2, "vertex_p3n3": 2, "vertex_p3n3t2": 2, "vertex": 2, "vertex_array": 2, "positive": 4, "vertices": 2, "triangle": 2, "natural": 4, "triangle_array": 2, "triangles": 2, "material_name": 2, "object": 1, "digit_without_zero": 3, "digit": 4 }, "ECL": { "#option": 1, "(": 32, "true": 1, ")": 32, ";": 23, "namesRecord": 4, "RECORD": 1, "string20": 1, "surname": 1, "string10": 2, "forename": 1, "integer2": 5, "age": 2, "dadAge": 1, "mumAge": 1, "END": 1, "namesRecord2": 3, "record": 1, "extra": 1, "end": 1, "namesTable": 11, "dataset": 2, "FLAT": 2, "namesTable2": 9, "aveAgeL": 3, "l": 1, "l.dadAge": 1, "+": 16, "l.mumAge": 1, "/2": 2, "aveAgeR": 4, "r": 1, "r.dadAge": 1, "r.mumAge": 1, "output": 9, "join": 11, "left": 2, "right": 3, "//Several": 1, "simple": 1, "examples": 1, "of": 1, "sliding": 2, "syntax": 1, "left.age": 8, "right.age": 12, "-": 5, "and": 10, "<": 1, "between": 7, "//Same": 1, "but": 1, "on": 1, "strings.": 1, "Also": 1, "includes": 1, "to": 1, "ensure": 1, "sort": 1, "is": 1, "done": 1, "by": 1, "non": 1, "before": 1, "sliding.": 1, "left.surname": 2, "right.surname": 4, "[": 4, "]": 4, "all": 1, "//This": 1, "should": 1, "not": 1, "generate": 1, "a": 1, "self": 1 }, "ECLiPSe": { "-": 14, "lib": 1, "(": 20, "ic": 1, ")": 20, ".": 8, "vabs": 2, "Val": 8, "AbsVal": 10, "#": 9, ";": 1, "labeling": 2, "[": 9, "]": 9, "vabsIC": 1, "or": 1, "faitListe": 3, "_": 2, "First": 2, "|": 5, "Rest": 6, "Taille": 2, "Min": 2, "Max": 2, "Min..Max": 1, "Taille1": 2, "suite": 3, "Xi": 5, "Xi1": 7, "Xi2": 7, "checkRelation": 3, "VabsXi1": 2, "Xi.": 1, "checkPeriode": 3, "ListVar": 2, "length": 1, "Length": 2, "<": 1, "X1": 2, "X2": 2, "X3": 2, "X4": 2, "X5": 2, "X6": 2, "X7": 2, "X8": 2, "X9": 2, "X10": 3 }, "EJS": { "<": 40, "%": 76, "include": 7, "parts/depend": 1, "
": 16, "class=": 18, "if": 6, "(": 8, "user.primaryAccount": 2, ")": 8, "{": 13, "teacher/sidebar": 1, "teacher/dashboard": 1, "}": 13, "else": 6, "student/sidebar": 1, "student/dashboard": 1, "
": 3, "

": 3, "There": 1, "seems": 1, "to": 3, "be": 1, "a": 1, "problem": 1, "

": 3, "
": 3, "
": 16, "../parts/depend": 1, "sidebar": 1, "

": 4, "Pieces": 5, "

": 4, "pieces.length": 3, "

": 9, "You": 3, "have": 3, "": 9, "": 9, "piece": 1, "practice": 2, "

": 9, "pieces": 2, "undefined": 3, "||": 3, "No": 3, "no": 1, "assigned.": 1, "style=": 2, "role=": 1, "": 2, "Completed": 2, "inProgressPieces": 6, "inProgressPieces.length": 2, "in": 1, "for": 2, "var": 2, "i": 16, ";": 4, "+": 4, "": 4, "href=": 4, "[": 10, "]": 10, ".title": 4, "": 4, "By": 2, ".author": 2, "Teacher": 2, ".teacherName": 2, "Average": 2, "Practice": 4, "Time": 2, ".averagePracticeTime": 2, "mins": 2, "completedPieces": 6, "completedPieces.length": 2 }, "EML": { "Return": 1, "-": 36, "Path": 1, "": 4, "example": 5, "org": 4, "To": 2, "Mario": 3, "Zaizar": 3, "local": 1, "Subject": 1, "Testing": 2, "From": 1, "nobody": 2, "Reply": 1, "Sender": 1, "nobody@example.org": 1, "X": 1, "Mailer": 1, "http": 1, "//www.phpclasses.org/mimemessage": 1, "Revision": 1, "(": 1, "mail": 2, ")": 1, "MIME": 1, "Version": 1, "Content": 9, "Type": 4, "multipart/mixed": 1, ";": 5, "boundary": 1, "Message": 1, "ID": 2, "<20050430192829.0489.nobody>": 1, "Date": 1, "Sat": 1, "Apr": 1, "69c1683a3ee16ef7cf16edd700694a2f": 3, "text/plain": 1, "charset": 2, "ISO": 2, "Transfer": 3, "Encoding": 3, "quoted": 2, "printable": 2, "This": 1, "is": 1, "an": 2, "HTML": 2, "message.": 2, "Please": 1, "use": 1, "capable": 1, "program": 1, "to": 1, "read": 1, "this": 1, "text/html": 1, "": 1, "": 1, "": 1, "TML": 1, "message": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "6a82fb459dcaacd40ab3404529e808dc": 2, "image/gif": 1, "name": 1, "base64": 1, "Disposition": 1, "inline": 1, "filename": 1, "+": 20, "Pj4": 1, "Pz7": 1, "/v///////////////////": 1, "/////yH5BAEAAAkALAAAAACWACMAQwT": 1, "RBp5NQYxLAYGLi8oSwoJBlE": 1, "BiSNj5E/PDQsmy4pAJWQLAKJY5": 1, "hXhZ2dDYldFWtNSFPiXssXnZR": 1, "k5": 1, "OlpoOuQo": 1, "Ol7NK": 1, "RlG2ka9b3lP3pm2l6u7P": 1, "l/YLj3": 1, "AX6hV": 1, "UMC": 1, "2QaonECwcJt/": 1, "CoZna0HQnPHS3AhRbIeDpqmR09E0bsu": 1, "soeaw994z": 1, "4jxLst2N8sRJYU": 1, "VFQnKB5uX4mr9qJ79pann": 1, "7bjnrvvuvPfu": 1 }, "EQ": { "public": 81, "interface": 1, "String": 58, "Stringable": 7, "Integer": 1, "Double": 1, "Boolean": 1, "{": 162, "static": 21, "instance": 1, "(": 374, "o": 26, ")": 374, "if": 68, "null": 60, "return": 65, ";": 256, "}": 162, "as_string": 2, "Object": 10, "is": 6, ".to_string": 6, "strptr": 10, "as_strptr": 1, "var": 22, "str": 17, "str.to_strptr": 1, "bool": 18, "is_in_collection": 1, "Collection": 2, "c": 6, "false": 23, "foreach": 2, "s": 9, "in": 2, "s.equals": 1, "true": 9, "is_empty": 1, "as": 2, "&&": 6, "str.get_char": 2, "<": 5, "for_object": 1, "for_character": 1, "int": 35, "sb": 3, "StringBuffer.create": 3, "sb.append_c": 3, "sb.to_string": 3, "for_integer": 2, "av": 6, "IFDEF": 5, "v": 19, "embed": 10, "av.ToString": 2, "String.for_strptr": 5, "ELSE": 6, "st": 9, "java.lang.String.valueOf": 3, ".printf": 5, ".add": 6, "for_long": 1, "long": 1, "for_double": 1, "double": 1, "for_boolean": 1, "val": 2, "for_strptr": 1, "literal": 2, "new": 6, "StringImpl": 2, "v.set_strptr": 1, "for_utf8_buffer": 1, "Buffer": 2, "data": 4, "haszero": 2, "v.set_utf8_buffer": 1, "combine": 1, "strings": 2, "delim": 4, "-": 8, "unique": 2, "HashTable": 1, "flags": 3, "HashTable.create": 1, "String.as_string": 1, "continue": 2, "flags.get": 1, "flags.set": 1, "sb.count": 1, "sb.append": 2, "capitalize": 1, "c0": 5, "+": 1, "str.substring": 1, "StringFormatter": 1, "printf": 1, "dup": 1, "append": 1, "get_length": 1, "get_char": 1, "n": 2, "truncate": 1, "len": 2, "replace": 1, "r": 6, "replace_char": 1, "replace_string": 1, "remove": 1, "start": 3, "insert": 1, "pos": 1, "substring": 1, "alength": 1, "reverse": 1, "lowercase": 1, "uppercase": 1, "strip": 1, "Iterator": 1, "split": 1, "max": 1, "contains": 1, "rstr": 1, "chr": 1, "rchr": 1, "has_prefix": 1, "prefix": 4, "has_suffix": 1, "suffix": 1, "compare": 1, "ao": 4, "compare_ignore_case": 1, "equals": 1, "equals_ptr": 1, "equals_ignore_case": 1, "equals_ignore_case_ptr": 1, "StringIterator": 2, "iterate": 1, "iterate_reverse": 1, "to_integer_base": 1, "ibase": 1, "to_strptr": 1, "to_utf8_buffer": 1, "zero": 1, "hash": 1, "EditableString": 1, "as_editable": 1, "IFNDEF": 1, "class": 6, "HTTPServerVirtualHostListener": 5, "EventLoopReadListener": 3, "create": 3, "name": 7, "HTTPServer": 5, "server": 14, "Logger": 1, "logger": 3, "server.get_logger": 3, "Log.error": 1, "void": 17, "on_read_ready": 3, "close": 6, "LoggerObject": 2, "Client": 3, "LocalSocket": 3, "socket": 18, "EventLoopEntry": 2, "ee": 8, "#include": 3, "": 1, "": 1, "": 1, "||": 2, "eventloop": 2, "server.get_eventloop": 2, "v.set_logger": 2, "v.server": 2, "v.socket": 1, "v.ee": 2, "eventloop.entry_for_object": 1, "v.ee.set_read_listener": 1, "ee.remove": 2, "socket.close": 2, "receive_fd": 2, "private": 1, "FileDescriptor": 2, "lsfd": 2, ".get_fd": 1, "newfd": 6, "char": 2, "buf": 2, "[": 5, "]": 5, "struct": 4, "msghdr": 1, "msg": 3, "iovec": 1, "iov": 4, "ssize_t": 1, "union": 1, "cmsghdr": 1, "cm": 1, "control": 1, "CMSG_SPACE": 1, "sizeof": 3, "control_un": 1, "cmsghdr*": 1, "cmptr": 6, "msg.msg_control": 1, "control_un.control": 2, "msg.msg_controllen": 1, "msg.msg_name": 1, "NULL": 2, "msg.msg_namelen": 1, ".iov_base": 1, ".iov_len": 1, "msg.msg_iov": 1, "msg.msg_iovlen": 1, "recvmsg": 1, "&": 2, "log_error": 7, "CMSG_FIRSTHDR": 1, "cmsg_len": 1, "CMSG_LEN": 1, "cmsg_level": 1, "SOL_SOCKET": 1, "cmsg_type": 1, "SCM_RIGHTS": 1, "*": 1, "int*": 1, "CMSG_DATA": 1, "log_warning": 1, "newsock": 4, "TCPSocket.create": 1, "fds": 2, "FileDescriptorSocket": 1, "fds.set_fd": 1, "server.on_new_client_socket": 1, "socketprefix": 2, "v.socketprefix": 1, "v.start": 1, "String.is_empty": 5, "LocalSocket.create": 1, "pp": 4, "socketname": 3, "socket.listen": 1, "event_loop": 2, "event_loop.entry_for_object": 1, "ee.set_read_listener": 1, "this": 1, "log_debug": 1, "ns": 3, "socket.accept": 1, "Client.create": 1, "SEButtonEntity": 6, "SESpriteEntity": 1, "SEPointerListener": 1, "SEImageButtonEntity": 2, "property": 9, "SEImage": 7, "image_normal": 4, "image_hover": 3, "image_pressed": 2, "update": 8, "get_pressed": 3, "img": 12, "set_image": 3, "else": 5, "get_has_pointer": 3, "SETextButtonEntity": 2, "button_text": 4, "normal_font": 6, "hover_font": 5, "pressed_font": 4, "ff": 10, "set_text": 3, "for_image": 1, "SEButtonEntity.for_images": 1, "for_images": 1, "normal": 2, "hover": 2, "pressed": 10, ".set_image_normal": 1, ".set_image_hover": 1, ".set_image_pressed": 1, "for_text": 1, "text": 2, ".set_button_text": 1, ".set_normal_font": 1, ".set_hover_font": 1, ".set_pressed_font": 1, "SEMessageListener": 1, "listener": 2, "has_pointer": 8, "initialize": 1, "SEResourceCache": 1, "rsc": 2, "base.initialize": 1, "virtual": 4, "on_pointer_enter": 2, "SEPointerInfo": 6, "pi": 9, "on_pointer_leave": 2, "on_pointer_move": 1, "pi.is_inside": 3, "get_x": 3, "get_y": 3, "get_width": 3, "get_height": 3, "on_pointer_press": 1, "on_pointer_release": 1, "on_pointer_click": 2, "listener.on_message": 1 }, "Eagle": { "": 2, "version=": 4, "encoding=": 2, "": 2, "eagle": 4, "SYSTEM": 2, "dtd": 2, "": 2, "": 2, "": 2, "": 4, "alwaysvectorfont=": 2, "verticaltext=": 2, "": 2, "": 2, "distance=": 2, "unitdist=": 2, "unit=": 2, "style=": 2, "multiple=": 2, "display=": 2, "altdistance=": 2, "altunitdist=": 2, "altunit=": 2, "": 2, "": 118, "number=": 119, "name=": 447, "color=": 118, "fill=": 118, "visible=": 118, "active=": 125, "": 2, "": 1, "xreflabel=": 1, "xrefpart=": 1, "": 2, "": 4, "": 60, "&": 5501, "lt": 2665, ";": 5567, "b": 64, "gt": 2770, "Frames": 1, "for": 5, "Sheet": 2, "and": 5, "Layout": 1, "/b": 64, "": 60, "": 4, "": 3, "": 1, "": 1, "": 497, "x1=": 630, "y1=": 630, "x2=": 630, "y2=": 630, "width=": 511, "layer=": 821, "": 108, "x=": 241, "y=": 241, "size=": 114, "font=": 4, "DRAWING_NAME": 1, "": 108, "LAST_DATE_TIME": 1, "SHEET": 1, "": 1, "columns=": 1, "rows=": 1, "": 1, "": 1, "": 1, "": 1, "prefix=": 1, "uservalue=": 1, "FRAME": 1, "p": 65, "DIN": 1, "A4": 1, "landscape": 1, "with": 1, "location": 1, "doc.": 1, "field": 1, "": 1, "": 1, "symbol=": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 3, "Resistors": 2, "Capacitors": 4, "Inductors": 2, "Based": 2, "on": 2, "the": 5, "previous": 2, "libraries": 2, "ul": 2, "li": 12, "r.lbr": 2, "cap.lbr": 2, "cap": 2, "-": 768, "fe.lbr": 2, "captant.lbr": 2, "polcap.lbr": 2, "ipc": 2, "smd.lbr": 2, "/ul": 2, "All": 2, "SMD": 4, "packages": 2, "are": 2, "defined": 2, "according": 2, "to": 3, "IPC": 2, "specifications": 2, "CECC": 2, "author": 3, "Created": 3, "by": 3, "librarian@cadsoft.de": 3, "/author": 3, "Electrolyt": 2, "see": 4, "also": 2, "www.bccomponents.com": 2, "www.panasonic.com": 2, "www.kemet.com": 2, "http": 4, "(": 4, "SANYO": 2, ")": 4, "trimmer": 2, "refence": 2, "u": 2, "www.electrospec": 2, "/u": 2, "table": 2, "border": 2, "cellspacing": 2, "cellpadding": 2, "width": 6, "cellpaddding": 2, "tr": 2, "valign": 2, "td": 4, "amp": 66, "nbsp": 66, "/td": 4, "font": 2, "color": 20, "size": 2, "TRIM": 4, "POT": 4, "CROSS": 4, "REFERENCE": 4, "/font": 2, "P": 14, "TABLE": 4, "BORDER": 4, "CELLSPACING": 4, "CELLPADDING": 4, "TR": 36, "TD": 170, "COLSPAN": 16, "FONT": 166, "SIZE": 166, "FACE": 166, "ARIAL": 166, "B": 90, "RECTANGULAR": 2, "MULTI": 6, "TURN": 10, "/B": 90, "/FONT": 166, "/TD": 170, "/TR": 36, "ALIGN": 124, "CENTER": 124, "BOURNS": 6, "BI": 10, "TECH": 10, "DALE": 10, "VISHAY": 10, "PHILIPS/MEPCO": 10, "MURATA": 6, "PANASONIC": 10, "SPECTROL": 6, "MILSPEC": 6, "BGCOLOR": 76, "3005P": 2, "BR": 1478, "3006P": 2, "3006W": 2, "3006Y": 2, "3009P": 2, "3009W": 2, "3009Y": 2, "3057J": 2, "3057P": 2, "3057Y": 2, "3059J": 2, "3059P": 2, "3059Y": 2, "89P": 2, "89W": 2, "89X": 2, "89PH": 2, "76P": 2, "89XH": 2, "78SLT": 2, "ALT": 42, "56P": 4, "78P": 4, "T8S": 2, "T18/784": 2, "1697/1897": 2, "1680/1880": 2, "8035EKP/CT20/RJ": 2, "20P": 2, "RJ": 14, "20X": 2, "8012EKQ": 4, "8012EKR": 4, "1211P": 2, "8012EKJ": 2, "8012EKL": 2, "2101P": 2, "2101W": 2, "2101Y": 2, "2102S": 2, "2102Y": 2, "EVMCOG": 2, "43P": 2, "43W": 2, "43Y": 2, "40P": 2, "40Y": 2, "70Y": 4, "T602": 2, "70P": 2, "RT/RTR12": 6, "RJ/RJR12": 6, "SQUARE": 2, "BOURN": 4, "3250P": 2, "3250W": 2, "3250X": 2, "3252P": 2, "3252W": 2, "3252X": 2, "3260P": 2, "3260W": 2, "3260X": 2, "3262P": 2, "3262W": 2, "3262X": 2, "3266P": 2, "3266W": 2, "3266X": 2, "3290H": 2, "3290P": 2, "3290W": 2, "3292P": 2, "3292W": 2, "3292X": 2, "3296P": 2, "3296W": 2, "3296X": 2, "3296Y": 2, "3296Z": 2, "3299P": 2, "3299W": 2, "3299X": 2, "3299Y": 2, "3299Z": 2, "66P": 8, "66W": 8, "66X": 8, "64W": 8, "64P": 6, "64X": 6, "67P": 4, "67W": 2, "67X": 4, "67Y": 4, "67Z": 4, "68P": 2, "68W": 2, "68X": 2, "T63YB": 2, "T63XB": 2, "T93Z": 2, "T93YA": 2, "T93XA": 2, "T93YB": 2, "T93XB": 2, "8026EKP": 4, "8026EKW": 2, "8026EKM": 4, "8026EKB": 2, "1309X": 2, "1309P": 2, "1309W": 2, "8024EKP": 2, "8024EKW": 2, "8024EKN": 2, "9P/CT9P": 2, "9W": 2, "9X": 2, "3103P": 4, "3103Y": 4, "3103Z": 4, "3105P/3106P": 2, "3105W/3106W": 2, "3105X/3106X": 2, "3105Y/3106Y": 2, "3105Z/3105Z": 2, "3102P": 2, "3102W": 2, "3102X": 2, "3102Y": 2, "3102Z": 2, "EVMCBG": 2, "EVMCCG": 2, "X": 14, "64Y": 2, "64Z": 2, "RT/RTR22": 8, "RJ/RJR22": 6, "RT/RTR26": 6, "RJ/RJR26": 12, "RT/RTR24": 6, "RJ/RJR24": 12, "SINGLE": 4, "3323P": 2, "3323S": 2, "3323W": 2, "3329H": 2, "3329P": 2, "3329W": 2, "3339H": 2, "3339P": 2, "3339W": 2, "3352E": 2, "3352H": 2, "3352K": 2, "3352P": 2, "3352T": 2, "3352V": 2, "3352W": 2, "3362H": 2, "3362M": 2, "3362P": 2, "3362R": 2, "3362S": 2, "3362W": 2, "3362X": 2, "3386B": 2, "3386C": 2, "3386H": 2, "3386K": 2, "3386M": 2, "3386P": 2, "3386S": 2, "3386W": 2, "3386X": 2, "25P": 4, "25S": 4, "25RX": 4, "82P": 2, "82M": 2, "82PA": 2, "91E": 2, "91X": 2, "91T": 2, "91B": 2, "91A": 2, "91V": 2, "91W": 2, "25W": 2, "25V": 2, "25X": 2, "72XW": 2, "72XL": 2, "72PM": 2, "72RX": 2, "72PX": 2, "72P": 2, "72RXW": 2, "72RXL": 2, "72X": 2, "T7YB": 2, "T7YA": 2, "TXD": 2, "TYA": 2, "TYP": 2, "TYD": 2, "TX": 2, "150SX": 2, "100SX": 2, "102T": 2, "101S": 2, "190T": 2, "150TX": 2, "101SX": 2, "ET6P": 2, "ET6S": 2, "ET6X": 2, "6W/8014EMW": 2, "6P/8014EMP": 2, "6X/8014EMX": 2, "TM7W": 2, "TM7P": 2, "TM7X": 2, "8017SMS": 2, "8017SMB": 2, "8017SMA": 2, "CT": 12, "6W": 2, "6H": 2, "6P": 2, "6R": 2, "6V": 2, "6X": 2, "8038EKV": 2, "8038EKX": 2, "8038EKP": 2, "8038EKZ": 2, "8038EKW": 2, "3321H": 2, "3321P": 2, "3321N": 2, "1102H": 2, "1102P": 2, "1102T": 2, "RVA0911V304A": 2, "RVA0911H413A": 2, "RVG0707V100A": 2, "RVA0607V": 2, "H": 2, "306A": 2, "RVA1214H213A": 2, "3104B": 2, "3104C": 2, "3104H": 2, "3104M": 2, "3104P": 2, "3104S": 2, "3104W": 2, "3104X": 2, "EVMQ0G": 4, "EVMQIG": 2, "EVMQ3G": 2, "EVMS0G": 2, "EVMG0G": 2, "EVMK4GA00B": 2, "EVM30GA00B": 2, "EVMK0GA00B": 2, "EVM38GA00B": 2, "EVMB6": 2, "EVLQ0": 2, "EVMMSG": 2, "EVMMBG": 2, "EVMMAG": 2, "EVMMCS": 2, "EVMM1": 2, "EVMM0": 2, "EVMM3": 2, "67R": 2, "63V": 2, "63S": 2, "63M": 2, "63H": 2, "63P": 2, "63X": 2, "RJ/RJR50": 6, "/TABLE": 4, "TOCOS": 4, "AUX/KYOCERA": 4, "3224G": 2, "3224J": 2, "3224W": 2, "3269P": 2, "3269W": 2, "3269X": 2, "44G": 2, "44J": 2, "44W": 2, "84P": 2, "84W": 2, "84X": 2, "ST63Z": 2, "ST63Y": 2, "ST5P": 2, "ST5W": 2, "ST5X": 2, "3314G": 2, "3314J": 2, "3364A/B": 2, "3364C/D": 2, "3364W/X": 2, "3313G": 2, "3313J": 2, "23B": 2, "23A": 4, "21X": 2, "21W": 2, "22B": 4, "22A": 2, "ST5YL/ST53YL": 2, "ST5YJ/5T53YJ": 2, "ST": 14, "4B": 2, "4A": 2, "3B": 2, "3A": 2, "EVM": 8, "6YS": 2, "1E": 2, "1G": 2, "1D": 2, "G4B": 2, "G4A": 2, "TR04": 2, "3S1": 2, "TRG04": 2, "2S1": 2, "DVR": 2, "43A": 2, "CVR": 4, "42C": 2, "42A/C": 2, "ALTERNATE": 2, "/tr": 2, "/table": 2, "": 53, "RESISTOR": 52, "": 64, "dx=": 64, "dy=": 64, "NAME": 52, "VALUE": 52, "": 132, "": 52, "wave": 10, "soldering": 10, "Source": 2, "MELF": 8, "W": 8, "type": 20, "grid": 20, "mm": 18, "curve=": 56, "": 39, "drill=": 41, "shape=": 39, "ratio=": 41, "15mm": 1, "": 12, "radius=": 11, "10mm": 1, "": 1, "": 1, "": 1, "Pin": 1, "Header": 1, "Connectors": 1, "PIN": 1, "HEADER": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "language=": 2, "EAGLE": 2, "Design": 5, "Rules": 5, "Die": 1, "Standard": 1, "sind": 1, "so": 2, "gew": 1, "hlt": 1, "dass": 1, "sie": 1, "f": 1, "r": 1, "die": 3, "meisten": 1, "Anwendungen": 1, "passen.": 1, "Sollte": 1, "ihre": 1, "Platine": 1, "besondere": 1, "Anforderungen": 1, "haben": 1, "treffen": 1, "Sie": 1, "erforderlichen": 1, "Einstellungen": 1, "hier": 1, "und": 1, "speichern": 1, "unter": 1, "einem": 1, "neuen": 1, "Namen": 1, "ab.": 1, "The": 1, "default": 1, "have": 2, "been": 1, "set": 1, "cover": 1, "a": 2, "wide": 1, "range": 1, "of": 1, "applications.": 1, "Your": 1, "particular": 1, "design": 2, "may": 1, "different": 1, "requirements": 1, "please": 1, "make": 1, "necessary": 1, "adjustments": 1, "save": 1, "your": 1, "customized": 1, "rules": 1, "under": 1, "new": 1, "name.": 1, "": 142, "value=": 145, "": 1, "": 1, "": 8, "": 8, "refer=": 7, "": 1, "": 1, "": 3, "library=": 3, "package=": 3, "smashed=": 3, "": 6, "": 3, "": 1, "": 1, "": 3, "": 4, "element=": 4, "pad=": 4, "": 1, "extent=": 1, "": 3, "": 2, "": 8, "": 2, "": 1, "": 1, "": 1, "": 1 }, "Easybuild": { "easyblock": 1, "name": 1, "version": 1, "homepage": 1, "description": 1, "toolchain": 1, "{": 2, "}": 2, "toolchainopts": 1, "True": 1, "sources": 1, "[": 3, "SOURCE_TAR_GZ": 1, "]": 3, "source_urls": 1, "builddependencies": 1, "(": 1, ")": 1, "moduleclass": 1 }, "EditorConfig": { ";": 1, "editorconfig.org": 1, "root": 1, "true": 3, "[": 1, "*": 1, "]": 1, "indent_style": 1, "space": 1, "indent_size": 1, "end_of_line": 1, "lf": 1, "charset": 1, "utf": 1, "-": 1, "trim_trailing_whitespace": 1, "insert_final_newline": 1 }, "Edje Data Collection": { "#ifndef": 4, "BG_COLOR": 4, "#define": 3, "#endif": 6, "BG_COLOR_TRANSLUCENT": 2, "BELL_OVERLAY_COLOR": 3, "collections": 1, "{": 380, "group": 6, "name": 156, ";": 1586, "INHERIT_PROVIDE_OWN_COLORS": 1, "color_classes": 1, "#include": 1, "}": 380, "images": 6, "image": 35, "COMP": 32, "sounds": 2, "sample": 6, "LOSSY": 6, "source": 62, "script": 3, "public": 2, "message": 2, "(": 35, "Msg_Type": 2, "type": 60, "id": 4, "...": 2, ")": 34, "new": 2, "r": 5, "g": 5, "b": 5, "a": 6, "v": 4, "if": 3, "MSG_INT": 2, "||": 4, "return": 2, "getarg": 2, "*": 1, "/": 1, "custom_state": 2, "PART": 10, "get_state_val": 2, "STATE_COLOR": 4, "set_state_val": 2, "set_state": 4, "parts": 6, "part": 84, "RECT": 27, "clip_to": 25, "description": 151, "state": 151, "color": 68, "program": 84, "signal": 56, "action": 84, "STATE_SET": 72, "transition": 47, "ACCELERATE": 8, "target": 178, "inherit": 65, "visible": 73, "mouse_events": 45, "SWALLOW": 18, "#if": 2, "EFL_VERSION_MAJOR": 2, "EFL_VERSION_MINOR": 2, "PLAY_SAMPLE": 7, "ALERT": 1, "#else": 2, "after": 27, "TEXT": 6, "effect": 2, "GLOW": 1, "scale": 10, "fixed": 47, "rel1.to": 39, "rel2.to": 38, "rel1.offset": 15, "-": 49, "rel2.relative": 27, "rel2.offset": 18, "align": 34, "text": 9, "font": 7, "size": 6, "min": 19, "ellipsis": 2, "rel1.relative": 26, "repeat_events": 2, "rel1.to_y": 5, "DECELERATE": 32, "SIGNAL_EMIT": 4, "rel1.to_x": 5, "//color": 2, "rel2.to_y": 6, "rel2.to_x": 6, "image.normal": 26, "image.border": 14, "fill.smooth": 16, "max": 10, "SPACER": 5, "dragable.x": 2, "dragable.confine": 2, "SOFT_SHADOW": 1, "BOTTOM": 1, "color3": 1, "text_source": 1, "SPRING": 2, "map": 2, "on": 3, "smooth": 2, "rotation.center": 2, "map.rotation.z": 5, "LINEAR": 5, "rel1": 6, "to": 8, "rel2": 7, "image.border_scale_by": 4, "fill": 2, "size.relative": 2, "size.offset": 2, "image.middle": 2, "relative": 7, "offset": 11, "aspect": 1, "255/120": 2, "aspect_preference": 1, "HORIZONTAL": 1, "to_x": 1, "////": 4, "the": 2, "cursor": 1, "show": 1, "where": 1, "is": 2, "typed": 1, "normal": 3, "border": 3, "programs": 1, "in": 1, "ACTION_STOP": 1, "buf": 3, "[": 1, "]": 1, "snprintf": 1, "rand": 1, "%": 1, "+": 1, "run_program": 2, "get_program_id": 1, "PROGRAM": 1, "//": 1, "chosen": 1, "by": 1, "fair": 1, "dice": 1, "roll": 1, "an": 2, "object": 2, "contain": 1, "selection": 1, "tool": 1, "used": 1, "for": 1, "selecting": 1, "tabs": 1, "with": 1, "glow": 1, "grid": 1, "of": 1, "terms": 1, "<": 1, "else": 1, "CURRENT": 2, "overlayd": 1, "that": 1, "link": 1 }, "Eiffel": { "note": 2, "description": 2, "author": 1, "class": 4, "GIT_CHECKOUT_COMMAND": 1, "inherit": 2, "GIT_COMMAND": 1, "create": 10, "make": 7, "make_master": 2, "feature": 8, "{": 8, "NONE": 4, "}": 8, "-": 18, "Initialization": 3, "(": 21, "a_branch": 4, "STRING": 4, ")": 21, "do": 9, "initialize": 1, "arguments.force_last": 1, "branch": 3, "ensure": 3, "branch_set": 1, "end": 17, "Access": 3, "name": 5, "BOOK_COLLECTION": 2, "a_name": 6, "STRING_32": 5, "set_name": 2, "book_index.make": 1, "name_set": 2, "books": 2, "LIST": 4, "[": 9, "BOOK": 8, "]": 9, "LINKED_LIST": 3, "Result.make": 2, "across": 2, "book_index": 3, "as": 3, "it": 2, "loop": 2, "Result.append": 1, "it.item": 2, "books_by_author": 1, "a_author": 2, "if": 2, "attached": 1, "l_result": 2, "then": 2, "Result": 1, "else": 1, "Change": 1, "add_book": 2, "a_book": 2, "local": 2, "l": 4, "detachable": 1, "book_index.at": 1, "a_book.author.name": 2, "Void": 1, "l.make": 1, "book_index.put": 1, "l.force": 1, "add_books": 1, "book_list": 2, "like": 1, "Implementation": 1, "HASH_TABLE": 1, "date": 1, "revision": 1, "APPLICATION": 1, "ARGUMENTS": 1, "HTTP_SERVER_SHARED_CONFIGURATION": 1, "l_server": 2, "HTTP_SERVER": 1, "l_cfg": 3, "HTTP_SERVER_CONFIGURATION": 1, "l_http_handler": 2, "HTTP_HANDLER": 1, "l_cfg.make": 1, "l_cfg.http_server_port": 1, "9_000": 1, "l_cfg.document_root": 1, "default_document_root": 2, "set_server_configuration": 1, "debug": 1, "l_cfg.set_is_verbose": 1, "True": 1, "l_server.make": 1, "APPLICATION_CONNECTION_HANDLER": 1, "l_http_handler.make": 1, "l_server.setup": 1 }, "Elixir": { "%": 1, "{": 11, "hex": 10, "cowboy": 1, "}": 11, "cowlib": 1, "hackney": 1, "hound": 1, "httpoison": 1, "idna": 1, "phoenix": 1, "plug": 1, "poison": 1, "ranch": 1 }, "Elm": { "main": 3, "asText": 1, "(": 118, "qsort": 4, "[": 32, "]": 32, ")": 118, "lst": 6, "case": 5, "of": 7, "x": 14, "xs": 9, "-": 10, "filter": 2, "+": 14, "<": 2, "data": 1, "Tree": 3, "a": 5, "Node": 8, "|": 3, "Empty": 8, "empty": 2, "singleton": 2, "v": 8, "insert": 4, "tree": 7, "y": 7, "left": 7, "right": 8, "if": 2, "then": 2, "else": 2, "fromList": 3, "foldl": 1, "depth": 5, "max": 1, "map": 11, "f": 8, "t1": 2, "t2": 3, "flow": 4, "down": 3, "display": 4, "name": 6, "text": 4, ".": 9, "monospace": 1, "toText": 6, "concat": 1, "show": 2, "import": 3, "List": 1, "intercalate": 2, "intersperse": 3, "Website.Skeleton": 1, "Website.ColorScheme": 1, "addFolder": 4, "folder": 2, "let": 2, "add": 2, "in": 2, "n": 2, "elements": 2, "functional": 2, "reactive": 2, "example": 3, "loc": 2, "Text.link": 1, "toLinks": 2, "title": 2, "links": 2, "width": 3, "italic": 1, "bold": 2, "Text.color": 1, "accent4": 1, "insertSpace": 2, "{": 1, "spacer": 2, ";": 1, "}": 1, "subsection": 2, "w": 7, "info": 2, "words": 2, "markdown": 1, "###": 1, "Basic": 1, "Examples": 1, "Each": 1, "listed": 1, "below": 1, "focuses": 1, "on": 1, "single": 1, "function": 1, "or": 1, "concept.": 1, "These": 1, "examples": 1, "demonstrate": 1, "all": 1, "the": 1, "basic": 1, "building": 1, "blocks": 1, "Elm.": 1, "content": 2, "exampleSets": 2, "plainText": 1, "lift": 1, "skeleton": 1, "Window.width": 1 }, "Emacs Lisp": { ";": 694, "-": 1277, "*": 7, "mode": 33, "emacs": 12, "lisp": 3, "coding": 1, "mule": 1, "Desktop": 2, "File": 1, "for": 15, "Emacs": 12, "Created": 2, "Sat": 1, "Jan": 1, "file": 28, "format": 5, "version": 6, "Global": 1, "section": 2, "(": 607, "setq": 36, "desktop": 2, "missing": 1, "warning": 1, "nil": 79, ")": 555, "tags": 2, "name": 20, "table": 46, "list": 26, "search": 9, "ring": 3, "regexp": 16, "register": 1, "alist": 23, "history": 1, "Buffer": 1, "buffers": 1, "listed": 1, "in": 34, "same": 2, "order": 1, "as": 5, "buffer": 8, "create": 2, "define": 5, "abbrev": 4, "UTF": 1, "support": 1, "set": 16, "language": 3, "environment": 1, "setenv": 2, "default": 15, "tab": 1, "width": 3, "Function": 1, "to": 43, "load": 12, "all": 8, "files": 6, "/.emacs.d/config": 1, "defun": 19, "directory": 13, "dolist": 1, "element": 3, "and": 22, "attributes": 1, "let*": 5, "path": 12, "car": 4, "fullpath": 3, "concat": 11, "isdir": 3, "cdr": 1, "ignore": 7, "dir": 2, "or": 14, "string": 17, "cond": 2, "eq": 2, "t": 24, "not": 19, "substring": 1, "sans": 1, "extension": 1, "Tell": 1, "we": 1, "ispell": 1, "program": 9, "executable": 2, "find": 2, "Load": 2, "Homebrew": 1, "installed": 4, "packages": 11, "let": 11, "normal": 3, "top": 4, "level": 4, "add": 19, "subdirs": 1, "hook": 9, "aggressive": 2, "indent": 20, "autoload": 4, ".": 72, "rust": 1, "Git": 1, "related": 1, "syntax": 39, "highlighting": 1, "Keybindings": 1, "global": 2, "key": 18, "kbd": 1, "lambda": 2, "interactive": 6, "kill": 2, "line": 26, "Show": 1, "cursor": 3, "column": 4, "number": 1, "Disable": 1, "autosave": 1, "auto": 6, "save": 12, "Use": 2, "a": 21, "single": 3, "storing": 1, "backup": 3, "by": 12, "copying": 1, "delete": 3, "old": 2, "versions": 6, "kept": 2, "new": 1, "control": 1, "custom": 8, "variables": 5, "was": 3, "added": 3, "Custom.": 3, "If": 29, "you": 11, "edit": 3, "it": 16, "hand": 3, "could": 3, "mess": 3, "up": 5, "so": 3, "be": 14, "careful.": 3, "Your": 3, "init": 3, "should": 6, "contain": 3, "only": 9, "one": 10, "such": 4, "instance.": 3, "there": 3, "is": 42, "more": 4, "than": 4, "they": 3, "won": 3, "faces": 2, "Object": 1, "EDE": 1, "ede": 4, "proj": 4, "project": 2, "targets": 1, "target": 3, "elisp": 3, "autoloads": 1, "source": 4, "compiler": 2, "pre": 1, "versionsource": 1, "aux": 1, "web": 6, "site": 4, "url": 1, "ftp": 1, "upload": 1, "configuration": 8, "metasubproject": 1, "user": 3, "full": 1, "mail": 2, "address": 2, "image": 2, "mm": 1, "inline": 1, "large": 1, "images": 1, "gnus": 2, "select": 1, "method": 1, "nnimap": 3, "server": 5, "port": 1, "stream": 1, "ssl": 1, "message": 2, "send": 4, "function": 19, "smtpmail": 5, "starttls": 1, "credentials": 2, "auth": 1, "smtp": 3, "service": 1, "ignored": 2, "from": 9, "addresses": 1, "viper": 4, "inhibit": 1, "startup": 9, "expert": 1, "Key": 1, "bindings": 1, "vi": 1, "map": 1, "Return": 1, "of": 41, "window": 3, "my": 1, "return": 2, "beginning": 5, "package": 4, "depends": 4, "on": 15, "This": 11, "loaded": 2, "Spacemacs": 4, "at": 19, "startup.": 2, "It": 1, "must": 3, "stored": 2, "your": 3, "home": 1, "directory.": 2, "dotspacemacs/layers": 1, "List": 7, "additional": 3, "paths": 1, "where": 3, "look": 3, "layers.": 1, "Paths": 1, "have": 4, "trailing": 2, "slash": 1, "i.e.": 2, "/.mycontribs/": 1, "dotspacemacs": 38, "layer": 4, "layers": 7, "load.": 1, "the": 62, "symbol": 3, "then": 4, "discovered": 1, "will": 7, "installed.": 1, "Example": 1, "useful": 2, "may": 2, "want": 1, "use": 4, "right": 1, "away.": 1, "Uncomment": 1, "some": 4, "names": 1, "press": 1, "": 2, "f": 2, "e": 2, "R": 11, "Vim": 1, "style": 5, "": 1, "install": 2, "them.": 1, "charlock_holmes": 1, "escape_utils": 1, "mime": 1, "types": 1, "rugged": 1, "minitest": 1, "mocha": 1, "plist": 1, "pry": 1, "rake": 1, "yajl": 1, "ruby": 2, "colour": 2, "proximity": 1, "licensed": 1, "licensee": 1, "that": 8, "without": 2, "being": 1, "wrapped": 1, "layer.": 1, "need": 1, "these": 2, "consider": 1, "can": 4, "also": 1, "put": 2, "dotspacemacs/config": 1, "A": 5, "and/or": 2, "extensions": 1, "loaded.": 1, "excluded": 1, "non": 15, "spacemacs": 7, "any": 4, "orphan": 2, "are": 9, "declared": 1, "which": 6, "member": 2, "dotspacemacs/init": 1, "called": 2, "very": 2, "initialization": 3, "before": 5, "configuration.": 2, "sexp": 4, "an": 7, "exhaustive": 1, "supported": 2, "settings.": 1, "Either": 1, "vim": 1, "Evil": 2, "always": 2, "enabled": 4, "but": 2, "if": 17, "variable": 8, "editing": 4, "output": 1, "loading": 4, "progress": 3, "*Messages*": 1, "verbose": 1, "Specify": 1, "banner.": 1, "Default": 4, "value": 8, "official": 2, "logo.": 1, "An": 1, "integer": 1, "index": 1, "text": 1, "banner": 3, "random": 1, "build.": 1, "no": 2, "displayed.": 1, "items": 1, "show": 3, "buffer.": 2, "disabled.": 1, "Possible": 4, "values": 3, "recents": 1, "projects": 1, "lists": 2, "themes": 3, "first": 2, "when": 14, "starts.": 1, "Press": 1, "T": 1, "n": 7, "cycle": 2, "next": 1, "theme": 1, "works": 1, "great": 1, "with": 9, "variants": 1, "dark": 4, "light": 4, "solarized": 2, "atom": 3, "ui": 3, "material": 1, "zenburn": 1, "matches": 1, "state": 6, "colour.": 1, "colorize": 1, "according": 1, "font.": 1, "powerline": 2, "scale": 2, "size": 2, "make": 8, "separators": 1, "too": 1, "crappy.": 1, "font": 7, "weight": 1, "The": 5, "leader": 8, "accessible": 2, "Major": 2, "shortcut": 1, "equivalent": 1, "pressing": 2, "": 1, "m": 1, "Set": 1, "disable": 3, "it.": 1, "major": 2, "command": 19, "used": 5, "commands": 4, "ex": 1, "M": 2, "x": 2, "By": 1, "Location": 1, "files.": 1, "original": 1, "place": 1, "cache": 3, "location": 1, "ido": 2, "commands.": 1, "For": 2, "now": 1, "paste": 2, "micro": 2, "enabled.": 2, "When": 1, "p": 11, "several": 1, "times": 1, "between": 1, "content.": 1, "enable": 1, "Guide": 2, "delay": 4, "seconds.": 1, "popup": 1, "listing": 1, "bound": 1, "current": 15, "keystrokes.": 1, "guide": 2, "bar": 2, "displayed": 2, "loading.": 1, "increase": 1, "boot": 1, "time": 1, "systems": 1, "builds": 1, "boost": 1, "time.": 1, "frame": 4, "fullscreen": 6, "starts": 2, "up.": 2, "+": 13, "spacemacs/toggle": 4, "animations": 1, "OSX.": 1, "native": 2, "maximized": 2, "Takes": 1, "effect": 1, "range": 2, "increasing": 2, "opacity": 2, "describes": 2, "transparency": 6, "Transparency": 2, "toggled": 2, "through": 2, "toggle": 2, "active": 1, "inactive": 1, "unicode": 2, "symbols": 3, "line.": 1, "smooth": 2, "scrolling": 4, "Smooth": 1, "overrides": 1, "behavior": 1, "recenters": 1, "point": 23, "reaches": 1, "bottom": 1, "screen.": 1, "smartparens": 2, "strict": 2, "programming": 1, "modes.": 1, "Select": 1, "scope": 1, "highlight": 2, "delimiters.": 1, "delimiters": 1, "advises": 1, "quit": 1, "functions": 1, "keep": 2, "open": 10, "quitting.": 1, "persistent": 1, "tool": 2, "names.": 1, "uses": 1, "list.": 1, "Supported": 1, "tools": 2, "ag": 1, "ack": 1, "repository": 3, "explicit": 1, "has": 1, "been": 2, "specified": 1, "package.": 1, "Not": 1, "now.": 1, "numbers": 2, "turned": 1, "prog": 1, "derivatives.": 1, "relative": 1, "Delete": 1, "whitespace": 3, "while": 4, "saving": 1, "cleanup": 2, "changed": 1, "lines": 1, "User": 1, "goes": 1, "here": 1, "dotspacemacs/user": 1, "config": 1, "end": 12, "after": 2, "company": 1, "projectile": 1, "rails": 1, "insert": 2, "encoding": 1, "magic": 1, "comment": 11, "markup": 1, "offset": 7, "code": 2, "golden": 1, "ratio": 1, "globally": 2, "centered": 1, "Do": 1, "write": 3, "anything": 1, "past": 1, "this": 2, "comment.": 1, "generate": 1, "definitions.": 1, "print": 1, "ess": 107, "julia.el": 2, "ESS": 8, "julia": 92, "inferior": 29, "interaction": 1, "Copyright": 1, "C": 2, "Vitalie": 3, "Spinu.": 1, "Filename": 1, "Author": 1, "Spinu": 2, "based": 1, "mode.el": 1, "lang": 1, "Maintainer": 1, "Keywords": 1, "*NOT*": 1, "part": 2, "GNU": 4, "Emacs.": 1, "free": 1, "software": 1, "redistribute": 1, "modify": 28, "under": 1, "terms": 1, "General": 4, "Public": 3, "License": 3, "published": 1, "Free": 2, "Software": 2, "Foundation": 2, "either": 1, "later": 1, "version.": 1, "distributed": 1, "hope": 1, "WITHOUT": 1, "ANY": 1, "WARRANTY": 1, "even": 1, "implied": 2, "warranty": 1, "MERCHANTABILITY": 1, "FITNESS": 1, "FOR": 1, "PARTICULAR": 1, "PURPOSE.": 1, "See": 1, "details.": 1, "You": 1, "received": 1, "copy": 2, "along": 1, "see": 1, "COPYING.": 1, "Inc.": 1, "Franklin": 1, "Street": 1, "Fifth": 1, "Floor": 1, "Boston": 1, "MA": 1, "USA.": 1, "Commentary": 1, "customise": 1, "release": 1, "basic": 6, "start": 17, "julia.": 1, "require": 3, "Code": 1, "defvar": 11, "entry": 27, "_": 2, "underscores": 1, "words": 2, "@": 1, "#": 2, "{": 1, "}": 1, "[": 2, "]": 2, "operator": 1, "outside": 1, "quotes": 1, "&": 4, "<": 6, "%": 1, "holds": 1, "within": 1, "strings": 2, "char": 13, "defconst": 9, "regex": 10, "unquote": 2, "forloop": 2, "subset": 2, "lock": 6, "defaults": 5, "type": 2, "face": 1, "cons": 3, "mapconcat": 1, "block": 16, "keywords": 8, "other": 3, "inside": 6, "brackets": 3, "optional": 4, "pos": 19, "excursion": 8, "beg": 3, "re": 4, "backward": 5, "max": 3, "min": 10, "forward": 7, "keyword": 7, "kw": 2, "field": 1, "X.word": 1, "quoted": 1, "word": 6, "equal": 4, "get": 7, "position": 1, "last": 9, "count": 7, "progn": 6, "goto": 5, "indentation": 7, "special": 1, "form": 3, "opening": 1, "previous": 3, "cur": 2, "paren": 4, "parse": 2, "partial": 1, "closer": 1, "cadr": 1, "null": 2, "condition": 1, "case": 2, "scan": 1, "error": 10, "bol": 1, "errors": 3, "ends": 1, "skip": 2, "chars": 1, "eql": 1, "endtok": 2, "take": 1, "paragraph": 2, "separate": 1, "page": 1, "delimiter": 1, "fill": 1, "prefix": 3, "final": 1, "newline": 1, "calculate": 1, "comments": 1, "local": 7, "process": 10, "dump": 4, "Changelog": 1, "<->": 1, "attr": 1, "log": 2, "header": 2, "s": 4, "w": 1, "options": 1, "inf": 1, "Run": 1, "Edit": 1, "visibly": 1, "temporary": 1, "julia_eval_region": 1, "jl": 3, "temp": 1, "help": 13, "topics": 2, "proc": 3, "vector": 1, "all_help_topics": 1, "com": 1, "looked": 1, "compilation": 3, "0": 2, "9": 2, "2": 4, "3": 2, "1": 2, "S": 2, "customize": 7, "comint": 1, "prompt": 4, "eldoc": 4, "primary": 1, "secondary": 1, "funargs": 1, "imenu": 6, "generic": 5, "expression": 5, "objects": 2, "dialect": 3, "suffix": 2, "filename": 5, "template": 2, "replace": 2, "proto": 1, "change": 2, "sp": 2, "sec": 4, "keys": 2, "loop": 2, "timeout": 2, "fixme": 1, "spec.": 1, "cmd": 2, "pattern": 2, "object": 3, "db": 1, "smart": 2, "operators": 2, "filetype": 1, "exit": 1, "harmful": 1, "shell": 1, "args": 19, "STERM": 1, "editor": 2, "pager": 2, "Each": 1, "specifies": 1, "filename.": 1, "found": 1, "exec": 1, "Julia": 1, "made": 1, "available.": 1, "defcustom": 1, "These": 1, "arguments": 4, "currently": 1, "passed": 2, "created": 1, "using": 1, "r": 1, "group": 1, "###autoload": 2, "complete": 1, "remove": 2, "completion": 4, "fboundp": 1, "menubar": 1, "run": 3, "hooks": 2, "post": 1, "process.": 1, "Optional": 1, "u": 1, "allows": 1, "": 1, "OS": 1, "agnostic.": 1, "certain": 1, "them": 1, "settings": 1, "notably": 1, "dribble": 1, "debugging": 1, "arg": 1, "space": 1, "just": 1, "read": 1, "..": 3, "multi": 1, "...": 1, "tb": 1, "match": 1, "inject": 1, "etc": 1, "ELDOC": 1, "associated": 1, "do": 1, "try": 1, "doc": 11, "strings.": 1, "live": 1, "funname": 5, "funname.start": 1, "sequence": 1, "nth": 1, "W": 3, "minibuffer": 1, "length": 5, "propertize": 1, "sort": 1, "s1": 2, "s2": 2, "pop": 2, "IMENU": 1, "don": 1, "signature": 1, ".*": 1, "provide": 1 }, "EmberScript": { "class": 1, "App.FromNowView": 2, "extends": 1, "Ember.View": 1, "tagName": 1, "template": 1, "Ember.Handlebars.compile": 1, "output": 1, "return": 1, "moment": 1, "(": 5, "@value": 1, ")": 5, ".fromNow": 1, "didInsertElement": 1, "-": 4, "@tick": 2, "tick": 1, "f": 2, "@notifyPropertyChange": 1, "nextTick": 4, "Ember.run.later": 1, "this": 1, "@set": 1, "willDestroyElement": 1, "@nextTick": 1, "Ember.run.cancel": 1, "Ember.Handlebars.helper": 1 }, "Erlang": { "SHEBANG#!escript": 5, "main": 9, "(": 811, "[": 340, "]": 333, ")": 805, "-": 826, "start": 5, ";": 155, "N": 26, "list_to_integer": 5, "M": 10, ".": 506, "code": 6, "add_pathz": 2, "{": 589, "ok": 49, "Ctx": 9, "}": 591, "emonk": 3, "create_ctx": 1, "undefined": 1, "eval": 1, "js": 2, "run": 4, "wait": 4, "_": 112, "Self": 2, "self": 2, "Pid": 4, "spawn": 1, "fun": 1, "do_js": 4, "end": 12, "io": 10, "format": 11, "receive": 1, "finished": 2, "Parent": 4, "Test": 5, "random_test": 2, "Resp": 2, "call": 7, "<<": 30, "Sorted": 2, "sort": 9, "true": 22, "Tests": 3, "null": 2, "false": 20, "12.0e10": 1, "|": 107, "lists": 19, "split": 1, "random": 1, "uniform": 1, "length": 8, "Props": 2, "objsort": 4, "List": 6, "when": 54, "is_list": 1, "lstsort": 4, "Other": 6, "Other.": 2, "Acc": 14, "K": 2, "V": 2, "Rest": 14, "reverse": 32, "Val": 2, "application": 1, "sample": 2, "description": 1, "vsn": 1, "registered": 1, "mod": 1, "sample_app": 1, "applications": 1, "kernel": 1, "stdlib": 1, "env": 2, "modules": 1, "export": 3, "main/1": 1, "%": 557, "*": 41, "erlang": 10, "smp": 1, "enable": 1, "sname": 1, "factorial": 1, "mnesia": 1, "debug": 1, "verbose": 3, "String": 5, "try": 2, "F": 20, "fac": 4, "catch": 5, "usage": 3, "halt": 2, "Mode": 1, "coding": 1, "utf": 1, "tab": 1, "width": 1, "c": 8, "basic": 1, "offset": 1, "indent": 3, "tabs": 2, "mode": 4, "BSD": 1, "LICENSE": 1, "Copyright": 3, "Michael": 2, "Truog": 2, "": 1, "at": 3, "gmail": 1, "dot": 1, "com": 1, "All": 2, "rights": 1, "reserved.": 1, "Redistribution": 1, "and": 28, "use": 4, "in": 21, "source": 2, "binary": 4, "forms": 1, "with": 12, "or": 13, "without": 7, "modification": 1, "are": 10, "permitted": 1, "provided": 2, "that": 9, "the": 54, "following": 5, "conditions": 3, "met": 1, "Redistributions": 2, "of": 32, "must": 3, "retain": 1, "above": 2, "copyright": 2, "notice": 2, "this": 9, "list": 9, "disclaimer.": 1, "form": 1, "reproduce": 1, "disclaimer": 1, "documentation": 1, "and/or": 1, "other": 2, "materials": 2, "distribution.": 1, "advertising": 1, "mentioning": 1, "features": 1, "software": 5, "display": 1, "acknowledgment": 1, "This": 3, "product": 1, "includes": 2, "developed": 1, "by": 6, "The": 3, "name": 2, "author": 2, "may": 5, "not": 7, "be": 6, "used": 2, "to": 20, "endorse": 1, "promote": 1, "products": 1, "derived": 1, "from": 4, "specific": 3, "prior": 1, "written": 1, "permission": 1, "THIS": 3, "SOFTWARE": 2, "IS": 2, "PROVIDED": 1, "BY": 1, "THE": 5, "COPYRIGHT": 2, "HOLDERS": 1, "AND": 4, "CONTRIBUTORS": 2, "ANY": 6, "EXPRESS": 1, "OR": 10, "IMPLIED": 2, "WARRANTIES": 4, "INCLUDING": 3, "BUT": 2, "NOT": 3, "LIMITED": 2, "TO": 2, "OF": 11, "MERCHANTABILITY": 1, "FITNESS": 1, "FOR": 2, "A": 11, "PARTICULAR": 1, "PURPOSE": 1, "ARE": 1, "DISCLAIMED.": 1, "IN": 3, "NO": 1, "EVENT": 1, "SHALL": 1, "OWNER": 1, "BE": 1, "LIABLE": 1, "DIRECT": 1, "INDIRECT": 1, "INCIDENTAL": 1, "SPECIAL": 1, "EXEMPLARY": 1, "CONSEQUENTIAL": 1, "DAMAGES": 1, "PROCUREMENT": 1, "SUBSTITUTE": 1, "GOODS": 1, "SERVICES": 1, "LOSS": 1, "USE": 2, "DATA": 1, "PROFITS": 1, "BUSINESS": 1, "INTERRUPTION": 1, "HOWEVER": 1, "CAUSED": 1, "ON": 1, "THEORY": 1, "LIABILITY": 2, "WHETHER": 1, "CONTRACT": 1, "STRICT": 1, "TORT": 1, "NEGLIGENCE": 1, "OTHERWISE": 1, "ARISING": 1, "WAY": 1, "OUT": 1, "EVEN": 1, "IF": 1, "ADVISED": 1, "POSSIBILITY": 1, "SUCH": 1, "DAMAGE.": 1, "compile": 8, "sys": 2, "RelToolConfig": 5, "target_dir": 2, "TargetDir": 14, "overlay": 2, "OverlayConfig": 4, "file": 13, "consult": 1, "Spec": 2, "reltool": 2, "get_target_spec": 1, "case": 16, "make_dir": 1, "error": 18, "eexist": 1, "exit_code": 3, "eval_target_spec": 1, "root_dir": 1, "process_overlay": 2, "shell": 3, "Command": 3, "Arguments": 3, "CommandSuffix": 2, "os": 1, "cmd": 1, "flatten": 6, "io_lib": 3, "+": 265, "end.": 10, "boot_rel_vsn": 2, "Config": 2, "_RelToolConfig": 1, "rel": 2, "_Name": 1, "Ver": 1, "proplists": 1, "lookup": 1, "Ver.": 1, "minimal": 2, "parsing": 1, "for": 12, "handling": 1, "mustache": 11, "syntax": 1, "Body": 2, "Context": 11, "Result": 10, "_Context": 1, "KeyStr": 6, "mustache_key": 4, "C": 59, "Key": 2, "list_to_existing_atom": 1, "Value": 35, "dict": 2, "find": 1, "support": 2, "based": 1, "on": 6, "rebar": 2, "overlays": 1, "BootRelVsn": 2, "OverlayVars": 2, "from_list": 1, "erts_vsn": 1, "system_info": 1, "version": 2, "rel_vsn": 1, "hostname": 1, "net_adm": 1, "localhost": 1, "BaseDir": 7, "get_cwd": 1, "execute_overlay": 6, "_Vars": 1, "_BaseDir": 1, "_TargetDir": 1, "mkdir": 1, "Out": 4, "Vars": 7, "OutDir": 4, "filename": 3, "join": 3, "copy": 3, "In": 3, "InFile": 3, "OutFile": 2, "filelib": 1, "is_file": 1, "ExitCode": 2, "flush": 1, "Robert": 4, "Virding": 4, "Licensed": 2, "under": 6, "Apache": 2, "License": 8, "Version": 2, "you": 2, "except": 2, "compliance": 2, "License.": 4, "You": 2, "obtain": 2, "a": 40, "http": 2, "Unless": 2, "required": 4, "applicable": 2, "law": 2, "agreed": 2, "writing": 2, "distributed": 4, "is": 20, "an": 6, "BASIS": 2, "WITHOUT": 2, "CONDITIONS": 2, "KIND": 2, "either": 2, "express": 2, "implied.": 2, "See": 3, "language": 2, "governing": 2, "permissions": 2, "limitations": 2, "File": 2, "lfe_scan.xrl": 1, "Author": 2, "Purpose": 2, "Token": 26, "definitions": 2, "Lisp": 2, "Flavoured": 2, "Erlang.": 2, "Definitions.": 1, "B": 17, "O": 2, "D": 22, "H": 18, "9a": 2, "fA": 1, "B36": 1, "zA": 1, "Z": 3, "U": 2, "L": 19, "z": 2, "DEL": 2, "SYM": 8, "SSYM": 2, "WS": 2, "s": 5, "n": 5, "Rules.": 1, "Bracketed": 1, "Comments": 1, "using": 1, "#": 28, "foo": 6, "*#": 1, "block_comment": 2, "string": 14, "substr": 5, "TokenChars": 18, "Separators": 1, "TokenLine": 28, "token": 24, "@": 3, "list_to_atom": 3, "bB": 2, "mM": 1, "Characters": 1, "x": 7, "char_token": 4, "skip_past": 11, "Based": 1, "numbers": 1, "base_token": 15, "b": 15, "oO": 1, "o": 1, "dD": 1, "d": 4, "xX": 1, "X": 13, "rR": 1, "Scan": 1, "over": 1, "digit": 1, "chars": 15, "get": 15, "base.": 1, "Base": 16, "Ds": 2, "base1": 12, "tl": 1, "Strip": 4, "quotes.": 3, "S": 15, "TokenLen": 3, "Binary": 4, "Bin": 2, "unicode": 2, "characters_to_binary": 1, "utf8": 4, "Symbols": 1, "symbol_token": 4, "Funs": 1, "sharpsign": 1, "single": 1, "quote.": 1, "FunStr": 2, "Atoms": 1, "I": 2, "number": 11, "eE": 1, "list_to_float": 1, "skip_token.": 1, "Erlang": 5, "code.": 2, "lfe_scan.erl": 1, "start_symbol_char/1": 1, "symbol_char/1": 1, "import": 2, "substr/2": 1, "substr/3": 1, "start_symbol_char": 7, "Char": 2, "false.": 3, "symbol_char": 11, "Define": 1, "symbol": 5, "chars.": 1, "Symbol": 2, "quote": 1, "character": 2, "<": 20, "orelse": 2, "Chars": 2, "Line": 13, "E": 2, "Build": 1, "legal": 1, "characters": 3, "else": 3, "error.": 1, "Cs": 32, "Integer.": 1, "Convert": 3, "into": 4, "number.": 1, "We": 2, "only": 3, "allow": 1, "base": 1, "betqeen": 1, "optional": 1, "sign": 1, "first.": 1, "S*N": 1, "SoFar": 8, "Next": 6, "_Base": 2, "define": 7, "IS_UNICODE": 2, "16#10FFFF": 1, "InputChars": 2, "input": 3, "corresponding": 2, "character.": 1, "For": 2, "sequence": 1, "hex": 1, "we": 7, "check": 1, "resultant": 1, "range.": 1, "Chars.": 1, "characters.": 1, "know": 1, "correct.": 1, "Cs0": 4, "hex_char": 5, "Cs1": 2, "_Other": 1, "escape_char": 13, "f": 12, "BS": 1, "t": 3, "TAB": 1, "LF": 1, "v": 3, "VT": 1, "FF": 1, "r": 3, "CR": 1, "e": 3, "ESC": 1, "SPC": 1, "C.": 1, "Block": 1, "Comment": 1, "Provide": 1, "sensible": 1, "people": 1, "attempt": 1, "include": 2, "nested": 1, "comments": 1, "because": 3, "currently": 1, "parser": 2, "cannot": 1, "process": 1, "them": 1, "rebuild.": 1, "But": 2, "simply": 2, "exploding": 1, "going": 1, "helpful.": 1, "Check": 2, "str": 1, "skip_token": 1, "No": 1, "nesting": 1, "found": 1, "skip_until": 5, "Char1": 2, "Char2": 2, "String.": 2, "C1": 8, "C2": 8, "FILE": 1, "GENERATED.": 1, "DO": 1, "EDIT": 1, "IT": 1, "MANUALLY": 1, "sub_dirs": 1, "require_otp_vsn": 2, "cover_enabled": 1, "lib_dirs": 2, "erl_opts": 3, "debug_info": 3, "fail_on_warning": 1, "eunit_opts": 1, "erlydtl_opts": 2, "compiler_options": 1, "report": 2, "return": 1, "deps": 1, "rebar_lock_deps_plugin": 2, "git": 53, "node_package": 1, "goldrush": 1, "lager": 1, "syslog": 1, "lager_syslog": 1, "cluster_info": 1, "sidejob": 1, "erlang_js": 1, "meck": 1, "getopt": 1, "neotoma": 1, "cuttlefish": 1, "bitcask": 1, "eper": 1, "edown": 1, "sext": 1, "poolboy": 1, "basho_stats": 1, "riak_sysmon": 1, "eleveldb": 1, "riak_ensemble": 1, "pbkdf2": 1, "parse_trans": 1, "bear": 1, "folsom": 1, "setup": 1, "exometer_core": 1, "clique": 1, "riak_core": 1, "riak_pipe": 1, "protobuffs": 2, "riak_pb": 1, "mochiweb": 1, "webmachine": 1, "riak_api": 1, "riak_dt": 1, "eunit_formatters": 1, "riak_kv": 1, "merge_index": 1, "riak_search": 1, "erlydtl": 1, "riak_control": 1, "riaknostic": 1, "kvc": 1, "ibrowse": 1, "yokozuna": 1, "canola": 1, "riak_auth_mods": 1, "plugins": 1, "i": 2, "outdir": 1, "ref": 4, "level": 1, "nil": 13, "ex": 1, "ts": 1, "sw": 1, "ft": 1, "et": 1, "rebar.conf": 1, "shows": 1, "examples": 1, "some": 1, "options.": 1, "Core": 1, "Extend": 1, "always": 1, "recursive": 1, "commands": 1, "recursive_cmds": 1, "ERTS": 1, "OTP": 1, "release": 1, "require_erts_vsn": 1, "require_min_otp_vsn": 1, "Additional": 1, "library": 1, "directories": 1, "add": 1, "path": 1, "Compiler": 4, "files": 6, "before": 3, "rest.": 1, "Rebar": 1, "automatically": 1, "compiles": 1, "parse_transforms": 1, "custom": 1, "behaviours": 1, "anything": 1, "than": 4, "list.": 1, "erl_first_files": 1, "compiler": 6, "options": 4, "no_debug_info": 1, "src_dirs": 2, "platform_define": 3, "MIB": 1, "Options": 3, "mib_opts": 1, "SNMP": 1, "mibs": 1, "first": 3, "mib_first_files": 1, "leex": 2, "xrl_opts": 1, "xrl_first_files": 1, "yecc": 2, "yrl_opts": 1, "yrl_first_files": 1, "EDoc": 2, "edoc_opts": 1, "Port": 2, "compilation": 2, "environment": 1, "variables.": 1, "rebar_port_compiler.erl": 1, "more": 2, "info.": 1, "Default": 1, "port_env": 1, "port_specs": 2, "filenames": 1, "wildcards": 1, "compiled.": 1, "May": 1, "also": 1, "contain": 1, "tuple": 5, "consisting": 1, "regular": 1, "expression": 1, "applied": 1, "against": 1, "system": 1, "architecture": 1, "as": 5, "filter.": 1, "escriptize": 1, "escript_name": 1, "escript_incl_apps": 1, "escript_shebang": 1, "escript_comment": 1, "escript_emu_args": 1, "LFE": 3, "rest": 1, "lfe_first_files": 1, "reuse": 1, "ErlyDTL": 2, "Proto": 1, "proto_opts": 1, "Available": 1, "compilers": 1, "protocol": 1, "buffer": 1, "each": 1, "header": 1, "it": 3, "scans": 1, "thru": 1, "all": 2, "records": 1, "create": 1, "helper": 1, "functions": 2, "Helper": 1, "setters": 1, "getters": 1, "fields": 4, "fields_atom": 4, "type": 6, "module": 2, "record_helper": 1, "make/1": 1, "make/2": 1, "make": 3, "HeaderFiles": 5, "atom_to_list": 19, "||": 8, "<->": 7, "hrl": 1, "relative": 1, "current": 1, "dir": 1, "ModuleName": 3, "HeaderComment": 2, "ModuleDeclaration": 2, "Src": 10, "format_src": 8, "read": 4, "generate_type_default_function": 2, "write_file": 1, "erl": 1, "list_to_binary": 1, "HeaderFile": 4, "epp": 1, "parse_file": 1, "Tree": 4, "parse": 3, "Error": 8, "catched_error": 1, "T": 30, "Type": 3, "NSrc": 4, "_Type": 1, "Type1": 2, "parse_record": 3, "attribute": 1, "record": 4, "RecordInfo": 2, "RecordName": 41, "RecordFields": 10, "if": 7, "generate_setter_getter_function": 5, "generate_type_function": 3, "generate_fields_function": 2, "generate_fields_atom_function": 2, "parse_field_name": 5, "record_field": 9, "atom": 11, "FieldName": 26, "field": 4, "_FieldName": 2, "ParentRecordName": 8, "parent_field": 2, "parse_field_name_atom": 5, "concat": 5, "_S": 3, "concat_ext": 4, "parse_field": 6, "AccFields": 6, "AccParentFields": 6, "Field": 2, "PField": 2, "parse_field_atom": 4, "zzz": 1, "Fields": 4, "field_atom": 1, "to_setter_getter_function": 5, "setter": 2, "getter": 2, "auto": 1, "generated": 2, "file.": 1, "Please": 1, "don": 2, "record_utils": 1, "export_all": 1, "abstract_message": 21, "async_message": 12, "clientId": 5, "destination": 5, "messageId": 5, "timestamp": 5, "timeToLive": 5, "headers": 5, "body": 5, "correlationId": 5, "correlationIdBytes": 5, "Obj": 49, "is_record": 25, "Obj#abstract_message.body": 1, "Obj#abstract_message.clientId": 1, "Obj#abstract_message.destination": 1, "Obj#abstract_message.headers": 1, "Obj#abstract_message.messageId": 1, "Obj#abstract_message.timeToLive": 1, "Obj#abstract_message.timestamp": 1, "Obj#async_message.correlationId": 1, "parent": 5, "Obj#async_message.parent": 3, "ParentProperty": 6, "is_atom": 3, "set": 13, "NewObj": 20, "Obj#abstract_message": 7, "Obj#async_message": 3, "NewParentObject": 2, "undefined.": 1, "Nonterminals": 1, "grammar": 8, "expr_list": 8, "expr": 12, "container_expr": 10, "block_expr": 6, "access_expr": 29, "no_parens_expr": 32, "no_parens_zero_expr": 4, "no_parens_one_expr": 5, "no_parens_one_ambig_expr": 5, "bracket_expr": 4, "bracket_at_expr": 4, "bracket_arg": 8, "matched_expr": 52, "unmatched_expr": 36, "max_expr": 9, "unmatched_op_expr": 18, "matched_op_expr": 19, "no_parens_op_expr": 21, "no_parens_many_expr": 5, "comp_op_eol": 6, "at_op_eol": 10, "unary_op_eol": 9, "and_op_eol": 6, "or_op_eol": 6, "capture_op_eol": 7, "add_op_eol": 8, "mult_op_eol": 6, "two_op_eol": 6, "three_op_eol": 6, "pipe_op_eol": 11, "stab_op_eol": 5, "arrow_op_eol": 9, "match_op_eol": 6, "when_op_eol": 8, "in_op_eol": 6, "in_match_op_eol": 6, "type_op_eol": 7, "rel_op_eol": 6, "open_paren": 17, "close_paren": 16, "empty_paren": 5, "eoe": 16, "list_args": 6, "open_bracket": 8, "close_bracket": 7, "open_curly": 13, "close_curly": 11, "bit_string": 4, "open_bit": 5, "close_bit": 4, "map": 5, "map_op": 4, "map_close": 6, "map_args": 10, "map_expr": 8, "struct_op": 4, "assoc_op_eol": 8, "assoc_expr": 10, "assoc_base": 7, "assoc_update": 6, "assoc_update_kw": 4, "assoc": 4, "container_args_base": 10, "container_args": 7, "call_args_parens_expr": 6, "call_args_parens_base": 6, "call_args_parens": 12, "parens_call": 7, "call_args_no_parens_one": 6, "call_args_no_parens_ambig": 5, "call_args_no_parens_expr": 5, "call_args_no_parens_comma_expr": 6, "call_args_no_parens_all": 6, "call_args_no_parens_many": 8, "call_args_no_parens_many_strict": 6, "stab": 14, "stab_eoe": 5, "stab_expr": 9, "stab_op_eol_and_expr": 8, "stab_parens_many": 5, "kw_eol": 11, "kw_base": 6, "kw": 13, "call_args_no_parens_kw_expr": 5, "call_args_no_parens_kw": 10, "dot_op": 10, "dot_alias": 5, "dot_alias_container": 4, "dot_identifier": 9, "dot_op_identifier": 6, "dot_do_identifier": 5, "dot_paren_identifier": 4, "dot_bracket_identifier": 5, "do_block": 9, "fn_eoe": 4, "do_eoe": 7, "end_eoe": 5, "block_eoe": 5, "block_item": 5, "block_list": 6, "Terminals": 1, "identifier": 5, "kw_identifier": 4, "kw_identifier_safe": 3, "kw_identifier_unsafe": 3, "bracket_identifier": 4, "paren_identifier": 4, "do_identifier": 4, "block_identifier": 3, "fn": 2, "aliases": 3, "atom_safe": 2, "atom_unsafe": 2, "bin_string": 4, "list_string": 4, "sigil": 3, "dot_call_op": 2, "op_identifier": 5, "comp_op": 3, "at_op": 3, "unary_op": 3, "and_op": 3, "or_op": 3, "arrow_op": 4, "match_op": 3, "in_op": 3, "in_match_op": 3, "type_op": 3, "dual_op": 5, "add_op": 3, "mult_op": 3, "two_op": 3, "three_op": 3, "pipe_op": 3, "stab_op": 4, "when_op": 4, "assoc_op": 3, "capture_op": 3, "rel_op": 3, "eol": 39, "Rootsymbol": 1, "grammar.": 1, "Two": 1, "shift/reduce": 1, "conflicts": 1, "coming": 1, "call_args_parens.": 1, "Expect": 1, "Changes": 1, "ops": 1, "precedence": 2, "should": 1, "reflected": 1, "lib/elixir/lib/macro.ex": 1, "Note": 2, "though": 1, "operator": 2, "practice": 1, "has": 2, "lower": 1, "others": 1, "its": 1, "entry": 1, "table": 1, "user": 1, "bar": 5, "syntax.": 2, "Left": 32, "do.": 1, "Right": 27, "stab_op_eol.": 1, "Nonassoc": 4, "capture_op_eol.": 1, "&": 2, "in_match_op_eol.": 1, "allowed": 1, "matches": 1, "along": 1, "50": 1, "60": 1, "70": 1, "80": 1, "match_op_eol.": 1, "or_op_eol.": 1, "and_op_eol.": 1, "&&": 2, "comp_op_eol.": 1, "rel_op_eol.": 1, "arrow_op_eol.": 1, "in_op_eol.": 1, "three_op_eol.": 1, "two_op_eol.": 1, "..": 1, "add_op_eol.": 1, "mult_op_eol.": 1, "/": 1, "unary_op_eol.": 1, "dot_call_op.": 1, "dot_op.": 1, "at_op_eol.": 1, "dot_identifier.": 1, "MAIN": 1, "FLOW": 1, "EXPRESSIONS": 1, "nil.": 3, "to_block": 6, "Elixir": 1, "have": 3, "three": 1, "syntaxes": 1, "parentheses": 6, "do": 13, "blocks.": 2, "They": 1, "represented": 1, "AST": 1, "matched": 1, "no_parens": 1, "unmatched.": 1, "Calls": 1, "further": 1, "divided": 1, "according": 1, "how": 1, "problematic": 1, "they": 1, "no_parens_one": 1, "one": 2, "unproblematic": 1, "argument": 3, "e.g.": 4, "g": 6, "similar": 2, "unary": 1, "operators": 1, "no_parens_many": 2, "several": 1, "arguments": 1, "no_parens_one_ambig": 3, "which": 1, "itself": 1, "h": 1, "particular": 2, "expressions": 1, "ambiguous": 1, "interpreted": 2, "such": 3, "outer": 1, "function": 2, "arity": 2, "rather": 1, "Hence": 1, "no_parens_one_ambig.": 1, "distinction": 1, "can": 3, "block": 3, "inside": 2, "another": 1, "unless": 1, "there": 1, "invalid": 3, "valid": 3, "Similarly": 1, "possible": 1, "nest": 1, "calls": 3, "their": 1, "So": 1, "different": 1, "rules": 1, "need": 1, "take": 1, "account": 1, "blocks": 1, "segments": 1, "act": 1, "accordingly.": 1, "build_op": 14, "element": 29, "build_unary_op": 16, "throw_invalid_kw_identifier": 3, "build_identifier": 19, "build_nested_parens": 3, "Warn": 2, "no": 2, "parens": 2, "subset": 2, "warn_pipe": 5, "Allow": 2, "keywords": 1, "From": 1, "point": 1, "just": 1, "constructs": 1, "access": 1, "Notice": 1, "dot_": 1, "included": 1, "tokenizer": 1, "marks": 1, "identifiers": 1, "followed": 1, "brackets": 1, "bracket_identifier.": 1, "exprs": 11, "build_fn": 3, "build_stab": 17, "id": 4, "build_bin_string": 3, "build_list_string": 3, "build_sigil": 2, "Aliases": 1, "properly": 1, "formed": 1, "calls.": 1, "Used": 1, "map_expr.": 1, "build_quoted_atom": 8, "build_list": 6, "build_access": 5, "Blocks": 2, "Here": 1, "while": 1, "expression.": 1, "unwrap_when": 2, "unwrap_splice": 6, "meta_from_token": 22, "warn_empty_stab_clause": 2, "Helpers": 1, "build_dot": 6, "build_dot_alias": 4, "build_dot_container": 2, "Fun/local": 1, "throw_no_parens_many_strict": 3, "throw_no_parens_strict": 3, "throw_no_parens_container_strict": 2, "build_tuple": 4, "build_bit": 3, "unquote/@something/aliases": 1, "maps": 1, "structs.": 1, "build_map": 3, "build_map_update": 5, "elixir_parser_file": 1, "location": 3, "meta": 4, "Node": 6, "rearrange_uop": 3, "Op": 20, "directive": 1, "needed": 1, "significantly": 1, "faster": 1, ".erl": 1, "HiPE": 1, "hipe": 1, "regalloc": 1, "linear_scan": 1, "reverse/1": 1, "reverse/2": 1, "Counter": 2, "counter": 1, "meta_from_location": 14, "Column": 2, "EndColumn": 2, "is_integer": 3, "line": 3, "Operators": 1, "_Kind": 3, "Location": 23, "UOp": 3, "Expr": 6, "Marker": 16, "Args": 24, "_Marker": 1, "Pipe": 2, "Extra": 2, "build_block": 7, "Exprs": 6, "unquote_splicing": 4, "Dots": 1, "Dot": 12, "_Dot": 1, "Atom": 2, "throw_bad_atom": 2, "Meta": 36, "extract_identifier": 2, "Kind": 6, "Identifier": 8, "Identifier.": 1, "Identifiers": 1, "Args1": 2, "Args2": 2, "FArgs": 2, "Arg": 2, "ambiguous_op": 1, "Fn": 1, "Stab": 2, "_Stab": 1, "throw": 11, "Access": 1, "Interpolation": 1, "aware": 1, "Sigil": 2, "Parts": 4, "Modifiers": 2, "string_parts": 5, "_Location": 3, "is_binary": 4, "elixir_utils": 2, "characters_to_list": 1, "to_char_list": 1, "Safe": 4, "binary_to_atom_op": 4, "binary_to_existing_atom": 1, "binary_to_atom.": 1, "string_part": 3, "Part": 2, "Tokens": 4, "Form": 2, "string_tokens_parse": 2, "to_string": 1, "Forms": 2, "Keywords": 1, "Else": 2, "Old": 2, "New": 2, "Temp": 6, "Every": 1, "time": 1, "sees": 1, "assumes": 1, "being": 1, "spliced": 1, "wrapping": 1, "splicing": 1, "__block__.": 1, "clause": 1, "arg": 1, "style": 1, "call.": 1, "unwraps": 1, "splice": 1, "Splice": 2, "split_last": 1, "Start": 2, "End": 2, "One": 2, "Warnings": 1, "errors": 1, "keyfind": 1, "MODULE": 1, "elixir_tokenizer": 1, "invalid_do_error": 1, "KW": 2, "TODO": 1, "Make": 1, "those": 1, "warnings": 1, "errors.": 1, "_Begin": 2, "_End": 2, "elixir_errors": 2, "warn": 2, "_Token": 1, "ok.": 1, "loop": 7, "eof": 1, "stop": 1, "Reason": 2 }, "F#": { "namespace": 7, "Nessos.FsPickler.Tests": 2, "open": 34, "System": 6, "System.Collections.Generic": 3, "PerfUtil": 2, "Nessos.FsPickler": 7, "Nessos.FsPickler.Tests.TestTypes": 1, "module": 4, "PerformanceTests": 1, "type": 18, "Marker": 1, "class": 1, "end": 2, "let": 135, "guid": 2, "Guid.NewGuid": 1, "(": 218, ")": 216, "[": 71, "": 34, "1000": 13, "]": 71, "Value": 5, "Guid": 1, "s": 68, "roundtrip": 34, "date": 2, "DateTime.Now": 2, "DateTime": 2, "10000": 9, "String": 4, "stringValue": 12, "boxed": 2, "box": 11, "|": 73, "..": 9, "Boxed": 1, "Object": 1, "fsClass": 2, "new": 52, "Class": 5, "Simple": 1, "F#": 1, "serializableClass": 2, "SerializableClass": 2, "<_>": 4, "ISerializable": 1, "boxedClass": 2, "Some": 6, "Subtype": 1, "Resolution": 1, "floatArray": 2, "Array.init": 3, "fun": 7, "i": 29, "-": 40, "float": 2, "10": 3, "Array": 7, "Float": 2, "intArray": 2, "id": 4, "Int": 3, "stringArray": 2, "+": 4, "string": 45, "100": 9, "kvarr": 2, "Array.map": 1, "Key": 2, "Pairs": 1, "duArray": 2, "for": 9, "in": 14, "Something": 1, "Discriminated": 1, "Unions": 1, "objArray": 2, ";": 17, "<": 32, "": 4, "option": 3, "Objects": 1, "array3D": 2, "Array3D.init": 1, "j": 2, "k": 2, "*": 1, "Rank": 1, "bclDict": 2, "dict": 1, ".NET": 4, "Dictionary": 1, "bclStack": 2, "Stack": 4, "": 14, "bclList": 2, "List": 6, "int": 4, "bclSet": 2, "SortedSet": 1, "Set": 2, "smallTuple": 2, "FSharp": 15, "Tuple": 3, "Small": 2, "largeTuple": 2, "true": 15, "Large": 2, "intList": 2, "stringList": 2, "pairList": 2, "nestedLst": 2, "n": 10, "_": 18, "Nested": 1, "union": 2, "SomethingElse": 1, "Union": 1, "record": 2, "{": 5, "}": 5, "Record": 1, "peano": 2, "int2Peano": 1, "Peano": 1, "Rectype": 1, "closure": 2, "@": 5, "Set.ofList": 1, "Curried": 1, "Function": 1, "binTree": 2, "mkTree": 1, "Binary": 1, "Tree": 1, "intSet": 2, "List.map": 2, "set": 9, "fsMap": 2, "Seq.map": 2, "Map.ofSeq": 1, "Map": 2, "testType": 2, "typeof": 2, "ref": 1, "Reflection": 1, "Type": 1, "quotationSmall": 2, "x": 4, "pown": 1, "quotationLarge": 2, "async": 2, "rec": 1, "fibAsync": 4, "match": 7, "with": 18, "when": 2, "return": 4, "invalidArg": 2, "fn": 2, "fnn": 2, "values": 2, "Async.Parallel": 1, "Seq.sum": 1, "Quotation": 2, "Nessos.FsPickler.Json": 6, "internal": 5, "OAttribute": 1, "DAttribute": 1, "///": 62, "": 12, "Json": 14, "pickler": 13, "instance.": 5, "": 16, "JsonSerializer": 2, "inherit": 7, "FsPicklerTextSerializer": 2, "val": 4, "private": 3, "format": 4, "JsonPickleFormatProvider": 3, "Initializes": 3, "a": 12, "": 15, "name=": 15, "indent": 11, "out": 2, "pickles.": 4, "": 15, "omit": 2, "FsPickler": 9, "header": 2, "specify": 3, "custom": 5, "name": 3, "converter.": 3, "": 8, "D": 8, "null": 13, "omitHeader": 19, "typeConverter": 12, "defaultArg": 2, "false": 22, "json": 6, "Gets": 4, "or": 4, "sets": 4, "whether": 3, "output": 1, "should": 4, "be": 4, "indented.": 1, "member": 77, "x.Indent": 1, "get": 8, "x.format.Indent": 2, "and": 6, "b": 4, "<->": 15, "summary": 4, "headers": 1, "ignored": 1, "pickle": 5, "format.": 2, "x.OmitHeader": 1, "x.format.OmitHeader": 2, "non": 2, "whitespace": 2, "that": 1, "serves": 1, "as": 2, "top": 2, "level": 2, "sequence": 1, "separator.": 2, "x.SequenceSeparator": 1, "x.format.SequenceSeparator": 2, "sep": 6, "sequences": 1, "serialized": 1, "using": 1, "the": 5, "e": 2, "BSON": 2, "BsonSerializer": 2, "FsPicklerSerializer": 1, "BsonPickleFormatProvider": 1, "static": 3, "methods.": 1, "CreateJson": 1, "Bson": 5, "CreateBson": 1, "System.IO": 3, "Newtonsoft.Json": 3, "serializer.": 1, "JsonPickleWriter": 3, "jsonWriter": 35, "JsonWriter": 1, "indented": 2, "isTopLevelSequence": 19, "separator": 2, "leaveOpen": 16, "do": 7, "jsonWriter.Formatting": 1, "if": 36, "then": 38, "Formatting": 2, "Indented": 1, "else": 22, "None": 2, "CloseOutput": 1, "not": 10, "isBsonWriter": 2, "BsonWriter": 1, "mutable": 5, "depth": 35, "isTopLevelSequenceHead": 4, "currentValueIsNull": 4, "arrayStack": 5, "arrayStack.Push": 4, "Int32.MinValue": 2, "omitTag": 45, "&&": 10, "||": 2, "arrayStack.Peek": 2, "interface": 4, "IPickleFormatWriter": 1, "__.BeginWriteRoot": 1, "tag": 88, "jsonWriter.WriteStartObject": 1, "writePrimitive": 23, "jsonFormatVersion": 2, "__.EndWriteRoot": 1, "jsonWriter.WriteEnd": 1, "__.BeginWriteObject": 1, "flags": 4, "ObjectFlags": 5, "jsonWriter.WritePropertyName": 1, "flags.HasFlag": 1, "ObjectFlags.IsNull": 2, "WriteNull": 2, "elif": 2, "HasFlag": 1, "IsSequenceHeader": 3, "0": 2, "WriteStartArray": 1, "Push": 1, "1": 9, "WriteStartObject": 1, "flagCsv": 2, "mkFlagCsv": 1, "_flags": 1, "__": 26, "EndWriteObject": 1, "Peek": 1, "WriteEndArray": 1, "Pop": 1, "ignore": 11, "jsonWriter.WriteEndObject": 1, "__.SerializeUnionCaseNames": 2, "__.PreferLengthPrefixInSequences": 2, "__.WriteNextSequenceElement": 1, "hasNext": 1, "WriteWhitespace": 1, "WriteCachedObjectId": 1, "WriteBoolean": 1, "value": 51, "WriteByte": 1, "WriteSByte": 1, "WriteInt16": 1, "WriteInt32": 1, "WriteInt64": 1, "WriteUInt16": 1, "WriteUInt32": 1, "WriteUInt64": 1, "WriteSingle": 1, "WriteDouble": 1, "WriteDecimal": 1, "WriteChar": 1, "WriteString": 1, "WriteBigInteger": 1, "WriteGuid": 1, "WriteTimeSpan": 1, "spec": 2, "mandates": 1, "use": 1, "of": 4, "Unix": 1, "time": 1, "this": 1, "has": 1, "millisecond": 1, "precision": 1, "which": 1, "results": 1, "loss": 1, "accuracy": 1, "w": 1, "r": 1, "t": 1, "ticks": 4, "since": 1, "goal": 1, "is": 1, "to": 4, "offer": 1, "faithful": 1, "representations": 1, "NET": 1, "objects": 1, "we": 1, "choose": 1, "override": 5, "serialize": 1, "outright": 1, "see": 2, "also": 1, "https": 2, "codeplex": 1, "com": 2, "discussions": 1, "212067": 1, "WriteDate": 1, "Ticks": 1, "WriteBytes": 1, "byte": 3, "WritePropertyName": 1, "obj": 1, "ReferenceEquals": 1, "WriteValue": 1, "WritePrimitiveArray": 1, "raise": 11, "NotSupportedException": 3, "Dispose": 1, "Flush": 1, "System.Globalization": 1, "System.Numerics": 1, "System.Text": 2, "deserializer": 1, "JsonPickleReader": 3, "jsonReader": 7, "JsonReader": 1, "jsonReader.CloseInput": 1, "SupportMultipleContent": 1, "isBsonReader": 4, "BsonReader": 1, "IPickleFormatReader": 1, "__.BeginReadRoot": 1, "jsonReader.Read": 7, "jsonReader.TokenType": 7, "JsonToken.StartObject": 1, "FormatException": 6, "jsonReader.MoveNext": 8, "version": 6, "jsonReader.ReadPrimitiveAs": 21, "v": 1, "Version": 1, "sprintf": 3, "sTag": 3, "InvalidPickleTypeException": 1, "__.EndReadRoot": 1, "__.BeginReadObject": 1, "jsonReader.ReadProperty": 4, "TokenType": 1, "JsonToken": 3, "Null": 1, "JsonToken.StartArray": 1, "StartObject": 1, "ValueAs": 1, "csvFlags": 2, "jsonReader.ValueAs": 7, "parseFlagCsv": 1, "ObjectFlags.None": 1, "token": 4, "__.EndReadObject": 1, "arrayStack.Pop": 2, "Read": 1, "JsonToken.Null": 2, "JsonToken.EndObject": 1, "EndArray": 1, "__.ReadNextSequenceElement": 1, "JsonToken.None": 1, "JsonToken.EndArray": 1, "__.ReadCachedObjectId": 1, "": 10, "__.ReadBoolean": 1, "": 1, "__.ReadByte": 1, "__.ReadSByte": 1, "sbyte": 1, "__.ReadInt16": 1, "int16": 1, "__.ReadInt32": 1, "__.ReadInt64": 1, "__.ReadUInt16": 1, "uint16": 1, "__.ReadUInt32": 1, "uint32": 1, "__.ReadUInt64": 1, "uint64": 1, "__.ReadSingle": 1, "JsonToken.Float": 2, "": 2, "single": 1, "JsonToken.String": 2, "Single.Parse": 1, "CultureInfo.InvariantCulture": 2, "__.ReadDouble": 1, "Double.Parse": 1, "__.ReadChar": 1, "value.": 3, "__.ReadString": 1, "__.ReadBigInteger": 1, "BigInteger.Parse": 1, "__.ReadGuid": 1, "": 1, "Guid.Parse": 1, "__.ReadTimeSpan": 1, "TimeSpan.Parse": 1, "__.ReadDecimal": 1, "decimal": 1, "__.ReadDate": 1, "": 1, "__.ReadBytes": 1, "bytes": 2, "": 1, "base64": 2, "Convert.FromBase64String": 1, "__.ReadPrimitiveArray": 1, "NotImplementedException": 1, "__.Dispose": 1, "IDisposable": 1, ".Dispose": 1, "Sample": 1, "Foo": 1, "Bar": 1, "Baz": 1, "Sample1": 1, "xs": 2, "list": 1, "String.concat": 1, "Factory": 1, "methods": 3, "serialization": 1, "self": 1, "isCustomSeq": 5, "self.OmitHeader": 1, "sequenceSeparator": 5, "Indent": 1, "OmitHeader": 1, "__.SequenceSeparator": 1, "String.IsNullOrWhiteSpace": 1, "SequenceSeparator": 1, "ITextPickleFormatProvider": 1, "Name": 1, "discussion": 1, "github": 1, "nessos": 1, "issues": 1, "17": 1, "DefaultEncoding": 1, "UTF8Encoding": 1, "Encoding": 1, "__.CreateWriter": 2, "stream": 6, "encoding": 6, "#if": 2, "NET40": 2, "sw": 3, "StreamWriter": 2, "#else": 2, "#endif": 2, "jw": 4, "JsonTextWriter": 2, "__.OmitHeader": 4, "__.Indent": 2, "__.CreateReader": 2, "sr": 3, "StreamReader": 2, "jr": 4, "JsonTextReader": 2, "textWriter": 2, "textReader": 2, "PerfUtil.NUnit": 1, "NUnit.Framework": 1, "": 1, "PerfTester": 4, "NUnitPerf": 1, "": 2, "tests": 2, "PerfTest.OfModuleMarker": 1, "": 1, "__.PerfTests": 1, "Serializer": 8, "Comparison": 3, "fsp": 4, "FsPickler.initBinary": 3, "bfs": 2, "BinaryFormatterSerializer": 1, "ndc": 2, "NetDataContractSerializer": 1, "jdn": 2, "JsonDotNetSerializer": 1, "bdn": 2, "JsonDotNetBsonSerializer": 1, "pbn": 2, "ProtoBufSerializer": 1, "ssj": 2, "ServiceStackJsonSerializer": 1, "sst": 2, "ServiceStackTypeSerializer": 1, "comparer": 6, "WeightedComparer": 2, "spaceFactor": 2, "leastAcceptableImprovementFactor": 2, "tester": 6, "ImplementationComparer": 2, "throwOnError": 3, "warmup": 3, "__.PerfTester": 3, "Formats": 1, "binary": 2, "FsPickler.initJson": 1, "bson": 2, "FsPickler.initBson": 1, "xml": 2, "FsPickler.initXml": 1, "Past": 1, "Versions": 1, "persistResults": 2, "persistenceFile": 2, "": 1, ".Assembly.GetName": 1, ".Version": 1, "PastImplementationComparer": 1, "historyFile": 1, "": 1, "__.Persist": 1, "tester.PersistCurrentResults": 1, "Nessos.FsPickler.Combinators": 1, "pickling": 2, "": 2, "jsonSerializer": 1, "lazy": 2, "FsPickler.CreateJson": 1, "Pickles": 2, "Json.": 2, "utilized": 4, "pickler.": 4, "input": 4, "Pickler": 4, "T": 4, "Unpickles": 2, "from": 2, "pickle.": 2, "unpickle": 2, "bsonPickler": 1, "FsPickler.CreateBson": 1, "Bson.": 1, "bsonPickler.Value.Pickle": 1, "bson.": 1, "bsonPickler.Value.UnPickle": 1 }, "FIGlet Font": { "flf2a": 1, "Ivrit": 1, "(": 60, "Hebrew": 3, ")": 61, "Unicode": 1, "font": 1, "assembled": 1, "by": 6, "John": 1, "Cowan": 1, "": 1, "ccil": 1, "org": 1, "Latin": 2, "chars": 2, "from": 2, "Standard": 1, "G.": 1, "Chappell": 1, "&": 1, "Ian": 1, "Chai": 1, "Jerusalem": 1, "Gedaliah": 1, "Friedenberg": 1, "": 1, "nyx": 1, "cs": 1, "du": 1, "edu": 1, "Use": 3, "for": 5, "keyboard": 2, "mapping": 2, "U.S.": 1, "-": 9, "style": 1, "script": 1, "ISO": 1, "text": 1, "Or": 1, "use": 2, "UTF": 1, "WARNING": 1, "FIGfonts": 1, "aren": 1, "default": 2, "even": 1, "the": 1, "characters.": 1, "figlet": 1, "release": 1, "November": 1, "Modified": 1, "Paul": 1, "Burton": 1, "": 1, "earthlink": 1, "net": 1, "12/96": 1, "to": 1, "include": 1, "new": 2, "parameter": 1, "supported": 1, "FIGlet": 1, "and": 1, "FIGWin.": 1, "May": 1, "also": 1, "be": 1, "slightly": 1, "modified": 1, "better": 1, "of": 3, "full": 1, "width/kern/smush": 1, "alternatives": 1, "but": 1, "output": 1, "is": 1, "NOT": 1, "changed.": 1, "@": 643, "@@": 141, "_": 308, "|": 786, "V": 11, "||": 8, "..": 1, "/": 113, "__": 71, "/@": 25, "__@": 17, "/_": 8, "/_/": 14, "___": 48, "<": 6, "___/": 16, "__/": 6, "_____": 21, "____": 25, "____/": 6, ".": 9, "_/": 7, "_____@": 1, "/____": 1, "_.__/": 1, "__/@": 1, ".__/": 1, "___/@": 1, "____@": 1, "/___": 1, "_/@": 2, "NO": 1, "BREAK": 1, "SPACE": 1, "SOFT": 1, "HYPHEN": 1, "LATIN": 7, "CAPITAL": 3, "LETTER": 34, "A": 2, "WITH": 6, "DIAERESIS": 6, "O": 2, "U": 2, "SMALL": 4, "SHARP": 1, "S": 1, "HEBREW": 27, "ALEF": 1, "BET": 1, "______": 7, "_@": 1, "/________/@": 1, "GIMEL": 1, "/____/": 1, "DALET": 1, "_______": 10, "HE": 1, "VAV": 1, "ZAYIN": 1, "________": 2, "HET": 1, "TET": 1, "YOD": 1, "FINAL": 5, "KAF": 2, "_____/": 2, "LAMED": 1, "MEM": 2, "NUN": 2, "SAMEKH": 1, "AYIN": 1, "PE": 2, "TSADI": 2, "//": 2, "__.@": 1, "QOF": 1, "RESH": 1, "SHIN": 1, "_______/": 1, "TAV": 1, "STAR": 1, "OF": 1, "DAVID": 1, "aleph": 2, "t": 2, "bet/vet": 2, "c": 2, "gimel": 2, "d": 2, "dalet": 2, "s": 2, "he": 2, "v": 2, "vav": 2, "u": 2, "zayin": 2, "z": 2, "het": 2, "j": 2, "tet": 2, "y": 2, "yod": 2, "h": 2, "kaf/chaf": 2, "f": 2, "final": 10, "kaf": 2, "l": 2, "lamed": 2, "k": 2, "mem": 4, "n@": 1, "o": 2, "nun": 4, "b": 2, "i": 2, "samekh": 2, "x": 2, "ayin": 2, "g": 2, "pe/fe": 2, "p": 2, "pe": 2, ";": 1, "tsadi": 4, "m": 1, "qof": 2, "e": 2, "resh": 2, "r": 2, "shin/sin": 2, "a": 2, "tav": 2, "comma": 1, "Star": 2, "David": 2, "*": 2, "m@": 1, "n": 1, "w": 1, "q": 1 }, "FLUX": { "Listen": 9, "(": 140, ")": 140, "int": 87, "socket": 32, ";": 143, "ReadRequest": 4, "bool": 22, "close": 22, "image_tag": 22, "*request": 22, "CheckCache": 6, "Compress": 4, "__u8": 3, "*rgb_data": 3, "Write": 4, "Complete": 6, "source": 9, "Image": 2, "-": 32, "Handler": 7, "typedef": 18, "hit": 2, "TestInCache": 2, "[": 18, "_": 56, "]": 18, "ReadInFromDisk": 5, "StoreInCache": 5, "handle": 2, "error": 2, "FourOhFor": 2, "atomic": 16, "{": 16, "cache": 6, "}": 16, "choke": 2, "TestChoke": 1, "unchoke": 2, "TestUnchoke": 1, "interested": 2, "TestInterested": 1, "uninterested": 2, "TestUninterested": 1, "request": 2, "TestRequest": 1, "cancel": 2, "TestCancel": 1, "piece": 7, "TestPiece": 1, "bitfield": 2, "TestBitfield": 1, "have": 2, "TestHave": 1, "piececomplete": 2, "TestPieceComplete": 1, "CheckinWithTracker": 4, "torrent_data_t": 44, "*tdata": 44, "SendRequestToTracker": 2, "GetTrackerResponse": 2, "UpdateChokeList": 4, "PickChoked": 2, "chokelist_t": 2, "clist": 2, "SendChokeUnchoke": 2, "SetupConnection": 4, "Handshake": 2, "client_data_t": 38, "*client": 38, "SendBitfield": 2, "Message": 4, "ReadMessage": 8, "type": 17, "length": 11, "char": 11, "*payload": 11, "HandleMessage": 11, "MessageDone": 2, "CompletePiece": 3, "VerifyPiece": 2, "SendHave": 2, "SendUninterested": 2, "Choke": 2, "Cancel": 2, "Interested": 2, "Uninterested": 2, "Bitfield": 2, "Unchoke": 2, "SendRequest": 4, "Have": 2, "Piece": 2, "Request": 2, "SendKeepAlives": 3, "GetClients": 6, "maxfd": 2, "fd_set": 4, "*fds": 4, "SelectSockets": 2, "CheckSockets": 3, "TrackerTimer": 2, "ChokeTimer": 2, "Connect": 2, "KeepAliveTimer": 2, "BigLock": 7, "xml": 1, "TestXML": 1, "html": 1, "TestHTML": 1, "inCache": 2, "Page": 3, "engine": 2, "isEngineMessage": 1, "turn": 2, "isTurnMessage": 1, "connect": 2, "isConnectMessage": 1, "disconnect": 2, "isDisconnectMessage": 1, "ClientMessage": 3, "char*": 11, "data": 9, "ParseMessage": 2, "client": 14, "ParseEngine": 2, "direction": 4, "DoEngine": 2, "ParseTurn": 2, "DoTurn": 2, "ParseConnect": 2, "host": 2, "port": 2, "DoConnect": 3, "ParseDisconnect": 2, "DoDisconnect": 3, "UpdateBoard": 2, "ClientList": 8, "clients": 8, "SendData": 2, "DoUpdate": 3, "DataTimer": 3, "Wait": 2, "client_lock": 3 }, "Fantom": { "mixin": 1, "Expr": 7, "{": 30, "abstract": 1, "Obj": 5, "eval": 3, "(": 73, ")": 73, "}": 30, "class": 4, "Constant": 1, "value": 4, "new": 2, "make": 2, "this.value": 1, "override": 2, "enum": 1, "Op": 3, "plus": 1, "minus": 1, "Infix": 1, "op": 4, "left": 11, "right": 10, "this.op": 1, "this.left": 1, "this.right": 1, "switch": 1, "case": 2, "Op.plus": 1, "return": 11, "Int": 12, "left.eval": 2, "+": 15, "right.eval": 2, "Op.minus": 1, "-": 2, "default": 1, "throw": 1, "Err": 1, "Spelling": 1, "**": 10, "Load": 1, "sample": 1, "text": 2, "and": 2, "offer": 1, "corrections": 2, "for": 4, "input": 1, "static": 11, "Void": 1, "main": 1, "Str": 27, "[": 17, "]": 17, "args": 1, "File.os": 1, ".readAllStr": 1, "counts": 14, "def": 1, "text.split.each": 1, "|": 14, "word": 27, "args.each": 1, "arg": 2, "echo": 1, "correction": 3, "const": 1, "Range": 1, "letters": 1, "Range.makeInclusive": 1, "Most": 1, "probable": 1, "spelling": 2, ".": 6, "candidates": 2, ".max": 1, "x": 2, "y": 2, "<": 3, "Generate": 1, "possible": 1, "result": 6, "known": 4, "if": 4, "result.size": 3, "edits1": 4, "edits2": 2, "The": 1, "subset": 1, "of": 2, "words": 2, "that": 3, "appear": 1, "in": 1, "the": 1, "map": 1, "words.findAll": 1, "i": 26, ".unique": 1, "All": 2, "edits": 6, "are": 2, "one": 1, "edit": 1, "away": 2, "from": 2, ";": 2, "word.size": 6, "edits.add": 2, "delete": 2, "transpose": 2, "edits.addAll": 2, "replace": 2, "insert": 2, "edits.unique": 1, "edits.remove": 1, "Word": 4, "with": 5, "th": 3, "letter": 4, "removed.": 1, "word.getRange": 8, "Range.makeExclusive": 9, "st": 1, "swapped.": 1, "first": 2, "right.get": 2, ".toChar": 2, "second": 2, "rest": 2, "right.getRange": 1, "right.size": 1, "replaced": 1, "every": 1, "other": 1, "letter.": 1, "letters.map": 2, "ch": 2, "ch.toChar": 2, "each": 1, "inserted": 1, "at": 1, "two": 1, ".map": 1, "w": 2, ".flatten": 1 }, "Filebench WML": { "#": 8, "set": 7, "dir": 3, "/tmp": 1, "nfiles": 3, "meandirwidth": 3, "meanfilesize": 3, "16k": 1, "iosize": 5, "1m": 1, "nthreads": 2, "mode": 1, "quit": 1, "firstdone": 1, "define": 3, "fileset": 2, "name": 10, "bigfileset": 2, "path": 2, "size": 2, "entries": 2, "dirwidth": 2, "prealloc": 1, "paralloc": 1, "destfiles": 2, "process": 1, "filereader": 1, "instances": 2, "{": 2, "thread": 1, "filereaderthread": 1, "memsize": 1, "10m": 1, "flowop": 6, "openfile": 1, "openfile1": 1, "filesetname": 2, "fd": 6, "readwholefile": 1, "readfile1": 1, "createfile": 1, "createfile2": 1, "writewholefile": 1, "writefile2": 1, "srcfd": 1, "closefile": 2, "closefile1": 1, "closefile2": 1, "}": 2, "echo": 1 }, "Filterscript": { "#pragma": 2, "version": 1, "(": 24, ")": 24, "rs": 1, "java_package_name": 1, "foo": 1, "int": 3, "__attribute__": 5, "kernel": 5, "root": 2, "uint32_t": 5, "ain": 3, "{": 7, "return": 4, ";": 10, "}": 7, "void": 3, "in_only": 1, "out_only": 1, "everything": 1, "x": 1, "y": 1, "#include": 1, "static": 1, "rs_matrix4x4": 2, "Mat": 4, "init": 1, "rsMatrixLoadIdentity": 1, "&": 2, "setMatrix": 1, "m": 2, "uchar4": 2, "in": 2, "float4": 1, "f": 6, "convert_float4": 1, "rsMatrixMultiply": 1, "clamp": 1, "convert_uchar4": 1 }, "Formatted": { "Weekly": 1, "SST": 5, "data": 1, "starts": 1, "week": 1, "centered": 1, "on": 1, "3Jan1990": 1, "Nino1": 1, "+": 1, "Nino3": 1, "Nino34": 1, "Nino4": 1, "Week": 1, "SSTA": 4, "03JAN1990": 1, "-": 2816, "10JAN1990": 1, "17JAN1990": 1, "24JAN1990": 1, "31JAN1990": 1, "07FEB1990": 1, "14FEB1990": 1, "21FEB1990": 1, "28FEB1990": 1, "07MAR1990": 1, "14MAR1990": 1, "21MAR1990": 1, "28MAR1990": 1, "04APR1990": 1, "11APR1990": 1, "18APR1990": 1, "25APR1990": 1, "02MAY1990": 1, "09MAY1990": 1, "16MAY1990": 1, "23MAY1990": 1, "30MAY1990": 1, "06JUN1990": 1, "13JUN1990": 1, "20JUN1990": 1, "27JUN1990": 1, "04JUL1990": 1, "11JUL1990": 1, "18JUL1990": 1, "25JUL1990": 1, "01AUG1990": 1, "08AUG1990": 1, "15AUG1990": 1, "22AUG1990": 1, "29AUG1990": 1, "05SEP1990": 1, "12SEP1990": 1, "19SEP1990": 1, "26SEP1990": 1, "03OCT1990": 1, "10OCT1990": 1, "17OCT1990": 1, "24OCT1990": 1, "31OCT1990": 1, "07NOV1990": 1, "14NOV1990": 1, "21NOV1990": 1, "28NOV1990": 1, "05DEC1990": 1, "12DEC1990": 1, "19DEC1990": 1, "26DEC1990": 1, "02JAN1991": 1, "09JAN1991": 1, "16JAN1991": 1, "23JAN1991": 1, "30JAN1991": 1, "06FEB1991": 1, "13FEB1991": 1, "20FEB1991": 1, "27FEB1991": 1, "06MAR1991": 1, "13MAR1991": 1, "20MAR1991": 1, "27MAR1991": 1, "03APR1991": 1, "10APR1991": 1, "17APR1991": 1, "24APR1991": 1, "01MAY1991": 1, "08MAY1991": 1, "15MAY1991": 1, "22MAY1991": 1, "29MAY1991": 1, "05JUN1991": 1, "12JUN1991": 1, "19JUN1991": 1, "26JUN1991": 1, "03JUL1991": 1, "10JUL1991": 1, "17JUL1991": 1, "24JUL1991": 1, "31JUL1991": 1, "07AUG1991": 1, "14AUG1991": 1, "21AUG1991": 1, "28AUG1991": 1, "04SEP1991": 1, "11SEP1991": 1, "18SEP1991": 1, "25SEP1991": 1, "02OCT1991": 1, "09OCT1991": 1, "16OCT1991": 1, "23OCT1991": 1, "30OCT1991": 1, "06NOV1991": 1, "13NOV1991": 1, "20NOV1991": 1, "27NOV1991": 1, "04DEC1991": 1, "11DEC1991": 1, "18DEC1991": 1, "25DEC1991": 1, "01JAN1992": 1, "08JAN1992": 1, "15JAN1992": 1, "22JAN1992": 1, "29JAN1992": 1, "05FEB1992": 1, "12FEB1992": 1, "19FEB1992": 1, "26FEB1992": 1, "04MAR1992": 1, "11MAR1992": 1, "18MAR1992": 1, "25MAR1992": 1, "01APR1992": 1, "08APR1992": 1, "15APR1992": 1, "22APR1992": 1, "29APR1992": 1, "06MAY1992": 1, "13MAY1992": 1, "20MAY1992": 1, "27MAY1992": 1, "03JUN1992": 1, "10JUN1992": 1, "17JUN1992": 1, "24JUN1992": 1, "01JUL1992": 1, "08JUL1992": 1, "15JUL1992": 1, "22JUL1992": 1, "29JUL1992": 1, "05AUG1992": 1, "12AUG1992": 1, "19AUG1992": 1, "26AUG1992": 1, "02SEP1992": 1, "09SEP1992": 1, "16SEP1992": 1, "23SEP1992": 1, "30SEP1992": 1, "07OCT1992": 1, "14OCT1992": 1, "21OCT1992": 1, "28OCT1992": 1, "04NOV1992": 1, "11NOV1992": 1, "18NOV1992": 1, "25NOV1992": 1, "02DEC1992": 1, "09DEC1992": 1, "16DEC1992": 1, "23DEC1992": 1, "30DEC1992": 1, "06JAN1993": 1, "13JAN1993": 1, "20JAN1993": 1, "27JAN1993": 1, "03FEB1993": 1, "10FEB1993": 1, "17FEB1993": 1, "24FEB1993": 1, "03MAR1993": 1, "10MAR1993": 1, "17MAR1993": 1, "24MAR1993": 1, "31MAR1993": 1, "07APR1993": 1, "14APR1993": 1, "21APR1993": 1, "28APR1993": 1, "05MAY1993": 1, "12MAY1993": 1, "19MAY1993": 1, "26MAY1993": 1, "02JUN1993": 1, "09JUN1993": 1, "16JUN1993": 1, "23JUN1993": 1, "30JUN1993": 1, "07JUL1993": 1, "14JUL1993": 1, "21JUL1993": 1, "28JUL1993": 1, "04AUG1993": 1, "11AUG1993": 1, "18AUG1993": 1, "25AUG1993": 1, "01SEP1993": 1, "08SEP1993": 1, "15SEP1993": 1, "22SEP1993": 1, "29SEP1993": 1, "06OCT1993": 1, "13OCT1993": 1, "20OCT1993": 1, "27OCT1993": 1, "03NOV1993": 1, "10NOV1993": 1, "17NOV1993": 1, "24NOV1993": 1, "01DEC1993": 1, "08DEC1993": 1, "15DEC1993": 1, "22DEC1993": 1, "29DEC1993": 1, "05JAN1994": 1, "12JAN1994": 1, "19JAN1994": 1, "26JAN1994": 1, "02FEB1994": 1, "09FEB1994": 1, "16FEB1994": 1, "23FEB1994": 1, "02MAR1994": 1, "09MAR1994": 1, "16MAR1994": 1, "23MAR1994": 1, "30MAR1994": 1, "06APR1994": 1, "13APR1994": 1, "20APR1994": 1, "27APR1994": 1, "04MAY1994": 1, "11MAY1994": 1, "18MAY1994": 1, "25MAY1994": 1, "01JUN1994": 1, "08JUN1994": 1, "15JUN1994": 1, "22JUN1994": 1, "29JUN1994": 1, "06JUL1994": 1, "13JUL1994": 1, "20JUL1994": 1, "27JUL1994": 1, "03AUG1994": 1, "10AUG1994": 1, "17AUG1994": 1, "24AUG1994": 1, "31AUG1994": 1, "07SEP1994": 1, "14SEP1994": 1, "21SEP1994": 1, "28SEP1994": 1, "05OCT1994": 1, "12OCT1994": 1, "19OCT1994": 1, "26OCT1994": 1, "02NOV1994": 1, "09NOV1994": 1, "16NOV1994": 1, "23NOV1994": 1, "30NOV1994": 1, "07DEC1994": 1, "14DEC1994": 1, "21DEC1994": 1, "28DEC1994": 1, "04JAN1995": 1, "11JAN1995": 1, "18JAN1995": 1, "25JAN1995": 1, "01FEB1995": 1, "08FEB1995": 1, "15FEB1995": 1, "22FEB1995": 1, "01MAR1995": 1, "08MAR1995": 1, "15MAR1995": 1, "22MAR1995": 1, "29MAR1995": 1, "05APR1995": 1, "12APR1995": 1, "19APR1995": 1, "26APR1995": 1, "03MAY1995": 1, "10MAY1995": 1, "17MAY1995": 1, "24MAY1995": 1, "31MAY1995": 1, "07JUN1995": 1, "14JUN1995": 1, "21JUN1995": 1, "28JUN1995": 1, "05JUL1995": 1, "12JUL1995": 1, "19JUL1995": 1, "26JUL1995": 1, "02AUG1995": 1, "09AUG1995": 1, "16AUG1995": 1, "23AUG1995": 1, "30AUG1995": 1, "06SEP1995": 1, "13SEP1995": 1, "20SEP1995": 1, "27SEP1995": 1, "04OCT1995": 1, "11OCT1995": 1, "18OCT1995": 1, "25OCT1995": 1, "01NOV1995": 1, "08NOV1995": 1, "15NOV1995": 1, "22NOV1995": 1, "29NOV1995": 1, "06DEC1995": 1, "13DEC1995": 1, "20DEC1995": 1, "27DEC1995": 1, "03JAN1996": 1, "10JAN1996": 1, "17JAN1996": 1, "24JAN1996": 1, "31JAN1996": 1, "07FEB1996": 1, "14FEB1996": 1, "21FEB1996": 1, "28FEB1996": 1, "06MAR1996": 1, "13MAR1996": 1, "20MAR1996": 1, "27MAR1996": 1, "03APR1996": 1, "10APR1996": 1, "17APR1996": 1, "24APR1996": 1, "01MAY1996": 1, "08MAY1996": 1, "15MAY1996": 1, "22MAY1996": 1, "29MAY1996": 1, "05JUN1996": 1, "12JUN1996": 1, "19JUN1996": 1, "26JUN1996": 1, "03JUL1996": 1, "10JUL1996": 1, "17JUL1996": 1, "24JUL1996": 1, "31JUL1996": 1, "07AUG1996": 1, "14AUG1996": 1, "21AUG1996": 1, "28AUG1996": 1, "04SEP1996": 1, "11SEP1996": 1, "18SEP1996": 1, "25SEP1996": 1, "02OCT1996": 1, "09OCT1996": 1, "16OCT1996": 1, "23OCT1996": 1, "30OCT1996": 1, "06NOV1996": 1, "13NOV1996": 1, "20NOV1996": 1, "27NOV1996": 1, "04DEC1996": 1, "11DEC1996": 1, "18DEC1996": 1, "25DEC1996": 1, "01JAN1997": 1, "08JAN1997": 1, "15JAN1997": 1, "22JAN1997": 1, "29JAN1997": 1, "05FEB1997": 1, "12FEB1997": 1, "19FEB1997": 1, "26FEB1997": 1, "05MAR1997": 1, "12MAR1997": 1, "19MAR1997": 1, "26MAR1997": 1, "02APR1997": 1, "09APR1997": 1, "16APR1997": 1, "23APR1997": 1, "30APR1997": 1, "07MAY1997": 1, "14MAY1997": 1, "21MAY1997": 1, "28MAY1997": 1, "04JUN1997": 1, "11JUN1997": 1, "18JUN1997": 1, "25JUN1997": 1, "02JUL1997": 1, "09JUL1997": 1, "16JUL1997": 1, "23JUL1997": 1, "30JUL1997": 1, "06AUG1997": 1, "13AUG1997": 1, "20AUG1997": 1, "27AUG1997": 1, "03SEP1997": 1, "10SEP1997": 1, "17SEP1997": 1, "24SEP1997": 1, "01OCT1997": 1, "08OCT1997": 1, "15OCT1997": 1, "22OCT1997": 1, "29OCT1997": 1, "05NOV1997": 1, "12NOV1997": 1, "19NOV1997": 1, "26NOV1997": 1, "03DEC1997": 1, "10DEC1997": 1, "17DEC1997": 1, "24DEC1997": 1, "31DEC1997": 1, "07JAN1998": 1, "14JAN1998": 1, "21JAN1998": 1, "28JAN1998": 1, "04FEB1998": 1, "11FEB1998": 1, "18FEB1998": 1, "25FEB1998": 1, "04MAR1998": 1, "11MAR1998": 1, "18MAR1998": 1, "25MAR1998": 1, "01APR1998": 1, "08APR1998": 1, "15APR1998": 1, "22APR1998": 1, "29APR1998": 1, "06MAY1998": 1, "13MAY1998": 1, "20MAY1998": 1, "27MAY1998": 1, "03JUN1998": 1, "10JUN1998": 1, "17JUN1998": 1, "24JUN1998": 1, "01JUL1998": 1, "08JUL1998": 1, "15JUL1998": 1, "22JUL1998": 1, "29JUL1998": 1, "05AUG1998": 1, "12AUG1998": 1, "19AUG1998": 1, "26AUG1998": 1, "02SEP1998": 1, "09SEP1998": 1, "16SEP1998": 1, "23SEP1998": 1, "30SEP1998": 1, "07OCT1998": 1, "14OCT1998": 1, "21OCT1998": 1, "28OCT1998": 1, "04NOV1998": 1, "11NOV1998": 1, "18NOV1998": 1, "25NOV1998": 1, "02DEC1998": 1, "09DEC1998": 1, "16DEC1998": 1, "23DEC1998": 1, "30DEC1998": 1, "06JAN1999": 1, "13JAN1999": 1, "20JAN1999": 1, "27JAN1999": 1, "03FEB1999": 1, "10FEB1999": 1, "17FEB1999": 1, "24FEB1999": 1, "03MAR1999": 1, "10MAR1999": 1, "17MAR1999": 1, "24MAR1999": 1, "31MAR1999": 1, "07APR1999": 1, "14APR1999": 1, "21APR1999": 1, "28APR1999": 1, "05MAY1999": 1, "12MAY1999": 1, "19MAY1999": 1, "26MAY1999": 1, "02JUN1999": 1, "09JUN1999": 1, "16JUN1999": 1, "23JUN1999": 1, "30JUN1999": 1, "07JUL1999": 1, "14JUL1999": 1, "21JUL1999": 1, "28JUL1999": 1, "04AUG1999": 1, "11AUG1999": 1, "18AUG1999": 1, "25AUG1999": 1, "01SEP1999": 1, "08SEP1999": 1, "15SEP1999": 1, "22SEP1999": 1, "29SEP1999": 1, "06OCT1999": 1, "13OCT1999": 1, "20OCT1999": 1, "27OCT1999": 1, "03NOV1999": 1, "10NOV1999": 1, "17NOV1999": 1, "24NOV1999": 1, "01DEC1999": 1, "08DEC1999": 1, "15DEC1999": 1, "22DEC1999": 1, "29DEC1999": 1, "05JAN2000": 1, "12JAN2000": 1, "19JAN2000": 1, "26JAN2000": 1, "02FEB2000": 1, "09FEB2000": 1, "16FEB2000": 1, "23FEB2000": 1, "01MAR2000": 1, "08MAR2000": 1, "15MAR2000": 1, "22MAR2000": 1, "29MAR2000": 1, "05APR2000": 1, "12APR2000": 1, "19APR2000": 1, "26APR2000": 1, "03MAY2000": 1, "10MAY2000": 1, "17MAY2000": 1, "24MAY2000": 1, "31MAY2000": 1, "07JUN2000": 1, "14JUN2000": 1, "21JUN2000": 1, "28JUN2000": 1, "05JUL2000": 1, "12JUL2000": 1, "19JUL2000": 1, "26JUL2000": 1, "02AUG2000": 1, "09AUG2000": 1, "16AUG2000": 1, "23AUG2000": 1, "30AUG2000": 1, "06SEP2000": 1, "13SEP2000": 1, "20SEP2000": 1, "27SEP2000": 1, "04OCT2000": 1, "11OCT2000": 1, "18OCT2000": 1, "25OCT2000": 1, "01NOV2000": 1, "08NOV2000": 1, "15NOV2000": 1, "22NOV2000": 1, "29NOV2000": 1, "06DEC2000": 1, "13DEC2000": 1, "20DEC2000": 1, "27DEC2000": 1, "03JAN2001": 1, "10JAN2001": 1, "17JAN2001": 1, "24JAN2001": 1, "31JAN2001": 1, "07FEB2001": 1, "14FEB2001": 1, "21FEB2001": 1, "28FEB2001": 1, "07MAR2001": 1, "14MAR2001": 1, "21MAR2001": 1, "28MAR2001": 1, "04APR2001": 1, "11APR2001": 1, "18APR2001": 1, "25APR2001": 1, "02MAY2001": 1, "09MAY2001": 1, "16MAY2001": 1, "23MAY2001": 1, "30MAY2001": 1, "06JUN2001": 1, "13JUN2001": 1, "20JUN2001": 1, "27JUN2001": 1, "04JUL2001": 1, "11JUL2001": 1, "18JUL2001": 1, "25JUL2001": 1, "01AUG2001": 1, "08AUG2001": 1, "15AUG2001": 1, "22AUG2001": 1, "29AUG2001": 1, "05SEP2001": 1, "12SEP2001": 1, "19SEP2001": 1, "26SEP2001": 1, "03OCT2001": 1, "10OCT2001": 1, "17OCT2001": 1, "24OCT2001": 1, "31OCT2001": 1, "07NOV2001": 1, "14NOV2001": 1, "21NOV2001": 1, "28NOV2001": 1, "05DEC2001": 1, "12DEC2001": 1, "19DEC2001": 1, "26DEC2001": 1, "02JAN2002": 1, "09JAN2002": 1, "16JAN2002": 1, "23JAN2002": 1, "30JAN2002": 1, "06FEB2002": 1, "13FEB2002": 1, "20FEB2002": 1, "27FEB2002": 1, "06MAR2002": 1, "13MAR2002": 1, "20MAR2002": 1, "27MAR2002": 1, "03APR2002": 1, "10APR2002": 1, "17APR2002": 1, "24APR2002": 1, "01MAY2002": 1, "08MAY2002": 1, "15MAY2002": 1, "22MAY2002": 1, "29MAY2002": 1, "05JUN2002": 1, "12JUN2002": 1, "19JUN2002": 1, "26JUN2002": 1, "03JUL2002": 1, "10JUL2002": 1, "17JUL2002": 1, "24JUL2002": 1, "31JUL2002": 1, "07AUG2002": 1, "14AUG2002": 1, "21AUG2002": 1, "28AUG2002": 1, "04SEP2002": 1, "11SEP2002": 1, "18SEP2002": 1, "25SEP2002": 1, "02OCT2002": 1, "09OCT2002": 1, "16OCT2002": 1, "23OCT2002": 1, "30OCT2002": 1, "06NOV2002": 1, "13NOV2002": 1, "20NOV2002": 1, "27NOV2002": 1, "04DEC2002": 1, "11DEC2002": 1, "18DEC2002": 1, "25DEC2002": 1, "01JAN2003": 1, "08JAN2003": 1, "15JAN2003": 1, "22JAN2003": 1, "29JAN2003": 1, "05FEB2003": 1, "12FEB2003": 1, "19FEB2003": 1, "26FEB2003": 1, "05MAR2003": 1, "12MAR2003": 1, "19MAR2003": 1, "26MAR2003": 1, "02APR2003": 1, "09APR2003": 1, "16APR2003": 1, "23APR2003": 1, "30APR2003": 1, "07MAY2003": 1, "14MAY2003": 1, "21MAY2003": 1, "28MAY2003": 1, "04JUN2003": 1, "11JUN2003": 1, "18JUN2003": 1, "25JUN2003": 1, "02JUL2003": 1, "09JUL2003": 1, "16JUL2003": 1, "23JUL2003": 1, "30JUL2003": 1, "06AUG2003": 1, "13AUG2003": 1, "20AUG2003": 1, "27AUG2003": 1, "03SEP2003": 1, "10SEP2003": 1, "17SEP2003": 1, "24SEP2003": 1, "01OCT2003": 1, "08OCT2003": 1, "15OCT2003": 1, "22OCT2003": 1, "29OCT2003": 1, "05NOV2003": 1, "12NOV2003": 1, "19NOV2003": 1, "26NOV2003": 1, "03DEC2003": 1, "10DEC2003": 1, "17DEC2003": 1, "24DEC2003": 1, "31DEC2003": 1, "07JAN2004": 1, "14JAN2004": 1, "21JAN2004": 1, "28JAN2004": 1, "04FEB2004": 1, "11FEB2004": 1, "18FEB2004": 1, "25FEB2004": 1, "03MAR2004": 1, "10MAR2004": 1, "17MAR2004": 1, "24MAR2004": 1, "31MAR2004": 1, "07APR2004": 1, "14APR2004": 1, "21APR2004": 1, "28APR2004": 1, "05MAY2004": 1, "12MAY2004": 1, "19MAY2004": 1, "26MAY2004": 1, "02JUN2004": 1, "09JUN2004": 1, "16JUN2004": 1, "23JUN2004": 1, "30JUN2004": 1, "07JUL2004": 1, "14JUL2004": 1, "21JUL2004": 1, "28JUL2004": 1, "04AUG2004": 1, "11AUG2004": 1, "18AUG2004": 1, "25AUG2004": 1, "01SEP2004": 1, "08SEP2004": 1, "15SEP2004": 1, "22SEP2004": 1, "29SEP2004": 1, "06OCT2004": 1, "13OCT2004": 1, "20OCT2004": 1, "27OCT2004": 1, "03NOV2004": 1, "10NOV2004": 1, "17NOV2004": 1, "24NOV2004": 1, "01DEC2004": 1, "08DEC2004": 1, "15DEC2004": 1, "22DEC2004": 1, "29DEC2004": 1, "05JAN2005": 1, "12JAN2005": 1, "19JAN2005": 1, "26JAN2005": 1, "02FEB2005": 1, "09FEB2005": 1, "16FEB2005": 1, "23FEB2005": 1, "02MAR2005": 1, "09MAR2005": 1, "16MAR2005": 1, "23MAR2005": 1, "30MAR2005": 1, "06APR2005": 1, "13APR2005": 1, "20APR2005": 1, "27APR2005": 1, "04MAY2005": 1, "11MAY2005": 1, "18MAY2005": 1, "25MAY2005": 1, "01JUN2005": 1, "08JUN2005": 1, "15JUN2005": 1, "22JUN2005": 1, "29JUN2005": 1, "06JUL2005": 1, "13JUL2005": 1, "20JUL2005": 1, "27JUL2005": 1, "03AUG2005": 1, "10AUG2005": 1, "17AUG2005": 1, "24AUG2005": 1, "31AUG2005": 1, "07SEP2005": 1, "14SEP2005": 1, "21SEP2005": 1, "28SEP2005": 1, "05OCT2005": 1, "12OCT2005": 1, "19OCT2005": 1, "26OCT2005": 1, "02NOV2005": 1, "09NOV2005": 1, "16NOV2005": 1, "23NOV2005": 1, "30NOV2005": 1, "07DEC2005": 1, "14DEC2005": 1, "21DEC2005": 1, "28DEC2005": 1, "04JAN2006": 1, "11JAN2006": 1, "18JAN2006": 1, "25JAN2006": 1, "01FEB2006": 1, "08FEB2006": 1, "15FEB2006": 1, "22FEB2006": 1, "01MAR2006": 1, "08MAR2006": 1, "15MAR2006": 1, "22MAR2006": 1, "29MAR2006": 1, "05APR2006": 1, "12APR2006": 1, "19APR2006": 1, "26APR2006": 1, "03MAY2006": 1, "10MAY2006": 1, "17MAY2006": 1, "24MAY2006": 1, "31MAY2006": 1, "07JUN2006": 1, "14JUN2006": 1, "21JUN2006": 1, "28JUN2006": 1, "05JUL2006": 1, "12JUL2006": 1, "19JUL2006": 1, "26JUL2006": 1, "02AUG2006": 1, "09AUG2006": 1, "16AUG2006": 1, "23AUG2006": 1, "30AUG2006": 1, "06SEP2006": 1, "13SEP2006": 1, "20SEP2006": 1, "27SEP2006": 1, "04OCT2006": 1, "11OCT2006": 1, "18OCT2006": 1, "25OCT2006": 1, "01NOV2006": 1, "08NOV2006": 1, "15NOV2006": 1, "22NOV2006": 1, "29NOV2006": 1, "06DEC2006": 1, "13DEC2006": 1, "20DEC2006": 1, "27DEC2006": 1, "03JAN2007": 1, "10JAN2007": 1, "17JAN2007": 1, "24JAN2007": 1, "31JAN2007": 1, "07FEB2007": 1, "14FEB2007": 1, "21FEB2007": 1, "28FEB2007": 1, "07MAR2007": 1, "14MAR2007": 1, "21MAR2007": 1, "28MAR2007": 1, "04APR2007": 1, "11APR2007": 1, "18APR2007": 1, "25APR2007": 1, "02MAY2007": 1, "09MAY2007": 1, "16MAY2007": 1, "23MAY2007": 1, "30MAY2007": 1, "06JUN2007": 1, "13JUN2007": 1, "20JUN2007": 1, "27JUN2007": 1, "04JUL2007": 1, "11JUL2007": 1, "18JUL2007": 1, "25JUL2007": 1, "01AUG2007": 1, "08AUG2007": 1, "15AUG2007": 1, "22AUG2007": 1, "29AUG2007": 1, "05SEP2007": 1, "12SEP2007": 1, "19SEP2007": 1, "26SEP2007": 1, "03OCT2007": 1, "10OCT2007": 1, "17OCT2007": 1, "24OCT2007": 1, "31OCT2007": 1, "07NOV2007": 1, "14NOV2007": 1, "21NOV2007": 1, "28NOV2007": 1, "05DEC2007": 1, "12DEC2007": 1, "19DEC2007": 1, "26DEC2007": 1, "02JAN2008": 1, "09JAN2008": 1, "16JAN2008": 1, "23JAN2008": 1, "30JAN2008": 1, "06FEB2008": 1, "13FEB2008": 1, "20FEB2008": 1, "27FEB2008": 1, "05MAR2008": 1, "12MAR2008": 1, "19MAR2008": 1, "26MAR2008": 1, "02APR2008": 1, "09APR2008": 1, "16APR2008": 1, "23APR2008": 1, "30APR2008": 1, "07MAY2008": 1, "14MAY2008": 1, "21MAY2008": 1, "28MAY2008": 1, "04JUN2008": 1, "11JUN2008": 1, "18JUN2008": 1, "25JUN2008": 1, "02JUL2008": 1, "09JUL2008": 1, "16JUL2008": 1, "23JUL2008": 1, "30JUL2008": 1, "06AUG2008": 1, "13AUG2008": 1, "20AUG2008": 1, "27AUG2008": 1, "03SEP2008": 1, "10SEP2008": 1, "17SEP2008": 1, "24SEP2008": 1, "01OCT2008": 1, "08OCT2008": 1, "15OCT2008": 1, "22OCT2008": 1, "29OCT2008": 1, "05NOV2008": 1, "12NOV2008": 1, "19NOV2008": 1, "26NOV2008": 1, "03DEC2008": 1, "10DEC2008": 1, "17DEC2008": 1, "24DEC2008": 1, "31DEC2008": 1, "07JAN2009": 1, "14JAN2009": 1, "21JAN2009": 1, "28JAN2009": 1, "04FEB2009": 1, "11FEB2009": 1, "18FEB2009": 1, "25FEB2009": 1, "04MAR2009": 1, "11MAR2009": 1, "18MAR2009": 1, "25MAR2009": 1, "01APR2009": 1, "08APR2009": 1, "15APR2009": 1, "22APR2009": 1, "29APR2009": 1, "06MAY2009": 1, "13MAY2009": 1, "20MAY2009": 1, "27MAY2009": 1, "03JUN2009": 1, "10JUN2009": 1, "17JUN2009": 1, "24JUN2009": 1, "01JUL2009": 1, "08JUL2009": 1, "15JUL2009": 1, "22JUL2009": 1, "29JUL2009": 1, "05AUG2009": 1, "12AUG2009": 1, "19AUG2009": 1, "26AUG2009": 1, "02SEP2009": 1, "09SEP2009": 1, "16SEP2009": 1, "23SEP2009": 1, "30SEP2009": 1, "07OCT2009": 1, "14OCT2009": 1, "21OCT2009": 1, "28OCT2009": 1, "04NOV2009": 1, "11NOV2009": 1, "18NOV2009": 1, "25NOV2009": 1, "02DEC2009": 1, "09DEC2009": 1, "16DEC2009": 1, "23DEC2009": 1, "30DEC2009": 1, "06JAN2010": 1, "13JAN2010": 1, "20JAN2010": 1, "27JAN2010": 1, "03FEB2010": 1, "10FEB2010": 1, "17FEB2010": 1, "24FEB2010": 1, "03MAR2010": 1, "10MAR2010": 1, "17MAR2010": 1, "24MAR2010": 1, "31MAR2010": 1, "07APR2010": 1, "14APR2010": 1, "21APR2010": 1, "28APR2010": 1, "05MAY2010": 1, "12MAY2010": 1, "19MAY2010": 1, "26MAY2010": 1, "02JUN2010": 1, "09JUN2010": 1, "16JUN2010": 1, "23JUN2010": 1, "30JUN2010": 1, "07JUL2010": 1, "14JUL2010": 1, "21JUL2010": 1, "28JUL2010": 1, "04AUG2010": 1, "11AUG2010": 1, "18AUG2010": 1, "25AUG2010": 1, "01SEP2010": 1, "08SEP2010": 1, "15SEP2010": 1, "22SEP2010": 1, "29SEP2010": 1, "06OCT2010": 1, "13OCT2010": 1, "20OCT2010": 1, "27OCT2010": 1, "03NOV2010": 1, "10NOV2010": 1, "17NOV2010": 1, "24NOV2010": 1, "01DEC2010": 1, "08DEC2010": 1, "15DEC2010": 1, "22DEC2010": 1, "29DEC2010": 1, "05JAN2011": 1, "12JAN2011": 1, "19JAN2011": 1, "26JAN2011": 1, "02FEB2011": 1, "09FEB2011": 1, "16FEB2011": 1, "23FEB2011": 1, "02MAR2011": 1, "09MAR2011": 1, "16MAR2011": 1, "23MAR2011": 1, "30MAR2011": 1, "06APR2011": 1, "13APR2011": 1, "20APR2011": 1, "27APR2011": 1, "04MAY2011": 1, "11MAY2011": 1, "18MAY2011": 1, "25MAY2011": 1, "01JUN2011": 1, "08JUN2011": 1, "15JUN2011": 1, "22JUN2011": 1, "29JUN2011": 1, "06JUL2011": 1, "13JUL2011": 1, "20JUL2011": 1, "27JUL2011": 1, "03AUG2011": 1, "10AUG2011": 1, "17AUG2011": 1, "24AUG2011": 1, "31AUG2011": 1, "07SEP2011": 1, "14SEP2011": 1, "21SEP2011": 1, "28SEP2011": 1, "05OCT2011": 1, "12OCT2011": 1, "19OCT2011": 1, "26OCT2011": 1, "02NOV2011": 1, "09NOV2011": 1, "16NOV2011": 1, "23NOV2011": 1, "30NOV2011": 1, "07DEC2011": 1, "14DEC2011": 1, "21DEC2011": 1, "28DEC2011": 1, "04JAN2012": 1, "11JAN2012": 1, "18JAN2012": 1, "25JAN2012": 1, "01FEB2012": 1, "08FEB2012": 1, "15FEB2012": 1, "22FEB2012": 1, "29FEB2012": 1, "07MAR2012": 1, "14MAR2012": 1, "21MAR2012": 1, "28MAR2012": 1, "04APR2012": 1, "11APR2012": 1, "18APR2012": 1, "25APR2012": 1, "02MAY2012": 1, "09MAY2012": 1, "16MAY2012": 1, "23MAY2012": 1, "30MAY2012": 1, "06JUN2012": 1, "13JUN2012": 1, "20JUN2012": 1, "27JUN2012": 1, "04JUL2012": 1, "11JUL2012": 1, "18JUL2012": 1, "25JUL2012": 1, "01AUG2012": 1, "08AUG2012": 1, "15AUG2012": 1, "22AUG2012": 1, "29AUG2012": 1, "05SEP2012": 1, "12SEP2012": 1, "19SEP2012": 1, "26SEP2012": 1, "03OCT2012": 1, "10OCT2012": 1, "17OCT2012": 1, "24OCT2012": 1, "31OCT2012": 1, "07NOV2012": 1, "14NOV2012": 1, "21NOV2012": 1, "28NOV2012": 1, "05DEC2012": 1, "12DEC2012": 1, "19DEC2012": 1, "26DEC2012": 1, "02JAN2013": 1, "09JAN2013": 1, "16JAN2013": 1, "23JAN2013": 1, "30JAN2013": 1, "06FEB2013": 1, "13FEB2013": 1, "20FEB2013": 1, "27FEB2013": 1, "06MAR2013": 1, "13MAR2013": 1, "20MAR2013": 1, "27MAR2013": 1, "03APR2013": 1, "10APR2013": 1, "17APR2013": 1, "24APR2013": 1, "01MAY2013": 1, "08MAY2013": 1, "15MAY2013": 1, "22MAY2013": 1, "29MAY2013": 1, "05JUN2013": 1, "12JUN2013": 1, "19JUN2013": 1, "26JUN2013": 1, "03JUL2013": 1, "10JUL2013": 1, "17JUL2013": 1, "24JUL2013": 1, "31JUL2013": 1, "07AUG2013": 1, "14AUG2013": 1, "21AUG2013": 1, "28AUG2013": 1, "04SEP2013": 1, "11SEP2013": 1, "18SEP2013": 1, "25SEP2013": 1, "02OCT2013": 1, "09OCT2013": 1, "16OCT2013": 1, "23OCT2013": 1, "30OCT2013": 1, "06NOV2013": 1, "13NOV2013": 1, "20NOV2013": 1, "27NOV2013": 1, "04DEC2013": 1, "11DEC2013": 1, "18DEC2013": 1, "25DEC2013": 1, "01JAN2014": 1, "08JAN2014": 1, "15JAN2014": 1, "22JAN2014": 1, "29JAN2014": 1, "05FEB2014": 1, "12FEB2014": 1, "19FEB2014": 1, "26FEB2014": 1, "05MAR2014": 1, "12MAR2014": 1, "19MAR2014": 1, "26MAR2014": 1, "02APR2014": 1, "09APR2014": 1, "16APR2014": 1, "23APR2014": 1, "30APR2014": 1, "07MAY2014": 1, "14MAY2014": 1, "21MAY2014": 1, "28MAY2014": 1, "04JUN2014": 1, "11JUN2014": 1, "18JUN2014": 1, "25JUN2014": 1, "02JUL2014": 1, "09JUL2014": 1, "16JUL2014": 1, "23JUL2014": 1, "30JUL2014": 1, "06AUG2014": 1, "13AUG2014": 1, "20AUG2014": 1, "27AUG2014": 1, "03SEP2014": 1, "10SEP2014": 1, "17SEP2014": 1, "24SEP2014": 1, "01OCT2014": 1, "08OCT2014": 1, "15OCT2014": 1, "22OCT2014": 1, "29OCT2014": 1, "05NOV2014": 1, "12NOV2014": 1, "19NOV2014": 1, "26NOV2014": 1, "03DEC2014": 1, "10DEC2014": 1, "17DEC2014": 1, "24DEC2014": 1, "31DEC2014": 1, "07JAN2015": 1, "14JAN2015": 1, "21JAN2015": 1, "28JAN2015": 1, "04FEB2015": 1, "11FEB2015": 1, "18FEB2015": 1, "25FEB2015": 1, "ACCEPTABLE": 1, "LEFT": 1, "PRIMERS": 1, "based": 1, "#": 1, "self": 2, "hair": 1, "qual": 1, "tgctagctaggcgatgctag": 1, "actgatacgcgatgctagct": 1, "gatcgatgctagctaggcga": 1, "tcgatcgatgctagctaggc": 1, "tagctgatcgatcgtagcgg": 1, "gctgactgatcgatcgatgc": 1, "tatcatctctgcgcgatcga": 1, "agctaggcgatgctagctag": 1, "ctagctaggcgatgctagct": 1, "ggcgatctagctagctgact": 1, "tcgatgctagctaggcgatg": 1, "gctgatcgatcgatgctagc": 1, "gctagctgatcgatcgatgc": 1, "atcatctctgcgcgatcgat": 1, "gactgatacgcgatgctagc": 1, "atcgatgctagctaggcgat": 1, "gctagctgactgatacgcga": 1, "agctagctgactgatacgcg": 1, "atgctagctaggcgatgcta": 1, "ctatcatctctgcgcgatcg": 1, "gatgctagctaggcgatgct": 1, "gctactatcatctctgcgcg": 1, "cgtagcggcgatctagctag": 1, "cggcgatctagctagctgac": 1, "gctagctgatcgatcgtagc": 1, "gatcgatcgatgtgcggcta": 1, "atcgatcgatgtgcggctag": 1, "gctgactgatacgcgatgc": 1, "agctagctgatcatcgatgct": 1, "gctagctagctgactgatcga": 1, "tcatctctgcgcgatcgat": 1, "atcatctctgcgcgatcga": 1, "atcgatcgatgtgcggcta": 1, "gtagcggcgatctagctagc": 1, "gctagctgactgatcgatcg": 1, "gctgatcgatcgatgtgcg": 1, "tatcatctctgcgcgatcgat": 1, "gctagctagctgatcgatcga": 2, "catctctgcgcgatcgatg": 1, "tcgtagcggcgatctagcta": 1, "actgatacgcgatgctagcta": 1, "actgatcgatcgatgctagct": 1, "agctagctgatcgatcgatgt": 1, "tagcggcgatctagctagct": 1, "cgtagcggcgatctagcta": 1, "ctagctgatcgatcgtagcg": 1, "tagcggcgatctagctagc": 1, "catcgatcgatgcatgcatg": 1, "tcatctctgcgcgatcgatg": 1, "gctagctagctgatcgatcg": 3, "agcatcggattagctagctga": 1, "agctgatcgatcgtagcgg": 1, "cggcgatctagctagctga": 1, "ctagctgatcgatcgatgtgc": 1, "gctagctgatcgatcgatgtg": 1, "gctagctaggcgatgctagc": 1, "tagctagctgactgatacgcg": 1, "gctagctgactgatcgatcga": 1, "agctagctgactgatcgatcg": 1, "cgatcgatgctagctaggcg": 1, "gctagctagctgactgatcg": 1, "atgctagctaggcgatgct": 1, "agctagctgatcgatcgtagc": 1, "gctagctagctgatcgatcgt": 1, "tagctaggcgatgctagctag": 1, "ctagctaggcgatgctagcta": 1, "tagctgatcgatcgatgtgc": 1, "gatgctagctaggcgatgcta": 1, "atgctagctaggcgatgctag": 1, "gctagctgatcatcgatgct": 1, "agctagctgatcatcgatgc": 1, "gctgactgatacgcgatgct": 1, "agctgactgatacgcgatgc": 1, "ggcgatctagctagctgacta": 1, "gatcgatgctagctaggcgat": 1, "atcgatcgatgctagctaggc": 1, "ctgatcgatcgatgtgcgg": 1, "agctgatcgatcgatgtgcg": 1, "cgatcatcgatgctagctagc": 1, "tagctaggcgatgctagcta": 1, "agctagctactgatcgatgct": 1, "tcgatcgatgtgcggctag": 1, "gactgatcgatcgatgctagc": 1, "agctagctgactgatcgatca": 1, "ctgactgatacgcgatgctag": 1, "ctagctgactgatacgcgatg": 1, "gctactatcatctctgcgcga": 1, "agctactatcatctctgcgcg": 1, "actatcatctctgcgcgatc": 1, "actgatcgatcgatgctagc": 1, "gctagctgatcgatcgatgt": 1, "ctatcatctctgcgcgatcga": 1, "atcgatgctagctaggcgatg": 1, "tgactgatacgcgatgctag": 1, "ctgactgatacgcgatgcta": 1, "tagctgactgatacgcgatg": 1, "ctgactgatcgatcgatgct": 1, "agctgactgatcgatcgatg": 1, "tcggattagctagctgatgc": 1, "gcatcggattagctagctga": 1, "agcatcggattagctagctg": 1, "gatgctagctaggcgatgc": 1, "ctgatacgcgatgctagctag": 1, "gctagctgactgatacgcg": 1, "ctctgcgcgatcgatgctag": 1, "tctgcgcgatcgatgctag": 1, "ctctgcgcgatcgatgcta": 1, "cgatgctagctaggcgatgc": 1, "gactgatacgcgatgctagct": 1, "gctagctgactgatacgcgat": 1, "tgatacgcgatgctagctag": 1, "ctgatacgcgatgctagcta": 1, "cgcgatcgatgctagctagc": 1, "gcgcgatcgatgctagctag": 1, "ctgatcgatcgatgctagct": 2, "agctgatcgatcgatgctag": 1, "ctagctgatcgatcgatgct": 1, "agctagctgatcgatcgatg": 2, "catcggattagctagctgatgc": 1, "gcatcggattagctagctgatg": 1, "tcgatgctagctaggcgat": 1, "atcgatgctagctaggcga": 1, "actatcatctctgcgcgatcg": 1, "gcgcgatcgatgctagcta": 1, "gctgatcgatcgatgctagct": 1, "agctgatcgatcgatgctagc": 1, "gctagctgatcgatcgatgct": 1, "agctagctgatcgatcgatgc": 1, "cgcgatcgatgctagctag": 1, "tcgtagcggcgatctagc": 1, "cgtagcggcgatctagct": 1, "gcggcgatctagctagct": 1, "agcggcgatctagctagc": 1, "ctagctgactgatacgcgat": 1, "ctagctgatcgatcgtagcgg": 1, "agctactatcatctctgcgc": 1, "gctagctactgatcgatgct": 1, "agctagctactgatcgatgc": 1, "agcatcggattagctagctgat": 1, "tgctagctaggcgatgcta": 1, "aagcatcggattagctagctg": 1, "tctgcgcgatcgatgcta": 1, "cgatgctagctaggcgatg": 1, "agctagctgatcatcgatgcta": 1, "tagctagctgatcatcgatgct": 1, "atcgatcgatgtgcggct": 1, "gctagctgactgatcgatca": 1, "tagctagctgactgatcgatcg": 1, "agctgatcatcatcgatgct": 1, "agctagctgactgatcgatcat": 1, "tgactgatacgcgatgctagc": 1, "gctgactgatacgcgatgcta": 1, "tagctgactgatacgcgatgc": 1, "tagctagctgatcgatcgtagc": 1, "gctagctagctgatcgatcgta": 1, "tgatcgatcgatgctagctagg": 1, "gctgactgatcgatcgatgct": 1, "agctgactgatcgatcgatgc": 1, "gatcgatcgatgtgcggct": 1, "gctgatcatcgatgctactagc": 1, "gctagctgatcatcgatgctac": 1, "gatcgatcgatgtgcggc": 1, "ctagctagctgactgatacgc": 1, "tagctgatcgatcgatgtgcg": 1, "agctgatcgatcgatgtgc": 1, "gctgatcatcatcgatgctagc": 1, "gctagctgatcatcatcgatgc": 1, "aagcatcggattagctagctga": 1, "gatcgatcgtagcggcga": 1, "atcggattagctagctgatgc": 1, "gcatcggattagctagctgat": 1, "gcggcgatctagctagctg": 1, "tgctagtgatgcatgctagt": 1, "ctactatcatctctgcgcga": 1, "actagctagctgactgatacgc": 1, "gctagctagctgatcatcga": 1, "tctctgcgcgatcgatgcta": 1, "tgatcgatcgatgctagctagt": 1, "actgatcgatcgatgctagcta": 1, "tagctagctgatcgatcgatgt": 1, "agctaggcgatgctagcta": 1, "tagctaggcgatgctagct": 1, "gatcgatcgatgctagctagg": 1, "gctagctagctgactgatcgat": 1, "gatcgatgctagctaggcg": 1, "cgatcgatgctagctaggc": 1, "tagctagctgactgatacgc": 1, "agctagctgactgatcgatc": 2, "aaagcatcggattagctagctg": 1, "gctgactgatcgatcatcatgc": 1, "tagctactatcatctctgcgcg": 1, "ctgatcgatcgatgtgcggc": 1, "gctgatcgatcgatgtgcgg": 1, "tcgtagcggcgatctagct": 1, "agcggcgatctagctagct": 1, "ctagctagctgatcatcgatgc": 1, "gctagctagctgatcatcgatg": 1, "tcatctctgcgcgatcga": 1, "tcgatcgatgtgcggcta": 1, "tgatcgatcgatgtgcggc": 1, "ctagctaggcgatgctagctag": 1, "gctagctagctgatcgatcgat": 2, "ctgcgcgatcgatgctag": 1, "aagcatcggattagctagct": 1, "gctagctgatcatcgatgcta": 1, "tagctagctgatcatcgatgc": 1, "actgatacgcgatgctagc": 1, "gctagctgactgatcgatcatc": 1, "atcgatcgatgctagctagg": 1, "atctctgcgcgatcgatgc": 1, "tgatcgatcgtagcggcg": 1, "atcatctctgcgcgatcgatg": 1, "agctagctgatcgatcgtag": 1, "ctagctagctgatcgatcgt": 1, "gctagctgactgatcgatcat": 1, "ctgatcgatcgtagcggcg": 1, "ctgactgatacgcgatgct": 1, "agctgactgatacgcgatg": 1, "gctagctgatcgatcgtagcg": 1, "ctagctgactgatcgatcga": 1, "agctagctactgatcgatgcta": 1, "tagctagctactgatcgatgct": 1, "gactgatacgcgatgctagcta": 1, "actgatacgcgatgctagctag": 1, "gactgatcgatcgatgctagct": 1, "gctagctgactgatcgatcgat": 1, "tgcgcgatcgatgctagcta": 1, "gcggcgatctagctagctga": 1, "agcggcgatctagctagctg": 1, "ctactatcatctctgcgcgatc": 1, "tatcatctctgcgcgatcg": 1, "tactatcatctctgcgcgatcg": 1, "tagctagctgactgatcgatca": 1, "gctgatcgatcgatgctagcta": 1, "tagctgatcgatcgatgctagc": 1, "gctagctgatcgatcgatgcta": 1, "tagctagctgatcgatcgatgc": 1, "gctaggcgatgctagctag": 1, "ctagctaggcgatgctagc": 1, "gctagctaggcgatgctag": 1, "catctctgcgcgatcgatgc": 1, "aaagcatcggattagctagct": 1, "ctgactgatcgatcgatgctag": 1, "ctagctgactgatcgatcgatg": 1, "tactatcatctctgcgcgatc": 1, "gctagctactgatcgatgctac": 1, "ctactatcatctctgcgcgat": 1, "agctgatcatcgatgctact": 1, "gctagctagctgatcatcgat": 1, "ctgatacgcgatgctagct": 1, "ggcgatctagctagctgac": 1, "tgactgatcgatcgatgctag": 1, "ctgactgatcgatcgatgcta": 1, "tagctgactgatcgatcgatg": 1, "actgatcgatcatcatgctagc": 1, "agctgactgatcgatcatca": 1, "ctagctagctgatcgatcga": 2, "gatcgatcgatgtgcggctag": 1, "tgctagctaggcgatgct": 1, "gctgatcgatcgtagcggc": 1, "cgatcgatgtgcggctag": 1, "tgatcgatcgatgtgcggct": 1, "ctgactgatcgatcatcatgct": 1, "agctgactgatcgatcatcatg": 1, "agctagctgactgatacgcga": 1, "tgactgatcgatcgatgctagc": 1, "gctgactgatcgatcgatgcta": 1, "tagctgactgatcgatcgatgc": 1, "agctagctgatcgatcgatgtg": 1, "ctgatcgatcgatgctagctag": 2, "ctagctgatcgatcgatgctag": 1, "ctagctagctgatcgatcgatg": 2, "gactgatcgatcatcatgctagc": 1, "gctagtgatgcatgctagtagtg": 1, "gctactatcatctctgcgcgat": 1, "gtagcggcgatctagctag": 1, "tgactgatcgatcatcatgct": 1, "ctagctactatcatctctgcgc": 1, "gctagctactatcatctctgcg": 1, "ctagctagctactgatcgatgc": 1, "gctagctagctactgatcgatg": 1, "catcgatcgatgctagtatgct": 1, "tgatcgatcgatgctagctag": 2, "ctgatcgatcgatgctagcta": 2, "tagctgatcgatcgatgctag": 1, "ctagctgatcgatcgatgcta": 1, "tagctagctgatcgatcgatg": 2, "gatcgatcgatgctagctagt": 1, "ctatcatctctgcgcgatcgat": 1, "tgatcgatcgtagcggcga": 1, "tcgtagcggcgatctagctag": 1, "tactagctagctgactgatacgc": 1, "ctgatcatcatcgatgctagct": 1, "agctgatcatcatcgatgctag": 1, "ctagctgatcatcatcgatgct": 1, "agctagctgatcatcatcgatg": 1, "ctgatcgatcatcatgctagct": 1, "ctagctgactgatcgatcgat": 1, "ttagctagctgactgatcgatca": 1, "tagctactatcatctctgcgc": 1, "gctagctactgatcgatgcta": 1, "tagctagctactgatcgatgc": 1, "tctctgcgcgatcgatgc": 1, "ctctgcgcgatcgatgct": 1, "agctagctactatcatctctgcg": 1, "ctagctagctactgatcgatgct": 1, "ctgatcgatcgtagcggc": 1, "gctgatcgatcgtagcgg": 1, "agctaggcgatgctagct": 1, "tgctagtgatgcatgctagtagt": 1, "gcgcgatcgatgctagct": 1, "tgatcatcatcgatgctagct": 1, "agctgatcatcatcgatgcta": 1, "tagctgatcatcatcgatgct": 1, "tgatcgatcatcatgctagct": 1, "ctagctagctgactgatacgcg": 1, "tgctagtgatgcatgctagtag": 1, "gctagtgatgcatgctagtagt": 1, "tagctagctgatcatcgatgcta": 1, "agctagctgactgatacgc": 1, "tatcatctctgcgcgatcgatg": 1, "agctgactgatcgatcatcat": 1, "actagctagctgatcatcatcga": 1, "tagctagctgactgatcgatcat": 1, "gatgctagctaggcgatgctag": 1, "cggcgatctagctagctgact": 1, "ctagctagctgatcgatcgat": 2, "actgatcgatcatcatgctagct": 1, "ctagctagctgactgatcgatc": 1, "ctgactgatcgatcatcatgc": 1, "gctgactgatcgatcatcatg": 1, "gatcgatcgatgctagctaggc": 1, "gtgatgcatgctagtagtgatgt": 1, "tgctagtgatgcatgctagta": 1, "tagcggcgatctagctagctg": 1, "gtagcggcgatctagctagct": 1, "tagctgatcgatcgtagcg": 1, "gctagctagctactgatcgat": 1, "agctagctactgatcgatgctac": 1, "atcgatcgatgctagtatgct": 1, "agctactgatcgatgctacatc": 1, "agtgatgcatgctagtagtga": 1, "gactgatcgatcgatgctagcta": 1, "ctgatcgatcgatgctagctagt": 1, "actgatcgatcgatgctagctag": 1, "ctagctagctgatcgatcgatgt": 1, "catcgatcgatgctagtatgc": 1, "tagctagctgactgatcgatc": 2, "ctagctagctgactgatcgat": 1, "tcgatgctagctaggcga": 1, "tgatcgatcgatgctagctagta": 1, "ctgcgcgatcgatgctagc": 1, "agctagctgatcatcatcgat": 1, "tgcgcgatcgatgctagc": 1, "ctagctagctgatcgatcgtag": 1, "actagctagctgactgatacg": 1, "ctagctgactgatacgcga": 1, "gctactagctagctgactgat": 1, "ctgatcatcatcgatgctagc": 1, "gctgatcatcatcgatgctag": 1, "ctagctgatcatcatcgatgc": 1, "gctagctgatcatcatcgatg": 1, "ctgatcgatcatcatgctagc": 1, "agctactgatcgatgctacat": 1, "tgatcgatcgatgtgcggcta": 1, "atctctgcgcgatcgatg": 1, "catctctgcgcgatcgat": 1, "atcatctctgcgcgatcg": 1, "aagcatcggattagctagctgat": 1, "agtgatgcatgctagtagtgatg": 1, "gatcgatgctagctaggcgatg": 1, "atctctgcgcgatcgatgcta": 1, "tagctagctgactgatacgcga": 1, "tagctagctgatcgatcgtag": 1, "ctagctagctgatcgatcgta": 1, "tcgatcgatgctagctagtag": 1, "gctagctactgatcgatgctaca": 1, "agctagctgactgatcgatcatc": 1, "agctagctgactgatcgatcga": 1, "tctctgcgcgatcgatgct": 1, "tgatgcatgctagtagtgatgt": 1, "tgatcgatcgatgtgcgg": 1, "cgatcgatgctagctaggcga": 1, "tcgatcgatgctagctaggcg": 1, "atcgatcgatgcatgcatg": 1, "catcgatcgatgcatgcat": 1, "actagctagctgatcatcatcg": 1, "ctgatcatcgatgctactagct": 1, "agctgatcatcgatgctactag": 1, "ctagctgatcatcgatgctact": 1, "tttagctagctgactgatcga": 1, "tagctagctgatcgatcgatgtg": 1, "gctagctagctgatcatcatct": 1, "ctagctagctgatcatcgatgct": 1, "agctagctactatcatcgatcga": 1, "ttagctagctgactgatcgatc": 1, "ctagctgactgatcgatcatca": 1, "aaagcatcggattagctagctga": 1, "agctgactgatacgcgatgct": 1, "tagctagctactgatcgatgcta": 1, "tcatcatcgatgctagctagt": 1, "tcgatcatcatgctagctact": 1, "tgatcatcgatgctactagct": 1, "agctgatcatcgatgctacta": 1, "tagctgatcatcgatgctact": 1, "tcgatcgatgctagtatgctag": 1, "gcgatctagctagctgact": 1, "gctactgatcgatgctacatc": 1, "cggcgatctagctagctg": 1, "gctagctgactgatcgatcatca": 1, "actatcatctctgcgcgat": 1, "catcggattagctagctgatg": 1, "tagctgactgatcgatcatca": 1, "actagctagctgatcatcatcgat": 1, "agtgatgcatgctagtagtgat": 1, "ctagctagctgatcatcatcga": 1, "gctgatcatcgatgctactagct": 1, "agctgatcatcgatgctactagc": 1, "gctagctgatcatcgatgctact": 1, "agctagctgatcatcgatgctac": 1, "tagctagctactatcatctctgcg": 1, "ctagctagctactgatcgatgcta": 1, "agctactatcatctctgcgcga": 1, "gctatttagctagctgactgatcg": 1, "tgatcgatcatcatgctagctac": 1, "gtgatgcatgctagtagtgatg": 1, "ctagctagctgactgatcgatcg": 1, "ctagctactgatcgatgctaca": 1, "cggcgatctagctagctgacta": 1, "atgctagctaggcgatgc": 1, "ctgatcgatcatcatgctagctac": 1, "gctactagctagctgatcatca": 2, "ctgactgatacgcgatgctagc": 1, "gctgactgatacgcgatgctag": 1, "ctagctgactgatacgcgatgc": 1, "gctagctgactgatacgcgatg": 1, "tgactgatcgatcatcatgctag": 1, "ctgactgatcgatcatcatgcta": 1, "tagctgactgatcgatcatcatg": 1, "ctagctagctgatcgatcgtagc": 1, "gctagctagctgatcgatcgtag": 1, "ctgatcgatcgatgctagctagg": 1, "gatcgatcgatgctagctagtag": 1, "ttagctagctgactgatcgatcat": 1, "ctgactgatcgatcatcatgctag": 1, "ctagctgactgatcgatcatcatg": 1, "ctagctgatcgatcgatgtgcg": 1, "tttagctagctgactgatcgatc": 1, "tgactgatcgatcatcatgcta": 1, "gctagctactatcatcgatcga": 1, "gatcgatcgatgctagctagta": 1, "agctagctactatcatcgatcg": 1, "atcgatcgatgctagctagtag": 1, "tgatcatcatcgatgctagctagt": 1, "tgatcgatcatcatgctagctact": 1, "actgatcgatcatcatgctagcta": 1, "catcgatcgatgctagtatgcta": 1, "tttagctagctgactgatcgat": 1, "atttagctagctgactgatcga": 1, "cgcgatcgatgctagcta": 1, "catcgatcgatgctagtatgctag": 1, "tagctagctactgatcgatgctac": 1, "agcatcggattagctagctgatg": 1, "agctagctgactgatacgcgat": 1, "tgatcatcatcgatgctagctag": 1, "ctgatcatcatcgatgctagcta": 1, "tagctgatcatcatcgatgctag": 1, "ctagctgatcatcatcgatgcta": 1, "tagctagctgatcatcatcgatg": 1, "ctgatcgatcatcatgctagcta": 1, "gatcatcatcgatgctagctagt": 1, "gatcgatcatcatgctagctact": 1, "gctagctagctgactgatcgatc": 1, "tgatcgatcgatgctagctagtag": 1, "ctgatcgatcgatgctagctagta": 1, "ctgatcatcatcgatgctagctag": 1, "ctagctgatcatcatcgatgctag": 1, "ctagctagctgatcatcatcgatg": 1, "tttagctagctgactgatcgatca": 1, "actatcatctctgcgcgatcga": 1, "agctgatcgatcgtagcg": 1, "gctactagctagctgactgatac": 1, "agctgatcgatcgatgctagct": 1, "agctagctgatcgatcgatgct": 1, "ctagctgactgatcgatcatcat": 1, "agctagctactatcatctctgc": 1, "ctagctactatcatctctgcgcg": 1, "tgatcatcatcgatgctagcta": 1, "tagctgatcatcatcgatgcta": 1, "tgatcgatcatcatgctagcta": 1, "atcatcatcgatgctagctagt": 1, "atcgatcatcatgctagctact": 1, "agctagctactatcatcgatcgat": 1, "gctagctgatcgatcgatgtgc": 1, "tagctgactgatcgatcatcat": 1, "tagctagctgactgatcgatcga": 1, "atcgatcgatgctagtatgctag": 1, "ctagtgatgcatgctagtagtga": 1, "tagctagctgactgatcgatcatc": 1, "tactagctagctgatcatcatcga": 1, "gctagctagctactatcatcga": 1, "tgactgatacgcgatgctagct": 1, "agctgactgatacgcgatgcta": 1, "tagctgactgatacgcgatgct": 1, "atcgatcgatgctagtatgcta": 1, "ctagctagctgatcatcatcgat": 1, "agctgactgatcgatcgatgct": 1, "ctagctagctgatcatcgatgcta": 1, "gtgatgcatgctagtagtgatgta": 1, "gctgatcatcatcgatgctagct": 1, "agctgatcatcatcgatgctagc": 1, "gctagctgatcatcatcgatgct": 1, "agctagctgatcatcatcgatgc": 1, "tagtgatgcatgctagtagtga": 1, "ctactagctagctgactgatacg": 1, "tagctactgatcgatgctacatc": 1, "gactgatacgcgatgctagctag": 1, "ctagctactgatcgatgctacat": 1, "gctagctactatcatctctgcgc": 1, "gctagctagctactgatcgatgc": 1, "gctactagctagctgatcatcat": 2, "ctagctactgatcgatgctacatc": 1, "gctactagctagctgatcatcatc": 2, "gctgatcatcatctagctagtagc": 1, "tagctagctgatcatcatcgat": 1, "ctactatcatctctgcgcgatcg": 1, "tactagctagctgactgatacg": 1, "gctgatcgatcgatgctagctag": 1, "ctagctgatcgatcgatgctagc": 1, "gctagctgatcgatcgatgctag": 1, "ctagctagctgatcgatcgatgc": 1, "gctagctagctgatcgatcgatg": 2, "gctactagctagctgactgata": 1, "gatcgatcatcatgctagctac": 1, "cgatgctagctaggcgat": 1, "atcgatgctagctaggcg": 1, "tagctactgatcgatgctacat": 1, "gctagctactatcatcgatcgat": 1, "tgcatgctagtagtgatgtatacg": 1, "gcatgctagtagtgatgtatacgt": 1, "atttagctagctgactgatcgatc": 1, "gactgatcgatcatcatgctag": 1, "atttagctagctgactgatcgat": 1, "gctgactgatcgatcatcatgct": 1, "agctgactgatcgatcatcatgc": 1, "tagctactatcatctctgcgcga": 1, "gctgatcatcgatgctactagcta": 1, "tagctgatcatcgatgctactagc": 1, "gctagctgatcatcgatgctacta": 1, "tagctagctgatcatcgatgctac": 1, "tagtgatgcatgctagtagtgatg": 1, "agtgatgcatgctagtagtgatgt": 1, "tgatgcatgctagtagtgatgta": 1, "ctgactgatcgatcgatgctagc": 1, "gctgactgatcgatcgatgctag": 1, "ctagctgactgatcgatcgatgc": 1, "gctagctgactgatcgatcgatg": 1, "tcatcatcgatgctagctagtag": 1, "tactagctagctgatcatcatcg": 1, "tcgatcatcatgctagctactag": 1, "tgatcatcgatgctactagctag": 1, "ctgatcatcgatgctactagcta": 1, "tagctgatcatcgatgctactag": 1, "ctagctgatcatcgatgctacta": 1, "ctactagctagctgatcatcatcg": 1, "ctgatcatcgatgctactagctag": 1, "ctagctgatcatcgatgctactag": 1, "gctagctagctgatcatcatctag": 1, "gctagctagctgatcatcatcta": 1, "ctagtgatgcatgctagtagtg": 1, "gctactatcatctctgcgcgatc": 1, "gctgatcgatcgatgtgc": 1, "tagctagctactatcatcgatcga": 1, "agctagctgatcgatcgtagcg": 1, "tgactgatacgcgatgct": 1, "gatcatcatcgatgctagctag": 1, "tcatcatcgatgctagctagta": 1, "tcgatcatcatgctagctacta": 1, "tgatcatcgatgctactagcta": 1, "tagctgatcatcgatgctacta": 1, "tagctagctgactgatacgcgat": 1, "ctagctagctactatcatcgatcga": 1, "agctagctgactgatcgatcgat": 1, "ctactagctagctgactgatacgc": 1, "gctactagctagctgactgatacg": 1, "tgatcatcatcgatgctagctagta": 1, "tgatcgatcatcatgctagctacta": 1, "ctagtgatgcatgctagtagtgatg": 1, "gctagctagctactatcatcgatc": 1, "gctagctactgatcgatgctacat": 1, "gctagctagctactatcatcgat": 1, "ctagtgatgcatgctagtagtgat": 1, "tactatcatctctgcgcgatcga": 1, "agctgatcgatcgatgctagcta": 1, "tagctgatcgatcgatgctagct": 1, "agctagctgatcgatcgatgcta": 1, "tagctagctgatcgatcgatgct": 1, "tagtgatgcatgctagtagtgat": 1, "tactagctagctgatcatcatcgat": 1, "gctagctagctgatcatcgatgc": 1, "gctagtgatgcatgctagtagtga": 1, "aaagcatcggattagctagctgat": 1, "gtgatgcatgctagtagtgatgtat": 1, "ctatcatctctgcgcgatcgatg": 1, "tgactgatacgcgatgctagcta": 1, "tagctgactgatacgcgatgcta": 1, "tgctagtagtgatgtatacgtagct": 1, "tgactgatcgatcgatgctagct": 1, "agctgactgatcgatcgatgcta": 1, "tagctgactgatcgatcgatgct": 1, "ctagctagctactatcatcgatcg": 1, "tagctagctactatcatcgatcg": 1, "gactgatcgatcatcatgctagct": 1, "gctagctgactgatcgatcatcat": 1, "ctatttagctagctgactgatcga": 1, "gcatgctagtagtgatgtatacg": 1, "tatttagctagctgactgatcga": 1, "ctactagctagctgatcatcatcga": 1, "agctactatcatctctgcgcgat": 1, "gctgatcatcatcgatgctagcta": 1, "tagctgatcatcatcgatgctagc": 1, "gctagctgatcatcatcgatgcta": 1, "tagctagctgatcatcatcgatgc": 1, "atgcatgctagtagtgatgtatacg": 1, "tgatgcatgctagtagtgatgtat": 1, "gactgatcgatcgatgctagctag": 1, "gctatttagctagctgactgatc": 1, "tgctagtgatgcatgctagtagtg": 1, "ctagctagctactatcatctctgc": 1, "gctagctagctactatcatctctg": 1, "gatcatcatcgatgctagctagta": 1, "gatcgatcatcatgctagctacta": 1, "atcatcatcgatgctagctagtag": 1, "atcgatcatcatgctagctactag": 1, "tagctagctactatcatctctgc": 1, "atcatcatcgatgctagctagta": 1, "atcgatcatcatgctagctacta": 1, "gatcatcatcgatgctagctagtag": 1, "gatcgatcatcatgctagctactag": 1, "actagctagctgatcatcatctact": 1, "tgactgatcgatcatcatgctagc": 1, "gctgactgatcgatcatcatgcta": 1, "tagctgactgatcgatcatcatgc": 1, "tgctagtagtgatgtatacgtagc": 1, "ctagctagctgactgatacgcga": 1, "tagctagctactatcatcgatcgat": 1, "gctactagctagctgatcatcatct": 1, "agctgatcatcatctagctagtagc": 1, "ctagctagctgatcgatcgatgtg": 1, "agtgatgcatgctagtagtgatgta": 1, "tagtgatgcatgctagtagtgatgt": 1, "actatcatctctgcgcgatcgat": 1, "ctatttagctagctgactgatcg": 1, "tagctagctgatcgatcgtagcg": 1, "gcatcggattagctagctgatgc": 1, "tgcatgctagtagtgatgtatacgt": 1, "tttagctagctgactgatcgatcat": 1, "atttagctagctgactgatcgatca": 1, "gctagctagctactatcatctct": 1, "aagcatcggattagctagctgatg": 1, "agtgatgtatacgtagctagtagc": 1, "gctagtagtgatgtatacgtagct": 1, "tagctagctgactgatcgatcgat": 1, "actagctagctgactgatacgcg": 1, "actagctagctgatcatcatctac": 1, "tagctgatcgatcgatgctagcta": 1, "tagctagctgatcgatcgatgcta": 1, "tatttagctagctgactgatcgat": 1, "gcatgctagtagtgatgtatacgta": 1, "tatttagctagctgactgatcgatc": 1, "ctatttagctagctgactgatcgat": 1, "ctagctagctactatcatctctgcg": 1, "tgatcgatcgatgctagctaggc": 1, "agctagctactgatcgatgctaca": 1, "tgactgatcgatcgatgctagcta": 1, "tagctgactgatcgatcgatgcta": 1, "catgctagtagtgatgtatacgtagc": 1, "gcatgctagtagtgatgtatacgtag": 1, "actgatcgatcgatgctagctagt": 1, "ctatttagctagctgactgatcgatc": 1, "ttagctagctgactgatcgatcatc": 1, "atgctagtagtgatgtatacgtagct": 1, "ctagctagctgatcatcatctact": 1, "ctactagctagctgatcatcatct": 1, "agctgatcatcatctagctagtag": 1, "ctagctgatcatcatctagctagt": 1, "tagctactatcatctctgcgcgat": 1, "gactgatcgatcatcatgctagcta": 1, "ctgatcatcatcgatgctagctagt": 1, "actagctagctgatcatcatcgatg": 1, "ctgatcgatcatcatgctagctact": 1, "atgctagtagtgatgtatacgtagc": 1, "ctagctagctactgatcgatgctac": 1, "gctagctagctactatcatctctgc": 1, "agctagctgatcatcatctactatca": 1, "ctgatcgatcgatgctagctagtag": 1, "agctagctgactgatcgatcatca": 1, "gctagctagctactatcatcgatcg": 1, "gctatttagctagctgactgatcga": 1, "ctagctagctactatcatcgatcgat": 1, "agctgatcatcgatgctactagct": 1, "agctagctgatcatcgatgctact": 1, "ctagctagctgactgatcgatcga": 1, "actgatcgatcatcatgctagctac": 1, "tgatgcatgctagtagtgatgtatac": 1, "gtgatgcatgctagtagtgatgtata": 1, "tactatcatctctgcgcgatcgat": 1, "gctagctgatcatcatctactatca": 1, "gctactagctagctgatcatcatcta": 1, "tagctgatcatcatctagctagtagc": 1, "tgctagtagtgatgtatacgtagcta": 1, "gatgcatgctagtagtgatgtatacg": 1, "tagtgatgcatgctagtagtgatgta": 1, "gctagtgatgcatgctagtagtgat": 1, "tgcatgctagtagtgatgtatacgta": 1, "tatttagctagctgactgatcgatca": 1, "tgatgcatgctagtagtgatgtata": 1, "tactagctagctgactgatacgcg": 1, "ctagctactatcatctctgcgcga": 1, "agctagctgatcatcatctactatc": 1, "agctagctgatcatcatctactat": 1, "gctactagctagctgatcatcatcg": 1, "gctgatcatcgatgctactagctag": 1, "ctagctgatcatcgatgctactagc": 1, "gctagctgatcatcgatgctactag": 1, "ctagctagctgatcatcgatgctac": 1, "actagctagctgatcatcatctacta": 1, "tactagctagctgatcatcatctact": 1, "ctactagctagctgatcatcatcgat": 1, "tagctagctactgatcgatgctaca": 1, "gtagtgatgtatacgtagctagtagc": 1, "actgatcgatcgatgctagctagta": 1, "gatgcatgctagtagtgatgtatac": 1, "agctgatcatcatcgatgctagct": 1, "agctagctgatcatcatcgatgct": 1, "ctagctagctgactgatacgcgat": 1, "atgcatgctagtagtgatgtatac": 1, "agctagctactatcatctctgcgc": 1, "gctagctagctactgatcgatgct": 1, "ctactatcatctctgcgcgatcga": 1, "gctagctactgatcgatgctacatc": 1, "tagtgatgtatacgtagctagtagc": 1, "gctagtagtgatgtatacgtagcta": 1, "tgatcatcatcgatgctagctagtag": 1, "ctgatcatcatcgatgctagctagta": 1, "tactagctagctgatcatcatcgatg": 1, "tgatcgatcatcatgctagctactag": 1, "ctgatcgatcatcatgctagctacta": 1, "agctgatcgatcgatgctagctag": 1, "ctagctgatcgatcgatgctagct": 1, "agctagctgatcgatcgatgctag": 1, "ctagctagctgatcgatcgatgct": 1, "tactagctagctgatcatcatctac": 1, "gctagctgatcatcatctactatc": 1, "agtgatgcatgctagtagtgatgtat": 1, "gctagtagtgatgtatacgtagctag": 1, "tagctagctgactgatcgatcatca": 1, "ctactagctagctgatcatcatctac": 1, "agtagtgatgtatacgtagctagt": 1, "gctagctgatcatcatctactatcat": 1, "agctgatcatcatctactatcatca": 1, "atgcatgctagtagtgatgtatacgt": 1, "atttagctagctgactgatcgatcat": 1, "agctgatcatcgatgctactagcta": 1, "tagctgatcatcgatgctactagct": 1, "agctagctgatcatcgatgctacta": 1, "tagctagctgatcatcgatgctact": 1, "atgctagtagtgatgtatacgtagcta": 1, "gctagctgatcatcatctactatcatc": 1, "ctagctagctgatcatcatctacta": 1, "ctactagctagctgatcatcatcta": 1, "tagctgatcatcatctagctagtag": 1, "ctagctgatcatcatctagctagta": 1, "gctgatcatcatcgatgctagctag": 1, "ctagctgatcatcatcgatgctagc": 1, "gctagctgatcatcatcgatgctag": 1, "ctagctagctgatcatcatcgatgc": 1, "agctagctgatcatcatctactatcat": 1, "ctactagctagctgatcatcatctact": 1, "ctagctgatcatcatctagctagtag": 1, "aaagcatcggattagctagctgatg": 1, "agctagctactgatcgatgctacat": 1, "tagctagctgatcatcatctactatca": 1, "actagctagctgatcatcatctactat": 1, "ctgactgatcgatcatcatgctagc": 1, "gctgactgatcgatcatcatgctag": 1, "ctagctgactgatcgatcatcatgc": 1, "gctagctgactgatcgatcatcatg": 1, "tgctagtagtgatgtatacgtagctag": 1, "agtagtgatgtatacgtagctagtagc": 1, "gctagtagtgatgtatacgtagctagt": 1, "ctagtgatgcatgctagtagtgatgt": 1, "gctgatcatcatctactatcatcatca": 1, "agctagctgactgatcgatcatcat": 1, "tttagctagctgactgatcgatcatc": 1, "catgctagtagtgatgtatacgtag": 1, "agctgatcatcatcgatgctagcta": 1, "tagctgatcatcatcgatgctagct": 1, "agctagctgatcatcatcgatgcta": 1, "tagctagctgatcatcatcgatgct": 1, "gctatttagctagctgactgatcgat": 1, "ctagctagctgactgatcgatcgat": 1, "agctgatcatcatctactatcatcat": 1, "tagctagctactatcatctctgcgc": 1, "gctagctagctactgatcgatgcta": 1, "tgctagtgatgcatgctagtagtga": 1, "tagctgatcgatcgatgctagctag": 1, "ctagctgatcgatcgatgctagcta": 1, "tagctagctgatcgatcgatgctag": 1, "ctagctagctgatcgatcgatgcta": 1, "gtgatgcatgctagtagtgatgtatac": 1, "agctgatcatcatctactatcatcatc": 1, "tagctagctgatcatcatctactat": 1, "tagctagctgatcatcatctactatc": 1, "tgactgatcgatcatcatgctagct": 1, "agctgactgatcgatcatcatgcta": 1, "tagctgactgatcgatcatcatgct": 1, "ctagctagctgatcatcatctactat": 1, "agtgatgcatgctagtagtgatgtata": 1, "tagtgatgcatgctagtagtgatgtat": 1, "tgactgatcgatcgatgctagctag": 1, "ctgactgatcgatcgatgctagcta": 1, "tagctgactgatcgatcgatgctag": 1, "ctagctgactgatcgatcgatgcta": 1, "tagctagctgactgatcgatcgatg": 1, "gactgatcgatcgatgctagctagt": 1, "tactagctagctgatcatcatctacta": 1, "tagctgatcatcgatgctactagcta": 1, "tagctagctgatcatcgatgctacta": 1, "atgcatgctagtagtgatgtatacgta": 1, "tatttagctagctgactgatcgatcat": 1, "ctagctagctgatcatcatctactatc": 1, "tagctactatcatctctgcgcgatc": 1, "gctgatcatcatctactatcatcat": 1, "ctagctactatcatctctgcgcgat": 1, "gctgatcatcatctactatcatcatc": 1, "tagctagctactgatcgatgctacat": 1, "agtagtgatgtatacgtagctagtag": 1, "ctagtagtgatgtatacgtagctagt": 1, "catgctagtagtgatgtatacgtagct": 1, "gactgatcgatcatcatgctagctac": 1, "tagctgatcatcatctactatcatca": 1, "ctagctgatcatcatctactatcatca": 1, "ctagctgatcatcatctagctagtagc": 1, "tagctagctgactgatcgatcatcat": 1, "ctagtgatgcatgctagtagtgatgta": 1, "tgcatgctagtagtgatgtatacgtag": 1, "ctatttagctagctgactgatcgatca": 1, "tagctgatcatcatcgatgctagcta": 1, "tagctagctgatcatcatcgatgcta": 1, "gctagctagctactatcatcgatcga": 1, "gctactagctagctgatcatcatctac": 1, "ttagctagctgactgatcgatcatca": 1, "tgactgatcgatcatcatgctagcta": 1, "tagctgactgatcgatcatcatgcta": 1, "actgatcgatcatcatgctagctact": 1, "gctagtgatgcatgctagtagtgatg": 1, "ctagctagctactgatcgatgctaca": 1, "gactgatcgatcgatgctagctagta": 1, "actgatcgatcgatgctagctagtag": 1, "ctagctgatcatcatctactatcatc": 1, "ctgatcatcatcgatgctagctagtag": 1, "ctactagctagctgatcatcatcgatg": 1, "ctgatcgatcatcatgctagctactag": 1, "tagctgatcatcatctactatcatcat": 1, "tgatgcatgctagtagtgatgtatacg": 1, "gatgcatgctagtagtgatgtatacgt": 1, "gctactagctagctgatcatcatcga": 1, "agctgatcatcgatgctactagctag": 1, "ctagctgatcatcgatgctactagct": 1, "agctagctgatcatcgatgctactag": 1, "ctagctagctgatcatcgatgctact": 1, "atttagctagctgactgatcgatcatc": 1, "tctactatcatcatcatctactagct": 1, "tgctagtgatgcatgctagtagtgat": 1, "ctgatcatcatctactatcatcatca": 1, "agctagctactgatcgatgctacatc": 1, "tagtagtgatgtatacgtagctagtag": 1, "ctagtagtgatgtatacgtagctagta": 1, "actgatcgatcatcatgctagctacta": 1, "gcatgctagtagtgatgtatacgtagc": 1, "gctatttagctagctgactgatcgatc": 1, "atctactatcatcatcatctactagct": 1, "catctactatcatcatcatctactagc": 1, "tgatcatcatctactatcatcatcatc": 1, "tagctgatcatcgatgctactagctag": 1, "ctagctgatcatcgatgctactagcta": 1, "tagctagctgatcatcgatgctactag": 1, "ctagctagctgatcatcgatgctacta": 1, "ctgatcatcatctactatcatcatcat": 1, "gctagctagctactatcatcgatcgat": 1, "ttagctagctgactgatcgatcatcat": 1, "tagctagctactgatcgatgctacatc": 1, "ctagctagctactgatcgatgctacat": 1, "gatcatcatctactatcatcatcatct": 1, "tttagctagctgactgatcgatcatca": 1, "tctactatcatcatcatctactagcta": 1, "see": 1, "James": 1, "E": 1, "Angelo": 1, "Neville": 1, "R": 1, "Moody": 1, "Michael": 1, "I": 1, "Baskes": 1, "Modelling": 1, "and": 1, "Simulation": 1, "in": 1, "Materials": 1, "Science": 1, "&": 1, "Engineering": 1, "vol.": 1, "pp.": 1, "(": 1, ")": 1, "Ni": 1, "Al": 1, "H": 1, "fcc": 2 }, "Forth": { "immediate": 137, "lastxt": 22, "@": 100, "dup": 131, "c@": 17, "negate": 17, "swap": 133, "c": 43, ";": 494, "source": 13, "nip": 30, "in": 11, "Copyright": 9, "Lars": 9, "Brinkhoff": 9, "char": 62, "(": 471, "-": 1819, ")": 466, "bl": 27, "word": 35, "here": 58, "+": 183, "ahead": 10, "resolve": 20, "postpone": 161, "nonimmediate": 5, "[": 98, "compile": 12, "]": 63, "literal": 30, "create": 36, "dovariable_code": 5, "header": 6, "reveal": 8, "postponers": 10, "caddr": 13, "drop": 32, "C": 66, "find": 13, "cells": 17, "execute": 8, "unresolved": 21, "orig": 25, "chars": 10, "n1": 17, "n2": 17, "else": 35, "orig1": 5, "orig2": 5, "branch": 14, "if": 91, "flag": 22, "0branch": 25, "then": 87, "does": 34, "dodoes_code": 5, "over": 42, "code": 19, "r": 162, "begin": 44, "dest": 26, "while": 41, "x": 78, "repeat": 41, "until": 5, "recurse": 10, "pad": 16, "addr": 47, "parse": 20, "n": 82, "": 5, "2dup": 39, "r@": 30, "2drop": 42, "TODO": 131, "If": 5, "necessary": 5, "refill": 13, "and": 30, "keep": 5, "parsing.": 5, "string": 28, "allot": 24, "align": 8, "cmove": 6, "s": 31, "cell": 27, "aligned": 8, "squote": 5, "": 16, "state": 12, "abort": 22, "cr": 28, "type": 22, "Core": 5, "words.": 15, "#": 17, "#s": 5, "y": 46, "&": 5, "nand": 26, "invert": 14, "*": 16, "*/mod": 5, "loop": 42, "nest": 10, "sys": 26, "unloop": 10, "space": 17, "emit": 18, ".": 72, "<": 48, "digit": 10, "base": 13, "/mod": 10, "number": 14, "rot": 12, "count": 10, "/": 8, "x/y": 5, "x1": 45, "x2": 40, "2*": 7, "2n": 5, "Kernel": 34, "2/": 5, "2@": 5, "2over": 5, "x3": 20, "x4": 10, "pick": 13, "2swap": 5, "abs": 5, "|": 21, "accept": 5, "constant": 8, "decimal": 5, "depth": 7, "data_stack": 5, "do": 26, "R": 28, "environment": 5, "evaluate": 6, "fill": 5, "fm/mod": 5, "hold": 5, "j": 5, "leave": 5, "lshift": 10, "rshift": 17, "max": 10, "min": 5, "mod": 7, "move": 5, "quit": 10, "...": 11, "return_stack": 5, "interpret": 6, "bye": 7, "body": 11, "d": 16, "sign": 7, "sm/rem": 5, "spaces": 5, "u.": 5, "signbit": 15, "xor": 16, "u": 12, "um/mod": 5, "variable": 16, "/cell": 15, "Implements": 3, "ENUM.": 1, "Double": 1, "DOES": 1, "enum": 2, "But": 1, "this": 1, "is": 8, "simpler.": 1, "forth": 4, "#tib": 2, ".r": 1, "2r": 2, "2r@": 1, "noname": 1, "again": 5, "": 1, "case": 5, "xt": 21, "convert": 1, "endcase": 1, "endof": 1, "sys1": 1, "of": 7, "sys2": 1, "erase": 2, "expect": 1, "false": 2, "hex": 2, "marker": 1, "xn": 7, "x0": 4, "query": 1, "tib": 2, "#source": 2, "restore": 2, "input": 4, "roll": 3, "save": 3, "id": 1, "span": 1, "to": 6, "true": 3, "tuck": 3, "u.r": 1, "unused": 1, "value": 2, "within": 2, "Forth2012": 3, "core": 1, "extension": 6, "action": 1, "buffer": 2, "defer": 10, "xt2": 6, "xt1": 2, "defer@": 1, "holds": 1, "name": 6, "Simplifies": 1, "compiling": 1, "Usage": 1, "foo": 2, "bar": 1, "Tools": 4, ".s": 2, "dump": 2, "bounds": 5, "i": 11, "cdump": 2, "see": 17, "end": 12, "exit": 7, "nextxt": 6, "cabs": 6, "xt.": 6, "disassemble": 4, ".addr": 4, "line": 4, "#body": 2, "traverse": 2, "dictionary": 2, "in..": 8, "out..": 4, "execution": 2, "words": 2, "assembler": 9, "kernel": 2, "cs": 5, "editor": 2, "forget": 2, "tools": 2, "nr": 2, "synonym": 2, "undefined": 4, "defined": 3, "Assembler": 2, "for": 2, "x86.": 1, "Adds": 1, "FORTH": 1, "vocabulary": 3, "ASSEMBLER": 2, "CODE": 3, "CODE.": 2, "Creates": 1, "with": 4, "END": 1, "x86": 1, "opcodes.": 1, "Conventional": 1, "prefix": 1, "syntax": 2, "Addressing": 2, "modes": 2, "direct": 3, "register": 3, "": 1, "indirect": 4, "displacement": 1, "indexed": 2, "not": 4, "supported": 1, "yet": 1, "require": 2, "lib/common.fth": 1, "search.fth": 1, "also": 3, "definitions": 2, "Access": 1, "the": 9, "target": 1, "image.": 1, "delta": 2, "dp": 4, "h": 4, "This": 1, "signals": 1, "that": 1, "an": 1, "operand": 2, "a": 9, "address.": 1, "deadbeef": 1, "state.": 2, "opcode": 22, "dir": 5, "mrrm": 17, "sib": 11, "disp": 12, "imm": 15, "reg": 20, "opsize": 3, "Set": 6, "opcode.": 1, "And": 1, "destination": 1, "or": 4, "memory.": 2, "3@": 1, "off": 8, "mem": 2, "bits": 10, "mod/reg/rm": 1, "byte.": 2, "c0": 2, "reg@": 1, "@bits": 2, "rm@": 4, "rm": 11, "Write": 1, "parts": 1, "instruction": 3, "ds": 8, "twobyte": 2, "FF": 5, "imm8": 4, "imm16": 1, "imm32": 2, "disp8": 3, "disp32": 4, "size.": 1, "op8": 2, "op32": 1, "op16": 1, "SIB": 1, "displacement.": 1, "byte": 3, "pc": 2, "relative": 2, "operand.": 2, "addressing": 2, "direct.": 1, "reg1": 1, "reg2": 3, "ind": 6, "ind#": 2, "idx": 1, "idx#": 1, "Reset": 1, "0opsize": 4, "0ds": 5, "0reg": 4, "0mrrm": 2, "0sib": 2, "0disp": 2, "0imm": 2, "0asm": 4, "on": 1, "Enter": 1, "mode.": 1, "start": 3, "previous": 2, "mode": 2, "immediate.": 1, "extend": 2, "alu#": 9, "mov#": 2, "B0": 1, "push#": 2, "test#": 2, "F6": 1, "op": 12, "Process": 1, "one": 1, "All": 1, "operands": 1, "except": 1, "address": 1, "have": 2, "stack": 4, "picture": 1, "n*x": 1, "Define": 2, "formats.": 2, "mnemonic": 2, "format": 9, "csp": 2, "Instruction": 2, "0op": 20, "1reg": 3, "1op": 3, "2op": 18, "1addr": 3, "1imm8": 2, "mnemonics.": 1, "add": 1, "0F44": 1, "Todo": 1, "other": 1, "condition": 1, "codes.": 1, "0FB6": 1, "movzx": 1, "0FBE": 1, "movsx": 1, "adc": 1, "sbb": 1, "es": 1, "sub": 1, "2E": 1, "ss": 1, "cmp": 1, "3E": 1, "push": 2, "pop": 2, "fs": 1, "gs": 1, "jcc": 1, "test": 2, "xchg": 1, "mov": 3, "8D": 1, "lea": 1, "8F/0": 1, "nop": 1, "C3": 1, "ret": 1, "C6/0": 1, "r/m": 2, "C7/0": 1, "CD": 1, "int": 1, "E8": 1, "call": 2, "E9": 1, "jmp": 3, "EB": 1, "rel8": 1, "F0": 1, "lock": 1, "F2": 1, "rep": 1, "F3": 1, "repz": 1, "F4": 1, "hlt": 1, "F5": 1, "cmc": 1, "F610": 1, "F618": 1, "neg": 1, "F8": 1, "clc": 1, "F9": 1, "stc": 1, "FA": 1, "cli": 1, "FB": 1, "sti": 1, "FC": 1, "cld": 1, "FD": 1, "std": 1, "FE": 1, "inc": 1, "dec": 1, "sp": 4, "displaced": 1, "indirect.": 1, "registers.": 1, "reg8": 2, "reg16": 2, "reg32": 2, "Register": 1, "names.": 1, "al": 1, "ax": 1, "eax": 1, "cl": 1, "cx": 1, "ecx": 1, "dl": 1, "dx": 1, "edx": 1, "bx": 1, "ebx": 1, "ah": 1, "esp": 1, "ch": 1, "bp": 1, "ebp": 1, "dh": 1, "si": 1, "esi": 1, "bh": 1, "di": 1, "edi": 1, "Runtime": 1, "elsewhere.": 1, "only": 1, "Standard": 1, "entry": 1, "points.": 1, "KataDiversion": 1, "Forth": 1, "utils": 1, "empty": 2, "EMPTY": 1, "DEPTH": 2, "IF": 10, "BEGIN": 3, "DROP": 3, "UNTIL": 3, "THEN": 10, "power": 2, "**": 2, "n1_pow_n2": 1, "SWAP": 8, "DUP": 14, "DO": 2, "OVER": 2, "LOOP": 2, "NIP": 4, "compute": 1, "highest": 1, "below": 1, "N.": 1, "e.g.": 2, "MAXPOW2": 2, "log2_n": 1, "ABORT": 1, "ELSE": 7, "I": 5, "i*2": 1, "kata": 1, "given": 3, "N": 6, "has": 1, "two": 2, "adjacent": 2, "NOT": 3, "TWO": 3, "ADJACENT": 3, "BITS": 3, "bool": 1, "uses": 1, "following": 1, "algorithm": 1, "return": 5, "A": 5, "X": 5, "LOG2": 1, "OR": 1, "2DROP": 2, "INVERT": 1, "maximum": 1, "which": 3, "can": 2, "be": 2, "made": 2, "MAX": 2, "NB": 3, "m": 2, "2**n": 1, "numbers": 1, "less": 1, "bits.": 1, "http": 1, "HOW": 1, "MANY": 1, "HELLO": 4, "Block": 2, "blk": 3, "current": 5, "block": 8, "extended": 3, "semantics": 3, "flush": 1, "load": 2, "buffers": 2, "update": 1, "scr": 2, "list": 1, "thru": 1, "Bit": 1, "arrays.": 1, "u1": 1, "u2": 1, "bitmap": 1, "bit@": 1, "f": 2, "1bit": 2, "0bit": 2, "bit": 1 }, "Fortran": { "c": 3, "comment": 8, "*": 4, "program": 3, "main": 3, "end": 13, "subroutine": 3, "foo": 4, "(": 20, "i": 12, "x": 8, "b": 8, ")": 20, "INTEGER": 4, "REAL": 4, "LOGICAL": 4, "if": 6, "i.ne.0": 3, "then": 3, "call": 3, "bar": 4, "-": 4, "return": 6, "double": 3, "complex": 3, "function": 3, "baz": 8, "0.0d0": 8, "PROGRAM": 1, "MAIN": 1, "END": 4, "C": 1, "SUBROUTINE": 1, "IF": 2, "i.NE.0": 1, "THEN": 1, "CALL": 1, "RETURN": 2, "DOUBLE": 1, "COMPLEX": 1, "FUNCTION": 1, "real": 1, "onemu": 1, "twomu": 1, "data": 3, "onemu/0.0098/": 1, "twomu/1./": 1, "threemu/0.e9/": 1 }, "FreeMarker": { "<": 18, "#import": 1, "as": 2, "layout": 2, "#assign": 1, "results": 3, "[": 1, "{": 6, "}": 6, "]": 1, "/": 6, "@layout.page": 1, "title": 3, "#if": 1, "size": 1, "There": 1, "were": 1, "no": 1, "results.": 1, "#else": 1, "
    ": 1, "#list": 1, "result": 1, "
  • ": 1, "": 1, "result.title": 1, "": 1, "

    ": 2, "result.description": 1, "

    ": 2, "
    • ": 1, "": 8, "list": 1, "
": 1, "if": 1, "#": 2, "-": 9, "This": 2, "is": 2, "a": 1, "FreeMarker": 2, "comment": 1, "@currentTime": 1, "page": 3, "#macro": 4, "currentTime": 1, ".now": 1, "string.full": 1, "macro": 4, "#ftl": 1, "strip_text": 1, "true": 1, "": 1, "html": 1, "": 1, "lang=": 1, "": 1, "": 1, "": 1, "@metaTags": 1, "": 1, "": 1, "#nested": 1, "@footer": 1, "": 1, "": 1, "Default": 1, "meta": 1, "tags": 1, "metaTags": 1, "#compress": 1, "": 4, "charset=": 1, "http": 1, "equiv=": 1, "content=": 3, "name=": 2, "compress": 1, "footer": 1, "using": 1, "v": 1, ".version": 1 }, "Frege": { "package": 2, "examples.Sudoku": 1, "where": 38, "import": 7, "Data.TreeMap": 1, "(": 123, "Tree": 4, "keys": 2, ")": 130, "Data.List": 1, "as": 33, "DL": 1, "hiding": 1, "find": 14, "union": 10, "type": 9, "Element": 6, "Int": 6, "-": 136, "Zelle": 8, "[": 75, "]": 71, "set": 4, "of": 28, "candidates": 18, "Position": 22, "Feld": 3, "Brett": 13, "data": 3, "for": 23, "assumptions": 10, "and": 12, "conclusions": 3, "Assumption": 19, "ISNOT": 14, "|": 33, "IS": 16, "derive": 2, "Eq": 1, "Ord": 1, "instance": 1, "Show": 1, "show": 22, "p": 70, "e": 15, "pname": 7, "+": 101, "e.show": 2, "showcs": 5, "cs": 27, "joined": 4, "map": 48, "Assumption.show": 1, "elements": 12, "all": 22, "possible": 2, "..": 1, "positions": 16, "rowstarts": 4, "a": 93, "row": 22, "is": 20, "starting": 3, "colstarts": 3, "column": 2, "boxstarts": 3, "box": 18, "boxmuster": 3, "pattern": 1, "by": 1, "adding": 1, "upper": 1, "left": 5, "position": 7, "results": 1, "in": 22, "real": 1, "extract": 2, "field": 5, "getf": 16, "f": 19, "fs": 22, "fst": 9, "otherwise": 8, "cell": 23, "getc": 12, "b": 100, "snd": 19, "compute": 5, "the": 15, "list": 6, "that": 17, "belong": 3, "to": 14, "same": 8, "given": 3, "z..": 1, "z": 13, "quot": 1, "*": 3, "col": 19, "c": 34, "mod": 3, "ri": 2, "div": 3, "or": 11, "depending": 1, "on": 2, "ci": 3, "index": 3, "middle": 3, "right": 3, "check": 2, "if": 5, "candidate": 9, "has": 2, "exactly": 2, "one": 2, "member": 1, "i.e.": 1, "been": 1, "solved": 1, "single": 9, "Bool": 2, "_": 47, "true": 16, "false": 14, "unsolved": 10, "allrows": 8, "allcols": 5, "allboxs": 5, "allrcb": 5, "zip": 7, "repeat": 3, "containers": 6, "String": 9, "packed": 1, "chr": 2, "ord": 6, "printb": 3, "mapM_": 4, "p1line": 2, "println": 22, "do": 36, "print": 6, "pfld": 4, "line": 3, "x": 44, "zs": 1, "result": 11, "msg": 5, "return": 15, "res012": 2, "case": 6, "concatMap": 1, "a*100": 1, "b*10": 1, "turnoff1": 3, "IO": 13, "i": 13, "off": 10, "nc": 5, "newb": 7, "filter": 26, "notElem": 7, "<->": 30, "turnoff": 11, "turnoffh": 1, "ps": 8, "foldM": 2, "toh": 2, "setto": 3, "n": 40, "cname": 3, "nf": 2, "SOLVING": 1, "STRATEGIES": 1, "reduce": 3, "sets": 2, "contains": 1, "numbers": 1, "already": 1, "This": 2, "finds": 1, "logs": 1, "NAKED": 3, "SINGLEs": 1, "passing": 1, "sss": 3, "each": 2, "with": 14, "more": 2, "than": 2, "1": 14, "fields": 6, "are": 6, "s": 19, "rcb": 16, "elem": 16, "collect": 1, "remove": 3, "from": 6, "look": 10, "number": 4, "appears": 1, "container": 9, "this": 2, "can": 6, "go": 1, "no": 2, "other": 2, "place": 1, "HIDDEN": 4, "SINGLE": 1, "hiddenSingle": 2, "select": 1, "containername": 1, "FOR": 11, "IN": 9, "occurs": 5, "length": 17, "PAIRS": 4, "TRIPLES": 4, "QUADS": 2, "nakedPair": 2, "t": 17, "naked": 1, "tuple": 3, "nm": 6, "SELECT": 3, "pos": 5, "name": 2, "2": 10, "3": 7, "4": 6, "let": 8, "u": 6, "fold": 6, "non": 2, "outof": 6, "tuples": 2, "hit": 7, "subset": 3, "any": 3, "hiddenPair": 2, "hidden": 1, ".": 13, "minus": 2, "uniq": 4, "sort": 4, "common": 4, "bs": 7, "undefined": 1, "cannot": 1, "happen": 1, "because": 1, "either": 1, "empty": 4, "not": 6, "intersectionlist": 2, "intersection": 4, "intersections": 2, "reason": 8, "reson": 1, "cpos": 7, "WHERE": 2, "head": 18, "tail": 2, "we": 5, "occurences": 1, "but": 2, "an": 6, "XY": 2, "Wing": 3, "there": 6, "exists": 6, "A": 7, "X": 6, "Y": 4, "B": 4, "Z": 5, "shares": 2, "C": 5, "reasoning": 1, "will": 4, "be": 9, "since": 1, "indeed": 1, "xyWing": 2, "board": 38, "y": 16, "rcba": 4, "share": 1, "b1": 13, "b2": 12, "then": 1, "else": 1, "c1": 4, "c2": 3, "N": 5, "Fish": 1, "Swordfish": 2, "Jellyfish": 2, "When": 2, "particular": 1, "digit": 1, "rows": 3, "located": 2, "only": 1, "columns": 2, "eliminate": 1, "those": 2, "which": 2, "fish": 6, "fishname": 5, "unknown": 1, "rset": 4, "take": 17, "cols": 5, "certain": 1, "rflds": 2, "rowset": 1, "colss": 3, "must": 5, "appear": 1, "at": 3, "least": 3, "cstart": 2, "immediate": 1, "consequences": 6, "assumption": 9, "form": 1, "conseq": 3, "cp": 4, "two": 1, "contradict": 2, "contradicts": 7, "a=": 3, "x=": 2, "get": 2, "aPos": 5, "List": 1, "turned": 1, "when": 2, "toClear": 7, "whose": 1, "implications": 5, "themself": 1, "chain": 2, "paths": 10, "solution": 6, "reverse": 4, "css": 8, "implies": 1, "Therefore": 1, "yields": 1, "contradictory": 2, "chainContra": 2, "pro": 8, "contra": 4, "ALL": 2, "conlusions": 1, "uniqBy": 2, "using": 2, "sortBy": 2, "comparing": 2, "conslusion": 1, "chains": 3, "LET": 1, "BE": 1, "final": 2, "conclusion": 4, "THE": 1, "FIRST": 1, "con": 6, "leads": 1, "implication": 2, "some": 1, "ai": 2, "so": 1, "a0": 1, "OR": 7, "a1": 2, "a2": 2, "IMPLIES": 1, "For": 2, "cells": 1, "pi": 1, "have": 1, "construct": 2, "p0=": 1, "p1=": 1, "pi=": 1, "p=": 2, "c0": 1, "cellRegionChain": 2, "os": 3, "cellas": 2, "regionas": 2, "iss": 3, "ass": 2, "first": 2, "b=": 1, "region": 2, "oss": 2, "Liste": 1, "aller": 1, "Annahmen": 1, "r": 7, "ein": 1, "bestimmtes": 1, "acstree": 3, "Tree.fromList": 1, "Just": 2, "lookup": 1, "error": 1, "performance": 1, "resons": 1, "confine": 1, "ourselves": 1, "20": 1, "per": 1, "mkPaths": 3, "acst": 3, "impl": 2, "{": 2, "a3": 1, "impls": 2, "ns": 2, "concat": 1, "takeUntil": 1, "null": 1, "iterate": 1, "expandchain": 2, "avoid": 1, "loops": 1, "uni": 3, "SOLVE": 1, "SUDOKU": 1, "Apply": 1, "available": 1, "strategies": 1, "until": 1, "nothing": 2, "changes": 1, "anymore": 1, "Strategy": 1, "functions": 2, "supposed": 1, "applied": 1, "give": 2, "changed": 1, "strategy": 2, "does": 2, "anything": 1, "alter": 1, "it": 1, "returns": 2, "next": 1, "tried": 1, "solve": 13, "Solved": 1, "solvable": 1, "res": 11, "apply": 11, "smallest": 1, "res@": 9, "SINGLES": 1, "locked": 1, "QUADRUPELS": 2, "WINGS": 1, "FISH": 1, "9": 3, "forcing": 1, "allow": 1, "infer": 1, "both": 1, "brd": 2, "turn": 1, "string": 1, "into": 1, "mkrow": 2, "mkrow1": 2, "xs": 4, "make": 1, "sure": 1, "unpacked": 2, "&&": 2, "<": 2, "ignored": 1, "main": 11, "stderr.println": 3, "s@#": 1, "W": 1, "}": 1, "#": 1, "felder": 2, "decode": 4, "files": 2, "forM_": 1, "sudoku": 2, "file": 2, "br": 4, "openReader": 1, "lines": 2, "BufferedReader": 2, "getLines": 2, "process": 5, "ss": 8, "mapM": 3, "sum": 2, "candi": 2, "consider": 3, "acht": 4, "neun": 2, "module": 2, "examples.CommandLineClock": 1, "Date": 5, "native": 4, "java.util.Date": 1, "new": 22, "MutableIO": 1, "toString": 2, "Mutable": 1, "ST": 1, "d.toString": 1, "action": 2, "us": 1, "current": 4, "time": 1, "d": 2, "java": 4, "lang": 2, "Thread": 2, "sleep": 4, "takes": 3, "long": 4, "may": 1, "throw": 1, "InterruptedException": 4, "without": 1, "doubt": 1, "public": 1, "static": 1, "void": 2, "millis": 1, "throws": 4, "Encoded": 1, "Frege": 3, "argument": 1, "Long": 3, "defined": 1, "frege": 1, "Lang": 1, "args": 2, "forever": 1, "stdout.flush": 1, "Thread.sleep": 4, "examples.SwingExamples": 1, "Java.Awt": 1, "ActionListener": 2, "Java.Swing": 1, "rs": 2, "Runnable": 1, "helloWorldGUI": 2, "buttonDemoGUI": 2, "celsiusConverterGUI": 2, "invokeLater": 1, "Hit": 1, "enter": 1, "end": 1, "getLine": 2, "tempTextField": 2, "JTextField": 1, "celsiusLabel": 2, "JLabel": 3, "convertButton": 2, "JButton": 7, "fahrenheitLabel": 1, "frame": 13, "JFrame": 6, "setDefaultCloseOperation": 3, "dispose_on_close": 3, "setTitle": 1, "Celsius": 2, "Converter": 1, "setText": 2, "Convert": 1, "convertButtonActionPerformed": 2, "celsius": 3, "getText": 1, "double": 1, "Left": 4, "fahrenheitLabel.setText": 3, "Right": 5, "c*1.8": 1, ".long": 1, "ActionListener.new": 2, "convertButton.addActionListener": 1, "contentPane": 3, "getContentPane": 2, "layout": 2, "GroupLayout": 1, "setLayout": 1, "TODO": 1, "continue": 1, "http": 3, "docs": 2, "oracle": 2, "com": 2, "javase": 2, "tutorial": 2, "displayCode": 1, "html": 1, "code=": 1, "uiswing": 1, "examples": 1, "learn": 2, "CelsiusConverterProject": 1, "src": 1, "CelsiusConverterGUI": 1, "pack": 2, "setVisible": 2, "Hello": 2, "World": 2, "label": 2, "add": 1, "Button": 1, "Demo": 1, "newContentPane": 2, "JPanel": 1, "Disable": 1, "button": 3, "setVerticalTextPosition": 3, "SwingConstants": 6, "center": 3, "setHorizontalTextPosition": 3, "leading": 3, "Middle": 1, "b3": 7, "Enable": 1, "setEnabled": 7, "action1": 2, "action3": 2, "b1.addActionListener": 1, "b3.addActionListener": 1, "newContentPane.add": 3, "newContentPane.setOpaque": 1, "frame.setContentPane": 1, "frame.pack": 1, "frame.setVisible": 1, "examples.Concurrent": 1, "System.Random": 1, "Java.Net": 1, "URL": 2, "Control.Concurrent": 1, "main2": 1, "m": 6, "newEmptyMVar": 1, "forkIO": 11, "put": 6, "replicateM_": 3, "got": 1, "example1": 1, "100000": 2, "putChar": 2, "example2": 2, "setReminder": 3, "1000L*n": 1, "table": 1, "mainPhil": 2, "fork1": 3, "fork2": 3, "fork3": 3, "fork4": 3, "fork5": 3, "MVar": 6, "5": 1, "philosopher": 7, "Kant": 1, "Locke": 1, "Wittgenstein": 1, "Nozick": 1, "Mises": 1, "me": 13, "g": 4, "Random": 3, "newStdGen": 1, "phil": 4, "tT": 2, "g1": 2, "randomR": 2, "60L": 1, "120L": 1, "eT": 2, "g2": 3, "80L": 1, "160L": 1, "thinkTime": 3, "300L": 2, "eatTime": 3, "going": 1, "dining": 1, "room": 1, "his": 1, "seat": 1, "fl": 4, "up": 1, "fork": 1, "rFork": 2, "poll": 1, "fr": 3, "right.put": 1, "left.put": 2, "table.notifyAll": 2, "Nothing": 2, "table.wait": 1, "inter": 3, "catch": 2, "getURL": 4, "xx": 2, "url": 2, "openConnection": 1, "connect": 1, "getInputStream": 1, "typ": 5, "getContentType": 1, "stderr": 1, "content": 1, "ir": 2, "InputStreamReader": 2, "fromMaybe": 1, "UTF": 1, "8": 1, "charset": 2, "unsupportedEncoding": 3, "InputStream": 1, "UnsupportedEncodingException": 1, "x.catched": 1, "InputStreamReader.new": 1, "ctyp": 2, "charset=": 1, "S": 1, "m.group": 1, "SomeException": 2, "Throwable": 1, "m1": 3, "newEmpty": 3, "m2": 3, "m3": 3, "catchAll": 3, "www": 3, "wikipedia": 3, "org": 3, "wiki": 3, "Haskell": 1, "htto": 1, "Java": 1, "r1": 2, "r2": 2, "r3": 3, "putStrLn": 1, "x.getClass.getName": 1 }, "Fstar": { "module": 15, "Hacl.HKDF": 1, "ST": 2, "FStar.HyperStack.ST": 3, "open": 15, "FStar.HyperStack.All": 2, "FStar.Mul": 2, "FStar.Ghost": 1, "FStar.HyperStack": 1, "FStar.Buffer": 2, "FStar.UInt32": 3, "U8": 1, "FStar.UInt8": 1, "U32": 2, "U64": 1, "FStar.UInt64": 1, "S8": 1, "Hacl.UInt8": 1, "S32": 1, "Hacl.UInt32": 1, "S64": 1, "Hacl.UInt64": 1, "Buffer": 1, "Cast": 1, "Hacl.Cast": 1, "Hash": 1, "Hacl.Hash.SHA2.L256": 1, "HMAC": 1, "Hacl.HMAC": 1, "let": 87, "uint8_t": 1, "FStar.UInt8.t": 1, "uint32_t": 10, "FStar.UInt32.t": 1, "uint64_t": 1, "FStar.UInt64.t": 1, "suint8_t": 2, "Hacl.UInt8.t": 1, "suint32_t": 2, "Hacl.UInt32.t": 1, "suint64_t": 1, "Hacl.UInt64.t": 1, "suint32_p": 1, "Buffer.buffer": 2, "suint8_p": 10, "u8_to_s8": 2, "Cast.uint8_to_sint8": 1, "u32_to_s8": 3, "Cast.uint32_to_sint8": 1, "u32_to_s32": 1, "Cast.uint32_to_sint32": 1, "u32_to_s64": 1, "Cast.uint32_to_sint64": 1, "s32_to_s8": 1, "Cast.sint32_to_sint8": 1, "s32_to_s64": 1, "Cast.sint32_to_sint64": 1, "u64_to_s64": 1, "Cast.uint64_to_sint64": 1, "//": 2, "inline_for_extraction": 4, "hashsize": 18, "HMAC.hashsize": 1, "hashsize_32": 1, "HMAC.hashsize_32": 1, "blocksize": 1, "HMAC.blocksize": 1, "blocksize_32": 1, "HMAC.blocksize_32": 1, "val": 20, "hkdf_extract": 2, "prk": 22, "{": 31, "length": 11, "v": 19, "}": 31, "-": 120, "salt": 5, "saltlen": 4, "ikm": 5, "ikmlen": 4, "Stack": 3, "unit": 3, "(": 231, "requires": 8, "fun": 6, "h0": 18, "live": 12, "/": 37, ")": 213, "ensures": 8, "r": 3, "h1": 9, "modifies_1": 3, "HMAC.hmac": 3, "[": 2, "@": 2, "]": 2, "private": 1, "hkdf_expand_inner": 5, "state": 13, "<": 19, "prklen": 11, "info": 13, "infolen": 13, "n": 11, "pow2": 14, "i": 34, "rec": 4, "push_frame": 2, ";": 34, "size_T": 5, "U32.mul_mod": 3, "in": 36, "size_Ti": 6, "size_Til": 10, "+": 18, "pos_Ti": 3, "pos_Til": 5, "pos_T": 4, "ti": 6, "Buffer.sub": 4, "til": 8, "t": 5, "if": 6, "then": 6, "begin": 2, "Buffer.blit": 6, "Buffer.upd": 2, "end": 2, "else": 6, "pos": 7, "pop_frame": 2, "hkdf_expand": 2, "okm": 8, "len": 63, "*": 27, "U32.v": 3, "U32.": 1, "div": 1, "Buffer.create": 1, "0uy": 1, "_T": 2, "Hacl.Spec.Bignum.Fmul": 1, "Hacl.Bignum.Constants": 1, "Hacl.Bignum.Parameters": 1, "Hacl.Spec.Bignum.Bigint": 1, "Hacl.Bignum.Limb": 1, "Hacl.Spec.Bignum.Modulo": 1, "Hacl.Spec.Bignum.Fproduct": 1, "#set": 8, "options": 12, "shift_reduce_pre": 5, "s": 32, "seqelem": 37, "GTot": 4, "Type0": 4, "reduce_pre": 1, "shift_spec": 7, "shift_reduce_spec": 3, "Tot": 4, "reduce_spec": 1, "lemma_shift_spec_eq": 3, "Lemma": 12, "Seq.append": 2, "Seq.slice": 6, "Seq.lemma_eq_intro": 2, "lemma_shift_reduce_spec": 3, "seval": 38, "%": 34, "prime": 36, "limb_size": 6, "lemma_reduce_spec": 1, "mul_shift_reduce_pre_": 5, "output": 46, "seqelem_wide": 9, "input": 54, "input2": 45, "ctr": 73, "nat": 11, "decreases": 3, "sum_scalar_multiplication_pre_": 2, "Seq.index": 7, "true": 1, "#reset": 4, "lemma_mul_shift_reduce_pre_def": 2, "mul_shift_reduce_pre": 7, "input_init": 16, "seval_wide": 16, "seval_": 9, "lemma_mod_mul_distr": 2, "a": 15, "b": 8, "p": 12, "lemma_mod_mul_comm": 2, "a*b": 1, "*b": 1, "lemma_mul_shift_reduce_spec_1_1": 4, "o": 23, "i0": 19, "i2": 17, "ij": 15, "*limb_size": 8, "so": 8, "cut": 8, "lemma_seval_def": 1, "lemma_mul_shift_reduce_spec_1_2": 3, "si": 1, "Math.Lemmas.pow2_plus": 1, "lemma_mul_shift_reduce_spec_1": 3, "lemma_mul_shift_reduce_spec_2": 3, "mul_shift_reduce_spec_": 7, "tuple2": 1, "j": 4, "input2j": 6, "lemma_sum_scalar_multiplication_": 1, "lemma_mul_shift_reduce_spec_def": 2, "assert": 1, "lemma_seval_wide_null": 4, "Seq.create": 5, "wide_zero": 5, "seval_wide_": 1, "mul_shift_reduce_spec": 7, "assert_norm": 1, "_": 1, "fmul_pre": 2, "carry_wide_pre": 1, "carry_top_wide_pre": 1, "carry_wide_spec": 4, "copy_from_wide_pre": 1, "carry_top_wide_spec": 3, "carry_0_to_1_pre": 1, "copy_from_wide_spec": 2, "fmul_spec": 2, "output1": 2, "output2": 3, "lemma_carry_top_wide_spec": 1, "output3": 3, "lemma_copy_from_wide": 1, "output4": 2, "carry_0_to_1_spec": 1, "lemma_whole_slice": 2, "#a": 2, "Type": 1, "Seq.seq": 1, "Seq.length": 2 }, "G-code": { ";": 8, "RepRapPro": 1, "Ormerod": 1, "Board": 1, "test": 1, "GCodes": 1, "M111": 1, "S1": 1, "Debug": 1, "on": 1, "G21": 1, "mm": 1, "G90": 1, "Absolute": 1, "positioning": 1, "M83": 1, "Extrusion": 1, "relative": 1, "M906": 1, "X800": 1, "Y800": 1, "Z800": 1, "E800": 1, "Motor": 1, "currents": 1, "(": 1, "mA": 1, ")": 1, "T0": 2, "Extruder": 1, "G1": 17, "X50": 1, "F500": 2, "X0": 2, "G4": 18, "P500": 6, "Y50": 1, "Y0": 2, "Z20": 1, "F200": 2, "Z0": 1, "E20": 1, "E": 1, "-": 1, "M106": 2, "S255": 1, "S0": 1, "M105": 13, "G10": 1, "P0": 1, "S100": 2, "M140": 1, "P5000": 12, "M0": 2, "G28": 1, "X55": 3, "Y5": 3, "F2000": 1, "Y180": 2, "X180": 2 }, "GAMS": { "*Basic": 1, "example": 2, "of": 7, "transport": 5, "model": 6, "from": 2, "GAMS": 5, "library": 3, "Title": 1, "A": 3, "Transportation": 1, "Problem": 1, "(": 22, "TRNSPORT": 1, "SEQ": 1, ")": 22, "Ontext": 1, "This": 2, "problem": 1, "finds": 1, "a": 3, "least": 1, "cost": 4, "shipping": 1, "schedule": 1, "that": 1, "meets": 1, "requirements": 1, "at": 5, "markets": 2, "and": 2, "supplies": 1, "factories.": 1, "Dantzig": 1, "G": 1, "B": 1, "Chapter": 2, "In": 2, "Linear": 1, "Programming": 1, "Extensions.": 1, "Princeton": 2, "University": 1, "Press": 2, "New": 1, "Jersey": 1, "formulation": 1, "is": 1, "described": 1, "in": 10, "detail": 1, "Rosenthal": 1, "R": 1, "E": 1, "Tutorial.": 1, "User": 1, "The": 2, "Scientific": 1, "Redwood": 1, "City": 1, "California": 1, "line": 1, "numbers": 1, "will": 1, "not": 1, "match": 1, "those": 1, "the": 1, "book": 1, "because": 1, "these": 1, "comments.": 1, "Offtext": 1, "Sets": 1, "i": 18, "canning": 1, "plants": 1, "/": 9, "seattle": 3, "san": 3, "-": 6, "diego": 3, "j": 18, "new": 3, "york": 3, "chicago": 3, "topeka": 3, ";": 15, "Parameters": 1, "capacity": 1, "plant": 2, "cases": 3, "b": 2, "demand": 4, "market": 2, "Table": 1, "d": 2, "distance": 1, "thousands": 3, "miles": 2, "Scalar": 1, "f": 2, "freight": 1, "dollars": 3, "per": 3, "case": 2, "thousand": 1, "/90/": 1, "Parameter": 1, "c": 3, "*": 1, "Variables": 1, "x": 4, "shipment": 1, "quantities": 1, "z": 3, "total": 1, "transportation": 1, "costs": 1, "Positive": 1, "Variable": 1, "Equations": 1, "define": 1, "objective": 1, "function": 1, "supply": 3, "observe": 1, "limit": 1, "satisfy": 1, "..": 3, "e": 1, "sum": 3, "*x": 1, "l": 1, "g": 1, "Model": 1, "/all/": 1, "Solve": 1, "using": 1, "lp": 1, "minimizing": 1, "Display": 1, "x.l": 1, "x.m": 1, "ontext": 1, "#user": 1, "stuff": 1, "Main": 1, "topic": 1, "Basic": 2, "Featured": 4, "item": 4, "Trnsport": 1, "Description": 1, "offtext": 1 }, "GAP": { "##": 769, "PackageInfo.g": 1, "for": 60, "the": 143, "package": 11, "cvec": 1, "(": 800, "created": 1, "from": 6, "Frank": 1, "L": 1, "beck": 1, "SetPackageInfo": 1, "rec": 21, "PackageName": 2, "Subtitle": 1, "Version": 1, "Date": 1, "#": 215, "dd/mm/yyyy": 1, "format": 2, "Information": 1, "about": 3, "authors": 2, "and": 104, "maintainers.": 1, "Persons": 1, "[": 231, "LastName": 1, "FirstNames": 1, "IsAuthor": 1, "true": 28, "IsMaintainer": 1, "false": 10, "Email": 1, "WWWHome": 1, "PostalAddress": 1, "Concatenation": 15, "]": 255, ")": 800, "Place": 1, "Institution": 1, "Status": 2, "information.": 1, "Currently": 1, "following": 8, "cases": 2, "are": 16, "recognized": 1, "successfully": 2, "refereed": 2, "packages": 5, "which": 8, "GAP": 15, "developers": 1, "agreed": 1, "to": 48, "distribute": 1, "them": 1, "with": 56, "core": 1, "system": 1, "development": 1, "versions": 1, "of": 120, "all": 18, "other": 4, "You": 1, "must": 6, "provide": 2, "next": 11, "two": 15, "entries": 8, "if": 103, "only": 4, "status": 1, "is": 77, "because": 2, "was": 3, "#CommunicatedBy": 1, "#AcceptDate": 1, "PackageWWWHome": 1, "README_URL": 1, ".PackageWWWHome": 2, "PackageInfoURL": 1, "ArchiveURL": 1, ".Version": 2, "ArchiveFormats": 1, "Here": 2, "you": 3, "a": 120, "short": 1, "abstract": 1, "explaining": 1, "content": 1, "in": 65, "HTML": 1, "used": 19, "on": 7, "overview": 1, "Web": 1, "page": 1, "an": 24, "URL": 1, "Webpage": 1, "more": 4, "detailed": 1, "information": 1, "not": 49, "than": 1, "few": 1, "lines": 1, "less": 1, "ok": 1, "Please": 1, "use": 6, "specifing": 1, "names.": 1, "AbstractHTML": 1, "PackageDoc": 1, "BookName": 1, "ArchiveURLSubset": 1, "HTMLStart": 1, "PDFFile": 1, "SixFile": 1, "LongTitle": 1, "Dependencies": 1, "NeededOtherPackages": 1, "SuggestedOtherPackages": 1, "ExternalConditions": 1, "AvailabilityTest": 1, "function": 38, "SHOW_STAT": 1, "Filename": 8, "DirectoriesPackagePrograms": 1, "fail": 20, "then": 128, "#Info": 1, "InfoWarning": 1, ";": 651, "return": 42, "fi": 91, "end": 34, "*Optional*": 2, "but": 1, "recommended": 1, "path": 1, "relative": 1, "root": 1, "file": 6, "contains": 7, "as": 23, "many": 1, "tests": 1, "functionality": 1, "sensible.": 1, "#TestFile": 1, "can": 13, "list": 16, "some": 4, "keyword": 1, "related": 1, "topic": 1, "package.": 2, "Keywords": 1, "Magic.gi": 1, "AutoDoc": 6, "Copyright": 6, "Max": 3, "Horn": 3, "JLU": 2, "Giessen": 2, "Sebastian": 2, "Gutsche": 2, "University": 4, "Kaiserslautern": 2, "BindGlobal": 7, "str": 8, "suffix": 3, "local": 16, "n": 30, "m": 8, "Length": 13, "{": 21, "-": 137, "+": 9, "1..n": 1, "}": 21, "i": 25, "while": 5, "<": 49, "do": 18, "od": 15, "1..Length": 1, "d": 16, "tmp": 20, "IsDirectoryPath": 1, "CreateDir": 2, "Note": 3, "currently": 1, "undocumented": 1, "Error": 7, "LastSystemError": 1, ".message": 1, "pkg": 32, "subdirs": 2, "extensions": 3, "d_rel": 6, "files": 7, "result": 9, "DirectoriesPackageLibrary": 2, "IsEmpty": 6, "continue": 3, "Directory": 5, "DirectoryContents": 1, "Sort": 1, "AUTODOC_GetSuffix": 2, "IsReadableFile": 2, "Add": 4, "Make": 1, "this": 17, "callable": 1, "package_name": 3, "AutoDocWorksheet.": 1, "Which": 1, "will": 5, "create": 1, "worksheet": 1, "InstallGlobalFunction": 5, "arg": 16, "package_info": 3, "opt": 3, "scaffold": 13, "gapdoc": 8, "maketest": 13, "autodoc": 9, "pkg_dir": 5, "doc_dir": 18, "doc_dir_rel": 3, "title_page": 7, "tree": 8, "is_worksheet": 13, "position_document_class": 7, "gapdoc_latex_option_record": 4, "LowercaseString": 3, "DirectoryCurrent": 1, "else": 25, "PackageInfo": 1, "key": 3, "val": 4, "ValueOption": 1, "opt.": 1, "IsBound": 39, "opt.dir": 4, "elif": 21, "IsString": 7, "or": 14, "IsDirectory": 1, "AUTODOC_CreateDirIfMissing": 1, "Print": 24, "opt.scaffold": 5, "package_info.AutoDoc": 3, "IsRecord": 7, "IsBool": 4, "AUTODOC_APPEND_RECORD_WRITEONCE": 3, "AUTODOC_WriteOnce": 10, "opt.autodoc": 5, "ForAny": 1, "x": 19, "autodoc.files": 7, "autodoc.scan_dirs": 5, "autodoc.level": 3, "PushOptions": 1, "level_value": 1, "Append": 2, "AUTODOC_FindMatchingFiles": 2, "opt.gapdoc": 5, "opt.maketest": 4, "gapdoc.main": 8, "package_info.PackageDoc": 3, ".BookName": 2, "gapdoc.bookname": 4, "#Print": 1, "gapdoc.files": 9, "gapdoc.scan_dirs": 3, "Set": 1, "Number": 1, "ListWithIdenticalEntries": 1, "List": 6, "f": 11, "DocumentationTree": 1, "autodoc.section_intros": 2, "AUTODOC_PROCESS_INTRO_STRINGS": 1, "Tree": 2, "AutoDocScanFiles": 1, "scaffold.TitlePage": 4, "scaffold.TitlePage.Title": 2, ".TitlePage.Title": 2, "Position": 2, "Remove": 2, "JoinStringsWithSeparator": 1, "ReplacedString": 2, "Syntax": 1, "scaffold.document_class": 7, "PositionSublist": 5, "GAPDoc2LaTeXProcs.Head": 14, "..": 6, "scaffold.latex_header_file": 2, "StringFile": 2, "scaffold.gapdoc_latex_options": 4, "RecNames": 1, "scaffold.gapdoc_latex_options.": 5, "IsList": 1, "scaffold.includes": 4, "scaffold.bib": 7, "Unbind": 1, "scaffold.main_xml_file": 2, ".TitlePage": 1, "ExtractTitleInfoFromPackageInfo": 1, "CreateTitlePage": 1, "scaffold.MainPage": 2, "scaffold.dir": 1, "scaffold.book_name": 1, "CreateMainPage": 1, "WriteDocumentation": 1, "SetGapDocLaTeXOptions": 1, "MakeGAPDocDoc": 1, "CopyHTMLStyleFiles": 1, "GAPDocManualLab": 1, "maketest.folder": 3, "maketest.scan_dir": 3, "CreateMakeTest": 1, "#W": 4, "example.gd": 2, "This": 10, "sample": 2, "declaration": 1, "file.": 3, "DeclareProperty": 2, "IsLeftModule": 6, "DeclareGlobalFunction": 5, "#C": 7, "IsQuuxFrobnicator": 1, "": 3, "": 28, "": 7, "Name=": 33, "Arg=": 33, "Type=": 7, "": 28, "Tests": 1, "whether": 5, "R": 5, "quux": 1, "frobnicator.": 1, "": 28, "": 28, "DeclareSynonym": 17, "IsField": 1, "IsGroup": 1, "gap": 133, "START_TEST": 2, "The": 33, "trigger": 9, "error": 8, "starting": 1, "K": 16, "AbelianPcpGroup": 3, "A": 17, "Subgroup": 11, "K.1": 5, "cr": 2, "CRRecordBySubgroup": 1, "ExtensionsCR": 1, "hom1": 3, "GroupHomomorphismByImages": 4, "hom2": 3, "IdentityMapping": 2, "incorrectly": 1, "triggered": 1, "at": 1, "point": 1, "IsTorsionFree": 1, "ExamplesOfSomePcpGroups": 2, "Verify": 1, "IsGeneratorsOfMagmaWithInverses": 2, "warnings": 1, "silenced": 1, "GeneratorsOfGroup": 1, "Check": 6, "bug": 6, "reported": 2, "by": 21, "Robert": 2, "Morse": 2, "g": 3, "PcGroupToPcpGroup": 2, "SmallGroup": 2, "Pcp": 28, "group": 32, "orders": 28, "commands": 2, "errors": 1, "NonAbelianTensorSquare": 2, "Centre": 2, "NonAbelianExteriorSquare": 1, "F": 62, "FreeGroup": 1, "": 1, "generators": 18, "y": 14, "F.1": 1, "F.2": 1, "G": 24, "F/": 1, "2/y": 1, "x/y": 1, "": 1, "iso": 2, "IsomorphismPcGroup": 1, "f1": 2, "f2*f5": 1, "iso1": 1, "IsomorphismPcpGroup": 1, "Image": 3, "f2": 1, "f3": 1, "f4": 1, "f5": 1, "g1": 2, "g2": 1, "g3": 1, "g4": 1, "g5": 2, "iso*iso1": 2, "command": 4, "problem": 2, "previous": 1, "example": 5, "is/was": 1, "that": 42, "Igs": 3, "set": 7, "non": 6, "standard": 1, "value": 14, "g2*g5": 1, "g3*g4*g5": 1, "g4*g5": 1, "Unfortunately": 1, "it": 9, "seems": 2, "lot": 1, "code": 3, "really": 5, "should": 3, "be": 26, "using": 4, "Ngs": 1, "Cgs": 1, "incorrectly.": 1, "For": 11, "direct": 1, "products": 1, "could": 1, "*invalid*": 1, "embeddings": 1, "D": 39, "DirectProduct": 1, "hom": 8, "Embedding": 1, "mapi": 6, "MappingGeneratorsImages": 2, "Source": 3, "Range": 3, "Projection": 1, "computing": 4, "Schur": 3, "extension": 4, "infinite": 2, "cyclic": 1, "groups": 2, "found": 5, "SchurExtension": 3, "subgroups": 3, "MH": 3, "HeisenbergPcpGroup": 4, "H": 6, "G.2": 4, "3*G.3": 1, "G.1": 4, "normalizer": 1, "caused": 1, "incorrect": 1, "resp.": 1, "overly": 1, "restrictive": 1, "Parent": 5, ".": 263, "G.3": 4, "G.4": 6, "G.5": 4, "B": 22, "Normalizer": 4, "In": 4, "polycyclic": 1, "cohomology": 1, "computations": 1, "broken.": 1, "UnitriangularPcpGroup": 1, "mats": 7, ".mats": 1, "C": 13, "CRRecordByMats": 1, "cc": 1, "TwoCohomologyCR": 1, "cc.factor.rels": 1, "c": 1, "cc.factor.prei": 1, "cc.gcb": 1, "cc.gcc": 1, "LowerCentralSeriesOfGroup": 2, "nilpotent": 1, "pcp": 1, "recursion": 2, "STOP_TEST": 2, "vspc.gd": 1, "library": 2, "Thomas": 2, "Breuer": 2, "#Y": 6, "Lehrstuhl": 2, "r": 2, "Mathematik": 2, "RWTH": 2, "Aachen": 2, "Germany": 2, "School": 2, "Math": 2, "Comp.": 2, "Sci.": 2, "St": 2, "Andrews": 2, "Scotland": 2, "Group": 3, "declares": 1, "operations": 2, "vector": 67, "spaces.": 4, "bases": 5, "free": 3, "left": 15, "modules": 1, "": 10, "lib/basis.gd": 1, "IsLeftOperatorRing": 1, "IsLeftOperatorAdditiveGroup": 2, "IsRing": 1, "IsAssociativeLOpDProd": 2, "#T": 6, "IsLeftOperatorRingWithOne": 2, "IsRingWithOne": 1, "IsLeftVectorSpace": 3, "": 38, "IsVectorSpace": 26, "#GAPDoc": 17, "Label": 17, "": 16, "space": 74, "": 16, "&": 39, "module": 2, "see": 31, "nbsp": 30, "": 73, "Func=": 41, "over": 24, "division": 15, "ring": 14, "Chapter": 3, "Chap=": 3, "

": 30, "Whenever": 1, "we": 3, "talk": 1, "": 42, "": 41, "": 138, "V": 151, "": 138, "additive": 1, "acts": 1, "via": 6, "multiplication": 1, "such": 4, "action": 4, "addition": 1, "right": 2, "distributive.": 1, "accessed": 1, "attribute": 2, "Vector": 1, "spaces": 15, "always": 1, "Filt=": 4, "synonyms.": 1, "#/GAPDoc": 17, "IsLeftActedOnByDivisionRing": 4, "InstallTrueMethod": 4, "IsFreeLeftModule": 3, "#F": 17, "IsGaussianSpace": 10, "": 14, "filter": 3, "Sect=": 6, "row": 17, "matrix": 5, "field": 12, "say": 1, "indicates": 3, "vectors": 16, "matrices": 5, "respectively": 1, "contained": 4, "case": 2, "called": 1, "Gaussian": 19, "space.": 5, "Bases": 1, "computed": 2, "elimination": 5, "given": 4, "generators.": 1, "": 12, "": 15, "CDATA": 15, "VectorSpace": 13, "Rationals": 13, "E": 2, "element": 2, "Field": 1, "": 12, "DeclareFilter": 1, "IsFullMatrixModule": 1, "IsFullRowModule": 1, "IsDivisionRing": 5, "": 12, "nontrivial": 1, "associative": 1, "algebra": 2, "multiplicative": 1, "inverse": 1, "each": 2, "nonzero": 3, "element.": 1, "every": 1, "possibly": 1, "itself": 1, "being": 2, "thus": 1, "property": 2, "get": 1, "usually": 1, "represented": 1, "coefficients": 3, "stored": 1, "DeclareSynonymAttr": 4, "IsMagmaWithInversesIfNonzero": 1, "IsNonTrivial": 1, "IsAssociative": 1, "IsEuclideanRing": 1, "#A": 7, "GeneratorsOfLeftVectorSpace": 1, "GeneratorsOfVectorSpace": 2, "": 7, "Attr=": 10, "returns": 14, "generate": 1, "FullRowSpace": 5, "CanonicalBasis": 3, "If": 11, "supports": 1, "canonical": 6, "basis": 14, "otherwise": 2, "": 6, "": 6, "returned.": 4, "defining": 1, "its": 3, "uniquely": 1, "determined": 1, "exist": 1, "same": 6, "acting": 8, "domain": 17, "equality": 1, "these": 5, "decided": 1, "comparing": 1, "bases.": 1, "exact": 1, "meaning": 1, "depends": 1, "type": 2, "Canonical": 1, "defined": 3, "one": 11, "designs": 1, "new": 2, "kind": 1, "defines": 1, "method": 4, "installs": 1, "call": 1, "On": 1, "hand": 1, "probably": 2, "install": 1, "simply": 2, "calls": 1, "": 14, "CANONICAL_BASIS_FLAGS": 1, "": 13, "vecs": 4, "": 8, "3": 5, "BasisVectors": 4, "DeclareAttribute": 4, "IsRowSpace": 2, "consists": 7, "IsRowModule": 1, "IsGaussianRowSpace": 1, "scalars": 2, "occur": 2, "vectors.": 2, "Thus": 3, "calculations.": 2, "Otherwise": 3, "Gaussian.": 2, "We": 5, "need": 3, "flag": 2, "write": 3, "down": 2, "methods": 4, "delegate": 2, "ones.": 2, "IsNonGaussianRowSpace": 1, "expresses": 2, "so": 3, "cannot": 2, "compute": 3, "handled": 3, "mechanism": 4, "nice": 4, "way.": 2, "Let": 4, "spanned": 4, "Then": 1, "/": 12, "cap": 1, "v": 5, "replacing": 1, "entry": 2, "forming": 1, "concatenation.": 1, "So": 2, "associated": 3, "DeclareHandlingByNiceBasis": 2, "IsMatrixSpace": 2, "IsMatrixModule": 1, "IsGaussianMatrixSpace": 1, "IsNonGaussianMatrixSpace": 1, "irrelevant": 1, "concatenation": 1, "rows": 1, "necessarily": 1, "NormedRowVectors": 2, "normed": 1, "finite": 4, "those": 1, "have": 3, "first": 1, "component.": 1, "yields": 1, "natural": 1, "dimensional": 5, "subspaces": 18, "also": 3, "GF": 22, "0*Z": 5, "Z": 6, "Action": 1, "GL": 1, "OnLines": 1, "TrivialSubspace": 2, "subspace": 7, "zero": 4, "triv": 2, "0": 2, "AsSet": 1, "TrivialSubmodule": 1, "": 5, "": 2, "collection": 3, "gens": 16, "elements": 7, "optional": 3, "argument": 1, "specify": 3, "empty.": 1, "string": 6, "known": 5, "linearly": 3, "independent": 3, "particular": 1, "dimension": 9, "immediately": 2, "note": 2, "formed": 1, "argument.": 1, "2": 2, "Subspace": 4, "generated": 1, "SubspaceNC": 2, "subset": 4, "empty": 1, "trivial": 1, "parent": 3, "returned": 3, "does": 1, "except": 1, "omits": 1, "check": 5, "both": 2, "W": 32, "1": 5, "Submodule": 1, "SubmoduleNC": 1, "#O": 2, "AsVectorSpace": 4, "view": 4, "": 2, "domain.": 1, "form": 2, "Oper=": 6, "smaller": 1, "larger": 1, "ring.": 3, "Dimension": 6, "LeftActingDomain": 28, "9": 1, "AsLeftModule": 6, "AsSubspace": 5, "": 6, "U": 12, "collection.": 1, "1/2": 3, "DeclareOperation": 2, "IsCollection": 3, "Intersection2Spaces": 4, "": 2, "": 2, "": 2, "takes": 1, "arguments": 1, "intersection": 5, "domains": 4, "different": 2, "let": 1, "their": 1, "intersection.": 1, "AsStruct": 2, "equal": 1, "either": 2, "Substruct": 1, "common": 1, "Struct": 1, "basis.": 1, "handle": 1, "intersections": 1, "algebras": 2, "ideals": 2, "sided": 1, "ideals.": 1, "": 2, "": 2, "Label=": 2, "nonnegative": 2, "integer": 2, "length": 1, "An": 2, "alternative": 2, "construct": 2, "above": 2, "FullRowModule": 2, "FullMatrixSpace": 2, "": 1, "positive": 1, "integers": 1, "fact": 1, "FullMatrixModule": 3, "IsSubspacesVectorSpace": 10, "fixed": 1, "lies": 1, "category": 1, "Subspaces": 8, "Size": 5, "iter": 17, "Iterator": 5, "NextIterator": 5, "DeclareCategory": 1, "IsDomain": 1, "#M": 20, "IsFinite": 4, "Returns": 1, "allow": 2, "": 1, "Called": 2, "k": 17, "Special": 1, "provided": 1, "domains.": 1, "IsInt": 3, "IsSubspace": 3, "OrthogonalSpaceInFullRowSpace": 1, "complement": 1, "full": 2, "#P": 1, "IsVectorSpaceHomomorphism": 3, "": 2, "": 1, "mapping": 2, "homomorphism": 1, "linear": 1, "source": 2, "range": 1, "b": 8, "s": 3, "*": 12, "hold": 1, "IsGeneralMapping": 2, "#E": 2, "Magic.gd": 1, "@Description": 1, "SHEBANG#!#! This": 1, "SHEBANG#!#! any": 1, "": 1, "": 27, "SHEBANG#!#! It": 3, "SHEBANG#!#! That": 1, "SHEBANG#!#! of": 1, "your": 2, "SHEBANG#!#! main": 1, "SHEBANG#!#! XML": 1, "SHEBANG#!#! other": 1, "SHEBANG#!#! as": 1, "SHEBANG#!#! to": 2, "SHEBANG#!#! Secondly": 1, "SHEBANG#!#! page": 1, "name": 3, "description": 1, "version": 1, "based": 1, "SHEBANG#!#! on": 1, "": 27, "SHEBANG#!#! tags": 1, "SHEBANG#!#! This": 1, "SHEBANG#!#! produce": 1, "SHEBANG#!#! MathJaX": 1, "SHEBANG#!#! generated": 1, "SHEBANG#!#! this": 1, "SHEBANG#!#! supplementary": 1, "BookName=": 2, "": 1, "SHEBANG#!#! For": 1, "SHEBANG#!#! The": 1, "": 6, "": 24, "": 24, "SHEBANG#!#! The": 2, "option_record": 3, "record": 1, "additional": 1, "options.": 1, "dir": 1, "SHEBANG#!#! This": 4, "SHEBANG#!#! Directory": 1, "i.e.": 1, "GAPDoc": 2, "XML": 5, "stored.": 1, "
": 4, "Default": 4, "SHEBANG#!#! for": 1, "SHEBANG#!#! The": 3, "SHEBANG#!#! record": 3, "SHEBANG#!#! equivalent": 3, "SHEBANG#!#! enabled": 3, "SHEBANG#!#! package": 2, "SHEBANG#!#! In": 3, "scaffolding": 3, "disabled.": 3, "SHEBANG#!#! If": 3, "####": 34, "TODO": 3, "mention": 1, "merging": 1, "PackageInfo.AutoDoc": 1, "includes": 1, "SHEBANG#!#! A": 6, "SHEBANG#!#! If": 2, "SHEBANG#!#! your": 1, "SHEBANG#!#! you": 1, "SHEBANG#!#! to": 4, "SHEBANG#!#! is": 1, "SHEBANG#!#! of": 2, "appendix": 1, "SHEBANG#!#! This": 3, "SHEBANG#!#! i": 1, "bib": 1, "SHEBANG#!#! The": 2, "SHEBANG#!#! then": 1, "param": 1, "bit": 2, "strange.": 1, "change": 1, "general": 1, "might": 1, "want": 1, "define": 2, "entities...": 1, "now": 1, "document": 1, "leave": 1, "us": 1, "choice": 1, "revising": 1, "how": 1, "works.": 1, "entities": 2, "names": 1, "corresponding": 1, "entities.": 1, "containing": 1, "": 2, "SomePackage": 4, "": 2, "added": 1, "preamble": 1, "

": 3, "ENTITY": 2, "Package": 1, "": 1, "allows": 1, "amp": 1, "documentation": 2, "reference": 1, "another": 1, "entity": 1, "desired": 1, "add": 2, "instead": 1, "list.": 2, "It": 1, "": 1, "please": 1, "careful.": 1, "TitlePage": 1, "SHEBANG#!#! for": 1, "SHEBANG#!#! statement": 1, "SHEBANG#!#! components": 2, "SHEBANG#!#! example": 1, "SHEBANG#!#! acknowledgements": 1, "Acknowledgements": 1, "Many": 1, "thanks": 2, "": 1, "SHEBANG#!#! For": 1, "manual": 1, "specifically": 1, "section": 1, "Subsect=": 1, "SHEBANG#!#! and": 1, "document_class": 1, "SHEBANG#!#! Sets": 1, "SHEBANG#!#! which": 4, "SHEBANG#!#! a": 1, "SHEBANG#!#! the": 2, "latex_header_file": 1, "SHEBANG#!#! Replaces": 1, "SHEBANG#!#! Please": 1, "gapdoc_latex_options": 1, "SHEBANG#!#! Must": 1, "SHEBANG#!#! will": 1, "": 6, "SHEBANG#!#! by": 1, "feature": 2, "SHEBANG#!#! Usually": 2, "scan_dirs": 2, "SHEBANG#!#! are": 2, "level": 1, "SHEBANG#!#! When": 1, "SHEBANG#!#! they": 1, "Document": 1, "section_intros": 2, "later": 1, "on.": 1, "However": 2, "comment": 1, "syntax": 1, "remaining": 1, "ability": 1, "order": 1, "chapters": 1, "sections.": 1, "TODO.": 1, "SHEBANG#!#! files": 1, "strictly": 1, "speaking": 1, "scaffold.": 1, "uses": 2, "necessary": 2, "custom": 1, "main": 2, "purpose": 1, "parameter": 1, "cater": 1, "existing": 1, "wish": 1, "scaffolding.": 1, "explain": 1, "why": 2, "specifying": 1, "gapdoc.main.": 1, "still": 1, "honor": 1, "though": 1, "just": 1, "case.": 1, "SHEBANG#!#! In": 1, "PACKAGENAME.xml": 1, "part.": 1, "Still": 1, "under": 1, "construction.": 1, "SHEBANG#!#! The": 1, "SHEBANG#!#! a": 1, "SHEBANG#!#! which": 1, "SHEBANG#!#! the": 1, "filename": 1, "SHEBANG#!#! Sets": 1, "SHEBANG#!#! A": 1, "SHEBANG#!#! will": 1, "@Returns": 1, "nothing": 1, "@Arguments": 1, "@ChapterInfo": 1, "implementation": 1, "SomeOperation": 1, "": 2, "performs": 1, "operation": 1, "InstallMethod": 18, "SomeProperty": 1, "M": 7, "IsTrivial": 1, "TryNextMethod": 7, "SomeGlobalFunction": 2, "global": 1, "variadic": 1, "funfion.": 1, "SomeFunc": 1, "z": 3, "func": 3, "j": 3, "mod": 2, "repeat": 1, "until": 1, "vspc.gi": 1, "generic": 1, "SetLeftActingDomain": 2, "": 2, "external": 1, "knows": 1, "e.g.": 1, "tell": 1, "InstallOtherMethod": 3, "IsAttributeStoringRep": 2, "IsLeftActedOnByRing": 2, "IsObject": 1, "extL": 2, "HasIsDivisionRing": 1, "SetIsLeftActedOnByDivisionRing": 1, "IsExtLSet": 1, "IsIdenticalObj": 5, "difference": 1, "between": 1, "shall": 1, "CallFuncList": 1, "FreeLeftModule": 1, "newC": 7, "IsSubset": 4, "SetParent": 1, "UseIsomorphismRelation": 2, "UseSubsetRelation": 4, "View": 1, "base": 5, "gen": 5, "loop": 2, "newgens": 4, "extended": 1, "Characteristic": 2, "Basis": 5, "AsField": 2, "GeneratorsOfLeftModule": 9, "LeftModuleByGenerators": 5, "Zero": 5, "Intersection": 1, "ViewObj": 4, "print": 1, "no.": 1, "HasGeneratorsOfLeftModule": 2, "HasDimension": 1, "override": 1, "PrintObj": 5, "HasZero": 1, "": 2, "factor": 2, "": 1, "ImagesSource": 1, "NaturalHomomorphismBySubspace": 1, "AsStructure": 3, "Substructure": 3, "Structure": 2, "inters": 17, "gensV": 7, "gensW": 7, "VW": 3, "sum": 1, "Intersection2": 4, "IsFiniteDimensional": 2, "Coefficients": 3, "SumIntersectionMat": 1, "LinearCombination": 2, "HasParent": 2, "SetIsTrivial": 1, "ClosureLeftModule": 2, "": 1, "closure": 1, "IsCollsElms": 1, "HasBasis": 1, "IsVector": 1, "w": 3, "easily": 1, "UseBasis": 1, "Methods": 1, "collections": 1, "#R": 1, "IsSubspacesVectorSpaceDefaultRep": 7, "representation": 1, "components": 1, "means": 1, "DeclareRepresentation": 1, "IsComponentObjectRep": 1, ".dimension": 9, ".structure": 9, "number": 2, "q": 20, "prod_": 2, "frac": 3, "sum_": 1, "size": 12, "qn": 10, "qd": 10, "ank": 6, "Int": 1, "/2": 1, "Enumerator": 2, "Use": 1, "iterator": 3, "allowed": 1, "elms": 4, "IsDoneIterator": 3, ".associatedIterator": 3, ".basis": 2, "structure": 4, "associatedIterator": 2, "ShallowCopy": 2, "IteratorByFunctions": 1, "IsDoneIterator_Subspaces": 1, "NextIterator_Subspaces": 1, "ShallowCopy_Subspaces": 1, "": 1, "dim": 2, "Objectify": 2, "NewType": 2, "CollectionsFamily": 2, "FamilyObj": 2, "map": 4, "S": 4, "IsLinearMapping": 1, "G/H": 1, "NaturalHomomorphism": 1 }, "GCC Machine Description": { ";": 2030, "-": 97, "Machine": 1, "description": 1, "for": 16, "the": 66, "PDP": 2, "Copyright": 1, "(": 2252, "C": 1, ")": 2186, "Lars": 2, "Brinkhoff.": 1, "Contributed": 1, "by": 17, "Brinkhoff": 1, "": 1, "nocrew": 1, "org": 1, "funded": 1, "XKL": 1, "LLC.": 1, "Index": 2, "Front": 1, "Page": 1, "Constraints": 2, "Immediate": 2, "Operands": 3, "To": 2, "do": 2, "List": 4, "Instruction": 3, "Wish": 2, "Attributes": 2, "length": 4, "skip": 6, "reorg_type": 2, "Unspec": 2, "Usage": 2, "UNSPEC_ADJSP": 2, "UNSPEC_ADJBP": 2, "UNSPEC_ADDRESS": 2, "UNSPEC_FFO": 2, "UNSPEC_SUBBP": 2, "VUNSPEC_BLT": 3, "VUNSPEC_FSC": 1, "VUNSPEC_XBLT": 3, "VUNSPEC_MOVSLJ": 3, "VUNSPEC_MOVST": 3, "Constants": 2, "RIGHT_HALF": 22, "LEFT_HALF": 11, "SIGNBIT": 19, "SP_REGNUM": 4, "Optimizations": 2, "Data": 4, "Movement": 4, "LDB": 2, "ILDB": 1, "LDBI": 2, "LDBE": 2, "ILDBE": 2, "LDBEI": 2, "DPB": 1, "IDPB": 1, "DPBI": 2, "HRR": 2, "HRL": 1, "HLR": 1, "HLL": 1, "HRRM": 1, "HRLM": 1, "HLRM": 1, "HLLM": 1, "HRRZ": 2, "HRLZ": 1, "HLRZ": 1, "HLLZ": 1, "HRRE": 3, "HRLE": 1, "HLRE": 1, "HLLE": 1, "SETZM": 1, "SETOM": 1, "MOVE": 2, "MOVEI": 3, "MOVSI": 2, "HRLOI": 2, "HRROI": 2, "MOVEM": 1, "MOVS": 1, "EXCH": 1, "SETZB": 1, "DMOVE": 1, "DMOVEM": 1, "BLT": 2, "XBLT": 2, "MOVSLJ": 2, "MOVST": 2, "CMPS": 2, "Conditional": 3, "SKIPL": 1, "SKIPE": 1, "SKIPLE": 1, "SKIPGE": 1, "SKIPN": 1, "SKIPG": 1, "TDZA": 1, "Integer": 9, "Arithmetic": 5, "AOS": 2, "SOS": 2, "ADD": 3, "ADDI": 1, "ADDM": 1, "ADDB": 1, "DADD": 1, "SUB": 2, "SUBI": 1, "SUBM": 1, "SUBB": 2, "DSUB": 1, "IMUL": 1, "IMULI": 1, "IMULM": 1, "IMULB": 1, "MUL": 1, "MULI": 1, "MULM": 1, "MULB": 1, "DMUL": 1, "IDIV": 1, "IDIVI": 3, "IDIVM": 1, "DIV": 1, "DIVI": 1, "DIVM": 1, "DDIV": 1, "UIDIV": 2, "UIDIVI": 2, "UIDIVM": 1, "UIMOD": 2, "UIMODI": 2, "UIMODM": 1, "MOVN": 2, "MOVNM": 2, "MOVNS": 2, "MOVNI": 1, "DMOVN": 3, "DMOVNM": 2, "MOVM": 2, "MOVMM": 2, "MOVMS": 2, "FFS": 3, "Conversions": 3, "ANDI": 3, "SEXT": 2, "Shifting": 2, "and": 53, "Rotating": 2, "LSH": 4, "LSHC": 1, "ASH": 1, "ASHC": 3, "ROT": 1, "ROTC": 1, "Logical": 2, "Operations": 1, "AND": 4, "ANDM": 1, "ANDB": 1, "TLZ": 2, "ANDCMI": 3, "ANDCA": 1, "ANDCAI": 1, "ANDCAM": 1, "ANDCAB": 1, "ANDCBI": 2, "ANDCM": 1, "ANDCMM": 1, "ANDCMB": 1, "XOR": 1, "XORI": 1, "XORM": 1, "XORB": 1, "TLC": 2, "EQVI": 1, "IOR": 1, "IORI": 1, "IORM": 1, "IORB": 1, "TLO": 6, "ORCMI": 2, "ANDCB": 1, "ANDCBM": 1, "ANDCBB": 1, "EQV": 1, "EQVM": 1, "EQVB": 1, "SETCA": 1, "SETCAM": 1, "SETCAB": 1, "SETCM": 1, "SETCMM": 1, "SETCMB": 1, "ORCA": 1, "ORCAI": 1, "ORCAM": 1, "ORCAB": 1, "ORCBI": 1, "ORCM": 1, "ORCMM": 1, "ORCMB": 1, "ORCB": 1, "ORCBM": 1, "ORCBB": 1, "Floating": 6, "point": 5, "FADR": 1, "FADRI": 1, "FADRM": 1, "FADRB": 1, "DFAD": 1, "GFAD": 1, "FSBR": 1, "FSBRI": 1, "FSBRM": 1, "FSBRB": 1, "DFSB": 1, "GFSB": 1, "FMPR": 1, "FMPRI": 1, "FMPRM": 1, "FMPRB": 1, "DFMP": 1, "GFMP": 1, "FDVR": 1, "FDVRI": 1, "FDVRM": 1, "FDVRB": 1, "DFDV": 1, "GFDV": 1, "SQRT": 2, "DSQRT": 2, "GSQRT": 2, "FSC": 2, "DFSC": 1, "GFSC": 1, "FIX": 1, "DFIX": 3, "GFIX": 1, "DDFIX": 2, "GDFIX": 1, "FLTR": 1, "DFLTR": 3, "GFLTR": 1, "DDFLTR": 2, "DGFLTR": 1, "GSNGL": 1, "GDBLE": 1, "Pointer": 1, "IBP": 1, "ADJBP": 2, "SUBBP": 2, "Unconditional": 1, "Jumps": 2, "JFCL": 1, "JRST": 1, "PUSHJ": 3, "TRNE": 2, "TLNE": 4, "TDNE": 1, "TRNN": 1, "TLNN": 1, "TDNN": 1, "TLZN": 1, "JUMP": 1, "SKIP": 1, "CAI": 1, "CAM": 1, "SOJ": 1, "AOJ": 1, "JFFO": 2, "CMPBP": 2, "Function": 1, "prologue": 1, "epilogue": 1, "POPJ": 4, "ADJSP": 2, "PUSH": 1, "POP": 1, "Peepholes": 2, "Miscellaneous": 1, "Instructions": 1, "in": 22, "parentheses": 1, "are": 6, "either": 1, "commented": 1, "out": 2, "or": 9, "not": 1, "generated": 3, "compiler.": 1, "Any": 2, "valid": 1, "immediate": 1, "floating": 3, "constant.": 2, "..": 3, "xxxxxx": 3, "TLN": 1, "zero.": 1, "Local": 1, "symbol.": 4, "Use": 2, "peep2_reg_dead_p": 1, "peepholes.": 1, "Unsigned": 3, "multiplication.": 1, "mul": 8, "multiply": 5, "AC1": 17, "AC3": 8, "lsh": 15, "lshc": 13, "result": 11, "AC2": 14, "bit": 10, "arithmetic.": 2, "Addition": 2, "subtraction": 1, "multiplication": 5, "division": 2, "arithmetic": 5, "shift": 19, "supported": 1, "hardware.": 1, "left": 2, "right": 3, ".": 42, "x": 16, "jfcl": 15, "+": 51, "add": 11, "to": 40, "AC4": 4, "jcry0": 12, "[": 649, "aoja": 10, "]": 648, "Subtraction": 1, "sub": 6, "subi": 3, "Negation": 1, "setcm": 2, "movn": 6, "jumpe": 6, "self": 1, "setca": 3, "Magnitude": 1, "conditional": 1, "negation": 2, "jumpge": 2, "mask": 3, "y": 4, "move": 12, "ash": 8, "shortcut": 1, "xor": 19, "Signed": 3, "Variable": 1, "amount": 7, "only": 5, "works": 2, "if": 52, "n": 7, "<": 3, "operand": 18, "loop": 1, "jumple": 1, "tlne": 5, "tlo": 5, "sojg": 1, "tlnn": 1, "tdza": 1, "movsi": 8, "movei": 11, "ashc": 1, "ior": 12, "Fixed": 1, "mask1": 1, "mask2": 1, "skipge": 3, "cail": 1, "iori": 2, "<2>": 1, "1": 39, "rotc": 2, "jov": 3, "jrst": 7, "cam": 3, "...": 6, "trne": 2, "tloa": 1, "tlz": 1, "*": 9, "high": 1, "part": 2, "mulm": 1, "Multiplication": 1, "dmul": 4, "Comparisons": 1, "CAMN": 1, "CAME": 1, "here": 1, "false": 1, "TSC": 1, "TSO": 1, "TSZ.": 1, "TSNE": 1, "TSNN.": 1, "Ok": 1, "negate": 1, "double": 5, "word": 7, "integer": 2, "with": 8, "Answer": 1, "perhaps": 1, "not.": 1, "If": 1, "comparison": 3, "code": 1, "cares": 1, "about": 1, "second": 2, "of": 13, "a": 26, "has": 1, "set": 264, "value.": 1, "Converting": 1, "from": 5, "float": 2, "single": 2, "truncdfsf2": 1, "needs": 1, "rounding.": 1, "really": 1, "faster": 1, "than": 1, "TRZ": 1, "Add": 1, "cmpdi": 1, "Revisit": 1, "casesi": 1, "*move_and_skipsi": 1, "*move_and_skipsf": 1, "clobbers": 1, "accumulator": 4, "Is": 1, "it": 2, "possible": 1, "allocate": 1, "scratch": 1, "register": 18, "AOSA": 1, "SOSA.": 1, "half": 1, "instructions.": 3, "AOBJP": 1, "AOBJN": 1, "SUBREG": 6, "DImode": 20, "causes": 1, "bad": 1, "allocation": 2, "divmodsi4": 1, "divmoddi4": 1, "expand_builtin_jffo": 1, "ffssi.": 1, "String": 1, "Avoid": 1, "them": 1, "now.": 1, "REG": 5, "fast.": 1, "None": 1, "these": 1, "is": 63, "thoroughly": 1, "tested.": 1, "They": 2, "all": 1, "require": 1, "lot": 1, "registers": 1, "setup.": 1, "uncharacteristic": 1, "other": 2, "Test": 2, "modify": 1, "instructions": 1, "In": 1, "case": 13, "anyone": 1, "would": 2, "like": 1, "play": 1, "strange": 1, "games": 1, "this": 4, "could": 3, "be": 6, "optimized": 1, "use": 5, "instruction": 6, "static": 2, "foo": 1, "void": 4, "**p": 2, "*f": 2, "FOO": 1, "{": 62, "p": 1, "&&": 46, "label": 5, "goto": 2, "return": 63, "}": 66, "And": 1, "bar": 1, "BAR": 1, "*p": 1, "JSP": 1, "call": 1, "functions": 1, "__attribute__": 1, "fastcall": 1, "similar.": 1, "Historical": 1, "KA10": 1, "software": 1, "precision": 1, "point.": 1, "increment": 1, "load": 2, "sign": 10, "extended": 1, "byte.": 2, "load/deposit": 1, "byte": 7, "then": 2, "increment.": 1, "subtract": 1, "pointers.": 2, "compare": 3, "r": 9, "extend": 13, "r.": 1, "Clear/set": 1, "<0.>": 1, "UDIV": 1, "UDDIV": 1, "unsigned": 6, "udivsi3": 1, "udivdi3": 1, "UMOD": 1, "UDMOD": 1, "modulo": 1, "umodsi3": 1, "umoddi3": 1, "UJUMP": 1, "USKIP": 1, "UCAI": 1, "UCAM": 1, "values": 1, "MIN": 1, "MAX": 1, "UMIN": 1, "UMAX": 1, "min": 1, "max": 1, "minsi3": 1, "maxsi3": 1, "uminsi3": 1, "umaxsi3": 1, "square": 1, "root": 1, "sqrtM2": 1, "SIN": 1, "DSIN": 1, "GSIN": 1, "sine": 1, "function": 3, "__builtin_sin": 1, "COS": 1, "DCOS": 1, "GCOS": 1, "cosine": 1, "__builtin_cos": 1, "mathematical": 1, "TAN": 1, "ASIN": 1, "ACOS": 1, "ATAN": 1, "SINH": 1, "COSH": 1, "TANH": 1, "ASINH": 1, "ACOSH": 1, "ATANH": 1, "EXP": 1, "LN": 1, "LOG2": 1, "LOG10": 1, "POW": 1, "All": 1, "potentially": 1, "giant": 1, "versions": 2, "find": 1, "first": 4, "counting": 1, "least": 2, "significant": 3, "ffsM2": 1, "DFIXR": 2, "Double": 8, "fix_truncdfsi2": 1, "Single": 1, "Precision": 4, "fix_truncsfdi2": 1, "DDFIXR": 1, "fix_truncdfdi2": 1, "Float": 4, "Round": 4, "floatsidf2": 1, "floatdisf2": 1, "floatdidf2": 1, "UDFLTR": 1, "UGFLTR": 1, "floatuns": 1, "WAIT": 1, "wait": 1, "interrupt": 1, "XPUSH": 1, "XPUSHJ": 1, "XPOP": 1, "XPOPJ": 1, "fast": 1, "global": 1, "stack": 4, "pointer": 16, "Length": 1, "words": 1, "define_attr": 3, "const_int": 142, "The": 12, "no": 2, "yes": 1, "const_string": 2, "type": 1, "used": 1, "machine": 1, "dependent": 1, "reorg": 1, "pass": 1, "none": 2, "ibp": 1, "ldb": 2, "dpb": 1, "define_constants": 3, "0": 46, "operation": 13, "Pmode": 7, "Operand": 38, "adjustment": 2, "2": 8, "Effective": 1, "address": 5, "calculation": 1, "memory": 9, "3": 5, "Find": 1, "one": 1, "FFO": 1, "SImode": 63, "UNSPEC_FSC": 1, "4": 2, "SFmode": 1, "DFmode": 1, "value": 11, "scale": 1, "factor": 1, "UNSPEC_SHIFT": 1, "5": 2, "Left": 1, "Used": 2, "compensate": 2, "unnecessary": 2, "shifts": 2, "count": 2, "UNSPEC_SHIFTRT": 1, "6": 1, "Right": 1, "UNSPEC_TLNE_TLZA_TLO": 1, "TLZA": 2, "sequence": 2, "7": 1, "8": 1, "Byte": 1, "difference": 1, "UNSPEC_CMPBP": 1, "9": 4, "Prepare": 1, "UNSPEC_REAL_ASHIFT": 3, "10": 1, "UNSPEC_ASH71": 1, "11": 1, "71": 2, "UNSPEC_MUL71": 2, "12": 1, "multiplicands": 1, "UNSPEC_SIGN_EXTEND": 4, "13": 2, "Sign": 1, "extension": 2, "number": 4, "bits": 7, "UNSPEC_ZERO_EXTEND": 4, "14": 1, "Zero": 1, "UNSPEC_TRUNCATE": 2, "15": 2, "Truncate": 1, "truncate": 11, "trunc": 1, "UNSPEC_TRNE_TLO": 2, "16": 1, "UNSPEC_ASHC": 1, "17": 3, "UNSPEC_LSHC": 1, "18": 3, "VUNSPEC_BLOCKAGE": 1, "BLKmode": 5, "source": 2, "destination": 2, "block": 5, "VUNSPEC_CMPS": 2, "262143": 1, "0000000777777": 1, "262144": 1, "0777777000000": 1, "34359738368": 1, "0400000000000": 1, "FP_REGNUM": 1, "Frame": 1, "Stack": 1, "Adding": 1, "constant": 1, "done": 2, "fastest": 2, "X": 2, "op0": 2, "const": 2, "op1": 8, "As": 2, "special": 2, "recognize": 2, "define_insn": 194, "MOVEI_sp": 1, "match_operand": 607, "SI": 698, "register_operand": 10, "plus": 29, "reg": 5, "const_int_operand": 4, "operands": 266, "gen_rtx_PLUS": 1, "stack_pointer_rtx": 1, "ADDRESS": 5, "TARGET_EXTENDED": 5, "xmovei": 3, "a1": 2, "Moving": 1, "any": 1, "move_from_sp": 1, "Load": 4, "scalar": 8, "signed": 2, "chars": 3, "using": 7, "sign_extend": 33, "QI": 47, "m": 6, "MEM_SCALAR_P": 8, "hrre": 2, "W1": 6, "sign_extract": 11, "27": 3, "subreg": 22, "zero_extract": 29, "memory_operand": 4, "movem": 7, "HI": 35, "unspec": 11, "INTVAL": 38, "MOVE.": 2, "zero_extend": 11, "This": 5, "well": 2, "int": 9, "variable.": 2, "Store": 2, "MOVEM.": 2, "shorts": 3, "HRRE.": 1, "ge": 12, "HOST_WIDE_INT": 17, "<<": 11, "gen_int_mode": 6, "&": 7, "else": 37, "set_attr": 54, "output_asm_insn": 19, "pc": 21, "if_then_else": 14, "label_ref": 9, "rtx": 29, "ops": 65, "GEN_INT": 26, "pdp10_output_range_compare": 6, "insn": 26, "clobber": 6, "match_scratch": 4, "lt": 9, "lshiftrt": 14, "BITS_PER_WORD": 5, "get_attr_length": 4, "pdp10_output_extzv": 1, "pdp10_output_extzv_sequence": 2, "attr": 4, "ne": 5, "symbol_ref": 1, "match_dup": 88, "ashift": 5, "define_expand": 45, "REG_P": 4, "GET_CODE": 30, "CONST_INT": 8, "gen_rtx_REG": 2, "REGNO": 13, "SUBREG_REG": 22, "ZERO_EXTRACT": 4, "XEXP": 35, "MEM": 7, "SUBREG_BYTE": 3, "emit_move_insn": 22, "convert_to_mode": 4, "DONE": 19, "temp": 46, "gen_reg_rtx": 16, "gen_rtx_SUBREG": 35, "QImode": 3, "emit_insn": 21, "gen_movsi": 2, "force_reg": 5, "CONSTANT_ADDRESS_P": 3, "pdp10_pointer_alignment": 2, "UNITS_PER_WORD": 4, "||": 11, "%": 495, "offset": 1, "pdp10_pointer_offset": 1, "pdp10_output_extv_sequence": 1, "which_alternative": 6, "ildb": 1, "HImode": 3, "mem": 2, "CONST": 1, "TARGET_SMALLISH": 1, "hrr": 1, "hrrm": 1, "hrl": 1, "hrlm": 1, "hlr": 1, "hlrm": 1, "W0": 5, "zero_extended_p": 6, "char": 1, "*insn": 1, "hrro": 1, "hrrom": 1, "hllz": 1, "hllzm": 1, "hllo": 1, "hllom": 1, "hll": 1, "hllm": 1, "hlrz": 1, "hlrzm": 1, "ashiftrt": 2, "hlre": 1, "hlrem": 1, "hrlz": 1, "hrlzm": 1, "pdp10_output_movhi": 1, "FAIL": 12, "TARGET_XKL2": 1, "pdp10_expand_extv": 1, "pdp10_expand_extzv": 1, "PLUS": 3, "pdp10_output_store_byte": 2, "gen_rtx_MEM": 1, "Special": 1, "version": 1, "SKIPA": 1, "full": 1, "may": 1, "beneficial": 1, "on": 4, "processors": 1, "cache.": 1, "Note": 1, "constraint": 10, "alternative": 4, "Reload": 3, "can": 5, "fall": 1, "back": 1, "last": 4, "instisting": 1, "moving": 2, "S": 3, "allows": 2, "match_operator": 6, "movs": 1, "movsm": 1, "DI": 92, "TODO": 1, "there": 7, "unused": 1, "register.": 1, "dmove": 4, "setzb": 4, "Z0": 34, "seto": 2, "movni": 3, "n1": 2, "D1": 1, "setzm": 9, "dmovem": 2, "Z1": 5, "A1": 2, "B1": 2, "TI": 17, "SF": 13, "movsf": 6, "G1": 3, "DF": 12, "movdf": 16, "BLK": 11, "unspec_volatile": 5, "eq": 4, "pdp10_compare_op0": 6, "pdp10_compare_op1": 10, "gt": 3, "le": 4, "pdp10_flip_sign_bit": 4, "skipe": 4, "@": 8, "_movei": 14, "seemingly": 1, "useless": 1, "combination": 2, "needed": 1, "enable": 1, "below.": 1, "Calculate": 1, "truth": 1, "particular": 1, "JCRY0.": 1, "_tdza": 4, "_": 10, "outputs.": 2, "Therefore": 2, "pattern": 2, "must": 2, "have": 2, "predicate": 3, "so": 3, "that": 5, "invalid": 3, "until": 3, "after": 3, "allocation.": 2, "just": 3, "as": 3, "resort": 3, "when": 3, "spilled": 3, "stack.": 3, "allow": 4, "pdp10_remove_unnecessary_label": 3, "switch": 3, "pdp10_output_jrst": 3, "default": 3, "abort": 3, "cond": 3, "eq_attr": 7, "minus": 12, "pass.": 1, "Make": 2, "sure": 2, "/": 2, "an": 1, "addi": 3, "N2": 2, "X2": 1, "addm": 2, "aos": 5, "sos": 4, "Z2": 4, "_subi": 2, "B2": 1, "A2": 1, "dadd": 2, "D2": 5, "subm": 3, "_sos": 1, "dsub": 2, "mult": 15, "imul": 2, "imuli": 1, "imulm": 1, "muli": 2, "neg": 13, "TImode": 2, "gen_DMUL": 1, "gen_ashlsi3": 3, "gen_lshrdi3": 2, "gen_TRNE_TLO": 1, "div": 10, "mod": 6, "idiv": 2, "idivi": 1, "indexing": 3, "missing.": 7, "IDIVB": 1, "temp0": 11, "gen_IDIV": 3, "gen_IDIVM": 1, "temp1": 4, "disabled": 1, "since": 1, "doesn": 1, "divsi3": 1, "patterns.": 1, "parallel": 2, "divi": 1, "DIVB": 1, "ddiv": 2, "gen_ashrsi3": 1, "gen_DDIV": 1, "udiv": 1, "uidivi": 1, "uidiv": 2, "uidivm": 1, "UIDIVB": 1, "umod": 1, "uimodi": 1, "uimod": 2, "uimodm": 1, "UIMODB": 1, "movnm": 1, "N1": 1, "movns": 1, "_movn": 1, "abs": 3, "movm": 1, "movmm": 1, "movms": 1, "smax": 1, "camge": 8, "_move": 14, "caige": 2, "_seto": 2, "camle": 8, "caile": 2, "_skipa": 6, "smin": 1, "skiple": 1, "searches": 2, "most": 1, "while": 1, "bit.": 1, "index": 1, "treatment": 1, "zero": 1, "also": 1, "differ.": 1, "ffs": 2, "t1": 3, "t2": 3, "t3": 5, "t4": 3, "gen_label_rtx": 1, "extern": 1, "pdp10_expand_ffs": 2, "gen_negsi2": 2, "gen_andsi3": 1, "emit_jump_insn": 1, "gen_JFFO": 1, "gen_rtx_LABEL_REF": 1, "emit_label": 1, "gen_subsi3": 1, "Sequence": 1, "taken": 1, "HAKMEM.": 1, "B": 10, "A": 7, "each": 1, "octal": 1, "digit": 1, "replaced": 1, "casting": 1, "extend_bits": 11, "bitsize": 5, "gen_ASH_right": 1, "sign_extended_p": 3, "gen_LSH_right": 1 }, "GDB": { "#": 13, "target": 1, "remote": 1, "localhost": 1, "monitor": 10, "reset": 2, "halt": 1, "sleep": 2, "wait_halt": 1, "flash": 3, "probe": 1, "info": 1, "write_image": 1, "erase": 1, "unlock": 1, "USBtoSerial.hex": 1, "run": 1, "exit": 1, "quit": 1, "define": 12, "aswhere": 2, "set": 24, "var": 24, "fcount": 2, "avmplus": 51, "AvmCore": 8, "getActiveCore": 8, "(": 84, ")": 84, "-": 19, "debugger": 9, "frameCount": 1, "i": 5, "while": 4, "<": 4, "asprintframe": 6, "+": 4, "end": 48, "document": 7, "Print": 5, "backtrace": 1, "of": 5, "all": 4, "the": 13, "ActionScript": 2, "stack": 6, "frames.": 1, "May": 2, "not": 4, "work": 2, "in": 4, "contexts": 1, "notably": 1, "inside": 1, "MMgc": 1, ".": 3, "properly": 1, "until": 1, "gdb": 4, "is": 2, "called": 1, "at": 2, "least": 1, "once.": 1, "_asframe_selected": 7, "frame": 36, "frameAt": 4, "arg0": 16, "if": 27, "echo": 20, "no": 9, "n": 13, "else": 7, "aspstring": 7, "Debugger": 43, "methodNameAt": 1, "vcount": 3, "autoVarCount": 3, "AUTO_ARGUMENT": 11, "j": 7, "argname": 2, "autoVarName": 3, "_atom": 2, "autoAtomAt": 1, "call": 8, "void": 2, "printAtom": 1, "asframe": 2, "argc": 3, "Select": 1, "and": 1, "print": 14, "an": 1, "frame.": 4, "With": 5, "argument": 8, "selected": 4, "AS": 3, "An": 1, "specifies": 1, "number": 1, "to": 2, "select.": 1, "printString": 1, "AS3": 1, "string.": 1, "aslocal": 3, "lcount": 2, "AUTO_LOCAL": 8, "k": 14, "lname": 2, "output": 4, "_last_type": 18, "autoAtomKindAt": 2, "unknown": 2, "autoVarAsObject": 3, "autoVarAsString": 2, "ecno": 1, "namespace": 2, "unfinished": 2, "undefined": 2, "autoVarAsBoolean": 2, "autoVarAsInteger": 2, "autoVarAsDouble": 2, "local": 3, "variables": 1, "currently": 3, "debuging": 1, "information": 2, "present.": 1, "Information": 1, "may": 1, "be": 2, "incorrect": 1, "a": 3, "safepoint.": 1, "variables.": 1, "numeric": 2, "specific": 2, "variable": 1, "will": 4, "store": 2, "value": 2, "history": 2, "for": 2, "further": 2, "manipulation": 2, "asarg": 3, "acount": 2, "name": 3, "arguments": 1, "If": 1, "debugging": 2, "available": 1, "names": 1, "printed.": 1, "arguments.": 1, "asthis": 2, "AUTO_THIS": 1, "receiver": 1, "asmixon": 2, "avmshell": 2, "DebugCLI": 2, "debuggerInterruptOnEnter": 2, "true": 1, "turn": 1, "on": 1, "stepping.": 1, "Execution": 1, "return": 1, "propmpt": 1, "after": 1, "asstep*": 1, "instructions.": 1, "Requires": 1, "symbols": 1, ".abcs": 1, "asstepout": 1, "stepOut": 1, "continue": 3, "asstepinto": 1, "stepInto": 1, "asstepover": 1, "stepOver": 1, "asprint": 1, "traits": 1 }, "GDScript": { "extends": 4, "Node2D": 1, "const": 11, "INITIAL_BALL_SPEED": 3, "var": 86, "ball_speed": 2, "screen_size": 2, "Vector2": 61, "(": 256, ")": 254, "#default": 1, "ball": 2, "direction": 7, "-": 27, "pad_size": 4, "PAD_SPEED": 1, "func": 19, "_process": 1, "delta": 11, "ball_pos": 8, "get_node": 24, ".get_pos": 5, "left_rect": 1, "Rect2": 5, "pad_size*0.5": 2, "right_rect": 1, "#integrate": 1, "new": 1, "postion": 1, "+": 19, "direction*ball_speed*delta": 1, "#flip": 2, "when": 2, "touching": 2, "roof": 1, "or": 4, "floor": 1, "if": 57, "ball_pos.y": 1, "<0>": 4, "and": 15, "y": 13, "0": 13, "screen_size.y": 3, "direction.y": 4, "change": 1, "increase": 1, "speed": 2, "pads": 1, "left_rect.has_point": 1, "direction.x": 4, "<": 6, "right_rect.has_point": 1, "ball_speed*": 1, "randf": 1, "*2.0": 1, "direction.normalized": 1, "#check": 1, "gameover": 1, "ball_pos.x": 1, "x": 12, "screen_size.x": 1, "screen_size*0.5": 1, ".set_pos": 3, "#move": 2, "left": 1, "pad": 2, "left_pos": 2, "left_pos.y": 4, "Input.is_action_pressed": 4, "PAD_SPEED*delta": 4, "right": 1, "right_pos": 2, "right_pos.y": 4, "_ready": 3, "get_viewport_rect": 1, ".size": 1, "#": 10, "get": 1, "actual": 1, "size": 1, ".get_texture": 1, ".get_size": 1, "set_process": 1, "true": 10, "BaseClass": 1, "a": 4, "s": 4, "arr": 1, "[": 21, "]": 21, "dict": 1, "{": 2, "}": 2, "answer": 1, "thename": 1, "v2": 1, "v3": 1, "Vector3": 9, "some_function": 1, "param1": 4, "param2": 5, "local_var": 2, "print": 6, "elif": 4, "else": 12, "for": 9, "i": 7, "in": 12, "range": 6, "while": 1, "local_var2": 2, "return": 14, "class": 1, "Something": 1, "_init": 1, "lv": 11, "Something.new": 1, "lv.a": 1, "RigidBody": 1, "#var": 1, "dir": 8, "ANIM_FLOOR": 2, "ANIM_AIR_UP": 2, "ANIM_AIR_DOWN": 2, "SHOOT_TIME": 2, "SHOOT_SCALE": 2, "CHAR_SCALE": 2, "facing_dir": 2, "movement_dir": 3, "jumping": 4, "false": 15, "turn_speed": 3, "keep_jump_inertia": 2, "air_idle_deaccel": 2, "accel": 3, "deaccel": 3, "sharp_turn_threshhold": 2, "max_speed": 5, "on_floor": 3, "prev_shoot": 3, "last_floor_velocity": 5, "shoot_blend": 6, "adjust_facing": 3, "p_facing": 5, "p_target": 2, "p_step": 2, "p_adjust_rate": 2, "current_gn": 2, "n": 2, "normal": 1, "t": 2, "n.cross": 1, ".normalized": 1, "n.dot": 1, "t.dot": 1, "ang": 11, "atan2": 1, "abs": 1, "<0.001>": 1, "too": 1, "small": 1, "sign": 1, "turn": 2, "a=": 2, "cos": 1, "sin": 1, "length": 2, "_integrate_forces": 1, "state": 12, "get_linear_velocity": 1, "linear": 1, "velocity": 3, "g": 3, "get_total_gravity": 1, "get_step": 1, "d": 2, "1": 5, "get_total_density": 1, "d=": 1, "apply": 1, "gravity": 2, "anim": 4, "up": 13, "normalized": 7, "is": 1, "against": 1, "vv": 6, "dot": 3, "vertical": 1, "hv": 8, "horizontal": 3, "hdir": 8, "hspeed": 15, "floor_velocity": 5, "onfloor": 6, "get_contact_count": 2, "get_contact_local_shape": 1, "continue": 1, "break": 1, "where": 1, "does": 1, "the": 1, "player": 1, "intend": 1, "to": 3, "walk": 2, "cam_xform": 5, "target": 1, "camera": 1, "get_global_transform": 3, "Input": 6, "is_action_pressed": 6, "move_forward": 1, "basis": 6, "2": 3, "move_backwards": 1, "move_left": 1, "move_right": 1, "jump_attempt": 2, "jump": 2, "shoot_attempt": 3, "shoot": 2, "target_dir": 5, "sharp_turn": 2, "rad2deg": 1, "acos": 1, "target_dir.dot": 1, "dir.length": 2, "#linear_dir": 1, "linear_h_velocity/linear_vel": 1, "#if": 1, "linear_vel": 1, "brake_velocity_limit": 1, "linear_dir.dot": 1, "ctarget_dir": 1, "<-cos>": 1, "Math": 1, "deg2rad": 1, "brake_angular_limit": 1, "brake=": 1, "hspeed=": 2, "mesh_xform": 3, "Armature": 4, "get_transform": 1, "facing_mesh=": 1, "facing_mesh": 7, "m3": 2, "Matrix3": 1, "cross": 1, "scaled": 1, "set_transform": 2, "Transform": 1, "origin": 1, "not": 5, "7": 1, "sfx": 2, "play": 2, "hs": 1, "*": 7, "hv.length": 1, "hv.normalized": 1, "jumping=": 1, "pass": 2, "set_linear_velocity": 2, "shoot_blend=": 1, "bullet": 9, "preload": 2, "res": 1, "scn": 1, "instance": 1, "orthonormalized": 1, "get_parent": 1, "add_child": 1, "20": 1, "PS": 1, "body_add_collision_exception": 1, "get_rid": 2, "add": 1, "it": 1, "AnimationTreePlayer": 4, "blend2_node_set_amount": 2, "transition_node_set_current": 1, "gun": 1, "min": 1, "set_angular_velocity": 1, "Initalization": 1, "here": 1, "set_active": 1, "Control": 1, "score": 4, "score_label": 2, "null": 1, "MAX_SHAPES": 2, "block": 3, "block_colors": 3, "Color": 7, "block_shapes": 4, "I": 1, "O": 1, "S": 1, "Z": 1, "L": 1, "J": 1, "T": 1, "block_rotations": 2, "Matrix32": 4, "width": 5, "height": 6, "cells": 8, "piece_active": 7, "piece_shape": 8, "piece_pos": 3, "piece_rot": 5, "piece_cell_xform": 4, "p": 2, "er": 4, "r": 2, "%": 3, ".xform": 1, "_draw": 1, "sb": 2, "get_stylebox": 1, "use": 1, "line": 1, "edit": 1, "bg": 1, "draw_style_box": 1, "get_size": 1, ".grow": 1, "bs": 3, "block.get_size": 1, "draw_texture_rect": 2, "*bs": 2, "c": 6, "piece_check_fit": 6, "ofs": 2, "pos": 4, "pos.x": 2, "pos.y": 2, "new_piece": 3, "randi": 1, "width/2": 1, "piece_pos.y": 2, "#game": 1, "over": 1, "#print": 1, "game_over": 2, "update": 7, "test_collapse_rows": 2, "accum_down": 6, "collapse": 3, "cells.erase": 1, "accum_down*100": 1, "score_label.set_text": 2, "str": 1, ".set_text": 2, "restart_pressed": 1, "cells.clear": 1, "piece_move_down": 2, "piece_rotate": 2, "adv": 2, "_input": 1, "ie": 1, "ie.is_pressed": 1, "ie.is_action": 4, "piece_pos.x": 2, "setup": 2, "w": 3, "h": 3, "set_size": 1, "*block.get_size": 1, ".start": 1, "set_process_input": 1 }, "GLSL": { "#version": 8, "uniform": 17, "sampler2D": 3, "texture": 2, ";": 847, "varying": 10, "vec3": 350, "color": 3, "vec2": 58, "texcoord": 4, "vec4": 151, "GetDiffuse": 2, "(": 914, ")": 914, "{": 174, "diffuse": 8, "color.rgb": 1, "*": 235, "texture2D": 13, "return": 97, "}": 174, "void": 65, "main": 14, "gl_FragData": 1, "[": 184, "]": 184, "mat4": 3, "u_MVPMatrix": 2, "attribute": 2, "a_position": 1, "a_color": 2, "v_color": 4, "gl_Position": 3, "pos": 85, "core": 2, "float": 236, "cbar": 4, "int": 18, "cfoo": 2, "CB": 4, "CD": 4, "CA": 2, "CC": 2, "CBT": 10, "CDT": 6, "CAT": 2, "CCT": 2, "norA": 8, "norB": 6, "norC": 2, "norD": 2, "norE": 8, "norF": 2, "norG": 2, "norH": 2, "norI": 2, "norcA": 4, "norcB": 6, "norcC": 4, "norcD": 4, "//": 28, "head": 2, "of": 2, "cycle": 4, "norcE": 2, "lead": 2, "into": 2, "const": 33, "NUM_LIGHTS": 4, "AMBIENT": 2, "MAX_DIST": 3, "MAX_DIST_SQUARED": 3, "lightColor": 3, "fragmentNormal": 2, "cameraVector": 2, "lightVector": 4, "specular": 3, "normal": 7, "normalize": 25, "cameraDir": 2, "for": 13, "i": 74, "<": 45, "+": 248, "dist": 12, "min": 20, "dot": 58, "/": 48, "distFactor": 3, "-": 220, "lightDir": 3, "diffuseDot": 2, "clamp": 5, "halfAngle": 2, "specularColor": 2, "specularDot": 2, "pow": 5, "sample": 3, "gl_FragColor": 5, "sample.rgb": 1, "sample.a": 1, "kCoeff": 4, "kCube": 4, "uShift": 6, "vShift": 6, "chroma_red": 4, "chroma_green": 4, "chroma_blue": 4, "bool": 2, "apply_disto": 8, "input1": 8, "adsk_input1_w": 8, "adsk_input1_h": 6, "adsk_input1_aspect": 2, "adsk_input1_frameratio": 10, "adsk_result_w": 6, "adsk_result_h": 4, "distortion_f": 6, "r": 28, "f": 34, "r*r": 2, "inverse_f": 4, "lut": 18, "max_r": 4, "sqrt": 12, "incr": 4, "lut_r": 10, "t": 88, "if": 58, ".z": 10, "&&": 20, "mix": 4, ".y": 4, "aberrate": 8, "chroma": 4, "chromaticize_and_invert": 4, "rgb_f": 10, "px": 8, "uv": 24, "gl_FragCoord.xy": 14, "px.x": 4, "px.y": 4, "uv.x": 22, "uv.y": 14, "*2": 4, "uv.x*uv.x": 2, "uv.y*uv.y": 2, "else": 2, "rgb_uvs": 24, "rgb_f.rr": 2, "rgb_f.gg": 2, "rgb_f.bb": 2, "sampled": 2, "sampled.r": 2, ".r": 6, "sampled.g": 2, ".g": 2, "sampled.b": 2, ".b": 2, "gl_FragColor.rgba": 2, "sampled.rgb": 2, "////": 8, "High": 2, "quality": 4, "Some": 2, "browsers": 2, "may": 2, "freeze": 2, "or": 2, "crash": 2, "//#define": 20, "HIGHQUALITY": 4, "Medium": 2, "Should": 2, "be": 2, "fine": 2, "on": 6, "all": 2, "systems": 2, "works": 2, "Intel": 2, "HD2000": 2, "Win7": 2, "but": 2, "quite": 2, "slow": 2, "MEDIUMQUALITY": 4, "Defaults": 2, "REFLECTIONS": 6, "#define": 27, "SHADOWS": 10, "GRASS": 6, "SMALL_WAVES": 8, "RAGGED_LEAVES": 10, "DETAILED_NOISE": 6, "LIGHT_AA": 6, "SSAA": 4, "HEAVY_AA": 4, "2x2": 2, "RG": 2, "TONEMAP": 10, "Configurations": 2, "#ifdef": 28, "#endif": 28, "eps": 10, "PI": 6, "sunDir": 10, "skyCol": 8, "sandCol": 4, "treeCol": 4, "grassCol": 4, "leavesCol": 8, "leavesPos": 8, "sunCol": 10, "#else": 10, "exposure": 2, "Only": 2, "used": 2, "when": 2, "tonemapping": 2, "mod289": 8, "x": 22, "floor": 16, "permute": 8, "x*34.0": 2, "*x": 2, "taylorInvSqrt": 4, "snoise": 14, "v": 16, "C": 2, "1.0/6.0": 2, "1.0/3.0": 2, "D": 2, "C.yyy": 4, "x0": 14, "C.xxx": 4, "g": 4, "step": 4, "x0.yzx": 2, "x0.xyz": 2, "l": 2, "i1": 4, "g.xyz": 4, "l.zxy": 4, "i2": 4, "max": 18, "x1": 8, "x2": 8, "2.0*C.x": 2, "1/3": 2, "C.y": 2, "x3": 8, "D.yyy": 2, "3.0*C.x": 2, "D.y": 2, "p": 52, "i.z": 2, "i1.z": 2, "i2.z": 2, "i.y": 2, "i1.y": 2, "i2.y": 2, "i.x": 2, "i1.x": 2, "i2.x": 2, "n_": 4, "1.0/7.0": 2, "ns": 8, "D.wyz": 2, "D.xzx": 2, "j": 13, "ns.z": 6, "mod": 4, "7*7": 2, "x_": 6, "y_": 4, "N": 2, "*ns.x": 4, "ns.yyyy": 4, "y": 4, "h": 42, "abs": 4, "b0": 6, "x.xy": 2, "y.xy": 2, "b1": 6, "x.zw": 2, "y.zw": 2, "//vec4": 6, "s0": 4, "lessThan": 4, "*2.0": 8, "s1": 4, "sh": 2, "a0": 2, "b0.xzyw": 2, "s0.xzyw*sh.xxyy": 2, "a1": 2, "b1.xzyw": 2, "s1.xzyw*sh.zzww": 2, "p0": 10, "a0.xy": 2, "h.x": 2, "p1": 10, "a0.zw": 2, "h.y": 2, "p2": 10, "a1.xy": 2, "h.z": 2, "p3": 10, "a1.zw": 2, "h.w": 2, "//Normalise": 2, "gradients": 2, "norm": 2, "norm.x": 2, "norm.y": 2, "norm.z": 2, "norm.w": 2, "m": 16, "m*m": 2, "fbm": 4, "final": 10, "waterHeight": 8, "d": 20, "length": 14, "p.xz": 4, "sin": 16, "iGlobalTime": 14, "Island": 2, "waves": 4, "p*0.5": 2, "Other": 2, "bump": 4, "rayDir": 86, "s": 44, "e": 2, "pos.x": 2, "iGlobalTime*0.5": 2, "pos.z": 4, "*0.7": 2, "*s": 6, "e.xyy": 2, "e.yxy": 2, "intersectSphere": 4, "rpos": 10, "rdir": 6, "rad": 4, "op": 10, "b": 10, "det": 22, "b*b": 4, "rad*rad": 4, "rdir*t": 2, "intersectCylinder": 2, "rdir2": 4, "rdir.yz": 2, "op.yz": 6, "rpos.yz": 4, "rdir2*t": 4, "pos.yz": 4, "intersectPlane": 6, "rayPos": 76, "n": 36, "sign": 2, "rotate": 10, "theta": 12, "c": 12, "cos": 8, "p.x": 4, "p.z": 4, "p.y": 2, "impulse": 4, "k": 16, "by": 2, "iq": 2, "k*x": 2, "exp": 4, "grass": 4, "Optimization": 2, "Avoid": 2, "noise": 2, "too": 2, "far": 2, "away": 2, "pos.y": 16, "tree": 4, "pos.y*0.03": 4, "mat2": 4, "m*pos.xy": 2, "width": 4, "scene": 14, "vtree": 8, "vgrass": 4, ".x": 8, "eps.xyy": 2, "eps.yxy": 2, "eps.yyx": 2, "plantsShadow": 4, "rayDir*t": 4, "res": 12, "res.x": 6, "k*res.x/t": 2, "s*s*": 2, "2.0*s": 2, "intersectWater": 4, "rayPos.y": 2, "rayDir.y": 2, "intersectSand": 6, "intersectTreasure": 4, "intersectLeaf": 4, "openAmount": 8, "dir": 4, "offset": 10, "rayDir*res.w": 2, "pos*0.8": 4, "||": 6, "res.w": 12, "res2": 4, "dir.xy": 2, "dir.z": 2, "rayDir*res2.w": 2, "res2.w": 6, "leaves": 8, "1e20": 6, "sway": 10, "fract": 2, "upDownSway": 4, "angleOffset": 6, "alpha": 6, "k*10.0": 2, "p.xzy": 2, ".xzy": 4, "d.xzy": 2, "res.xyz": 2, "shadow": 6, "resSand": 4, "//if": 2, "resSand.w": 8, "resLeaves": 6, "resLeaves.w": 20, "1e7": 6, "light": 8, "sunDir*0.01": 4, "col": 64, "n.y": 6, "lightLeaves": 6, "ao": 10, "sky": 10, "plants": 6, "res.y": 4, "uvFact": 4, "n.x": 2, "tex": 12, "iChannel0": 6, ".rgb": 4, "1e8": 2, "traceReflection": 4, "resPlants": 4, "resPlants.w": 12, "resPlants.xyz": 4, "pos.xz": 4, "leavesPos.xz": 4, "resLeaves.xyz": 4, "trace": 4, "resSand.xyz": 2, "resTreasure": 2, "resTreasure.w": 8, "resTreasure.xyz": 2, "resWater": 2, "resWater.w": 8, "ct": 4, "fresnel": 4, "trans": 4, "reflDir": 6, "reflect": 2, "refl": 6, "resWater.t": 2, "camera": 14, "rd": 2, "iResolution.yy": 2, "iResolution.x/iResolution.y*0.5": 2, "rd.x": 2, "rd.y": 2, "*0.25": 8, "*0.5": 3, "col*exposure": 2, "x*": 4, "6.2*x": 4, ".5": 2, "#extension": 4, "GL_ARB_separate_shader_objects": 2, "enable": 4, "GL_ARB_shading_language_420pack": 2, "struct": 2, "PnPatch": 4, "b210": 3, "b120": 3, "b021": 3, "b012": 3, "b102": 3, "b201": 3, "b111": 3, "n110": 3, "n011": 3, "n101": 3, "layout": 14, "binding": 2, "UBO": 2, "tessLevel": 1, "ubo": 2, "vertices": 1, "out": 6, "location": 10, "in": 6, "inNormal": 8, "inUV": 2, "outNormal": 2, "outUV": 2, "outPatch": 17, "wij": 7, "gl_in": 11, ".gl_Position.xyz": 7, "vij": 4, "Pj_minus_Pi": 4, "Ni_plus_Nj": 2, "2.0*dot": 1, "/dot": 1, "gl_out": 1, "gl_InvocationID": 29, ".gl_Position": 5, "P0": 6, "P1": 6, "P2": 6, "N0": 3, "N1": 3, "N2": 3, ".b210": 5, "2.0*P0": 2, "*N0": 2, "/3.0": 7, ".b120": 5, "2.0*P1": 2, "*N1": 2, ".b021": 5, ".b012": 5, "2.0*P2": 2, "*N2": 2, ".b102": 5, ".b201": 5, "E": 3, "V": 2, ".b111": 4, ".n110": 4, ".n011": 4, ".n101": 4, "gl_TessLevelOuter": 1, "ubo.tessLevel": 2, "gl_TessLevelInner": 1, "projection": 1, "model": 1, "tessAlpha": 1, "triangles": 1, "fractional_odd_spacing": 1, "ccw": 1, "iNormal": 4, "iTexCoord": 1, "iPnPatch": 31, "oNormal": 2, "oTexCoord": 2, "uvw": 4, "gl_TessCoord": 10, "uvwSquared": 3, "uvwCubed": 1, "*iTexCoord": 3, "barNormal": 2, "*iNormal": 3, "pnNormal": 1, "*uvwSquared": 3, "n110*uvw": 1, "*uvw": 11, "n011*uvw": 1, "n101*uvw": 1, "ubo.tessAlpha*pnNormal": 1, "ubo.tessAlpha": 2, "barPos": 1, "*gl_in": 3, "pnPos": 1, ".gl_Position.xyz*uvwCubed": 3, "b210*uvwSquared": 1, "b120*uvwSquared": 1, "b201*uvwSquared": 1, "b021*uvwSquared": 1, "b102*uvwSquared": 1, "b012*uvwSquared": 1, "b111*6.0*uvw": 1, "finalPos": 2, "*barPos": 1, "ubo.tessAlpha*pnPos": 1, "ubo.projection": 1, "ubo.model": 1, "static": 1, "char*": 1, "SimpleFragmentShader": 1, "STRINGIFY": 1, "FrontColor": 2, "gl_Color.rgb": 1, "gl_MultiTexCoord0.st": 1, "ftransform": 1 }, "GN": { "import": 54, "(": 2266, ")": 2262, "group": 34, "{": 1276, "public_deps": 67, "[": 1461, "]": 1461, "}": 1272, "config": 47, "defines": 72, "pkg_config": 2, "packages": 2, "source_set": 5, "deps": 208, "public_configs": 12, "shim_headers": 2, "root_path": 2, "headers": 2, "testonly": 9, "true": 61, "if": 786, "v8_test_isolation_mode": 7, "v8_isolate_run": 6, "isolate": 6, "is_android": 36, "declare_args": 4, "v8_android_log_stdout": 2, "false": 29, "v8_enable_verify_heap": 2, "v8_deprecation_warnings": 2, "v8_imminent_deprecation_warnings": 5, "v8_embed_script": 4, "v8_enable_disassembler": 4, "v8_enable_gdbjit": 5, "v8_enable_handle_zapping": 2, "is_debug": 15, "v8_enable_i18n_support": 10, "v8_enable_slow_dchecks": 2, "v8_interpreted_regexp": 2, "v8_object_print": 4, "v8_postmortem_support": 2, "v8_can_use_fpu_instructions": 3, "v8_use_mips_abi_hardfloat": 3, "defined": 402, "else": 188, "v8_enable_gdbjit_default": 2, "&&": 186, "v8_optimized_debug": 2, "v8_generated_peephole_source": 4, "v8_random_seed": 3, "v8_toolset_for_shell": 4, "#": 291, "visibility": 49, "Only": 19, "targets": 19, "in": 19, "this": 19, "file": 20, "can": 20, "depend": 19, "on": 20, "this.": 19, "include_dirs": 9, "is_component_build": 10, "libs": 9, "current_toolchain": 18, "host_toolchain": 6, "+": 797, "v8_use_external_startup_data": 12, "cflags": 131, "ldflags": 76, "v8_current_cpu": 18, "arm_version": 1, "arm_fpu": 3, "current_cpu": 38, "arm_float_abi": 2, "mips_arch_variant": 10, "mips_fpu_mode": 4, "||": 110, "host_cpu": 2, "is_win": 33, "is_linux": 14, "v8_enable_backtrace": 1, "dcheck_always_on": 3, "action": 48, "script": 50, "inputs": 66, "sources": 122, "outputs": 96, "args": 192, "rebase_path": 266, "root_build_dir": 255, "v8_extra_library_files": 1, "enable_java_templates": 3, "android_assets": 1, "renaming_sources": 1, "renaming_destinations": 3, "disable_compression": 1, "get_label_info": 35, "v8_use_snapshot": 3, "v8_source_set": 14, "configs": 58, "-": 6, "is_posix": 13, "host_os": 2, "is_mac": 20, "for": 2, "rand_s": 1, "v8_snapshot_toolchain": 2, "v8_executable": 8, "want_v8_shell": 3, "v8_component": 1, "template": 61, "name": 7, "target_name": 77, "forward_variables_from": 129, "invoker": 127, "v8_fuzzer": 5, "treat_warnings_as_errors": 4, "android_full_debug": 2, "linux_use_bundled_binutils": 5, "binutils_path": 1, "gold_path": 4, "msvs_xtree_patched": 2, "exclude_unwind_tables": 2, "is_chrome_branded": 1, "is_official_build": 7, "gdb_index": 2, "optimize_for_size": 3, "is_ios": 14, "fatal_linker_warnings": 2, "auto_profile_path": 2, "optimize_for_fuzzing": 5, "is_clang": 39, "is_nacl": 24, "update_args": 3, "llvm_force_head_revision": 1, "clang_revision": 1, "exec_script": 5, "use_gold": 4, "use_debug_fission": 4, "cc_wrapper": 2, "root_gen_dir": 1, "asmflags": 9, "cflags_c": 3, "cflags_cc": 18, "cflags_objc": 4, "cflags_objcc": 5, "See": 1, "http": 4, "//crbug.com/32204": 1, "is_chromeos": 7, "use_order_profiling": 2, "enable_profiling": 4, "Use": 1, "pipes": 1, "communicating": 1, "between": 1, "sub": 1, "processes.": 1, "Faster.": 1, "using_sanitizer": 4, "use_cfi_diag": 2, "_rebased_android_toolchain_root": 1, "android_toolchain_root": 1, "use_lld": 6, "#if": 1, "is_asan": 5, "is_lsan": 1, "is_tsan": 2, "is_msan": 2, "absolute_path": 1, "allow_posix_link_time_opt": 1, "is_cfi": 2, "use_thin_lto": 1, "arm_tune": 1, "mips_use_msa": 2, "mips_float_abi": 1, "mips_dsp_rev": 2, "is_nacl_nonsfi": 1, "target_cpu": 5, "arm_use_thumb": 1, "Unreferenced": 2, "formal": 1, "function": 5, "parameter.": 1, "Alignment": 1, "of": 3, "a": 1, "member": 1, "was": 2, "sensitive": 1, "to": 4, "packing.": 1, "Conversion": 1, "possible": 1, "loss": 1, "data.": 2, "local": 1, "has": 1, "been": 1, "removed.": 1, "Default": 2, "constructor": 2, "could": 2, "not": 3, "be": 4, "generated.": 2, "Assignment": 1, "operator": 1, "Class": 1, "never": 1, "instantiated": 1, "required.": 1, "Narrowing": 1, "conversion.": 1, "Doesn": 1, "marked": 1, "as": 17, "#pragma": 1, "deprecated": 1, "Deprecated": 2, "warning.": 2, "Unreachable": 1, "code.": 2, "//crbug.com/505296": 1, "//crbug.com/505314": 1, "//crbug.com/550065": 1, "Unused": 1, "parameters.": 1, "use_xcode_clang": 2, "Warning": 2, "level": 2, "Disable": 4, "warning": 1, "when": 2, "forcing": 1, "value": 1, "bool.": 1, "TODO": 1, "jschuh": 1, "size_t": 1, "int.": 1, "is_ubsan_vptr": 1, "is_ubsan_security": 1, "common_optimize_on_cflags": 19, "Both": 1, "explicit": 1, "and": 2, "auto": 1, "inlining.": 1, "omitting": 1, "frame": 1, "pointers": 1, "must": 1, "after": 1, "/O2.": 1, "Improve": 1, "debugging": 1, "optimized": 1, "Remove": 2, "unreferenced": 2, "COMDAT": 2, "faster": 1, "links": 1, ".": 5, "common_optimize_on_ldflags": 15, "Redundant": 1, "folding.": 1, "use_incremental_wpo": 2, "Link": 2, "time": 2, "code": 1, "generation.": 1, "full_wpo_on_official": 2, "arflags": 2, "symbol_level": 4, "Whole": 3, "program": 4, "optimization.": 4, "all": 1, "inlining": 1, "by": 1, "default": 1, "is_nacl_irt": 3, "optimization": 2, "whole": 1, "assert": 111, "default_toolchain": 11, "Produce": 1, "PDB": 1, "no": 1, "edit": 1, "continue.": 1, "is_win_fastlink": 1, "enable_dsyms": 2, "common_flags": 3, "toolchain": 2, "invoker.ar": 2, "invoker.cc": 2, "invoker.cxx": 2, "invoker.ld": 2, "invoker.rebuild_define": 2, "rebuild_string": 2, "invoker.toolchain_args": 4, "invoker_toolchain_args": 2, "toolchain_args": 2, "toolchain_args.use_goma": 2, "toolchain_uses_goma": 3, "use_goma": 1, "toolchain_args.cc_wrapper": 2, "toolchain_cc_wrapper": 5, "compiler_prefix": 5, "cc": 2, "cxx": 3, "ar": 2, "ld": 2, "invoker.readelf": 2, "readelf": 4, "invoker.nm": 2, "nm": 4, "invoker.shlib_extension": 2, "default_shlib_extension": 4, "shlib_extension": 1, "invoker.executable_extension": 2, "default_executable_extension": 3, "invoker.libs_section_prefix": 2, "libs_section_prefix": 2, "invoker.libs_section_postfix": 2, "libs_section_postfix": 2, "solink_libs_section_prefix": 2, "solink_libs_section_postfix": 2, "invoker.extra_cflags": 3, "extra_cflags": 2, "invoker.extra_cppflags": 3, "extra_cppflags": 2, "invoker.extra_cxxflags": 3, "extra_cxxflags": 2, "invoker.extra_ldflags": 3, "extra_ldflags": 2, "lib_switch": 1, "lib_dir_switch": 1, "object_subdir": 1, "tool": 9, "depfile": 61, "command": 13, "depsformat": 3, "description": 9, "compile_wrapper": 2, "rspfile": 4, "whitelist_flag": 4, "ar_wrapper": 1, "rspfile_content": 4, "default_output_dir": 6, "default_output_extension": 5, "output_prefix": 3, "soname": 2, "e.g.": 3, "sofile": 12, "Possibly": 1, "including": 1, "dir.": 1, "pool": 3, "whitelist_file": 2, "invoker.strip": 6, "unstripped_sofile": 8, "tocfile": 3, "link_command": 1, "strip_switch": 2, "solink_wrapper": 1, "shlib_subdir": 2, "restat": 1, "link_output": 1, "depend_output": 1, "strip_command": 2, "exename": 1, "outfile": 4, "unstripped_outfile": 4, "link_wrapper": 1, "invoker.link_outputs": 2, "stamp_command": 1, "stamp_description": 1, "copy_command": 1, "copy_description": 1, "invoker.toolprefix": 2, "toolprefix": 2, "gcc_toolchain": 1, "prefix": 1, "clang_use_chrome_plugins": 1, "clang_base_path": 1, "_libraries_list": 5, "_find_deps_target_name": 2, "invoker.binary": 4, "android_readelf": 3, "rebased_binaries": 1, "root_shlib_dir": 1, "copy_ex": 1, "clear_dir": 1, "dest": 1, "invoker.dist_dir": 1, "data": 6, "_rebased_libraries_list": 1, "_rebased_binaries_list": 1, "invoker.extra_files": 2, "_rebased_extra_files": 1, "invoker.deps": 53, "_name": 1, "get_path_info": 11, "invoker.target": 3, "_output": 3, "root_out_dir": 3, "invoker.flag_name": 1, "set_sources_assignment_filter": 46, "invoker.sources": 14, "invoker.jni_package": 4, "jni_package": 2, "base_output_dir": 4, "package_output_dir": 2, "jni_output_dir": 6, "jni_generator_include": 4, "foreach_target_name": 2, "action_foreach": 2, "invoker.classes": 2, "invoker.jar_file": 2, "jar_file": 4, "android_sdk_jar": 6, "jni_actions": 3, "foreach": 22, "class": 3, "_classname_list": 3, "process_file_template": 4, "classname": 1, "jni_target_name": 2, "check_includes": 2, "_include_path": 3, "invoker.include_path": 2, "_apply_gcc_target_name": 2, "_base_gen_dir": 2, "invoker.inputs": 4, "invoker.defines": 2, "def": 2, "get_target_outputs": 12, "zip": 3, "output": 9, "base_dir": 4, "_srcjar_path": 3, "_rebased_srcjar_path": 1, "_rebased_sources": 2, "invoker.input": 3, "invoker.output": 9, "invoker.variables": 4, "variables": 3, "invoker.resources": 3, "invoker.res_dir": 2, "_base_path": 11, "_resources_zip": 10, "_build_config": 40, "write_build_config": 10, "build_config": 28, "resources_zip": 8, "type": 33, "possible_config_deps": 9, "rebased_resources": 1, "invoker.resource_dirs": 10, "base_path": 13, "zip_path": 6, "srcjar_path": 12, "r_text_path": 6, "build_config_target_name": 8, "process_resources_target_name": 2, "final_target_name": 4, "resource_dirs": 6, "invoker.generated_resource_dirs": 4, "invoker.android_manifest_dep": 6, "custom_package": 1, "android_manifest": 17, "r_text": 1, "srcjar": 1, "process_resources": 2, "shared_resources": 1, "_build_config_target_name": 4, "asset_sources": 1, "invoker.renaming_sources": 6, "invoker.renaming_destinations": 5, "_source_count": 3, "_": 2, "_dest_count": 3, "asset_renaming_sources": 1, "asset_renaming_destinations": 1, "extra_output_path": 1, "grit_target_name": 2, "grit_output_dir": 3, "grit": 1, "grit_flags": 1, "output_dir": 4, "resource_ids": 1, "source": 2, "invoker.grd_file": 1, "invoker.outputs": 1, "generate_strings_outputs": 2, "zip_target_name": 2, "invoker.grit_output_dir": 1, "invoker.generated_files": 1, "java_library_impl": 4, "supports_android": 15, "main_class": 2, "invoker.main_class": 8, "is_java_binary": 1, "_java_binary_target_name": 2, "_test_runner_target_name": 4, "test_runner_script": 3, "test_name": 3, "invoker.target_name": 5, "test_suite": 1, "test_type": 3, "ignore_all_data_deps": 1, "java_binary": 1, "output_name": 13, "bypass_platform_checks": 2, "wrapper_script_name": 1, "java_prebuilt_impl": 2, "invoker.jar_path": 15, "requires_android": 13, "jar_excluded_patterns": 3, "deps_dex": 1, "strip_resource_classes": 1, "invoker.final_apk_path": 3, "invoker.apk_name": 5, "invoker.android_manifest": 14, "gen_dir": 1, "resources_zip_path": 3, "_all_resources_zip_path": 3, "_jar_path": 21, "_lib_dex_path": 4, "_rebased_lib_dex_path": 1, "_template_name": 6, "enable_multidex": 5, "invoker.enable_multidex": 4, "final_dex_path": 5, "final_dex_target_name": 1, "_final_apk_path": 10, "_final_apk_path_no_ext_list": 2, "_final_apk_path_no_ext": 3, "Mark": 17, "used.": 17, "_install_script_name": 4, "invoker.install_script_name": 2, "_incremental_install_script_path": 4, "_version_code": 7, "android_default_version_code": 1, "invoker.version_code": 5, "_version_name": 7, "android_default_version_name": 1, "invoker.version_name": 5, "_keystore_path": 8, "android_keystore_path": 1, "_keystore_name": 8, "android_keystore_name": 1, "_keystore_password": 8, "android_keystore_password": 1, "invoker.keystore_path": 5, "invoker.keystore_name": 3, "invoker.keystore_password": 3, "_srcjar_deps": 15, "invoker.srcjar_deps": 9, "_use_chromium_linker": 6, "invoker.use_chromium_linker": 2, "_enable_relocation_packing": 3, "_load_library_from_apk": 8, "invoker.load_library_from_apk": 3, "_requires_sdk_api_level_23": 4, "_native_libs_deps": 15, "_shared_libraries_is_valid": 3, "invoker.shared_libraries": 3, "_secondary_abi_native_libs_deps": 10, "mark": 1, "_runtime_deps_file": 7, "write_runtime_deps": 3, "_native_lib_version_rule": 4, "invoker.native_lib_version_rule": 2, "_native_lib_version_arg": 2, "invoker.native_lib_version_arg": 2, "_secondary_abi_runtime_deps_file": 3, "_bad_deps": 1, "_android_manifest_deps": 8, "_android_manifest": 18, "_rebased_build_config": 9, "_create_abi_split": 5, "invoker.create_abi_split": 2, "_create_density_splits": 3, "invoker.create_density_splits": 4, "_create_language_splits": 2, "invoker.language_splits": 4, "_proguard_enabled": 8, "invoker.proguard_enabled": 8, "_proguard_output_jar_path": 3, "_emma_never_instrument": 9, "invoker.testonly": 2, "build_config_target": 2, "jar_path": 12, "dex_path": 7, "apk_path": 3, "incremental_apk_path": 1, "incremental_install_script_path": 1, "emma_coverage": 7, "proguard_enabled": 1, "proguard_info": 1, "_final_deps": 9, "_generated_proguard_config": 3, "process_resources_target": 2, "all_resources_zip_path": 1, "generate_constant_ids": 1, "proguard_file": 1, "_enable_chromium_linker_tests": 3, "_ordered_libraries_json": 4, "_rebased_ordered_libraries_json": 1, "_ordered_libraries_target": 2, "_rebased_android_readelf": 1, "java_cpp_template": 2, "package_name": 2, "invoker.apk_under_test": 15, "is_java_debug": 2, "java_target": 2, "override_build_config": 1, "srcjar_deps": 3, "emma_never_instrument": 1, "invoker.dist_ijar_path": 2, "_dist_ijar_path": 6, "Generates": 2, "the": 3, "build": 2, "file.": 2, "jar": 1, "_proguard_configs": 5, "invoker.proguard_configs": 6, "_proguard_target": 4, "proguard": 2, "output_jar_path": 5, "_rebased_proguard_configs": 3, "_apk_under_test_build_config": 4, "_dex_sources": 4, "_dex_deps": 3, "_copy_proguard_mapping_target": 2, "copy": 3, "dex": 4, "_dex_arg_key": 3, "_native_libs_file_arg_dep": 5, "_native_libs_file_arg": 5, "_prepare_native_target_name": 4, "_native_libs_json": 6, "_rebased_native_libs_json": 2, "pack_relocation_section": 2, "file_list_json": 2, "libraries_filearg": 2, "_extra_native_libs": 6, "_extra_native_libs_deps": 5, "android_gdbserver": 1, "invoker.loadable_modules": 3, "create_apk": 2, "assets_build_config": 1, "load_library_from_apk": 2, "create_density_splits": 1, "emma_instrument": 2, "extensions_to_not_compress": 2, "version_code": 2, "version_name": 2, "keystore_name": 5, "keystore_path": 5, "keystore_password": 5, "incremental_deps": 3, "native_libs_filearg": 2, "native_libs": 4, "_manifest_rule": 2, "generate_split_manifest": 1, "main_manifest": 1, "out_manifest": 1, "split_name": 1, "_apk_rule": 2, "manifest_outputs": 2, "_rebased_apk_path_no_ext": 1, "_rebased_depfile": 3, "_rebased_extra_native_libs": 1, "data_deps": 19, "_apk_target_name": 2, "apk_target": 2, "test_jar": 2, "incremental_install": 1, "android_apk": 2, "install_script_name": 1, "invoker.additional_apks": 4, "proguard_configs": 5, "dist_ijar_path": 1, "invoker.run_findbugs_override": 4, "run_findbugs_override": 1, "invoker.java_files": 15, "_use_native_activity": 2, "invoker.use_native_activity": 2, "invoker.shared_library": 4, "jinja_template": 1, "_native_library_name": 1, "input": 1, "apk_name": 2, "android_manifest_dep": 2, "final_apk_path": 1, "use_default_launcher": 2, "shared_libraries": 1, "aidl_path": 3, "framework_aidl": 2, "imports": 4, "invoker.interface_file": 3, "rebased_imports": 1, "invoker.import_include": 4, "rebased_import_includes": 1, "_java_files_build_rel": 2, "_java_files": 12, "_protoc_dep": 3, "_protoc_out_dir": 1, "_protoc_bin": 2, "_proto_path": 2, "invoker.proto_path": 1, "android_library": 1, "chromium_code": 2, "java_files": 3, "_output_path": 5, "_unpack_target_name": 2, "_ignore_aidl": 2, "invoker.ignore_aidl": 2, "_ignore_assets": 2, "invoker.ignore_assets": 2, "_ignore_manifest": 2, "invoker.ignore_manifest": 2, "_ignore_native_libraries": 2, "invoker.ignore_native_libraries": 2, "_scanned_files": 1, "invoker.aar_path": 3, "_scanned_files.aidl": 1, "_scanned_files.assets": 1, "_scanned_files.is_manifest_empty": 1, "_scanned_files.has_classes_jar": 3, "_scanned_files.subjars": 2, "Unzips": 1, "AAR": 1, "_scanned_files.resources": 4, "_res_target_name": 3, "android_resources": 1, "generated_resource_dirs": 1, "generated_resource_files": 1, "v14_skip": 1, "_subjar_targets": 3, "_tuple": 1, "_scanned_files.subjar_tuples": 1, "_current_target": 2, "java_prebuilt": 2, "_base_output_name": 1, "_jar_target_name": 3, "java_group": 1, "_java_target_whitelist": 3, "java_test_support": 1, "_java_target_blacklist": 3, "invoker.type": 1, "_is_prebuilt_binary": 2, "invoker.is_prebuilt_binary": 2, "_parent_invoker": 1, "invoker.invoker": 1, "_target_label": 6, "invoker.build_config": 11, "_deps_configs": 3, "invoker.possible_config_deps": 2, "_possible_dep": 4, "_dep_gen_dir": 3, "_dep_name": 3, "_rebased_deps_configs": 1, "is_java": 6, "is_apk": 9, "is_android_assets": 4, "is_android_resources": 6, "is_deps_dex": 5, "is_group": 3, "invoker.supports_android": 12, "invoker.requires_android": 8, "invoker.dex_path": 10, "invoker.bypass_platform_checks": 4, "apk_under_test_gen_dir": 1, "apk_under_test_name": 1, "apk_under_test_config": 2, "invoker.asset_sources": 2, "_rebased_asset_sources": 1, "invoker.asset_renaming_sources": 2, "_rebased_asset_renaming_sources": 1, "invoker.disable_compression": 2, "invoker.resources_zip": 4, "invoker.custom_package": 4, "invoker.r_text": 2, "invoker.proguard_info": 1, "invoker.apk_path": 3, "_rebased_apk_path": 1, "_rebased_incremental_apk_path": 1, "invoker.incremental_apk_path": 1, "invoker.java_sources_file": 7, "invoker.srcjar": 2, "invoker.bundled_srcjars": 2, "_rebased_bundled_srcjars": 1, "invoker.input_jars_paths": 2, "_rebased_input_jars_paths": 1, "invoker.gradle_treat_as_prebuilt": 2, "_msg": 1, "_stamp_file": 3, "invoker.dest": 1, "rebased_sources": 1, "invoker.clear_dir": 2, "invoker.args": 10, "rebased_renaming_sources": 1, "_test_name": 1, "invoker.test_name": 1, "_test_type": 6, "invoker.test_type": 1, "_incremental_install": 4, "invoker.incremental_install": 2, "_runtime_deps": 3, "invoker.ignore_all_data_deps": 2, "_target_dir_name": 2, "_runtime_deps_target": 2, "test_runner_args": 15, "invoker.apk_target": 3, "invoker.executable_dist_dir": 3, "_apk_build_config": 2, "_rebased_apk_build_config": 2, "invoker.test_suite": 4, "_test_apk": 2, "invoker.test_jar": 1, "_apk_under_test": 2, "additional_apk": 3, "invoker.shard_timeout": 1, "generated_script": 4, "android_test_runner_script": 2, "rebased_android_sdk": 1, "android_sdk": 1, "rebased_android_sdk_build_tools": 3, "android_sdk_build_tools": 1, "rebased_android_sdk_jar": 4, "android_default_aapt_path": 3, "android_configuration_name": 2, "lint_suppressions_file": 3, "_cache_dir": 2, "_result_path": 6, "_config_path": 3, "_suppressions_file": 3, "_platform_xml_path": 3, "_rebased_lint_android_sdk_root": 1, "lint_android_sdk_root": 1, "invoker.create_cache": 2, "_rebased_java_sources_file": 2, "invoker.proguard_jar_path": 3, "_proguard_jar_path": 4, "_output_jar_path": 5, "invoker.output_jar_path": 4, "_rebased_android_sdk_jar": 9, "proguard_verbose": 1, "_exclusions_file": 3, "findbugs_verbose": 1, "_main_class": 2, "_script_name": 1, "invoker.script_name": 1, "java_script": 3, "invoker.wrapper_script_args": 2, "invoker.bootclasspath": 2, "_enable_multidex": 3, "_main_dex_list_path": 5, "_main_dex_list_target_name": 2, "main_dex_rules": 3, "rebased_output": 2, "enable_incremental_dx": 1, "_input_jar_path": 2, "invoker.input_jar_path": 3, "_jar_excluded_patterns": 3, "invoker.jar_excluded_patterns": 2, "_strip_resource_classes": 3, "invoker.strip_resource_classes": 2, "_filter_jar": 2, "_proguard_preprocess": 2, "invoker.proguard_preprocess": 6, "_enable_assert": 2, "_retrolambda": 2, "use_java8": 2, "_deps": 24, "_previous_output_jar": 10, "_filter_target": 2, "_filter_input_jar": 3, "_filter_output_jar": 4, "invoker.public_deps": 10, "_proguard_input_jar": 3, "_proguard_output_jar": 3, "_proguard_config_path": 3, "_rebased_input_paths": 1, "_assert_target": 2, "_assert_input_jar": 3, "_assert_output_jar": 4, "_retrolambda_target": 2, "_retrolambda_input_jar": 3, "_retrolambda_output_jar": 4, "_output_jar_target": 2, "_coverage_file": 3, "_source_dirs_listing_file": 3, "_emma_jar": 3, "emma_filter": 2, "_native_lib_placeholders": 4, "invoker.native_lib_placeholders": 2, "Used": 1, "deploying": 1, "APKs": 1, "invoker.native_libs": 6, "invoker.output_apk_path": 5, "_rebased_packaged_apk_path": 1, "invoker.assets_build_config": 3, "invoker.write_asset_list": 2, "_rebased_dex_path": 1, "invoker.native_libs_filearg": 3, "_rebased_native_libs": 1, "android_app_secondary_abi": 2, "invoker.secondary_native_libs": 4, "_secondary_native_libs": 1, "invoker.emma_instrument": 4, "_emma_device_jar": 2, "_rebased_emma_device_jar": 1, "invoker.input_apk_path": 2, "zipalign_path": 1, "invoker.rezip_apk": 2, "_rezip_jar_path": 2, "invoker.base_path": 1, "_incremental_final_apk_path": 2, "_dex_path": 11, "_incremental_deps": 5, "invoker.incremental_deps": 2, "_native_libs": 4, "_base_apk_path": 5, "_resource_packaged_apk_path": 3, "_packaged_apk_path": 3, "_incremental_packaged_apk_path": 3, "_shared_resources": 4, "invoker.shared_resources": 4, "_app_as_shared_lib": 4, "invoker.app_as_shared_lib": 4, "_split_densities": 5, "_split_languages": 5, "invoker.android_aapt_path": 4, "_android_aapt_path": 6, "_density": 1, "_language": 1, "_package_resources_target_name": 2, "package_resources_helper": 2, "resource_packaged_apk_path": 4, "_incremental_android_manifest": 4, "_rebased_src_manifest": 1, "_rebased_incremental_manifest": 1, "package_target": 2, "package_apk": 2, "output_apk_path": 5, "_incremental_package_target": 2, "_dex_target": 3, "_has_native_libs": 2, "native_lib_placeholders": 1, "_finalize_apk_rule_name": 2, "finalize_apk": 3, "input_apk_path": 3, "rezip_apk": 1, "_split_deps": 5, "_config": 3, "invoker.split_config": 1, "_type": 1, "invoker.split_type": 1, "_output_paths": 2, "_split": 4, "_split_rule": 4, "finalize_split": 2, "split_type": 2, "split_config": 2, "_supports_android": 19, "invoker.output_name": 14, "_output_name": 28, "_ijar_path": 2, "_jar_deps": 5, "invoker.jar_dep": 2, "_process_jar_target_name": 2, "_ijar_target_name": 4, "_dex_target_name": 2, "is_prebuilt_binary": 1, "process_java_prebuilt": 2, "input_jar_path": 3, "generate_interface_jar": 2, "input_jar": 4, "output_jar": 2, "_binary_script_target_name": 2, "java_binary_script": 2, "script_name": 4, "invoker.wrapper_script_name": 4, "_chromium_code": 11, "invoker.chromium_code": 4, "_requires_android": 6, "_enable_errorprone": 4, "use_errorprone_java_compiler": 1, "invoker.enable_errorprone": 2, "_provider_configurations": 3, "invoker.provider_configurations": 2, "_processors": 4, "_enable_interface_jars_javac": 3, "invoker.processors_javac": 2, "_processor_args": 3, "invoker.processor_args_javac": 2, "_additional_jar_files": 3, "invoker.additional_jar_files": 2, "_enable_incremental_javac": 3, "enable_incremental_javac": 1, "_manifest_entries": 3, "invoker.manifest_entries": 2, "_java_srcjars": 5, "invoker.srcjars": 5, "dep": 3, "_javac_target_name": 2, "_process_prebuilt_target_name": 2, "_final_target_name": 2, "_final_jar_path": 5, "_javac_jar_path": 6, "_process_prebuilt_jar_path": 5, "_final_ijar_path": 2, "_emma_instrument": 6, "_emma_instr_target_name": 2, "_rebased_jar_path": 1, "_rebased_java_srcjars": 1, "_android_sdk_ijar": 4, "_rebased_android_sdk_ijar": 1, "e": 8, "file_tuple": 4, "emma_instr": 1, "_accumulated_deps": 9, "target_dir_name": 1, "_run_findbugs": 5, "run_findbugs": 1, "arg": 1, "overridden.": 1, "invoker.emma_never_instrument": 2, "used": 1, "_java_sources_file": 5, "write_file": 1, "invoker.override_build_config": 2, "invoker.is_java_binary": 2, "java_sources_file": 3, "bundled_srcjars": 2, "d": 3, "_srcjars": 4, "_compile_java_target": 2, "compile_java": 1, "srcjars": 1, "_has_lint_target": 3, "android_lint": 1, "findbugs": 1, "invoker.zip_path": 1, "invoker.srcjar_path": 1, "invoker.r_text_path": 1, "non_constant_id": 3, "invoker.generate_constant_ids": 2, "_all_resource_dirs": 4, "_sources_build_rel": 2, "invoker.generated_resource_files": 2, "_rebased_all_resource_dirs": 1, "rebase_build_config": 1, "invoker.v14_skip": 2, "invoker.include_all_resources": 2, "invoker.all_resources_zip_path": 2, "all_resources_zip": 3, "invoker.proguard_file": 3, "rebased_build_config": 1, "dex_arg_key": 1, "invoker.excluded_jars": 2, "excluded_jars": 1, "invoker.main_manifest": 3, "invoker.out_manifest": 3, "invoker.split_name": 2, "invoker.has_code": 2, "invoker.file_list_json": 3, "invoker.libraries_filearg": 1, "_packed_libraries_dir": 2, "relocation_packer_target": 1, "relocation_packer_exe": 1, "buildconfig": 1, "secondary_source": 1, "check_targets": 1, "exec_script_whitelist": 1, "invoker.isolate": 3, "asan": 2, "msan": 2, "tsan": 2, "cfi_vptr": 2, "target_arch": 2, "configuration_name": 2, "component": 2, "icu_use_data_file": 1, "icu_use_data_file_flag": 2, "v8_enable_inspector": 1, "enable_inspector": 2, "use_external_startup_data": 2, "use_snapshot": 2, "v8_has_valgrind": 1, "has_valgrind": 2, "v8_gcmole": 1, "gcmole": 2, "invoker.arch_binary_target": 2, "_target_name": 36, "_all_target_cpu": 2, "additional_target_cpus": 1, "_all_toolchains": 2, "additional_toolchains": 1, "_arch_binary_target": 2, "_arch_binary_output": 2, "invoker.arch_binary_output": 2, "_index": 4, "_cpu": 1, "_toolchain": 1, "use_system_xcode": 3, "hermetic_xcode_path": 3, "_dsyms_output_dir": 1, "enable_stripping": 1, "_strip_all_in_config": 3, "invoker.configs": 2, "save_unstripped_output": 1, "invoker.product_type": 1, "invoker.bundle_extension": 2, "invoker.bundle_binary_target": 2, "_bundle_binary_target": 4, "_bundle_binary_output": 2, "invoker.bundle_binary_output": 2, "_bundle_extension": 1, "_bundle_root_dir": 4, "invoker.entitlements_target": 8, "_entitlements_path": 10, "invoker.entitlements_path": 6, "_entitlements_target_outputs": 4, "_enable_code_signing": 4, "ios_enable_code_signing": 1, "invoker.enable_code_signing": 2, "create_bundle": 1, "bundle_root_dir": 2, "bundle_resources_dir": 1, "bundle_executable_dir": 1, "bundle_plugins_dir": 1, "invoker.bundle_deps": 4, "code_signing_script": 1, "code_signing_sources": 1, "code_signing_outputs": 4, "ios_code_signing_identity": 2, "use_ios_simulator": 4, "invoker.extra_system_frameworks": 4, "_framework": 4, "code_signing_args": 5, "ios_sdk_name": 1, "invoker.info_plist": 4, "invoker.info_plist_target": 5, "_info_plist": 3, "_info_plist_target_output": 2, "info_plist": 3, "format": 2, "extra_substitutions": 4, "invoker.extra_substitutions": 2, "plist_templates": 1, "_arch_executable_source": 2, "_arch_executable_target": 2, "_lipo_executable_target": 2, "_generate_entitlements_target": 2, "_generate_entitlements_output": 4, "executable": 1, "output_prefix_override": 3, "lipo_binary": 3, "arch_binary_target": 3, "arch_binary_output": 3, "_generate_info_plist": 2, "ios_info_plist": 3, "executable_name": 3, "_gen_info_plist_outputs": 2, "_info_plist_path": 3, "_bundle_data_info_plist": 2, "bundle_data": 7, "create_signed_bundle": 3, "bundle_binary_target": 3, "bundle_binary_output": 3, "bundle_deps": 6, "product_type": 5, "bundle_extension": 5, "set_defaults": 4, "default_executable_configs": 3, "ios_app_bundle": 2, "invoker.source": 7, "_source_extension": 5, "_compile_xib": 2, "compile_xibs": 1, "ibtool_flags": 1, "ios_deployment_target": 1, "_convert_target": 2, "convert_plist": 1, "_has_public_headers": 5, "invoker.public_headers": 3, "_framework_headers_target": 2, "_framework_headers_config": 2, "_headers_map_config": 2, "_arch_shared_library_source": 2, "_arch_shared_library_target": 2, "_lipo_shared_library_target": 2, "shared_library": 1, "output_extension": 2, "_public_headers": 2, "_framework_root": 2, "_header_map_filename": 4, "_compile_headers_map_target": 2, "_create_module_map_target": 2, "_copy_public_headers_target": 2, "_framework_public_config": 2, "lib_dirs": 1, "_info_plist_target": 2, "_info_plist_bundle": 2, "default_shared_library_configs": 1, "_xctest_target": 8, "_xctest_output": 6, "_host_target": 2, "_host_output": 3, "loadable_module": 1, "_xctest_info_plist_target": 2, "_xctest_info_plist_bundle": 2, "_xctest_bundle": 2, "_ios_platform_library": 1, "extra_system_frameworks": 1 }, "Game Maker Language": { "#define": 83, "__http_init": 3, "global.__HttpClient": 4, "object_add": 1, "(": 2477, ")": 2459, ";": 2242, "object_set_persistent": 1, "true": 131, "__http_split": 3, "var": 156, "text": 11, "delimeter": 7, "limit": 4, "argument0": 148, "argument1": 46, "argument2": 12, "list": 90, "count": 4, "ds_list_create": 11, "while": 9, "string_pos": 26, "{": 488, "ds_list_add": 26, "string_copy": 41, "-": 438, "+": 380, "string_length": 37, "if": 465, "and": 225, "break": 146, "}": 501, "return": 152, "__http_parse_url": 4, "url": 57, "map": 91, "ds_map_create": 8, "ds_map_add": 47, "colonPos": 22, "string_char_at": 46, "slashPos": 13, "else": 174, "real": 31, "queryPos": 12, "ds_map_destroy": 14, "__http_resolve_url": 2, "baseUrl": 3, "refUrl": 18, "urlParts": 15, "refUrlParts": 5, "canParseRefUrl": 3, "result": 29, "ds_map_find_value": 24, "or": 89, "__http_resolve_path": 3, "ds_map_replace": 3, "ds_map_exists": 20, "ds_map_delete": 8, "path": 10, "query": 6, "relUrl": 1, "__http_construct_url": 2, "basePath": 4, "refPath": 7, "parts": 29, "refParts": 5, "lastPart": 3, "ds_list_find_value": 13, "ds_list_size": 17, "ds_list_delete": 5, "i": 323, "for": 79, "<": 59, "ds_list_destroy": 12, "part": 6, "ds_list_replace": 2, "continue": 4, "__http_parse_hex": 2, "hexString": 4, "hexValues": 3, "*": 20, "digit": 10, "string": 91, "__http_prepare_request": 4, "client": 33, "headers": 10, "parsed": 18, "show_error": 47, "with": 40, "destroyed": 3, "false": 97, "CR": 7, "chr": 16, "LF": 3, "CRLF": 12, "socket": 19, "tcp_connect": 1, "state": 118, "errored": 19, "error": 22, "linebuf": 33, "line": 12, "statusCode": 6, "reasonPhrase": 2, "responseBody": 19, "buffer_create": 2, "responseBodySize": 5, "responseBodyProgress": 5, "responseHeaders": 9, "requestUrl": 2, "requestHeaders": 2, "write_string": 8, "key": 51, "ds_map_find_first": 6, "is_string": 12, "ds_map_find_next": 6, "socket_send": 1, "__http_parse_header": 3, "ord": 5, "headerValue": 9, "string_lower": 4, "headerName": 4, "__http_client_step": 2, "exit": 4, "socket_has_error": 1, "socket_error": 1, "__http_client_destroy": 20, "available": 7, "tcp_receive_available": 1, "switch": 44, "case": 264, "&&": 16, "tcp_eof": 2, "bytesRead": 6, "c": 124, "read_string": 7, "httpVer": 2, "spacePos": 11, "write_buffer_part": 2, "write_buffer": 1, "actualResponseBody": 8, "actualResponseSize": 1, "actualResponseBodySize": 3, "buffer_bytes_left": 6, "chunkSize": 11, "buffer_destroy": 6, "responseHaders": 1, "location": 4, "resolved": 5, "socket_destroy": 1, "http_new_get": 1, "variable_global_exists": 2, "instance_create": 10, "http_new_get_ex": 1, "http_step": 1, "client.errored": 3, "||": 11, "client.state": 3, "http_status_code": 1, "client.statusCode": 1, "http_reason_phrase": 1, "client.error": 1, "client.reasonPhrase": 1, "http_response_body": 1, "client.responseBody": 1, "http_response_body_size": 1, "client.responseBodySize": 1, "http_response_body_progress": 1, "client.responseBodyProgress": 1, "http_response_headers": 1, "client.responseHeaders": 1, "http_destroy": 1, "instance_destroy": 2, "draw_menu": 1, "///draw_menu": 2, "str": 55, "background": 10, "foreground": 8, "x": 83, "y": 94, "hpadding": 8, "vpadding": 12, "height": 24, "mouse_button": 2, "//Distributed": 2, "under": 2, "the": 132, "MIT": 2, "licence": 2, "//Height": 2, "is": 30, "of": 44, "box": 2, "//Menu": 2, "syntax": 2, "xx": 28, "yy": 34, "width": 22, "//A": 2, "hacky": 4, "thing": 2, "so": 7, "that": 16, "it": 26, "draws": 2, "first": 14, "item": 9, "properly": 4, "I": 9, "should": 17, "probably": 2, "fix": 2, "this": 14, "later": 2, "argument3": 4, "argument4": 2, "0//argument5": 2, "argument5": 2, "argument6": 2, "argument7": 2, "mb": 6, "argument8": 2, "//This": 2, "main": 2, "mouse": 4, "button": 2, "added": 2, "to": 46, "give": 2, "more": 12, "choice": 2, "dev": 2, "//xx": 2, "be": 23, "corrected": 2, "they": 7, "are": 3, "placed": 2, "outside": 6, "room": 5, "will": 4, "lead": 2, "menu": 6, "being": 4, "cut": 2, "off": 2, "by": 8, "edge": 2, "item_list": 22, "item_string": 14, "": 2, "1": 47, "Parse": 2, "s": 40, "set": 2, "because": 2, "won": 3, "t": 27, "read": 2, "character": 31, "otherwise": 2, "yes": 2, "very": 2, "stupid": 2, "but": 3, "can": 9, "bothered": 2, "right": 2, "now": 10, "If": 8, "finds": 2, "a": 102, "means": 2, "there": 3, "an": 11, "escape": 9, "Move": 2, "next": 7, "Check": 10, "which": 2, "This": 4, "meta": 2, "info": 2, "n": 7, "Skip": 2, "letter": 2, "itself": 2, "as": 5, "we": 18, "don": 7, "want": 6, "drawn": 2, "For": 3, "some": 2, "reason": 2, "always": 3, "10": 4, "But": 2, "works": 2, "perfectly": 2, "fine": 2, "code": 2, "isn": 2, "show_message": 19, "Debug": 2, "ii=": 2, "ii": 10, "We": 2, "go": 4, "any": 2, "further": 2, "backslash": 2, "loop": 2, "hasn": 2, "been": 4, "broken": 2, "then": 4, "ll": 3, "draw": 5, "string_width": 4, "//Add": 6, "new": 2, "//Reset": 2, "draw_set_color": 6, "//draw_rectangle": 2, "height*ds_list_size": 2, "//Background": 4, "temporary": 4, "draw_button": 2, "hpadding*2": 2, "height*": 2, "": 2, "Go": 2, "through": 7, "items": 2, "draw_rectangle": 2, "Draw": 4, "rectange": 2, "one": 3, "re": 2, "doing": 2, "add": 4, "cool": 2, "effects": 2, "each": 15, "them": 2, "draw_line": 2, "0": 24, "5": 5, "2": 12, "seperator": 2, "draw_text": 4, "padding": 2, "mouse_x": 8, "": 4, "mouse_y": 8, "mouse_check_button_released": 4, "//show_message": 2, "//Debugging": 2, "//Returns": 2, "number": 4, "in": 23, "was": 4, "clicked": 4, "Return": 6, "indicate": 4, "user": 2, "chose": 2, "clicking": 2, "haven": 2, "already": 2, "returned": 2, "something": 3, "nothing": 2, "__jso_gmt_tuple": 57, "//Position": 1, "address": 4, "table": 4, "data": 19, "pos": 4, "addr_table": 5, "6*argument_count": 1, "//Build": 9, "tuple": 2, "element": 13, "ca": 13, "isstr": 7, "datastr": 5, "": 9, "argument": 29, "type": 30, "Save": 2, "strings": 1, "reals": 1, "scientific": 2, "notation": 2, "15": 1, "significant": 2, "digits": 12, "__jso_gmt_numtostr": 15, "Add": 1, "entry": 6, "30": 1, "string_format": 4, "size": 10, "header": 1, "argument_count": 13, "3": 1, "define": 11, "__jso_gmt_elem": 97, "elem": 1, "tuple_source": 1, "th": 3, "": 1, "@author": 1, "GameGeisha": 1, "@version": 1, "GMTuple": 2, "*/": 10, "//Capture": 1, "arguments": 23, "__jso_gmt_size": 6, "//Search": 1, "bounding": 1, "positions": 1, "": 2, "start": 6, "afterend": 5, "6*n": 3, "//Return": 4, "correct": 4, "frac": 2, "mantissa": 23, "exponent": 18, "floor": 8, "log10": 2, "abs": 23, "argument0/power": 2, "do": 8, "until": 13, "__jso_gmt_test_all": 2, "//Automated": 1, "testing": 1, "sequence": 1, "__jso_gmt_test_elem": 2, "__jso_gmt_test_size": 2, "__jso_gmt_test_numtostr": 2, "tolerance": 6, "1/10000000000": 1, "pi": 8, "1/pi": 3, "jso_new_map": 36, "jso_new_list": 31, "jso_map_add_real": 28, "jso_map_add_string": 11, "jso_map_add_sublist": 7, "jso_map_add_submap": 3, "jso_map_add_integer": 6, "jso_map_add_boolean": 6, "jso_list_add_real": 16, "jso_list_add_string": 10, "jso_list_add_sublist": 7, "jso_list_add_submap": 9, "jso_list_add_integer": 7, "jso_list_add_boolean": 9, "jso_map_get": 18, "//Grab": 4, "value": 21, "v": 27, "//String": 5, "could": 4, "string_delete": 4, "default": 31, "//Real": 4, "jso_map_get_type": 6, "jso_type_string": 6, "jso_type_list": 13, "jso_type_map": 14, "jso_type_boolean": 6, "jso_type_real": 6, "jso_list_get": 18, "jso_list_get_type": 6, "jso_cleanup_map": 48, "//Loop": 4, "all": 2, "keys": 8, "l": 11, "k": 43, "ds_map_size": 6, "": 4, "Look": 2, "values": 4, "need": 5, "recursed": 2, "Maps": 6, "Lists": 4, "jso_cleanup_list": 43, "Find": 1, "Done": 10, "clean": 2, "up": 13, "Recursively": 7, "free": 1, ".": 3, "JSOnion": 13, "version": 11, "1.0.0d": 9, "elements": 2, "jso_encode_real": 7, "JSON": 4, "encoded": 1, "": 1, "uses": 2, "decimal": 6, "values.": 1, "integers": 1, "just": 2, "adapted": 1, "from": 1, "same": 5, "algorithm": 2, "used": 1, "GMTuple.": 1, "jso_encode_string": 7, "//Iteratively": 2, "reconstruct": 1, "//Replace": 1, "characters": 6, "//Double": 1, "quotes": 2, "backslashes": 1, "slashes": 1, "//Backspace": 1, "//Form": 1, "feed": 1, "//New": 1, "//Carriage": 1, "//Horizontal": 1, "tab": 1, "//Not": 1, "jso_encode_list": 6, "encode": 4, "Prepend": 1, "comma": 3, "except": 1, "//Select": 2, "encoding": 3, "recursively": 2, "jso_encode_map": 7, "jso_encode_boolean": 5, "//Done": 2, "square": 1, "brackets": 1, "//Go": 1, "every": 1, "pair": 1, "Prefix": 1, "preceding": 1, "//Find": 1, "is_real": 1, "separator": 2, "//Get": 1, "braces": 1, "jso_encode_integer": 5, "jso_decode_map": 16, "_jso_decode_map": 11, "jso_decode_list": 15, "_jso_decode_list": 11, "jso_decode_string": 1, "_jso_decode_string": 10, "jso_decode_boolean": 1, "_jso_decode_boolean": 6, "jso_decode_real": 1, "_jso_decode_real": 16, "jso_decode_integer": 1, "_jso_decode_integer": 5, "len": 21, "//Seek": 6, "_jso_is_whitespace_char": 16, "//Read": 3, "end": 3, "ending": 12, "found_end": 17, "found": 46, "current_key": 8, "//0": 4, "Looking": 5, "closing": 1, "//1": 4, "//2": 2, "//3": 2, "looking": 12, "extracted": 3, "position": 3, "//Ended": 3, "too": 4, "early": 3, "throw": 3, "[": 19, "]": 21, "double": 3, "quote": 3, "escape_mode": 10, "//Escape": 1, "mode": 2, "/": 1, "u": 1, "_jso_hex_to_decimal": 2, "//Regular": 1, "f": 2, "//Look": 3, "//Error": 3, "unexpected": 3, "//Determine": 2, "starting": 6, "no": 3, "done": 13, "Found": 8, "sign": 3, "dot": 5, "e": 3, "E": 3, "//": 19, "after": 1, "e/E": 2, "//4": 1, "//5": 1, "final": 1, "//Am": 2, "still": 2, "expecting": 2, "jso_compare_maps": 22, "//If": 2, "aren": 2, "//Compare": 2, "contents": 3, "pairwise": 2, "b": 76, "": 2, "exists": 25, "on": 3, "both": 1, "sides": 1, "content": 4, "jso_compare_lists": 19, "Advance": 1, "No": 2, "mismatches": 2, "list1": 2, "list2": 1, "whether": 3, "compatible": 3, "lists": 4, "": 1, "same.": 1, "jso_map_check": 11, "key1": 6, "key2": 6, "look": 6, "indices": 7, "top": 6, "level": 6, "there.": 6, "//Catch": 6, "empty": 8, "calls": 6, "keys/indices": 6, "key_list": 30, "Call": 6, "lookup": 9, "kernel": 6, "cleanup": 6, "_jso_lookup_kernel": 8, "jso_list_check": 10, "jso_map_lookup": 5, "jso_map_lookup_type": 5, "jso_list_lookup": 5, "jso_list_lookup_type": 5, "jso_ds": 2, "jso_type": 2, "task_type": 9, "ds_args_list": 6, "Kernel": 1, "check": 2, "functions": 2, "The": 2, "structure": 89, "handle": 1, "0=": 1, "1=": 1, "2=": 1, "ds_list": 3, "passed": 1, "PLEASE": 1, "DO": 1, "NOT": 1, "CALL": 1, "DIRECTLY": 1, "use": 3, "regular": 1, "jso_": 1, "0d": 1, "type_string": 7, "keys_size": 3, "Iteratively": 1, "i=": 1, "existence": 2, "current": 2, "Cannot": 2, "find": 2, "index": 3, "nested": 17, "//Trying": 1, "leaf": 1, "//Can": 1, "requested": 1, "task": 1, "000A": 1, "000B": 1, "000C": 1, "000D": 1, "00A0": 1, "180E": 1, "200A": 1, "hex_string": 4, "hex_digits": 3, "//Convert": 1, "digit_value": 4, "num": 5, "//Unknown": 1, "global.levelType": 24, "//global.currLevel": 1, "global.currLevel": 22, "global.hadDarkLevel": 4, "global.startRoomX": 1, "global.startRoomY": 1, "global.endRoomX": 1, "global.endRoomY": 1, "oGame.levelGen": 2, "j": 8, "global.roomPath": 1, "global.lake": 4, "not": 63, "isLevel": 1, "i*16": 16, "j*16": 12, "obj": 10, "oDark": 2, "obj.invincible": 5, "obj.sprite_index": 6, "sDark": 1, "oTemple": 2, "global.cityOfGold": 3, "sTemple": 2, "oLush": 2, "sLush": 2, "oBrick": 1, "sBrick": 1, "40*16": 1, "//instance_create": 2, "35*16": 1, "oSpikes": 1, "background_index": 1, "bgTemple": 1, "global.temp1": 1, "global.gameStart": 3, "scrLevelGen": 1, "global.cemetary": 3, "rand": 10, "global.probCemetary": 1, "oRoom": 1, "scrRoomGen": 1, "global.blackMarket": 3, "scrRoomGenMarket": 1, "scrRoomGen2": 1, "global.yetiLair": 2, "scrRoomGenYeti": 1, "scrRoomGen3": 1, "scrRoomGen4": 1, "scrRoomGen5": 1, "global.darkLevel": 4, "//if": 5, "global.noDarkLevel": 1, "global.probDarkLevel": 1, "oPlayer1.x": 2, "oPlayer1.y": 2, "oFlare": 1, "global.genUdjatEye": 4, "global.madeUdjatEye": 1, "global.genMarketEntrance": 4, "global.madeMarketEntrance": 1, "////////////////////////////": 2, "global.temp2": 1, "isRoom": 3, "scrEntityGen": 1, "instance_exists": 9, "oEntrance": 1, "global.customLevel": 1, "oEntrance.x": 1, "oEntrance.y": 1, "global.snakePit": 1, "global.alienCraft": 1, "global.sacrificePit": 1, "oPlayer1": 1, "alarm": 11, "scrSetupWalls": 3, "global.graphicsHigh": 1, "repeat": 3, "tile_add": 4, "bgExtrasLush": 1, "32*rand": 4, "16*rand": 8, "bgExtrasIce": 1, "bgExtrasTemple": 1, "bgExtras": 1, "global.murderer": 1, "global.thiefLevel": 1, "isRealLevel": 1, "oExit": 1, "oShopkeeper": 1, "obj.status": 1, "oTreasure": 1, "collision_point": 39, "oSolid": 18, "instance_place": 4, "oWater": 3, "sprite_index": 10, "sWaterTop": 1, "sLavaTop": 1, "scrCheckWaterTop": 1, "global.temp3": 1, "args": 43, "//Required": 2, "_Piwik_idsite": 2, "_piwikUrlEncode": 20, "_Piwik_baseurl": 2, "room_get_name": 1, "_Piwik_id": 2, "round": 4, "random": 2, "game_id": 4, "//ds_map_add": 2, "//Pass": 5, "local": 4, "time": 3, "API": 2, "ctz": 4, "date_get_timezone": 3, "date_set_timezone": 6, "timezone_local": 2, "date_current_datetime": 2, "date_get_hour": 2, "date_get_minute": 2, "date_get_second": 2, "arg_keyval": 8, "_piwikStringExplode": 2, "Build": 2, "argstring": 8, "prevkey": 14, "Append": 2, "requests": 3, "sent": 2, "at": 4, "End": 2, "Step": 2, "_PIWIK_REQS": 2, "hangCountMax": 2, "kLeft": 17, "checkLeft": 1, "kLeftPushedSteps": 3, "kLeftPressed": 2, "checkLeftPressed": 1, "kLeftReleased": 3, "checkLeftReleased": 1, "kRight": 17, "checkRight": 1, "kRightPushedSteps": 3, "kRightPressed": 2, "checkRightPressed": 1, "kRightReleased": 3, "checkRightReleased": 1, "kUp": 7, "checkUp": 1, "kDown": 8, "checkDown": 1, "//key": 1, "canRun": 1, "kRun": 2, "kJump": 7, "checkJump": 1, "kJumpPressed": 11, "checkJumpPressed": 1, "kJumpReleased": 5, "checkJumpReleased": 1, "cantJump": 3, "global.isTunnelMan": 1, "sTunnelAttackL": 1, "holdItem": 3, "kAttack": 2, "checkAttack": 2, "kAttackPressed": 2, "checkAttackPressed": 1, "kAttackReleased": 2, "checkAttackReleased": 1, "kItemPressed": 2, "checkItemPressed": 1, "xPrev": 4, "yPrev": 4, "stunned": 6, "dead": 6, "colSolidLeft": 4, "colSolidRight": 3, "colLeft": 7, "colRight": 7, "colTop": 5, "colBot": 11, "colLadder": 3, "colPlatBot": 6, "colPlat": 5, "colWaterTop": 3, "colIceBot": 3, "runKey": 6, "isCollisionMoveableSolidLeft": 1, "isCollisionMoveableSolidRight": 1, "isCollisionLeft": 2, "isCollisionRight": 2, "isCollisionTop": 1, "isCollisionBottom": 1, "isCollisionLadder": 1, "isCollisionPlatformBottom": 1, "isCollisionPlatform": 1, "isCollisionWaterTop": 1, "oIce": 1, "checkRun": 1, "runHeld": 4, "whipping": 5, "CLIMBING": 7, "HANGING": 12, "approximatelyZero": 8, "xVel": 68, "xAcc": 25, "platformCharacterIs": 33, "ON_GROUND": 24, "DUCKING": 9, "pushTimer": 8, "SS_IsSoundPlaying": 2, "global.sndPush": 4, "playSound": 3, "facing": 19, "LEFT": 8, "runAcc": 2, "16/": 1, "RIGHT": 11, "16/xVel": 1, "oCape": 4, "oCape.open": 8, "kJumped": 7, "ladderTimer": 7, "ladder": 9, "oLadder": 8, "ladder.x": 5, "oLadderTop": 5, "yAcc": 36, "climbAcc": 2, "FALLING": 10, "STANDING": 5, "departLadderXVel": 2, "departLadderYVel": 1, "JUMPING": 7, "jumpButtonReleased": 7, "jumpTime": 8, "IN_AIR": 9, "gravityIntensity": 2, "yVel": 42, "RUNNING": 8, "jumps": 1, "//playSound": 1, "global.sndLand": 1, "grav": 23, "global.hasGloves": 3, "hangCount": 14, "yVel*0.3": 1, "oWeb": 3, "obj.life": 1, "initialJumpAcc": 6, "xVel/2": 3, "gravNorm": 7, "global.hasCape": 1, "global.hasJetpack": 4, "jetpackFuel": 2, "fallTimer": 4, "global.hasJordans": 1, "yAccLimit": 6, "global.hasSpringShoes": 1, "global.sndJump": 1, "jumpTimeTotal": 2, "//let": 1, "jump": 1, "jumpTime/jumpTimeTotal": 1, "UP": 1, "LOOKING_UP": 4, "move_snap": 6, "oTree": 4, "oArrow": 5, "instance_nearest": 1, "obj.stuck": 1, "//the": 2, "setCollisionBounds": 5, "colPointLadder": 3, "ladder.y": 1, "xFric": 13, "frictionClimbingX": 1, "yFric": 10, "frictionClimbingY": 1, "run": 2, "xVelLimit": 11, "frictionRunningFastX": 4, "<2>": 1, "image_speed": 11, "global.downToRun": 2, "//decrease": 1, "friction": 1, "when": 3, "frictionRunningX": 1, "swimming": 1, "global.hasSpikeShoes": 1, "collision_line": 2, "DUCKTOHANG": 4, "holdItem.held": 1, "holdItem.type": 2, "holdItem.y": 2, "scrDropItem": 2, "oMonkey": 2, "status": 4, "vineCounter": 2, "grabCounter": 2, "oParachute": 1, "xAccLimit": 4, "oBall": 2, "distance_to_object": 1, "oBall.x": 8, "oBall.y": 4, "yVelLimit": 4, "maxSlope": 2, "slopeYPrev": 4, "slopeChangeInY": 4, "maxSlope*abs": 1, "yPrevHigh": 1, "moveTo": 3, "dist": 4, "point_distance": 1, "overall": 1, "distance": 2, "has": 1, "traveled": 1, "xVelInteger": 6, "excess": 2, "<0>": 1, "move": 6, "back": 1, "since": 3, "moved": 1, "far": 1, "x=": 1, "y=": 1, "high": 1, "down": 3, "shorten": 1, "out": 2, "little": 1, "these": 1, "lines": 1, "changed": 2, "different": 7, "types": 4, "slowing": 1, "running": 1, "hills": 1, "ratio=": 1, "9": 1, "ratio": 2, "yVelInteger": 1, "simply": 1, "air": 1, "downhill": 1, "possible": 1, "multiply": 1, "maxDownSlope": 3, "absolute": 1, "normally": 1, "runs": 1, "larger": 1, "than": 1, "floating": 1, "above": 1, "slope": 1, "upYPrev": 4, "hit": 1, "solid": 1, "below": 1, "know": 1, "doesn": 10, "//figures": 1, "what": 1, "sprite": 2, "characterSprite": 1, "//sets": 1, "previous": 2, "previously": 1, "statePrevPrev": 1, "statePrev": 2, "//calculates": 1, "based": 1, "runAnimSpeed": 1, "sqrt": 1, "sqr": 2, "climbAnimSpeed": 1, "image_index": 1, "//limit": 1, "animation": 1, "looks": 1, "good": 1, "display": 1, "resolution": 1, "display_get_width": 1, "display_get_height": 1, "language": 1, "os_get_language": 1, "stored": 1, "exist": 1, "_Piwik_idvc": 2, "_Piwik_idts": 2, "_Piwik_viewts": 2, "assert_true": 39, "_assert_error_popup": 4, "string_repeat": 4, "_assert_newline": 7, "assert_false": 35, "assert_equal": 89, "//Safe": 1, "equality": 1, "match": 6, "//No": 1, "//Data": 1, "//Construct": 1, "message": 4, "msg": 9, "expected": 178, "_assert_debug_value": 3, "actual": 201, "//Display": 2, "os_browser": 3, "browser_not_a_browser": 3, "//Full": 1, "fledged": 1, "non": 1, "browser": 1, "environments": 1, "//Browsers": 1, "string_replace_all": 1, "//Numeric": 1, "//Integers": 1, "//Decimal": 1, "numbers": 1, "get": 1, "trailing": 1, "zeros": 1, "//Remove": 2, "only": 1, "normalized": 1, "nonzero": 1, "//GMTuple": 1, "jso_test_all": 1, "current_time": 2, "_test_jso_new": 2, "_test_jso_map_add": 2, "_test_jso_list_add": 2, "_test_jso_encode": 2, "_test_jso_compare": 2, "_test_jso_decode": 2, "_test_jso_lookup": 2, "_test_jso_bugs": 2, "show_debug_message": 2, "//jso_new_map": 1, "//jso_new_list": 1, "//jso_map_add_real": 1, "//jso_map_add_string": 1, "//jso_map_add_sublist": 1, "//jso_map_add_submap": 1, "//jso_map_add_integer": 1, "//jso_map_add_boolean": 2, "//Cleanup": 2, "//jso_list_add_real": 1, "ds_list_empty": 7, "ds_list_clear": 7, "//jso_list_add_string": 1, "//jso_list_add_sublist": 1, "//jso_list_add_submap": 1, "//jso_list_add_integer": 1, "//jso_list_add_boolean": 2, "original": 1, "//jso_encode_real": 3, "Positive": 7, "Negative": 7, "Zero": 4, "//jso_encode_integer": 3, "//jso_encode_boolean": 2, "//jso_encode_string": 3, "Simple": 2, "Empty": 10, "Basic": 1, "//jso_encode_map": 4, "empty_map": 4, "One": 5, "one_map": 10, "Multi": 4, "multi_map": 6, "ok1": 3, "ok2": 3, "//jso_encode_list": 3, "empty_list": 4, "one_list": 5, "multi_list": 7, "submap": 16, "sublist": 20, "json": 130, "expected_structure": 79, "actual_structure": 57, "////Primitives": 1, "//_jso_decode_string": 5, "Small": 1, "Escape": 1, "Mixed": 1, "//_jso_decode_boolean": 2, "True": 1, "False": 1, "//_jso_decode_real": 11, "Signed": 2, "zero": 2, "positive": 2, "3.14159*100": 1, "2.71828*100": 1, "negative": 2, "integer": 4, "//_jso_decode_integer": 3, "////Data": 1, "structures": 1, "//_jso_decode_map": 7, "#1": 2, "#2": 2, "Nested": 2, "maps": 4, "Map": 1, "subsublist": 4, "Mix": 2, "//_jso_decode_list": 7, "List": 1, "//jso_compare_maps": 6, "equal": 10, "other": 8, "An": 3, "filled": 2, "entered": 2, "orders": 2, "corresponding": 2, "crash.": 2, "//jso_compare_lists": 4, "entries": 2, "also": 1, "//jso_map_check": 9, "Single": 9, "//jso_map_lookup": 3, "//jso_map_lookup_type": 3, "Multiple": 20, "recurse": 10, "wrong": 1, "overflow": 1, "//jso_list_check": 6, "//jso_list_lookup": 3, "//jso_list_lookup_type": 3, "//jso_list_exists": 2, "//Bug": 1, "Crash": 1, "boolean": 1, "valued": 1, "unknown": 1, "variable": 1, "jso_type_integer": 1, "jsonMap": 11, "fh": 7, "otz": 2, "timezone_utc": 1, "requestToCache": 3, "current_year": 1, "current_month": 1, "current_day": 1, "current_hour": 1, "current_minute": 1, "current_second": 1, "file_exists": 1, "_Piwik_CacheFile": 5, "//Verify": 1, "cache": 2, "signature": 1, "make": 1, "sure": 1, "unwanted": 1, "heaven": 1, "forbid": 1, "malicious": 1, "have": 1, "added.": 1, "curCacheSig": 2, "sha1_string_utf8": 2, "sha1_file": 2, "ini_open": 2, "_Piwik_IniFile": 2, "storedSig": 2, "ini_read_string": 1, "ini_close": 2, "string_count": 1, "file_text_open_read": 1, "cachedJson": 2, "base64_decode": 1, "file_text_read_string": 1, "file_text_close": 2, "json_decode": 1, "ds_exists": 1, "ds_type_map": 1, "_PiwikDebugOutput": 1, "//Start": 1, "fresh": 1, "old": 1, "corrupted.": 1, "ounce": 1, "lost": 1, "analytics": 1, "worth": 1, "pound": 1, "security.": 1, "is_undefined": 1, "requestList": 3, "ds_map_add_list": 1, "newCachedJson": 2, "json_encode": 1, "file_text_open_write": 1, "file_text_write_string": 1, "base64_encode": 1, "cacheSig": 2, "ini_write_string": 1, "//draws": 1, "image_xscale": 5, "blinkToggle": 1, "sPExit": 1, "sDamselExit": 1, "sTunnelExit": 1, "draw_sprite_ext": 3, "image_yscale": 3, "image_angle": 3, "image_blend": 2, "image_alpha": 3, "//draw_sprite": 1, "draw_sprite": 9, "sJetpackBack": 1, "sJetpackRight": 1, "sJetpackLeft": 1, "redColor": 2, "make_color_rgb": 1, "holdArrow": 4, "ARROW_NORM": 2, "sArrowRight": 1, "ARROW_BOMB": 2, "holdArrowToggle": 2, "sBombArrowRight": 2, "sArrowLeft": 1, "sBombArrowLeft": 2 }, "Genie": { "init": 2, "print": 2, "(": 6, ")": 6, "new": 1, "Demo": 2, ".run": 1, "class": 1, "_message": 3, "string": 2, "construct": 1, "message": 2, "def": 1, "run": 1 }, "Gerber Image": { "G04": 80, "#@": 14, "TF.FileFunction": 14, "Copper": 4, "L1": 2, "Top": 2, "Signal*": 4, "%": 496, "FSLAX46Y46*": 14, "Gerber": 15, "Fmt": 15, "Leading": 15, "zero": 15, "omitted": 15, "Abs": 15, "format": 15, "(": 37, "unit": 15, "mm": 15, ")": 37, "*": 15, "Created": 15, "by": 15, "KiCad": 15, "PCBNEW": 15, "-": 4045, "BZR": 7, "product": 7, "date": 15, "Sunday": 7, "April": 7, "01*": 7, "MOMM*": 15, "LPD*": 15, "G01*": 81, "APERTURE": 30, "LIST*": 30, "ADD10C": 16, "0.150000*": 14, "ADD11R": 4, "0.800000X0.750000*": 3, "ADD12R": 3, "0.750000X0.800000*": 3, "ADD13R": 4, "1.198880X1.198880*": 3, "ADD14R": 8, "1.727200X2.032000*": 13, "ADD15O": 7, "ADD16R": 7, "0.500000X0.900000*": 3, "ADD17R": 4, "0.450000X1.750000*": 3, "ADD18R": 3, "1.060000X0.650000*": 3, "ADD19R": 5, "2.032000X1.727200*": 12, "ADD20O": 2, "ADD21R": 4, "0.900000X0.500000*": 3, "ADD22C": 3, "1.300000*": 8, "ADD23C": 4, "2.800000*": 6, "ADD24C": 7, "0.685800*": 2, "ADD25C": 5, "0.800000*": 4, "ADD26C": 5, "0.500000*": 3, "ADD27C": 4, "0.300000*": 5, "ADD28C": 4, "0.400000*": 2, "ADD29C": 2, "ADD30C": 2, "0.250000*": 1, "ADD31C": 2, "0.180000*": 3, "ADD32C": 2, "0.160000*": 1, "END": 15, "D10*": 17, "D11*": 18, "X165350000Y": 4, "82700000D03*": 14, "X163850000Y": 6, "X162350000Y": 10, "X160850000Y": 12, "D12*": 16, "X172700000Y": 7, "87350000D03*": 3, "88850000D03*": 3, "X181100000Y": 14, "90600000D03*": 6, "X179600000Y": 15, "D13*": 22, "X168800000Y": 22, "94500000D03*": 11, "96598040D03*": 9, "X170800000Y": 20, "X172800000Y": 16, "D14*": 14, "X175640000Y": 10, "81600000D03*": 18, "D15*": 16, "X173100000Y": 6, "X170560000Y": 9, "D16*": 11, "89000000D03*": 12, "87300000D03*": 6, "D17*": 14, "X156775000Y": 10, "92600000D03*": 42, "X157425000Y": 6, "X158075000Y": 10, "X158725000Y": 10, "X159375000Y": 9, "X160025000Y": 9, "X160675000Y": 14, "X161325000Y": 12, "X161975000Y": 6, "X162625000Y": 6, "X163275000Y": 12, "X163925000Y": 6, "X164575000Y": 9, "X165225000Y": 9, "85400000D03*": 42, "D18*": 14, "X175000000Y": 13, "87150000D03*": 6, "88100000D03*": 3, "89050000D03*": 6, "X177200000Y": 16, "D19*": 20, "X184000000Y": 22, "86460000D03*": 6, "D20*": 21, "91540000D03*": 6, "X174900000Y": 25, "94501960D03*": 3, "96600000D03*": 7, "X159000000Y": 7, "94600000D03*": 8, "X160500000Y": 11, "81100000D03*": 10, "D21*": 11, "X171150000Y": 9, "88600000D03*": 6, "90100000D03*": 6, "X169550000Y": 11, "91300000D03*": 15, "92800000D03*": 15, "X176600000Y": 8, "D22*": 9, "X152900000Y": 27, "88350000D03*": 6, "90350000D03*": 6, "92850000D03*": 6, "85850000D03*": 6, "D23*": 8, "X150800000Y": 20, "83500000D03*": 6, "95200000D03*": 6, "D24*": 10, "X173700000Y": 4, "89200000D03*": 2, "X162300004Y": 4, "87000000D03*": 2, "X159600000Y": 9, "X161700000Y": 3, "X176200000Y": 3, "91700000D03*": 2, "X158100000Y": 3, "83900000D03*": 2, "X168600000Y": 7, "89399998D03*": 2, "X167200000Y": 6, "85000000D03*": 2, "X163800000Y": 7, "D25*": 7, "X159300000Y": 8, "87400000D03*": 8, "X167300000Y": 10, "X160900000Y": 10, "90299999D03*": 2, "85300000D03*": 2, "X166500002Y": 4, "90900000D03*": 2, "90200000D03*": 2, "X168000000Y": 4, "X173800000Y": 5, "X154500000Y": 8, "89792900D03*": 2, "88907100D03*": 2, "D26*": 14, "X165325000Y": 6, "82700000D02*": 9, "83475000D01*": 1, "83475000D02*": 1, "X164900000Y": 2, "83900000D01*": 3, "83900000D02*": 2, "X164250677Y": 2, "X163947598Y": 4, "84375049D02*": 1, "X163927410Y": 3, "84395237D01*": 1, "84203079D01*": 1, "84203079D02*": 1, "84375049D01*": 1, "84395237D02*": 1, "85400000D01*": 4, "D27*": 10, "82826415D01*": 1, "82700000D01*": 3, "88850000D02*": 3, "X173350000Y": 2, "88850000D01*": 2, "89200000D01*": 2, "89050000D02*": 4, "X173850000Y": 2, "89050000D01*": 4, "88100000D02*": 6, "83378030D01*": 1, "83378030D02*": 1, "X163295188Y": 4, "83932842D01*": 2, "84125000D02*": 1, "84104812D01*": 1, "84104812D02*": 1, "85400000D02*": 9, "84125000D01*": 1, "83575000D01*": 3, "83575000D02*": 2, "X160875000Y": 2, "83600000D01*": 4, "83600000D02*": 2, "84025000D01*": 1, "84025000D02*": 1, "92600000D02*": 3, "93800000D01*": 3, "94600000D02*": 3, "93975000D01*": 1, "93975000D02*": 1, "86509937D01*": 1, "86509937D02*": 1, "X162784937Y": 2, "87000000D01*": 4, "87000000D02*": 2, "86509929D02*": 1, "X161815071Y": 2, "86509929D01*": 1, "X159700000Y": 3, "81100000D01*": 5, "94600000D01*": 1, "83925000D01*": 1, "83925000D02*": 1, "90600000D02*": 2, "91700000D01*": 1, "96600000D02*": 3, "96600000D01*": 3, "96598040D02*": 4, "X174898040Y": 2, "96598040D01*": 3, "X169250000Y": 2, "85000000D02*": 3, "83690000D01*": 1, "83690000D02*": 1, "81600000D01*": 2, "85000000D01*": 1, "90500000D02*": 1, "89399998D01*": 3, "91300000D02*": 6, "90700000D01*": 1, "90700000D02*": 1, "90500000D01*": 1, "D28*": 25, "X170500000Y": 7, "88600000D02*": 3, "88600000D01*": 4, "89399998D02*": 2, "X168750002Y": 2, "X161977410Y": 3, "83947590D01*": 1, "83947590D02*": 1, "D29*": 23, "81100000D02*": 2, "D30*": 56, "X174222599Y": 2, "89677401D02*": 3, "X175726921Y": 2, "89677401D01*": 1, "X176250000Y": 4, "89154322D01*": 1, "89154322D02*": 1, "88675000D01*": 1, "88675000D02*": 1, "87725000D01*": 1, "87725000D02*": 1, "87150000D01*": 3, "87150000D02*": 4, "X179450000Y": 2, "87300000D01*": 1, "94000000D01*": 1, "94000000D02*": 1, "93725000D01*": 1, "93725000D02*": 1, "92600000D01*": 1, "90100000D01*": 5, "96000000D01*": 1, "87300000D02*": 1, "89000000D01*": 4, "89000000D02*": 1, "94500000D02*": 3, "92800000D01*": 2, "X167301960Y": 2, "87400000D02*": 3, "86675000D01*": 2, "86675000D02*": 2, "92800000D02*": 4, "94500000D01*": 3, "95065685D01*": 1, "95065685D02*": 1, "X167734314Y": 2, "95499999D01*": 2, "95499999D02*": 2, "X167876797Y": 2, "X167878639Y": 2, "95501841D01*": 2, "95501841D02*": 2, "X170603241Y": 2, "95698600D01*": 1, "95698600D02*": 1, "86400000D01*": 2, "86900000D02*": 1, "86900000D01*": 1, "81600000D02*": 3, "84560000D01*": 1, "84560000D02*": 1, "85300000D01*": 1, "X175599999Y": 2, "90299999D01*": 3, "90299999D02*": 1, "X180803600Y": 2, "84796400D01*": 1, "84796400D02*": 1, "86460000D01*": 2, "94501960D01*": 1, "X165934317Y": 2, "90900000D02*": 2, "90900000D01*": 4, "X159900000Y": 2, "91425000D02*": 1, "91425000D01*": 1, "90200000D02*": 2, "X179550000Y": 2, "X166000000Y": 4, "89400000D02*": 2, "X167600001Y": 2, "87799999D01*": 1, "X158400000Y": 2, "89400000D01*": 2, "87799999D02*": 1, "87400000D01*": 5, "91025000D02*": 2, "X174050000Y": 2, "X156800000Y": 1, "91000000D01*": 4, "91025000D01*": 1, "90100000D02*": 7, "X169600000Y": 2, "91300000D01*": 5, "X175100000Y": 2, "X171600000Y": 2, "89792900D02*": 2, "X154342900Y": 4, "89792900D01*": 2, "88350000D01*": 1, "X157560197Y": 2, "89599999D02*": 2, "X154692901Y": 4, "89599999D01*": 2, "86712500D02*": 2, "X165150000Y": 4, "86787500D01*": 2, "86712500D01*": 2, "86787500D02*": 2, "87703552D01*": 1, "87703552D02*": 1, "X163905962Y": 2, "88947590D01*": 1, "88947590D02*": 1, "X158212605Y": 2, "88947591D01*": 1, "88947591D02*": 1, "X157353101Y": 2, "89100001D02*": 2, "89100001D01*": 2, "88907100D01*": 2, "X164650000Y": 4, "87496448D01*": 1, "X158005501Y": 2, "88447601D02*": 2, "87496448D02*": 1, "X163698847Y": 2, "88447601D01*": 2, "D31*": 23, "G36*": 4, "X161443040Y": 1, "80386260D02*": 1, "X161404451Y": 1, "80479422D01*": 1, "X161363152Y": 1, "80451826D01*": 2, "X161250000Y": 3, "80429319D01*": 2, "X160450000Y": 2, "X160336848Y": 1, "X160240922Y": 4, "80515922D01*": 1, "X160176826Y": 2, "80611848D01*": 1, "X160154319Y": 2, "80725000D01*": 1, "81475000D01*": 1, "81588152D01*": 1, "81684078D01*": 1, "X160310000Y": 4, "81730235D01*": 1, "82069765D01*": 1, "82115922D01*": 1, "X160211470Y": 2, "82160000D01*": 2, "X159949905Y": 1, "X159726444Y": 1, "82067210D01*": 1, "X159474661Y": 1, "82066991D01*": 1, "X159241959Y": 1, "82163141D01*": 1, "X159063767Y": 1, "82341023D01*": 1, "X158967210Y": 1, "82573556D01*": 1, "X158966991Y": 1, "82825339D01*": 1, "X159063141Y": 1, "83058041D01*": 1, "X159241023Y": 1, "83236233D01*": 1, "X159473556Y": 1, "83332790D01*": 1, "X159725339Y": 1, "83333009D01*": 1, "X159950439Y": 1, "83240000D01*": 2, "83284078D01*": 1, "83330235D01*": 1, "X160351105Y": 1, "83781649D01*": 1, "X160468162Y": 1, "83956838D01*": 1, "X160493160Y": 1, "83981835D01*": 1, "X160493162Y": 1, "83981838D01*": 1, "X160568503Y": 1, "84032179D01*": 1, "X160765644Y": 1, "84229319D01*": 8, "X160350000Y": 1, "84249210D01*": 3, "X160250000Y": 1, "X159800000Y": 1, "X159150000Y": 1, "X159050000Y": 1, "X158950000Y": 1, "X158648548Y": 1, "X158732790Y": 1, "84026444D01*": 1, "X172906000Y": 4, "81774000D01*": 3, "81426000D01*": 7, "X172926000Y": 5, "81406000D01*": 4, "X173274000Y": 6, "G37*": 4, "81426000D02*": 1, "X180070000Y": 2, "89624732D01*": 1, "89953439D01*": 1, "X180000000Y": 3, "89939515D01*": 2, "X179200000Y": 1, "X179090750Y": 1, "89961246D01*": 1, "X178998132Y": 1, "90023132D01*": 1, "X178936246Y": 1, "90115750D01*": 1, "X181810000Y": 7, "87900000D02*": 2, "X181816851Y": 2, "87934442D01*": 2, "X181836360Y": 2, "87963640D01*": 2, "X181865558Y": 2, "87983149D01*": 2, "X181900000Y": 2, "87990000D01*": 4, "X185210000Y": 4, "89910000D01*": 4, "X182100000Y": 2, "X182065558Y": 2, "89916851D01*": 2, "X182036360Y": 2, "89936360D01*": 2, "X182016851Y": 2, "89965558D01*": 2, "X182010000Y": 4, "90000000D01*": 3, "91310000D01*": 4, "X180490000Y": 4, "86190000D01*": 4, "87900000D01*": 3, "M02*": 16, "FSLAX45Y45*": 1, "e0": 7, "ubuntu16.04.1": 7, "Sat": 7, "Jul": 7, "2017*": 7, "0.127000*": 1, "ADD11C": 11, "ADD12C": 8, "0.200000*": 3, "ADD13C": 5, "X19625000Y": 4, "11800000D02*": 2, "X11300000Y": 4, "11800000D01*": 2, "5275000D02*": 2, "5275000D01*": 2, "X12657300Y": 3, "7234400D02*": 2, "X12717300Y": 2, "7294400D01*": 2, "9571200D02*": 3, "X18270700Y": 2, "X18330700Y": 2, "9631200D01*": 2, "X13764260Y": 4, "8013700D02*": 2, "G75*": 66, "G03X13764260Y": 4, "8013700I": 2, "35560J0D01*": 17, "8343900D02*": 2, "8343900I": 2, "10350500D02*": 2, "10350500I": 2, "10668000D02*": 7, "10668000I": 1, "X14869160Y": 1, "7962900D02*": 1, "G03X14869160Y": 1, "7962900I": 1, "X14881860Y": 3, "8318500D02*": 1, "G03X14881860Y": 3, "8318500I": 1, "10693400D02*": 3, "10693400I": 3, "X16177260Y": 4, "8001000D02*": 1, "G03X16177260Y": 4, "8001000I": 1, "10375900D02*": 1, "10375900I": 1, "X17294860Y": 4, "G03X17294860Y": 4, "8331200D02*": 1, "8331200I": 1, "10337800D02*": 1, "10337800I": 1, "X13525500Y": 2, "6360800D02*": 1, "6440800D01*": 1, "X13485500Y": 1, "6400800D02*": 2, "X13565500Y": 1, "6400800D01*": 2, "X14540000Y": 4, "5824000D02*": 1, "5904000D01*": 1, "X14500000Y": 2, "5864000D02*": 1, "X14580000Y": 2, "5864000D01*": 1, "6840000D02*": 1, "6920000D01*": 1, "6880000D02*": 1, "6880000D01*": 1, "X15500000Y": 4, "8844000D02*": 1, "8924000D01*": 1, "X15460000Y": 2, "8884000D02*": 1, "X15540000Y": 2, "8884000D01*": 1, "9860000D02*": 1, "9940000D01*": 1, "9900000D02*": 1, "9900000D01*": 1, "X12586462Y": 7, "7809738D01*": 9, "X12686538Y": 10, "7759700D02*": 5, "G03X12686538Y": 4, "7759700I": 5, "50038J0D01*": 47, "8471662D02*": 10, "8571738D01*": 10, "8521700D02*": 5, "8521700I": 5, "10033762D02*": 6, "10133838D01*": 6, "10083800D02*": 3, "10083800I": 3, "10795762D02*": 6, "10895838D01*": 6, "10845800D02*": 3, "10845800I": 3, "X12942062Y": 8, "7709662D02*": 8, "X13042138Y": 12, "G03X13042138Y": 4, "X13297662Y": 4, "7214362D02*": 8, "X13397738Y": 6, "7314438D01*": 8, "7264400D02*": 4, "G03X13397738Y": 2, "7264400I": 4, "9563862D02*": 4, "9663938D01*": 4, "9613900D02*": 2, "9613900I": 2, "X13373862Y": 8, "7722362D02*": 4, "X13473938Y": 12, "7822438D01*": 4, "7772400D02*": 2, "G03X13473938Y": 4, "7772400I": 2, "8484362D02*": 4, "8584438D01*": 4, "8534400D02*": 2, "8534400I": 2, "X13551662Y": 4, "X13651738Y": 6, "G03X13651738Y": 2, "X14491462Y": 8, "X14591538Y": 12, "G03X14591538Y": 4, "10084562D02*": 2, "10184638D01*": 2, "10134600D02*": 1, "10134600I": 1, "10846562D02*": 2, "10946638D01*": 2, "10896600D02*": 1, "10896600I": 1, "X15032859Y": 2, "6362405D02*": 4, "X15132935Y": 3, "6462481D01*": 4, "6412443D02*": 2, "G03X15132935Y": 1, "6412443I": 2, "X15667859Y": 2, "X15767935Y": 3, "G03X15767935Y": 1, "X16104362Y": 4, "5906262D02*": 4, "X16204438Y": 6, "6006338D01*": 4, "5956300D02*": 2, "G03X16204438Y": 2, "5956300I": 2, "6211062D02*": 4, "6311138D01*": 4, "6261100D02*": 2, "6261100I": 2, "X16396462Y": 8, "7735062D02*": 2, "X16496538Y": 12, "7835138D01*": 2, "7785100D02*": 1, "G03X16496538Y": 4, "7785100I": 1, "8497062D02*": 2, "8597138D01*": 2, "8547100D02*": 1, "8547100I": 1, "10071862D02*": 2, "10171938D01*": 2, "10121900D02*": 1, "10121900I": 1, "10833862D02*": 2, "10933938D01*": 2, "10883900D02*": 1, "10883900I": 1, "X16866362Y": 4, "X16966438Y": 6, "G03X16966438Y": 2, "X17336262Y": 4, "X17436338Y": 6, "G03X17436338Y": 2, "9551162D02*": 4, "9651238D01*": 4, "9601200D02*": 2, "9601200I": 2, "X17514062Y": 8, "X17614138Y": 12, "G03X17614138Y": 4, "10046462D02*": 6, "10146538D01*": 6, "10096500D02*": 3, "10096500I": 3, "10808462D02*": 6, "10908538D01*": 6, "10858500D02*": 3, "10858500I": 3, "X17590262Y": 4, "X17690338Y": 6, "G03X17690338Y": 2, "X17945862Y": 4, "X18045938Y": 6, "G03X18045938Y": 2, "X17958562Y": 4, "X18058638Y": 6, "G03X18058638Y": 2, "X18301462Y": 8, "X18401538Y": 12, "G03X18401538Y": 4, "X11760200Y": 1, "6096000D02*": 5, "X11861800Y": 2, "6197600D01*": 4, "X18872200Y": 6, "X18973800Y": 6, "10769600D01*": 6, "X18923000Y": 4, "10718800D02*": 2, "10718800D01*": 2, "10922000D02*": 6, "11023600D01*": 6, "10972800D02*": 2, "10972800D01*": 2, "X19126200Y": 60, "X19227800Y": 60, "X19177000Y": 40, "6146800D02*": 1, "6146800D01*": 1, "6350000D02*": 3, "6451600D01*": 3, "6604000D02*": 3, "6705600D01*": 3, "6654800D02*": 1, "6654800D01*": 1, "6858000D02*": 3, "6959600D01*": 3, "6908800D02*": 1, "6908800D01*": 1, "7112000D02*": 3, "7213600D01*": 3, "7162800D02*": 1, "7162800D01*": 1, "7366000D02*": 3, "7467600D01*": 3, "7416800D02*": 1, "7416800D01*": 1, "7620000D02*": 3, "7721600D01*": 3, "7670800D02*": 1, "7670800D01*": 1, "7874000D02*": 3, "7975600D01*": 3, "7924800D02*": 1, "7924800D01*": 1, "8128000D02*": 3, "8229600D01*": 3, "8178800D02*": 1, "8178800D01*": 1, "8382000D02*": 3, "8483600D01*": 3, "8432800D02*": 1, "8432800D01*": 1, "8636000D02*": 3, "8737600D01*": 3, "8686800D02*": 1, "8686800D01*": 1, "8890000D02*": 3, "8991600D01*": 3, "8940800D02*": 1, "8940800D01*": 1, "9144000D02*": 3, "9245600D01*": 3, "9194800D02*": 1, "9194800D01*": 1, "9398000D02*": 3, "9499600D01*": 3, "9448800D02*": 1, "9448800D01*": 1, "9652000D02*": 3, "9753600D01*": 3, "9702800D02*": 1, "9702800D01*": 1, "9906000D02*": 3, "10007600D01*": 3, "9956800D02*": 1, "9956800D01*": 1, "10160000D02*": 3, "10261600D01*": 3, "10210800D02*": 1, "10210800D01*": 1, "10414000D02*": 3, "10515600D01*": 3, "10464800D02*": 1, "10464800D01*": 1, "X11563928Y": 3, "12273214D02*": 3, "11973214D01*": 3, "X11635357Y": 4, "X11678214Y": 3, "11987500D01*": 3, "X11706786Y": 4, "12016071D01*": 1, "X11721071Y": 5, "12044643D01*": 1, "X11735357Y": 2, "12101786D01*": 2, "12144643D01*": 1, "12201786D01*": 1, "12230357D01*": 1, "12258929D01*": 1, "12273214D01*": 2, "X11863928Y": 3, "12073214D01*": 4, "12130357D02*": 1, "X11878214Y": 1, "X11892500Y": 1, "12087500D01*": 1, "X11921071Y": 1, "X11949643Y": 1, "X12049643Y": 5, "11973214D02*": 1, "X12035357Y": 1, "12001786D01*": 1, "X12063928Y": 1, "X18121071Y": 2, "12688929D01*": 1, "X18106786Y": 2, "12646071D01*": 1, "X18092500Y": 2, "12617500D01*": 1, "X18063929Y": 2, "12574643D01*": 1, "X18049643Y": 2, "12560357D01*": 1, "X11292500Y": 4, "13163500D02*": 1, "G03X11292500Y": 2, "13163500I": 1, "X11621071Y": 1, "12999214D02*": 1, "X11649643Y": 1, "12999214D01*": 1, "13013500D01*": 1, "X11692500Y": 2, "13027786D01*": 1, "13056357D01*": 1, "13113500D01*": 1, "13184929D01*": 1, "13242071D01*": 1, "13270643D01*": 1, "X12706786Y": 1, "13509500D01*": 12, "X12735357Y": 1, "13495214D01*": 7, "X12778214Y": 1, "X12806786Y": 1, "X12821071Y": 2, "13538071D01*": 4, "13695214D01*": 9, "X12963928Y": 3, "13695214D02*": 1, "13523786D02*": 1, "X12978214Y": 1, "X13006786Y": 1, "X13049643Y": 1, "X13078214Y": 1, "X13092500Y": 3, "13538071D02*": 1, "X13106786Y": 1, "X13135357Y": 1, "X13178214Y": 1, "X13206786Y": 1, "X13221071Y": 2, "X13806786Y": 1, "13380929D02*": 1, "X13549643Y": 1, "13766643D01*": 1, "X14192500Y": 3, "13395214D02*": 3, "X14221071Y": 2, "13395214D01*": 5, "X14249643Y": 2, "13409500D01*": 4, "X14263928Y": 2, "13423786D01*": 4, "X14278214Y": 2, "13452357D01*": 4, "X14292500Y": 2, "13580929D01*": 4, "13638071D01*": 4, "13666643D01*": 5, "13680929D01*": 6, "X14163928Y": 2, "X14149643Y": 2, "X14135357Y": 2, "X14121071Y": 2, "X14421071Y": 4, "13666643D02*": 1, "X14435357Y": 1, "X14406786Y": 1, "X14621071Y": 3, "X14649643Y": 2, "X14678214Y": 2, "X14692500Y": 2, "X14706785Y": 2, "X14721071Y": 2, "X14592500Y": 2, "X14578214Y": 2, "X14563928Y": 2, "X14549643Y": 2, "X14821071Y": 1, "X15006785Y": 2, "X14906785Y": 1, "X14949643Y": 1, "X14978214Y": 1, "13523786D01*": 1, "X14992500Y": 1, "13566643D01*": 1, "14797538D01*": 2, "14697462D02*": 1, "X11192424Y": 1, "14747500D02*": 1, "14747500I": 1, "14883214D02*": 2, "X11549643Y": 1, "14883214D01*": 1, "14583214D01*": 1, "X11606786Y": 1, "14626071D01*": 1, "X11578214Y": 1, "14654643D01*": 1, "X18135357Y": 1, "15136357D01*": 1, "15064929D01*": 1, "15022071D01*": 1, "14993500D01*": 1, "14950643D01*": 1, "14936357D01*": 1, "Soldermask": 4, "Bot*": 4, "0.100000*": 7, "2.000000*": 2, "ADD13O": 4, "2.000000X2.000000*": 2, "2.400000X1.924000*": 4, "1.700000X1.700000*": 2, "ADD17C": 6, "1.700000*": 2, "ADD18C": 7, "2.398980*": 2, "2.300000X2.400000*": 2, "ADD20C": 6, "2.300000*": 2, "2.127200X2.127200*": 4, "ADD22O": 1, "1.400760*": 2, "1.797000*": 2, "2.000200*": 2, "X196250000Y": 24, "118000000D02*": 12, "X113000000Y": 24, "118000000D01*": 12, "52750000D02*": 12, "52750000D01*": 12, "X145400000Y": 15, "68800000D03*": 4, "58640000D03*": 4, "X189230000Y": 63, "61468000D03*": 16, "X191770000Y": 63, "74168000D03*": 15, "109728000D03*": 16, "97028000D03*": 15, "X118110000Y": 87, "X120650000Y": 94, "64008000D03*": 18, "66548000D03*": 14, "69088000D03*": 14, "71628000D03*": 14, "76708000D03*": 14, "79248000D03*": 14, "81788000D03*": 14, "84328000D03*": 14, "86868000D03*": 14, "89408000D03*": 14, "91948000D03*": 14, "94488000D03*": 14, "99568000D03*": 14, "102108000D03*": 14, "104648000D03*": 14, "107188000D03*": 14, "X135255000Y": 10, "61508000D03*": 4, "X164465000Y": 27, "85471000D03*": 4, "77851000D03*": 4, "X136017000Y": 8, "72644000D03*": 32, "X133477000Y": 8, "X173863000Y": 8, "X176403000Y": 8, "96139000D03*": 8, "96012000D03*": 24, "X127007800Y": 10, "61542700D03*": 8, "X129547800Y": 14, "64082700D03*": 8, "X166243000Y": 4, "67056000D03*": 4, "X164973000Y": 11, "68326000D03*": 4, "65786000D03*": 4, "X128143000Y": 8, "71374000D03*": 4, "X129413000Y": 8, "X126873000Y": 11, "X181737000Y": 8, "73914000D03*": 4, "X180467000Y": 8, "X183007000Y": 9, "94742000D03*": 4, "97282000D03*": 4, "X134239000Y": 22, "85344000D03*": 40, "77724000D03*": 40, "X145415000Y": 29, "X175641000Y": 23, "85217000D03*": 20, "77597000D03*": 20, "108966000D03*": 4, "101346000D03*": 4, "108458000D03*": 12, "100838000D03*": 12, "108585000D03*": 12, "100965000D03*": 12, "108839000D03*": 20, "101219000D03*": 20, "X169164000Y": 8, "62611000D03*": 8, "X161544000Y": 11, "59563000D03*": 8, "X129921000Y": 20, "X126365000Y": 18, "X180086000Y": 11, "X183515000Y": 20, "X179959000Y": 11, "X155000000Y": 8, "99000000D03*": 4, "88840000D03*": 4, "X137287000Y": 36, "X142367000Y": 28, "X148463000Y": 34, "X153543000Y": 16, "X172593000Y": 39, "X167513000Y": 21, "X161417000Y": 37, "X156337000Y": 19, "108712000D03*": 16, "101092000D03*": 16, "X157178971Y": 6, "64124429D03*": 8, "X150828971Y": 5, "Legend": 3, "Top*": 5, "0.187500*": 1, "0.125000*": 1, "ADD14C": 2, "ADD15C": 2, "0.120000*": 2, "ADD16C": 3, "0.002540*": 1, "0.170000*": 1, "ADD19C": 4, "0.175000*": 4, "ADD21C": 5, "0.190000*": 1, "X171964285Y": 1, "68083333D02*": 1, "X123317001Y": 1, "106767381D01*": 3, "X123650334Y": 3, "106767381D02*": 2, "X123745572Y": 2, "X123793191Y": 2, "106815000D01*": 2, "X123840810Y": 2, "106910238D01*": 2, "X123864619Y": 2, "107100714D01*": 2, "107434048D01*": 2, "107624524D01*": 2, "107719762D01*": 2, "107767381D01*": 2, "X123602715Y": 2, "X123555096Y": 2, "X123531286Y": 2, "X124031287Y": 1, "X196102429Y": 1, "69431810D01*": 1, "X193274334Y": 1, "66254381D02*": 3, "X193393381Y": 1, "67254381D01*": 6, "X193488619Y": 1, "66540095D01*": 1, "X193583857Y": 1, "X193702905Y": 1, "66254381D01*": 8, "X193869572Y": 1, "66968667D02*": 1, "X194107667Y": 1, "66968667D01*": 1, "X193821953Y": 1, "67254381D02*": 5, "X193988620Y": 1, "X194155286Y": 1, "X194321953Y": 3, "X194607667Y": 2, "X194393381Y": 1, "66682952D01*": 2, "66825810D01*": 1, "X194821953Y": 3, "66730571D02*": 1, "X194988619Y": 1, "66730571D01*": 2, "X195060048Y": 2, "X195274334Y": 2, "67063905D01*": 2, "X195298143Y": 1, "67159143D01*": 2, "X195321953Y": 1, "67206762D01*": 2, "X195369572Y": 1, "X195464810Y": 1, "X195512429Y": 1, "X195536238Y": 1, "X195560048Y": 2, "X195798144Y": 3, "X195988620Y": 2, "X196036239Y": 2, "66302000D01*": 1, "X196060048Y": 2, "66349619D01*": 1, "X196083858Y": 2, "66444857D01*": 1, "66587714D01*": 1, "66778190D01*": 2, "X193929096Y": 2, "64016000D02*": 1, "X193833858Y": 1, "63968381D01*": 6, "X193691001Y": 2, "X193548143Y": 2, "64016000D01*": 2, "X193452905Y": 2, "64111238D01*": 2, "X193405286Y": 2, "64206476D01*": 2, "X193357667Y": 2, "64396952D01*": 2, "64539810D01*": 4, "64730286D01*": 2, "64825524D01*": 2, "64920762D01*": 3, "64968381D01*": 5, "X193786239Y": 2, "X193976715Y": 2, "64873143D01*": 1, "X194405286Y": 2, "64968381D02*": 2, "X194976715Y": 2, "X195452905Y": 3, "X195691000Y": 2, "X195833858Y": 2, "X195929096Y": 2, "X195976715Y": 2, "X196024334Y": 2, "X193278286Y": 1, "61539429D02*": 1, "X194040191Y": 1, "61539429D01*": 1, "X193659239Y": 2, "61920381D02*": 1, "61158476D01*": 1, "X194992572Y": 2, "60920381D02*": 1, "X194516381Y": 2, "60920381D01*": 1, "X194468762Y": 1, "61396571D01*": 2, "61348952D01*": 2, "X194611619Y": 1, "61301333D01*": 2, "X194849715Y": 1, "X194944953Y": 1, "X186697905Y": 1, "84637524D01*": 1, "X186602667Y": 1, "84732762D01*": 1, "X186459809Y": 1, "84780381D01*": 3, "X186221714Y": 1, "X187174095Y": 3, "84494667D02*": 1, "X187650286Y": 1, "84494667D01*": 1, "X187078857Y": 1, "84780381D02*": 1, "X187412190Y": 1, "83780381D01*": 1, "X187745524Y": 2, "X185555048Y": 3, "81240381D02*": 1, "X185721715Y": 3, "82240381D01*": 6, "X185888381Y": 4, "81240381D01*": 6, "X186055048Y": 3, "82240381D02*": 3, "X186174095Y": 5, "X186245524Y": 2, "81288000D01*": 2, "X186293143Y": 2, "81383238D01*": 2, "X186316952Y": 2, "81478476D01*": 2, "X186340762Y": 2, "81668952D01*": 2, "81811810D01*": 2, "82002286D01*": 2, "82097524D01*": 2, "82192762D01*": 2, "X186555048Y": 3, "X186674095Y": 2, "X186745524Y": 5, "X186793143Y": 2, "X186816952Y": 2, "X186840762Y": 2, "X187031238Y": 1, "81954667D02*": 1, "X187269333Y": 2, "81954667D01*": 1, "X186983619Y": 1, "X187150286Y": 3, "X187316952Y": 1, "X185245524Y": 3, "79700381D02*": 2, "78700381D01*": 5, "X185483619Y": 2, "X185626477Y": 2, "78748000D01*": 3, "78843238D01*": 2, "X185769334Y": 2, "78938476D01*": 2, "X185816953Y": 2, "79128952D01*": 2, "79271810D01*": 2, "79462286D01*": 2, "79557524D01*": 2, "79652762D01*": 3, "79700381D01*": 5, "X186197905Y": 1, "79414667D02*": 1, "X186674096Y": 1, "79414667D01*": 1, "X186102667Y": 1, "X186436000Y": 1, "X186769334Y": 1, "X187674096Y": 2, "79605143D02*": 1, "X187626477Y": 2, "X187483620Y": 2, "X187388382Y": 2, "X187245524Y": 2, "X187102667Y": 2, "X187055048Y": 2, "78795619D01*": 1, "X185745524Y": 2, "77065143D02*": 1, "X185697905Y": 2, "77112762D01*": 2, "77160381D01*": 3, "X185459810Y": 4, "X185316952Y": 2, "X185221714Y": 2, "77017524D01*": 1, "X185174095Y": 2, "76922286D01*": 1, "X185126476Y": 2, "76731810D01*": 1, "76588952D01*": 1, "76398476D01*": 2, "76303238D01*": 2, "76208000D01*": 2, "76160381D01*": 5, "76255619D01*": 1, "77160381D02*": 4, "76636571D02*": 1, "76636571D01*": 1, "X187459809Y": 2, "X187364571Y": 1, "76446095D01*": 1, "X185491524Y": 4, "74525143D02*": 1, "X185443905Y": 4, "74572762D01*": 2, "X185301048Y": 4, "74620381D01*": 4, "X185205810Y": 4, "X185062952Y": 4, "X184967714Y": 4, "74477524D01*": 1, "X184920095Y": 4, "74382286D01*": 1, "X184872476Y": 4, "74191810D01*": 1, "74048952D01*": 2, "73858476D01*": 1, "73763238D01*": 1, "73668000D01*": 4, "73620381D01*": 6, "73715619D01*": 2, "X185920095Y": 6, "74620381D02*": 2, "74096571D02*": 1, "X186491524Y": 6, "74096571D01*": 1, "X186920095Y": 2, "73715619D02*": 1, "X186967714Y": 1, "X187062952Y": 1, "X187301048Y": 3, "X187396286Y": 3, "X187443905Y": 4, "X187491524Y": 6, "73810857D01*": 1, "73906095D01*": 1, "X186872476Y": 3, "71985143D02*": 1, "72032762D01*": 4, "72080381D01*": 4, "71937524D01*": 1, "71842286D01*": 1, "71651810D01*": 2, "71508952D01*": 2, "71318476D01*": 1, "71223238D01*": 1, "71128000D01*": 2, "71080381D01*": 5, "71175619D01*": 1, "72080381D02*": 2, "71556571D02*": 1, "71556571D01*": 2, "71080381D02*": 1, "X187158190Y": 1, "71461333D01*": 2, "71889905D01*": 1, "71985143D01*": 2, "X187015333Y": 1, "X186094762Y": 2, "68588000D02*": 1, "X186047143Y": 1, "68540381D01*": 7, "X185975715Y": 2, "X185904286Y": 2, "68588000D01*": 2, "X185856667Y": 2, "68683238D01*": 2, "X185832858Y": 2, "68778476D01*": 2, "X185809048Y": 2, "68968952D01*": 2, "69111810D01*": 4, "69302286D01*": 2, "69397524D01*": 2, "69492762D01*": 3, "69540381D01*": 6, "X186023334Y": 2, "X186118572Y": 2, "69445143D01*": 1, "X186332858Y": 2, "69540381D02*": 3, "X186618572Y": 2, "X186856668Y": 3, "X186975715Y": 2, "X187047144Y": 2, "X187094763Y": 2, "X187118572Y": 2, "X187142382Y": 2, "X187332858Y": 1, "69254667D02*": 1, "X187570953Y": 1, "69254667D01*": 1, "X187285239Y": 1, "X187451906Y": 1, "X187618572Y": 1, "67000381D02*": 2, "66000381D01*": 4, "66952762D02*": 1, "X186031238Y": 1, "67000381D01*": 2, "X186269334Y": 2, "X186364572Y": 2, "66952762D01*": 1, "X186412191Y": 2, "66905143D01*": 1, "X186459810Y": 3, "66809905D01*": 1, "66714667D01*": 1, "66619429D01*": 1, "66571810D01*": 1, "66524190D01*": 1, "X186078857Y": 2, "66476571D01*": 1, "X185983619Y": 2, "66428952D01*": 1, "X185936000Y": 2, "66381333D01*": 1, "66286095D01*": 1, "66190857D01*": 1, "66095619D01*": 1, "66048000D01*": 2, "X186316953Y": 1, "X186888381Y": 2, "X170488095Y": 1, "97273810D01*": 1, "X146122399Y": 1, "64195858D02*": 1, "X146884304Y": 1, "64195858D01*": 1, "X146503352Y": 2, "64576810D02*": 1, "63814905D01*": 1, "L2": 2, "Bot": 2, "X162816666Y": 2, "95670833D02*": 1, "X162883333Y": 2, "95637500D01*": 3, "X163016666Y": 2, "X163083333Y": 2, "95670833D01*": 2, "X163150000Y": 2, "95737500D01*": 2, "X163183333Y": 2, "95804166D01*": 6, "95937500D01*": 3, "96004166D01*": 2, "96070833D01*": 5, "96104166D01*": 4, "X162950000Y": 1, "95404166D02*": 1, "X163116666Y": 1, "95437500D01*": 1, "X163283333Y": 1, "95537500D01*": 4, "X163383333Y": 1, "95704166D01*": 2, "X163416666Y": 1, "95870833D01*": 3, "X157450000Y": 1, "X157483333Y": 2, "95837500D01*": 4, "X157550000Y": 1, "X156816666Y": 3, "95504166D02*": 2, "X156950000Y": 1, "95504166D01*": 4, "X157016666Y": 3, "X157050000Y": 1, "95570833D01*": 2, "X157116666Y": 3, "X157150000Y": 3, "96137500D01*": 4, "X157083333Y": 2, "96170833D01*": 6, "96204166D01*": 11, "X156883333Y": 5, "X156783333Y": 2, "X156750000Y": 2, "95904166D01*": 3, "95770833D01*": 3, "X156450000Y": 2, "95937500D02*": 1, "X155916666Y": 1, "X155616666Y": 3, "96170833D02*": 2, "X155516666Y": 1, "X155350000Y": 2, "X155283333Y": 2, "X155250000Y": 2, "X155216666Y": 3, "X155483333Y": 2, "X155550000Y": 2, "X155583333Y": 2, "X155316666Y": 1, "X155016666Y": 1, "95737500D02*": 3, "X154750000Y": 2, "X154916666Y": 2, "X154883333Y": 2, "X154816666Y": 1, "X154216666Y": 4, "X154516666Y": 2, "X154483333Y": 2, "X154416666Y": 1, "X154316666Y": 1, "X154250000Y": 4, "X153583333Y": 5, "96204166D02*": 1, "X153650000Y": 1, "X153783333Y": 1, "96795833D01*": 4, "X156850000Y": 1, "96762500D01*": 3, "96729166D01*": 5, "97429166D02*": 6, "X156516666Y": 1, "97395833D01*": 5, "X156550000Y": 2, "97329166D01*": 3, "X156183333Y": 2, "96962500D02*": 2, "X155650000Y": 1, "97162500D01*": 3, "97362500D01*": 2, "96729166D02*": 2, "X154683333Y": 2, "96962500D01*": 13, "97095833D02*": 2, "97029166D01*": 3, "X154183333Y": 1, "96995833D01*": 7, "X154116666Y": 1, "X154050000Y": 1, "X153516666Y": 4, "97062500D01*": 3, "X153550000Y": 1, "X153616666Y": 1, "X153750000Y": 3, "X153816666Y": 3, "97395833D02*": 2, "97429166D01*": 6, "X153850000Y": 2, "97262500D01*": 1, "97195833D01*": 2, "97129166D01*": 2, "X153183333Y": 4, "97662500D01*": 1, "96995833D02*": 1, "X153116666Y": 2, "X152983333Y": 2, "X152916666Y": 2, "X152883333Y": 2, "X152850000Y": 2, "97095833D01*": 1, "97295833D01*": 1, "X152550000Y": 6, "X152583333Y": 1, "X152516666Y": 1, "X151950000Y": 2, "X152016666Y": 2, "X152150000Y": 2, "X152216666Y": 2, "X152250000Y": 3, "X151916666Y": 2, "X151616666Y": 3, "X151583333Y": 1, "X151550000Y": 1, "X151483333Y": 1, "X151416666Y": 1, "87999998D02*": 1, "X168257101Y": 2, "89057099D01*": 1, "87999998D01*": 1, "89057099D02*": 1, "87965685D02*": 1, "87965685D01*": 1, "88100000D01*": 3, "85300000D02*": 1, "X175300000Y": 2, "92100000D01*": 2, "92100000D02*": 2, "X167700002Y": 2, "88907100D02*": 2, "90350000D01*": 1, "X159316814Y": 6, "80416329D02*": 2, "X159076741Y": 4, "80576741D01*": 2, "X158916329Y": 4, "80816814D01*": 2, "X158860000Y": 2, "81383186D01*": 2, "81623259D01*": 2, "81783671D01*": 2, "81840000D01*": 2, "X164083186Y": 1, "X176823872Y": 1, "82748661D01*": 1, "X176850260Y": 2, "82616000D01*": 1, "82265373D01*": 1, "X151860838Y": 1, "81760869D01*": 2, "X151114549Y": 1, "81487287D01*": 1, "X150320374Y": 1, "81520123D01*": 1, "X149739162Y": 1, "X149586248Y": 1, "82054317D01*": 2, "X148415000Y": 2, "81040874D01*": 1, "X148467041Y": 1, "80779242D01*": 1, "X148592092Y": 1, "80592091D01*": 1, "X148779241Y": 1, "80467042D01*": 1, "X149040874Y": 1, "80415000D01*": 3, "X159323495Y": 2, "80416329D01*": 3, "Paste": 2, "stable": 1, "03/23/17": 1, "40*": 1, "1.100000X2.400000*": 2, "ADD12O": 2, "2.000000X2.032000*": 1, "X153000000Y": 2, "135000000D03*": 8, "X151000000Y": 2, "X149000000Y": 2, "X147000000Y": 2, "X145000000Y": 2, "X143000000Y": 4, "X141000000Y": 2, "X139000000Y": 2, "119000000D03*": 8, "X94500000Y": 7, "125500000D03*": 3, "X97040000Y": 8, "X99580000Y": 8, "128500000D03*": 3, "131500000D03*": 3, "134500000D03*": 3, "137500000D03*": 2, "140500000D03*": 3, "143500000D03*": 3, "146500000D03*": 3, "ADD14O": 2, "1.200000*": 5, "87100000D03*": 4, "91600000D03*": 4, "0.375000*": 1, "0.254000*": 1, "ADD17O": 1, "X164233333Y": 3, "82450000D02*": 1, "X164133333Y": 4, "82483333D01*": 4, "X164100000Y": 4, "82516666D01*": 2, "X164066666Y": 2, "82583333D01*": 2, "82683333D01*": 4, "82750000D01*": 4, "82783333D01*": 5, "X164200000Y": 1, "82816666D01*": 8, "X164466666Y": 3, "82116666D01*": 3, "X164166666Y": 2, "82150000D01*": 1, "82183333D01*": 1, "82250000D01*": 1, "82316666D01*": 1, "82383333D01*": 8, "82416666D01*": 5, "82450000D01*": 3, "X163666666Y": 3, "82816666D02*": 4, "X163733333Y": 2, "X163766666Y": 2, "82350000D01*": 10, "X163566666Y": 2, "X163500000Y": 2, "X163466666Y": 2, "X163433333Y": 2, "X162833333Y": 4, "X162866666Y": 1, "X162933333Y": 1, "X163066666Y": 3, "X163133333Y": 3, "82783333D02*": 2, "X162900000Y": 2, "X163166666Y": 2, "82716666D01*": 1, "82650000D01*": 2, "82550000D01*": 2, "X162500000Y": 3, "82483333D02*": 1, "X162466666Y": 1, "X162433333Y": 1, "X162366666Y": 1, "X162300000Y": 1, "X161766666Y": 4, "X161833333Y": 2, "X161966666Y": 2, "X162033333Y": 2, "X162066666Y": 2, "X162100000Y": 2, "X160933333Y": 2, "82350000D02*": 1, "X160433333Y": 1, "X160733333Y": 1, "82050000D02*": 1, "82950000D01*": 1, "82650000D02*": 1, "X161000000Y": 1, "X160700000Y": 1, "82950000D02*": 1, "82050000D01*": 1, "X181899107Y": 6, "86482142D02*": 1, "X180756250Y": 1, "86482142D01*": 1, "X181327678Y": 6, "87053571D02*": 3, "85910714D01*": 2, "X179327678Y": 3, "85553571D02*": 3, "X180041964Y": 3, "85553571D01*": 7, "X180113392Y": 2, "86267857D01*": 3, "86196428D01*": 3, "X179899107Y": 2, "86125000D01*": 2, "X179541964Y": 6, "X179399107Y": 2, "X179256250Y": 2, "86410714D01*": 2, "86767857D01*": 1, "86910714D01*": 2, "86982142D01*": 3, "87053571D01*": 7, "X178827678Y": 4, "X178327678Y": 2, "X177827678Y": 1, "X176184821Y": 3, "X175827678Y": 2, "X175613392Y": 2, "85625000D01*": 1, "X175470535Y": 2, "85767857D01*": 1, "X175399107Y": 2, "X175327678Y": 2, "86696428D01*": 1, "86839285D01*": 1, "X174684821Y": 3, "86267857D02*": 1, "X174184821Y": 1, "X173970535Y": 2, "X173541964Y": 1, "X173041964Y": 1, "X172541964Y": 1, "X181041964Y": 5, "89678571D02*": 3, "X181541964Y": 1, "88964285D01*": 3, "88178571D01*": 4, "X181184821Y": 2, "88250000D01*": 1, "X181113392Y": 4, "88321428D01*": 1, "88464285D01*": 1, "88678571D01*": 1, "88821428D01*": 1, "88892857D01*": 1, "X180541964Y": 2, "88178571D02*": 5, "89678571D01*": 4, "X179184821Y": 1, "X178756250Y": 2, "X177970535Y": 4, "X176970535Y": 2, "90875000D02*": 1, "X181256250Y": 1, "90803571D01*": 6, "X181470535Y": 2, "X181684821Y": 2, "90875000D01*": 2, "X181827678Y": 2, "91017857D01*": 2, "91160714D01*": 2, "X181970535Y": 2, "91446428D01*": 2, "91660714D01*": 4, "91946428D01*": 2, "92089285D01*": 2, "92232142D01*": 3, "92303571D01*": 5, "92160714D01*": 1, "X180399107Y": 2, "92303571D02*": 2, "X178470535Y": 2, "X178256250Y": 2, "X178113392Y": 2, "X178041964Y": 2, "X164873000Y": 7, "87373000D02*": 2, "X154627000Y": 4, "87373000D01*": 5, "83127000D01*": 4, "LPC*": 2, "ADD15R": 2, "ADD19O": 1, "ADD20R": 2, "ADD22R": 4, "ADD23R": 1, "ADD24O": 1, "ADD25R": 1, "X181000000Y": 2, "96250000D02*": 1, "96750000D01*": 1, "X180750000Y": 2, "96500000D02*": 1, "X181250000Y": 2, "96500000D01*": 1, "97250000D02*": 1, "97250000D01*": 1, "X156000000Y": 1, "G03X156000000Y": 1, "92800000I": 1, "200000J0D01*": 1, "X174800000Y": 3, "84116666D02*": 1, "83416666D01*": 2, "X174966666Y": 2, "X175066666Y": 2, "83450000D01*": 1, "X175133333Y": 2, "83516666D01*": 1, "X175166666Y": 2, "83583333D01*": 1, "X175200000Y": 2, "83716666D01*": 1, "83816666D01*": 1, "83950000D01*": 1, "84016666D01*": 1, "84083333D01*": 1, "84116666D01*": 2, "X175500000Y": 1, "83750000D02*": 1, "X175733333Y": 1, "83750000D01*": 1, "97316666D02*": 2, "X161783333Y": 1, "96816666D01*": 1, "X162450000Y": 1, "97116666D02*": 1, "X162783333Y": 1, "97116666D01*": 1, "X162383333Y": 1, "X162616666Y": 1, "96616666D01*": 1, "X162850000Y": 1, "97316666D01*": 1, "X164950000Y": 2, "83300000D02*": 2, "X164250000Y": 2, "83300000D01*": 2, "82100000D02*": 2, "82100000D01*": 2, "X161950000Y": 2, "X173300000Y": 2, "87750000D02*": 1, "88450000D01*": 1, "X172100000Y": 2, "88450000D02*": 1, "87750000D01*": 1, "X180700000Y": 2, "91200000D02*": 1, "91200000D01*": 1, "90000000D02*": 1, "97149020D02*": 4, "94449020D01*": 4, "X168050000Y": 2, "X168950000Y": 1, "95649020D02*": 4, "X168700000Y": 2, "95649020D01*": 2, "X168850000Y": 1, "95799020D01*": 2, "X168450000Y": 3, "95899020D02*": 3, "X169150000Y": 3, "95899020D01*": 3, "95549020D02*": 4, "95199020D01*": 2, "95549020D01*": 2, "X171550000Y": 2, "X170050000Y": 2, "X170950000Y": 1, "X170700000Y": 2, "X170850000Y": 1, "X170450000Y": 1, "X175900000Y": 1, "86400000D02*": 1, "G03X175900000Y": 1, "86400000I": 1, "100000J0D01*": 1, "X176350000Y": 4, "86650000D02*": 2, "X175850000Y": 4, "86650000D01*": 2, "89550000D02*": 2, "89550000D01*": 2, "X182730000Y": 4, "87730000D02*": 2, "92810000D01*": 2, "92810000D02*": 2, "X185270000Y": 4, "87730000D01*": 2, "X185550000Y": 2, "84910000D02*": 1, "X175580000Y": 1, "92550000D01*": 2, "X175920000Y": 2, "92550000D02*": 1, "91550000D01*": 1, "X177280000Y": 2, "91550000D02*": 1, "X148000000Y": 2, "95350000D02*": 3, "83350000D01*": 3, "X134100000Y": 3, "83350000D02*": 1, "X152800000Y": 1, "X141352380Y": 1, "X140352380Y": 1, "X140495238Y": 1, "88945238D01*": 1, "X140590476Y": 1, "89040476D01*": 1, "X140638095Y": 1, "89135714D01*": 1, "1.600000*": 2, "1.600000X1.600000*": 2, "2.000000X1.524000*": 4, "1.300000X1.300000*": 2, "1.998980*": 2, "1.900000X2.000000*": 2, "1.900000*": 2, "1.000000*": 1, "1.727200X1.727200*": 4, "ADD23O": 3, "1.000760*": 2, "1.397000*": 2, "1.600200*": 2, "1.270000*": 2, "0.304800*": 2, "X125250000Y": 2, "112250000D03*": 2, "70500000D03*": 2, "X167250000Y": 2, "92250000D03*": 2, "80137000D03*": 4, "83439000D03*": 4, "X148336000Y": 6, "79629000D03*": 2, "83185000D03*": 2, "83312000D03*": 2, "80010000D03*": 2, "103505000D03*": 4, "106680000D03*": 2, "103378000D03*": 2, "106934000D03*": 6, "103759000D03*": 2, "83439000D02*": 2, "80137000D01*": 2, "83058000D02*": 1, "79629000D01*": 1, "83185000D02*": 1, "83058000D01*": 1, "83312000D02*": 1, "80010000D01*": 1, "106680000D02*": 1, "103505000D01*": 2, "106934000D02*": 3, "103378000D01*": 1, "103759000D01*": 1, "4.000000*": 1, "ADD16O": 1, "1.500000*": 1, "0.900000*": 1, "0.600000*": 1, "ADD33C": 1, "0.635000*": 1, "ADD34C": 1, "0.450000*": 1, "X189307143Y": 1, "112775000D02*": 1, "X188592857Y": 1, "112775000D01*": 1, "X189450000Y": 1, "113203571D02*": 1, "X188950000Y": 1, "111703571D01*": 1, "X191107143Y": 1, "58571429D01*": 1, "X191178571Y": 1, "58714286D01*": 1, "X191321429Y": 1, "58857143D01*": 3, "X191535714Y": 1, "58928571D01*": 4, "X191892857Y": 1, "X190392857Y": 2, "57428571D02*": 1, "58642857D01*": 2, "X190321429Y": 1, "58785714D01*": 2, "X190250000Y": 1, "X190107143Y": 1, "X189821429Y": 1, "X189678571Y": 1, "X189607143Y": 1, "X189535714Y": 2, "57428571D01*": 1, "X188821428Y": 1, "58357143D02*": 1, "X170107142Y": 1, "55928571D01*": 3, "X170392856Y": 2, "X170535713Y": 2, "55857143D01*": 1, "X170678570Y": 2, "55714286D01*": 1, "X170749999Y": 2, "55428571D01*": 1, "54928571D01*": 1, "54642857D01*": 1, "54500000D01*": 1, "54428571D01*": 3, "X169107141Y": 2, "55928571D02*": 1, "X168249998Y": 2, "68800000D02*": 1, "70800000D01*": 1, "X148800000Y": 2, "74200000D02*": 2, "X153200000Y": 2, "74200000D01*": 2, "X154947800Y": 10, "75947800D01*": 1, "75947800D02*": 1, "77858800D01*": 2, "70800000D02*": 1, "61508000D02*": 5, "58640000D01*": 1, "X142600000Y": 2, "61508000D01*": 4, "X148212542Y": 2, "64124429D01*": 3, "64008000D02*": 2, "X116908002Y": 2, "64008000D01*": 1, "X131147000Y": 2, "57400000D02*": 2, "X118100000Y": 2, "57400000D01*": 2, "X116100002Y": 4, "59399998D02*": 1, "63200000D02*": 2, "59399998D01*": 1, "63200000D01*": 2, "101092000D02*": 2, "108712000D01*": 3, "104037000D01*": 1, "X177103500Y": 2, "105300000D02*": 2, "X177998300Y": 3, "104405200D01*": 2, "X157600000Y": 6, "105300000D01*": 2, "104037000D02*": 1, "85344000D02*": 6, "81661000D01*": 1, "D32*": 23, "81661000D02*": 1, "81608700D01*": 9, "85598000D02*": 1, "D33*": 15, "85418700D02*": 6, "85598000D01*": 1, "77858800D02*": 1, "X154940000Y": 13, "77851000D01*": 1, "77851000D02*": 2, "77798700D01*": 5, "81534000D01*": 3, "81534000D02*": 2, "X167520800Y": 7, "108786700D02*": 5, "101219000D01*": 3, "101219000D02*": 2, "101166700D01*": 5, "108839000D02*": 6, "105029000D01*": 1, "105029000D02*": 1, "104976700D01*": 6, "X153550800Y": 10, "108786700D01*": 5, "X156344800Y": 7, "85418700D01*": 5, "101166700D02*": 5, "X155074800Y": 2, "X174632800Y": 4, "98118700D02*": 2, "X173870800Y": 6, "97356700D01*": 1, "97356700D02*": 2, "96086700D01*": 5, "X132468800Y": 4, "104976700D02*": 5, "X142374800Y": 8, "X136024800Y": 6, "96086700D02*": 4, "96856700D01*": 1, "X131960800Y": 8, "98880700D02*": 7, "104468700D01*": 2, "X132422800Y": 2, "98418700D02*": 2, "98880700D01*": 7, "X134462800Y": 2, "98418700D01*": 2, "96856700D02*": 1, "104468700D02*": 2, "104214700D02*": 1, "X152788800Y": 4, "104214700D01*": 1, "X177426800Y": 3, "104405200D02*": 1, "X177934800Y": 8, "X177172800Y": 4, "98118700D01*": 2, "73988700D02*": 3, "72718700D01*": 5, "74750700D02*": 4, "73988700D01*": 2, "81100700D02*": 2, "X132024300Y": 2, "81164200D01*": 1, "81164200D02*": 1, "75512700D02*": 7, "81100700D01*": 2, "74750700D01*": 4, "75512700D01*": 8, "81608700D02*": 8, "X132722800Y": 3, "X135262800Y": 2, "72718700D02*": 4, "X157106800Y": 2, "77798700D02*": 4, "80846700D01*": 2, "80846700D02*": 2, "X133484800Y": 6, "X133738800Y": 4, "72464700D01*": 1, "72464700D02*": 1, "X129420800Y": 6, "X180474800Y": 6, "X176410800Y": 2, "X166410164Y": 1, "67016464D02*": 2, "X166936536Y": 2, "67016464D01*": 1, "X169235300Y": 3, "64717700D02*": 1, "62558700D01*": 1, "64717700D01*": 1, "X165140164Y": 1, "68286464D02*": 1, "X163616164Y": 2, "68286465D01*": 1, "X159552164Y": 2, "64222465D02*": 2, "X157266164Y": 2, "64222465D01*": 2, "68286465D02*": 1, "X157262972Y": 1, "64194429D02*": 1, "D34*": 23, "X128150800Y": 14, "75004700D02*": 3, "71448700D01*": 1, "X128658800Y": 4, "75004700D01*": 3, "X129928800Y": 6, "76020700D02*": 2, "77544700D02*": 1, "76020700D01*": 2, "X127084050Y": 5, "75715950D02*": 2, "75584050D01*": 1, "75373000D02*": 1, "72644000D01*": 1, "75584050D02*": 1, "75373000D01*": 1, "76782700D02*": 2, "75715950D01*": 1, "X126880800Y": 4, "79576700D02*": 2, "76782700D01*": 2, "X126372800Y": 6, "81354700D02*": 2, "79576700D01*": 2, "85164700D02*": 5, "81354700D01*": 2, "X181744800Y": 10, "X179966800Y": 9, "77290700D01*": 1, "X181236800Y": 4, "77290700D02*": 1, "X180220800Y": 3, "77544700D01*": 1, "X183522800Y": 3, "X183014800Y": 3, "100658700D02*": 1, "100912700D01*": 1, "99388700D02*": 2, "100658700D01*": 2, "99388700D01*": 2, "98372700D02*": 2, "98372700D01*": 2, "108585000D02*": 5, "106115000D01*": 1, "X183600000Y": 4, "96605000D02*": 1, "96012000D01*": 1, "98100000D02*": 1, "96605000D01*": 1, "X181700000Y": 4, "100000000D02*": 1, "98100000D01*": 1, "104300000D02*": 1, "100000000D01*": 1, "106115000D02*": 1, "104300000D01*": 1, "84328000D02*": 2, "X122828000Y": 2, "84328000D01*": 1, "X127000000Y": 2, "X131483000Y": 2, "85344000D01*": 4, "X125100000Y": 2, "X123200000Y": 12, "86200000D01*": 1, "86200000D02*": 1, "84700000D01*": 1, "84700000D02*": 1, "X122900000Y": 3, "84400000D01*": 2, "83439000D01*": 2, "80137000D02*": 2, "77724000D01*": 4, "X137040800Y": 4, "X137294800Y": 2, "X134246800Y": 2, "85164700D01*": 3, "86868000D02*": 2, "X121668000Y": 2, "86868000D01*": 1, "X123900000Y": 2, "89100000D02*": 3, "X122800000Y": 5, "88000000D01*": 2, "X141659000Y": 2, "89100000D01*": 1, "83185000D01*": 1, "79502000D02*": 1, "79629000D02*": 1, "79502000D01*": 1, "X148470800Y": 2, "X145422800Y": 5, "91948000D02*": 2, "X123152000Y": 2, "91948000D01*": 1, "X141100000Y": 2, "X123800000Y": 2, "X123300000Y": 2, "91800000D01*": 2, "X165237000Y": 2, "92700000D02*": 2, "X142500000Y": 2, "92700000D01*": 2, "X142050000Y": 2, "92250000D02*": 2, "85217000D02*": 2, "X172720000Y": 4, "85217000D01*": 3, "83312000D01*": 1, "X172600800Y": 1, "X172854800Y": 1, "89408000D02*": 2, "X122108000Y": 2, "89408000D01*": 1, "X142100000Y": 2, "91000000D02*": 1, "X158936000Y": 2, "85471000D02*": 1, "90200000D01*": 1, "80010000D02*": 1, "X161424800Y": 1, "X165234800Y": 1, "104648000D02*": 3, "X122548000Y": 2, "104648000D01*": 4, "X123500000Y": 4, "105600000D02*": 1, "X122750000Y": 2, "104850000D01*": 2, "110100000D02*": 1, "105600000D01*": 1, "X124900000Y": 2, "111500000D02*": 3, "110100000D01*": 1, "X131100000Y": 2, "111500000D01*": 1, "X134142000Y": 2, "108458000D01*": 4, "108458000D02*": 2, "106680000D01*": 1, "103505000D02*": 2, "108532700D02*": 3, "108532700D01*": 1, "X120653400Y": 1, "104651400D02*": 1, "X116100000Y": 6, "105700000D02*": 1, "105400000D01*": 1, "110559000D02*": 1, "X171100000Y": 8, "115100000D01*": 2, "115100000D02*": 2, "X119900000Y": 2, "111300000D01*": 1, "111300000D02*": 1, "105700000D01*": 1, "110559000D01*": 1, "X116852000Y": 2, "105400000D02*": 1, "108712000D02*": 2, "106934000D01*": 3, "103378000D02*": 1, "101092000D01*": 2, "108585000D01*": 1, "65786000D02*": 1, "61515307D01*": 1, "X164700000Y": 2, "61242307D02*": 1, "X163108164Y": 2, "59650464D01*": 4, "59650464D02*": 4, "X161584164Y": 1, "59650465D01*": 1, "61515307D02*": 1, "61242307D01*": 1, "95832700D02*": 1, "95832700D01*": 1, "100912700D02*": 1, "94816700D01*": 1, "104722700D02*": 1, "102944700D01*": 1, "102944700D02*": 1, "100150700D01*": 1, "100150700D02*": 1, "104722700D01*": 1, "107188000D02*": 2, "X122488000Y": 4, "107188000D01*": 1, "X141800000Y": 2, "112700000D02*": 4, "109085000D01*": 2, "X124100000Y": 2, "112700000D01*": 2, "X122600000Y": 7, "111200000D01*": 2, "107300000D02*": 1, "107300000D01*": 1, "108966000D02*": 1, "X144660800Y": 1, "109728000D02*": 1, "111350000D01*": 1, "X160300000Y": 2, "113900000D02*": 3, "113900000D01*": 1, "X120900000Y": 2, "111600000D01*": 2, "109735000D01*": 2, "111350000D02*": 1, "103759000D02*": 1, "108839000D01*": 1, "61468000D02*": 3, "60190000D01*": 1, "X124665100Y": 2, "59200000D02*": 2, "61542700D01*": 1, "X119100000Y": 2, "59200000D01*": 2, "60190000D02*": 1, "X122968000Y": 2, "61468000D01*": 1, "X124882700Y": 2, "64082700D02*": 6, "64082700D01*": 10, "X124000000Y": 4, "62500000D02*": 1, "62500000D01*": 1, "81788000D02*": 2, "81788000D01*": 1, "81900000D01*": 3, "X127400000Y": 2, "87100000D02*": 4, "X125500000Y": 2, "87100000D01*": 2, "81900000D02*": 1, "X122500000Y": 1, "X124300000Y": 4, "85900000D02*": 1, "85900000D01*": 1, "86579000D02*": 1, "X129400000Y": 2, "86579000D01*": 1, "94488000D02*": 2, "X123012000Y": 2, "94488000D01*": 1, "X140500000Y": 7, "93400000D02*": 2, "X139400000Y": 7, "92300000D01*": 2, "92300000D02*": 2, "X125200000Y": 2, "94300000D01*": 2, "87214000D02*": 2, "X142700000Y": 2, "94900000D02*": 2, "X141200000Y": 2, "93400000D01*": 2, "X166500000Y": 2, "94900000D01*": 2, "90300000D02*": 2, "X177000000Y": 2, "90300000D01*": 2, "102108000D02*": 2, "X123408000Y": 2, "102108000D01*": 2, "X124500000Y": 4, "103200000D02*": 1, "X123250000Y": 2, "101950000D01*": 2, "109300000D02*": 1, "103200000D01*": 1, "X125600000Y": 2, "110400000D02*": 3, "109300000D01*": 1, "X127900000Y": 2, "110400000D01*": 1, "X129842000Y": 2, "X115800000Y": 2, "102600000D02*": 1, "X116300000Y": 2, "102100000D01*": 2, "110841000D02*": 1, "X174400000Y": 2, "116400000D01*": 2, "116400000D02*": 2, "X118500000Y": 2, "X114800000Y": 4, "103600000D01*": 1, "103600000D02*": 1, "102600000D01*": 1, "110841000D01*": 1, "102100000D02*": 2, "X118102000Y": 2, "71628000D02*": 2, "X115400000Y": 6, "71628000D01*": 1, "X114600000Y": 4, "64700000D02*": 1, "65500000D01*": 1, "65500000D02*": 1, "71800000D01*": 2, "X159811000Y": 2, "62611000D02*": 1, "62611000D01*": 2, "60400000D02*": 1, "58667000D02*": 1, "60400000D01*": 1, "X153733000Y": 2, "54800000D02*": 2, "58667000D01*": 1, "X117400000Y": 2, "54800000D01*": 2, "57600000D02*": 2, "64700000D01*": 1, "97300000D02*": 3, "X151200000Y": 2, "97300000D01*": 2, "X158600000Y": 2, "97200000D02*": 4, "X169200000Y": 3, "97200000D01*": 8, "X158200000Y": 2, "96800000D02*": 2, "X151700000Y": 2, "96800000D01*": 2, "X170900000Y": 2, "98900000D02*": 5, "X173500000Y": 2, "98900000D01*": 5, "X175565000Y": 2, "100965000D02*": 3, "97965000D02*": 1, "X164400000Y": 1, "97900000D01*": 1, "97965000D01*": 1, "101346000D02*": 1, "100965000D01*": 1, "X138400000Y": 2, "X138700000Y": 2, "X136200000Y": 2, "X134262000Y": 2, "100838000D02*": 4, "X140400000Y": 3, "X145500000Y": 6, "97500000D02*": 1, "97285000D02*": 1, "97500000D01*": 1, "97285000D01*": 1, "94700000D02*": 2, "96200000D01*": 1, "96200000D02*": 1, "X171700000Y": 2, "93200000D02*": 2, "X183300000Y": 3, "93200000D01*": 3, "95300000D01*": 1, "95300000D02*": 1, "93800000D02*": 1, "X183250000Y": 1, "93150000D02*": 1, "X185900000Y": 4, "95800000D01*": 1, "98580000D01*": 2, "95800000D02*": 1, "X183700000Y": 1, "92900000D02*": 1, "X186316800Y": 6, "90283200D01*": 1, "90283200D02*": 1, "X185618300Y": 2, "68273700D02*": 7, "X180093800Y": 5, "68273700D01*": 9, "68972200D02*": 1, "X185935800Y": 2, "68591200D01*": 1, "68591200D02*": 1, "68972200D01*": 1, "100838000D01*": 2, "X126338000Y": 2, "X125000000Y": 4, "99500000D01*": 1, "99500000D02*": 1, "95200000D01*": 1, "95200000D02*": 1, "X126700000Y": 2, "93500000D01*": 2, "93500000D02*": 2, "X138200000Y": 2, "94700000D01*": 1, "X139200000Y": 1, "75500000D02*": 5, "X170010000Y": 4, "76285000D01*": 1, "X165250000Y": 2, "75500000D01*": 4, "X171250000Y": 2, "76285000D02*": 1, "X173544000Y": 2, "77597000D01*": 2, "77724000D02*": 2, "75665000D01*": 1, "X144000000Y": 2, "74250000D02*": 2, "74250000D01*": 3, "75665000D02*": 1, "77511000D01*": 1, "77511000D02*": 1, "X136500000Y": 2, "75250000D01*": 2, "75250000D02*": 2, "X139500000Y": 2, "71250000D01*": 1, "71250000D02*": 1, "X137750000Y": 2, "68500000D01*": 2, "68500000D02*": 2, "X129250000Y": 5, "68750000D01*": 4, "77597000D02*": 2, "X126347000Y": 2, "74450000D01*": 1, "74450000D02*": 1, "73050000D01*": 1, "73050000D02*": 1, "X127500000Y": 2, "68750000D02*": 3, "X129000000Y": 2, "68202200D01*": 1, "68202200D02*": 1, "61542700D02*": 1, "X131000000Y": 3, "X159974000Y": 2, "67750000D02*": 2, "X150322000Y": 2, "67750000D01*": 2, "X146642000Y": 2, "64070000D01*": 2, "64070000D02*": 2, "X142070000Y": 5, "X168726300Y": 2, "X163224000Y": 2, "71000000D02*": 2, "71000000D01*": 2, "X171457800Y": 2, "X169806800Y": 1, "X142438300Y": 1, "X130817800Y": 2, "X171521300Y": 4, "59637700D02*": 1, "X169204164Y": 1, "X171534064Y": 2, "68210200D01*": 1, "68210200D02*": 1, "MADE": 1, "WITH": 1, "FRITZING*": 1, "WWW.FRITZING.ORG*": 1, "DOUBLE": 1, "SIDED*": 1, "HOLES": 1, "PLATED*": 1, "CONTOUR": 2, "ON": 1, "CENTER": 1, "OF": 1, "VECTOR*": 1, "ASAXBY*": 1, "FSLAX23Y23*": 1, "MOIN*": 1, "OFA0B0*": 1, "SFA1.0B1.0*": 1, "ADD10R": 1, "1.267940X2.408830*": 1, "0.008000*": 1, "0.008*": 1, "LNCONTOUR*": 1, "G90*": 1, "G70*": 1, "G54D10*": 1, "G54D11*": 1, "X4Y2405D02*": 1, "X1264Y2405D01*": 1, "X1264Y4D01*": 1, "X4Y4D01*": 1, "X4Y2405D01*": 1, "D02*": 1, "End": 1, "of": 1, "contour*": 1, "Profile": 1, "NP*": 1 }, "Git Attributes": { ".emacs.d/lisp/*": 1, "linguist": 6, "-": 6, "vendored": 1, "share/man/*": 1, "documentation": 1, "*.colorscheme": 1, "language": 4, "INI": 2, "Shell.profile": 1, "sessionui.rc": 1, "XML": 2, "konsoleui.rc": 1 }, "Git Config": { "[": 24, "alias": 3, "]": 24, "br": 1, "branch": 7, "ci": 1, "commit": 17, "co": 1, "checkout": 6, "d": 3, "diff": 12, "-": 331, "w": 8, "HEAD": 10, "dc": 1, "cached": 3, "ds": 1, "staged": 1, "g": 1, "grep": 2, "break": 1, "heading": 1, "line": 2, "number": 1, "h": 1, "log": 28, "pretty": 8, "oneline": 7, "decorate": 7, "abbrev": 7, "date": 3, "short": 2, "hist": 2, "format": 8, "lgp": 1, "p": 7, "lgs": 1, "stat": 3, "lol": 1, "graph": 9, "lola": 1, "all": 6, "lolar": 1, "reverse": 2, "ls": 4, "files": 4, "push": 9, "pr": 1, "pull": 6, "rebase": 10, "st": 1, "status": 7, "sta": 1, "sts": 1, "s": 6, "wc": 1, "whatchanged": 1, "medium": 1, "ga": 1, "add": 2, "gb": 1, "gba": 1, "a": 4, "gc": 1, "v": 7, "gca": 1, "gcf": 1, "fixup": 1, "gcl": 1, "config": 2, "list": 2, "gclean": 1, "reset": 7, "hard": 3, "&&": 7, "git": 12, "clean": 2, "dfx": 1, "gcm": 1, "master": 6, "gcmsg": 1, "m": 1, "gco": 1, "gcount": 1, "shortlog": 3, "sn": 1, "gcp": 1, "cherry": 1, "pick": 1, "gf": 1, "fetch": 2, "gfr": 1, "remotes/origin/master": 1, "gg": 1, "gui": 2, "citool": 2, "gga": 1, "amend": 6, "ggpnp": 1, "origin": 7, "(": 5, "current_branch": 5, ")": 5, "ggpull": 1, "ggpur": 1, "ggpush": 1, "gignore": 1, "update": 5, "index": 4, "assume": 4, "unchanged": 3, "gignored": 1, "|": 1, "gl": 1, "glg": 1, "max": 2, "count": 2, "glgg": 1, "glgga": 1, "glo": 1, "color": 8, "glog": 1, "glp": 1, "_git_log_prettily": 1, "gm": 1, "merge": 2, "gmt": 1, "mergetool": 1, "no": 4, "prompt": 1, "gpoat": 1, "tags": 4, "gr": 1, "remote": 9, "grba": 1, "abort": 1, "grbc": 1, "continue": 1, "grbi": 1, "i": 3, "grh": 1, "grhh": 1, "gri": 1, "interactive": 1, "grmv": 1, "rename": 1, "grrm": 1, "remove": 2, "grset": 1, "set": 1, "url": 11, "grt": 1, "grup": 1, "grv": 1, "gss": 1, "gst": 1, "gsta": 1, "stash": 6, "gstd": 1, "drop": 1, "gstp": 1, "pop": 2, "gsts": 1, "show": 5, "text": 1, "gunignore": 1, "gsd": 1, "svn": 4, "dcommit": 3, "gsr": 1, "github": 1, "svntrunk": 1, "#": 8, "back": 1, "branches": 3, "branchout": 1, "b": 1, "name": 2, "rev": 1, "parse": 1, "ref": 1, "contributors": 2, "n": 2, "down": 1, "discard": 1, "dump": 1, "cat": 2, "file": 2, "filetrail": 1, "follow": 3, "remotes": 3, "order": 1, "history": 1, "ignore": 1, "ignored": 2, "o": 1, "exclude": 1, "standard": 1, "Show": 1, "by": 1, "invert": 1, "revert": 1, "incoming": 1, "orgin/master": 3, "only": 3, "what": 3, "is": 2, "in": 2, "that": 2, "isn": 2, "last": 1, "logs": 1, "mergetrail": 1, "ancestry": 1, "path": 7, "merges": 1, "move": 1, "mv": 1, "nevermind": 1, "f": 1, "outgoing": 1, "praise": 1, "blame": 1, "precommit": 1, "word": 3, "regex": 1, "prestage": 1, "rm": 2, "resave": 1, "rewrite": 1, "ru": 1, "since": 3, "#rushes": 1, "rushes": 1, "save": 1, "am": 1, "shop": 1, "stashes": 1, "summary": 2, "u": 1, "tag": 2, "type": 1, "t": 1, "uncommit": 1, "mixed": 1, "undo": 1, "soft": 1, "unignore": 1, "changed": 2, "unmerged": 2, "merged": 1, "filter": 1, "U": 1, "unstage": 1, "q": 1, "unstash": 1, "untrack": 1, "r": 1, "up": 2, "pup": 1, "pupup": 1, "submodule": 6, "vendor/CodeMirror": 1, "https": 6, "vendor/grammars/ABNF.tmbundle": 1, "vendor/grammars/Agda.tmbundle": 1, "vendor/grammars/Alloy.tmbundle": 1, "vendor/grammars/Assembly": 1, "Syntax": 2, "Definition": 2, "vendor/grammars/AutoHotkey": 1, "l": 2, "di": 1, "c": 1, "clone": 1, "recursive": 1, "ca": 1, "A": 1, "av": 1, "go": 1, "aliases": 1, "get": 1, "regexp": 1, "reuse": 1, "message": 1, "credit": 1, "reb": 1, "retag": 1, "fb": 1, "ft": 1, "fc": 1, "fm": 1, "dm": 1, "numbered": 1, "mpr": 1, "apply": 1, "whitespace": 2, "fix": 1, "core": 1, "excludesfile": 1, "/.gitignore": 1, "attributesfile": 1, "/.gitattributes": 1, "space": 2, "before": 1, "tab": 2, "indent": 1, "with": 1, "non": 1, "trailing": 1, "trustctime": 1, "false": 2, "precomposeunicode": 1, "untrackedCache": 1, "true": 4, "ui": 1, "auto": 1, "current": 1, "yellow": 4, "local": 1, "green": 3, "meta": 1, "bold": 2, "frag": 1, "magenta": 1, "info": 1, "old": 1, "red": 1, "deletions": 1, "new": 1, "additions": 1, "added": 1, "untracked": 1, "cyan": 1, "gpgsign": 1, "renames": 1, "copies": 1, "textconv": 1, "hexdump": 1, "C": 1, "help": 1, "autocorrect": 1, "default": 1, "simple": 1, "followTags": 1, "insteadOf": 4, "pushInsteadOf": 4 }, "Glyph Bitmap Distribution Format": { "STARTFONT": 1, "COMMENT": 3, "Copyright": 1, "(": 1, "c": 1, ")": 1, "Aaron": 1, "Christianson": 1, "ninjaaron@gmail.com": 1, "licenced": 1, "under": 1, "the": 1, "OFL": 1, "FONT": 1, "-": 55, "aaron": 1, "bitbuntu": 1, "medium": 1, "r": 1, "normal": 1, "C": 1, "iSO8859": 1, "SIZE": 1, "FONTBOUNDINGBOX": 1, "STARTPROPERTIES": 1, "FONTNAME_REGISTRY": 1, "FOUNDRY": 1, "FAMILY_NAME": 1, "WEIGHT_NAME": 1, "SLANT": 1, "SETWIDTH_NAME": 1, "ADD_STYLE_NAME": 1, "PIXEL_SIZE": 1, "POINT_SIZE": 1, "RESOLUTION_X": 1, "RESOLUTION_Y": 1, "SPACING": 1, "AVERAGE_WIDTH": 1, "CHARSET_REGISTRY": 1, "CHARSET_ENCODING": 1, "COPYRIGHT": 1, "FACE_NAME": 1, "WEIGHT": 1, "X_HEIGHT": 1, "QUAD_WIDTH": 1, "_ORIGINAL_FONT_NAME": 1, "_GBDFED_INFO": 1, "DEFAULT_CHAR": 1, "FONT_DESCENT": 1, "FONT_ASCENT": 1, "ENDPROPERTIES": 1, "CHARS": 1, "STARTCHAR": 190, "char32": 1, "ENCODING": 190, "SWIDTH": 190, "DWIDTH": 190, "BBX": 190, "BITMAP": 190, "ENDCHAR": 190, "char33": 2, "char34": 1, "A0": 26, "char35": 1, "F8": 10, "char36": 1, "F0": 38, "char37": 1, "C0": 33, "D8": 4, "char38": 1, "char39": 1, "char40": 1, "char41": 1, "char42": 1, "A8": 13, "char43": 1, "char44": 1, "char45": 1, "char46": 1, "char47": 1, "char48": 1, "char49": 1, "char50": 1, "char51": 1, "E0": 51, "char52": 1, "char53": 1, "char54": 1, "char55": 1, "char56": 1, "char57": 1, "char58": 1, "char59": 1, "char60": 1, "char61": 1, "char62": 1, "char63": 2, "char64": 1, "B0": 9, "D0": 8, "char65": 2, "char66": 1, "char67": 2, "QUOTE": 1, "THIS": 1, "SHIT": 1, "char68": 2, "char69": 5, "char70": 1, "char71": 1, "char72": 1, "char73": 5, "char74": 1, "char75": 1, "char76": 1, "char77": 1, "char78": 1, "char79": 1, "char80": 1, "char81": 1, "char82": 1, "char83": 1, "char84": 1, "char85": 5, "char86": 1, "char87": 1, "char88": 1, "char89": 2, "char90": 1, "char91": 1, "char92": 1, "char93": 1, "char94": 1, "char95": 1, "char96": 1, "char97": 2, "char98": 1, "char99": 3, "char100": 1, "char101": 5, "char102": 1, "char103": 1, "char104": 1, "char105": 5, "char106": 1, "char107": 1, "char108": 1, "char109": 1, "char110": 3, "char111": 1, "char112": 3, "char113": 1, "char114": 1, "char115": 1, "char116": 1, "char117": 5, "char118": 1, "char119": 1, "char120": 1, "char121": 3, "char122": 1, "char123": 1, "char124": 1, "char125": 1, "char126": 1, "char128": 1, "C8": 1, "char163": 1, "char164": 1, "char165": 1, "char166": 1, "char167": 1, "char168": 1, "char169": 2, "B4": 3, "C4": 1, "char170": 1, "char187": 2, "char172": 1, "BC": 1, "AC": 1, "char175": 1, "char176": 1, "char177": 1, "char178": 1, "char179": 3, "char180": 1, "char181": 1, "char182": 1, "E8": 3, "char183": 1, "char184": 1, "char185": 1, "char186": 1, "3C": 2, "char189": 1, "1C": 1, "char196": 5, "char197": 1, "7C": 2, "9C": 1, "char214": 8, "char215": 1, "char248": 2, "char223": 1, "char228": 5, "char229": 1, "6C": 1, "char240": 1, "char246": 2, "char247": 1, "ENDFONT": 1 }, "Gnuplot": { "set": 98, "label": 14, "at": 14, "-": 92, "left": 15, "norotate": 18, "back": 23, "textcolor": 13, "rgb": 8, "nopoint": 14, "offset": 25, "character": 22, "lt": 15, "style": 7, "line": 4, "linetype": 11, "linecolor": 4, "linewidth": 11, "pointtype": 4, "pointsize": 4, "default": 4, "pointinterval": 4, "noxtics": 2, "noytics": 2, "title": 13, "xlabel": 6, "xrange": 3, "[": 18, "]": 18, "noreverse": 13, "nowriteback": 12, "yrange": 4, "bmargin": 1, "unset": 2, "colorbox": 3, "plot": 3, "cos": 9, "(": 33, "x": 7, ")": 32, "ls": 4, ".2": 1, ".4": 1, ".6": 1, ".8": 1, "lc": 3, "dummy": 3, "u": 25, "v": 31, "arrow": 7, "from": 7, "to": 7, "head": 7, "nofilled": 7, "parametric": 3, "view": 3, "samples": 3, "isosamples": 3, "hidden3d": 2, "trianglepattern": 2, "undefined": 2, "altdiagonal": 2, "bentover": 2, "ztics": 2, "norangelimit": 3, "font": 8, "ylabel": 5, "rotate": 3, "by": 3, "zlabel": 4, "zrange": 2, "sinc": 13, "sin": 3, "sqrt": 4, "u**2": 4, "+": 6, "v**2": 4, "/": 2, "GPFUN_sinc": 2, "xx": 2, "dx": 2, "x0": 4, "x1": 4, "x2": 4, "x3": 4, "x4": 4, "x5": 4, "x6": 4, "x7": 4, "x8": 4, "x9": 4, "xmin": 3, "xmax": 1, "n": 1, "zbase": 2, "splot": 3, ".5": 2, "3*n": 1, "floor": 3, "u/3": 1, "*dx": 1, "%": 2, "u/3.*dx": 1, "1/0": 1, "notitle": 15, "<0.5>": 1, "1": 10, "0": 9, "5": 9, "border": 3, "angles": 1, "degrees": 1, "mapping": 1, "spherical": 1, "noztics": 1, "urange": 1, "vrange": 1, "cblabel": 1, "cbrange": 1, "user": 1, "vertical": 2, "origin": 1, "screen": 2, "size": 1, "front": 1, "bdefault": 1, "*cos": 1, "*sin": 1, "with": 3, "lines": 2, "using": 2, "labels": 1, "point": 1, "pt": 2, "lw": 1, ".1": 1, "tc": 1, "pal": 1, "SHEBANG#!gnuplot": 1, "reset": 1, "terminal": 1, "png": 1, "output": 1, "#set": 2, "xr": 1, "yr": 1, "boxwidth": 1, "absolute": 1, "fill": 1, "solid": 1, "key": 1, "inside": 1, "right": 1, "top": 1, "Right": 1, "noenhanced": 1, "autotitles": 1, "nobox": 1, "histogram": 1, "clustered": 1, "gap": 1, "datafile": 1, "missing": 1, "data": 1, "histograms": 1, "xtics": 3, "in": 1, "scale": 1, "nomirror": 1, "autojustify": 1, "i": 1, "xtic": 1, "ti": 4, "col": 4 }, "Go": { "package": 3, "proto": 1, "import": 4, "proto1": 1, "math": 1, "var": 7, "_": 6, "proto1.Marshal": 1, "math.Inf": 1, "//": 1, "type": 3, "ClientCmdID": 2, "struct": 3, "{": 19, "WallTime": 1, "int64": 4, "protobuf": 2, "json": 3, "Random": 1, "XXX_unrecognized": 1, "[": 6, "]": 6, "byte": 6, "}": 19, "func": 13, "(": 34, "m": 3, "*ClientCmdID": 2, ")": 34, "Reset": 1, "*m": 1, "String": 1, "string": 4, "return": 12, "proto1.CompactTextString": 1, "linguist": 1, "thrift.ZERO": 1, "fmt.Printf": 1, "bytes.Equal": 1, "init": 1, "resource": 1, "bindataRead": 2, "data": 2, "name": 4, "error": 2, "gz": 2, "err": 7, "gzip.NewReader": 1, "bytes.NewBuffer": 1, "if": 3, "nil": 8, "fmt.Errorf": 2, "buf": 2, "bytes.Buffer": 1, "io.Copy": 1, "&": 1, "clErr": 2, "gz.Close": 1, "buf.Bytes": 1, "asset": 1, "bytes": 1, "info": 1, "os.FileInfo": 1, "bindataFileInfo": 7, "size": 1, "mode": 1, "os.FileMode": 2, "modTime": 1, "time.Time": 2, "fi": 6, "Name": 1, "fi.name": 1, "Size": 1, "fi.size": 1, "Mode": 1, "fi.mode": 1, "ModTime": 1, "fi.modTime": 1, "IsDir": 1, "bool": 1, "false": 1, "Sys": 1, "interface": 1, "_uiCssAppCss": 2, "uiCssAppCssBytes": 1, "uiCssAppCss": 1 }, "Golo": { "module": 27, "samples.CollectionLiterals": 1, "local": 27, "function": 87, "play_with_tuples": 2, "{": 160, "let": 91, "hello": 6, "[": 33, "]": 33, "foreach": 11, "str": 2, "in": 11, "print": 1, "(": 656, "+": 121, ")": 656, "}": 160, "println": 170, "get": 16, "join": 3, "play_with_literals": 2, "data": 4, "tuple": 1, "array": 2, "set": 13, "map": 10, "vector": 1, "list": 27, "each": 1, "|": 234, "element": 8, "toString": 5, "getClass": 3, "main": 27, "args": 44, "#": 18, "samples.TemplatesChatWebapp": 1, "import": 32, "java.lang": 2, "java.io": 1, "java.net.InetSocketAddress": 2, "com.sun.net.httpserver": 2, "redirect": 2, "exchange": 27, "to": 3, "getResponseHeaders": 4, "sendResponseHeaders": 4, "close": 5, "respond": 2, "body": 3, "length": 8, "getResponseBody": 3, "write": 3, "getBytes": 3, "extract_post": 2, "posts": 7, "reader": 4, "BufferedReader": 1, "InputStreamReader": 1, "getRequestBody": 1, "var": 5, "line": 5, "readLine": 2, "while": 2, "isnt": 1, "null": 2, "if": 7, "startsWith": 3, "add": 22, "java.net.URLDecoder.decode": 1, "substring": 1, "index": 2, "template": 2, "getRequestMethod": 1, "else": 5, "index_template": 2, "-": 67, "index_tpl": 2, "gololang.TemplateEngine": 1, "compile": 1, "server": 8, "HttpServer.create": 2, "InetSocketAddress": 2, "createContext": 3, "bindTo": 5, "start": 10, "samples.MemoizeDecorator": 1, "gololang.Decorators": 3, "java.lang.System": 2, "memo": 1, "memoizer": 1, "@memo": 2, "fib": 15, "n": 17, "<": 6, "return": 28, "foo": 17, "run": 7, "System.currentTimeMillis": 6, "result": 14, "duration": 6, "run2": 2, "i": 20, "range": 4, "samples.MaxInt": 1, "max_int": 2, "java.lang.Integer.MAX_VALUE": 1, "Workers": 1, "java.lang.Thread": 2, "java.util.concurrent": 1, "pusher": 2, "queue": 5, "message": 4, "offer": 1, "generator": 2, "port": 2, "send": 3, "env": 25, "WorkerEnvironment.builder": 1, "withFixedThreadPool": 1, "ConcurrentLinkedQueue": 1, "pusherPort": 2, "spawn": 3, "generatorPort": 2, "finishPort": 2, "any": 1, "shutdown": 2, "Thread.sleep": 5, "2000_L": 1, "awaitTermination": 2, "reduce": 1, "acc": 6, "next": 2, "EchoArgs": 1, "for": 2, "arg": 2, "samples.Adapters": 1, "list_sample": 2, "fabric": 7, "carbonCopy": 5, "conf": 4, "super": 2, "name": 9, "invokeWithArguments": 6, "maker": 2, "newInstance": 2, "runnable_sample": 2, "this": 29, "runner": 4, "oftype": 2, "java.io.Serializable.class": 1, "java.lang.Runnable.class": 1, "AdapterFabric": 1, "samples.Fibonacci": 1, "true": 4, "samples.Augmentations": 1, "java.util.LinkedList": 5, "augment": 4, "java.util.List": 2, "with": 4, "value": 8, "java.util.Collection": 1, "doToEach": 2, "func": 12, "LinkedList": 4, "sample.EnumsThreadState": 1, "State": 1, "new": 3, "Thread": 4, "State.NEW": 1, "ordinal": 2, "State.values": 1, "DealingWithNull": 1, "java.util": 1, "contacts": 3, "mrbean": 5, "larry": 2, "orIfNull": 3, "street": 1, "number": 1, "samples.SwingHelloWorld": 1, "javax.swing": 2, "javax.swing.WindowConstants": 2, "frame": 10, "JFrame": 2, "setDefaultCloseOperation": 2, "EXIT_ON_CLOSE": 2, "label": 4, "JLabel": 1, "setFont": 2, "getFont": 2, "deriveFont": 2, "128.0_F": 1, "getContentPane": 2, "pack": 2, "setVisible": 2, "samples.WebServer": 1, "headers": 2, "response": 6, "StringBuilder": 1, "append": 7, "getRequestURI": 1, "java.util.Date": 1, "stop": 1, "MoreCoolContainers": 1, "dyn": 7, "DynamicVariable": 1, "t1": 3, "withValue": 2, "t2": 3, "Observable": 1, "onChange": 2, "v": 22, "mapped": 2, "samples.Decorators": 1, "simple_decorator": 1, "a": 22, "b": 14, "@simple_decorator": 1, "simple_adder": 2, "x": 19, "y": 16, "decorator_with_params": 1, "param1": 2, "param2": 2, "@decorator_with_params": 1, "parametrized_adder": 2, "generic_decorator": 1, "args...": 3, "@generic_decorator": 4, "generic_adder0": 2, "generic_adder1": 2, "generic_adder2": 2, "generic_adder3": 2, "z": 2, "list_sum_decorator": 1, "@list_sum_decorator": 1, "sum": 2, "elem": 2, "samples.AsyncHelpers": 1, "gololang.Async": 1, "java.util.concurrent.TimeUnit": 1, "java.util.concurrent.Executors": 1, "executor": 11, "newCachedThreadPool": 1, "f": 9, "enqueue": 2, "1000_L": 3, "onSet": 5, "onFail": 2, "e": 42, "cancel": 1, "fib_10": 3, "promise": 5, "fib_20": 3, "fib_30": 3, "fib_40": 3, "futures": 2, "future": 5, "submit": 6, "all": 1, "results": 2, "truth": 3, "500_L": 1, "2_L": 1, "SECONDS": 1, "StructDemo": 1, "struct": 1, "Point": 4, "StructDemo.types.Point": 1, "move": 2, "offsetX": 4, "offsetY": 4, "relative": 2, "p1": 15, "p2": 3, "p3": 4, "frozenCopy": 2, "p4": 3, "hashCode": 4, "members": 1, "values": 3, "item": 10, "p5": 3, "ImmutablePoint": 1, "try": 19, "catch": 19, "expected": 2, "getMessage": 1, "samples.DynamicObjectPerson": 1, "DynamicObject": 1, "email": 3, "define": 5, "bean": 4, "Matching": 1, "what_it_could_be": 2, "match": 2, "when": 5, "contains": 1, "then": 5, "otherwise": 2, "Closures": 1, "sayHello": 3, "who": 2, "adder": 5, "addToTen": 3, "adding": 3, "addingTen": 2, "pump_it": 2, "samples.PrepostDecorator": 1, "isInteger": 4, "isOfType": 1, "Integer.class": 1, "@checkResult": 1, "isString": 2, "andThen": 4, "lengthIs": 1, "@checkArguments": 4, "isPositive": 3, "myCheck": 1, "checkArguments": 1, "@myCheck": 1, "inv": 3, "/": 1, "isPositiveInt": 2, "mul": 3, "*": 1, "isNumber": 1, "num": 7, "isNotNull": 1, "notnull": 3, "1_L": 1, "1.5_F": 1, "samples.ContextDecorator": 1, "myContext": 3, "defaultContext": 1, "count": 4, "require": 1, "throw": 1, "@withContext": 1, "withContext": 1, "2*a": 2, "hello.World": 1, "samples.SwingActionListener": 1, "java.awt.event": 1, "listener": 2, "handler": 2, "asInterfaceInstance": 1, "ActionListener.class": 2, "button": 7, "JButton": 1, "96.0_F": 1, "addActionListener": 3, "event": 3, "samples.DynamicEvaluation": 1, "gololang.EvaluationEnvironment": 1, "test_asModule": 2, "code": 12, "mod": 6, "asModule": 1, "fun": 6, "test_anonymousModule": 2, "anonymousModule": 1, "test_asFunction": 2, "asFunction": 1, "test_def": 2, "def": 1, "test_run": 2, "test_run_map": 2, "java.util.TreeMap": 1, "EvaluationEnvironment": 1, "CoinChange": 1, "change": 9, "money": 5, "coins": 13, "or": 1, "isEmpty": 1, "head": 1, "tail": 1, "samples.LogDeco": 1, "log1": 2, "msg": 2, "@log1": 2, "bar": 2, "@sayHello": 1, "baz": 2, "log2": 4, "msgBefore": 2, "msgAfter": 2, "res": 2, "@log2": 1, "spam": 2, "logEnterExit": 1, "@logEnterExit": 1, "egg": 2, "strange_use": 2 }, "Gosu": { "package": 3, "example": 2, "uses": 8, "java.util.*": 1, "java.io.File": 1, "class": 2, "Person": 7, "extends": 1, "Contact": 1, "implements": 1, "IEmailable": 2, "{": 73, "var": 17, "_name": 4, "String": 14, "_age": 3, "Integer": 3, "as": 7, "Age": 1, "_relationship": 2, "Relationship": 3, "readonly": 1, "RelationshipOfPerson": 1, "delegate": 1, "_emailHelper": 2, "represents": 1, "enum": 2, "FRIEND": 1, "FAMILY": 1, "BUSINESS_CONTACT": 1, "}": 73, "static": 26, "ALL_PEOPLE": 2, "new": 8, "HashMap": 1, "": 1, "(": 123, ")": 124, "construct": 2, "name": 12, "age": 4, "relationship": 2, "EmailHelper": 1, "this": 1, "property": 13, "get": 11, "Name": 3, "return": 17, "set": 2, "override": 1, "function": 16, "getEmailName": 1, "incrementAge": 1, "+": 2, "@Deprecated": 1, "printPersonInfo": 1, "print": 3, "addPerson": 4, "p": 5, "if": 19, "ALL_PEOPLE.containsKey": 2, ".Name": 1, "throw": 5, "IllegalArgumentException": 1, "[": 4, "p.Name": 2, "]": 4, "addAllPeople": 1, "contacts": 2, "List": 1, "": 1, "for": 2, "contact": 3, "in": 3, "typeis": 2, "and": 1, "not": 1, "contact.Name": 1, "int": 2, "allPeople": 1, "ALL_PEOPLE.Values": 3, "allPeople.where": 1, "-": 7, "p.Age": 1, ".orderBy": 1, "loadPersonFromDB": 1, "id": 1, "using": 2, "conn": 1, "stmt": 1, "conn.prepareStatement": 1, "stmt.setInt": 1, "result": 1, "stmt.executeQuery": 1, "result.next": 1, "result.getString": 2, "result.getInt": 1, "Relationship.valueOf": 2, "loadFromFile": 1, "file": 3, "File": 3, "file.eachLine": 1, "line": 1, "line.HasContent": 1, "line.toPerson": 1, "saveToFile": 1, "writer": 2, "FileWriter": 1, "PersonCSVTemplate.renderToString": 1, "PersonCSVTemplate.render": 1, "ronin": 1, "gw.lang.reflect.*": 1, "java.lang.*": 1, "java.io.*": 1, "ronin.config.*": 1, "org.slf4j.*": 1, "Ronin": 1, "_CONFIG": 13, "IRoninConfig": 2, "Config": 1, "_CURRENT_REQUEST": 1, "ThreadLocal": 1, "": 1, ";": 1, "private": 1, "internal": 2, "init": 1, "servlet": 3, "RoninServlet": 3, "m": 3, "ApplicationMode": 2, "src": 2, "null": 15, "cfg": 2, "TypeSystem.getByFullNameIfValid": 2, "defaultWarning": 3, "false": 1, "ctor": 2, "cfg.TypeInfo.getConstructor": 1, "ronin.config.ApplicationMode": 1, "ronin.RoninServlet": 1, "ctor.Constructor.newInstance": 1, "else": 9, "DefaultRoninConfig": 1, "true": 2, "roninLogger": 2, "roninLogger.TypeInfo.getMethod": 1, "ronin.config.LogLevel": 1, ".CallHandler.handleCall": 1, "LogLevel": 5, "log": 2, "level": 7, "WARN": 2, "Quartz.maybeStart": 1, "ReloadManager.setSourceRoot": 1, "CurrentRequest": 3, "req": 2, "RoninRequest": 2, "_CURRENT_REQUEST.set": 1, "//": 2, "CurrentTrace": 1, "Trace": 1, ".Trace": 1, "_CURRENT_REQUEST.get": 1, "Mode": 1, ".Mode": 1, "TESTING": 1, ".LogLevel": 1, "DEBUG": 2, "TraceEnabled": 1, "boolean": 1, "_CONFIG.TraceEnabled": 1, "DefaultAction": 1, ".DefaultAction": 1, "DefaultController": 1, "Type": 1, ".DefaultController": 1, ".RoninServlet": 1, "ErrorHandler": 1, "IErrorHandler": 1, ".ErrorHandler": 1, "LogHandler": 1, "ILogHandler": 1, ".LogHandler": 2, "msg": 4, "Object": 1, "component": 7, "exception": 7, "java.lang.Throwable": 1, "INFO": 2, "<": 5, "msgStr": 9, "block": 3, "_CONFIG.LogHandler.log": 1, "switch": 1, "case": 6, "TRACE": 1, "LoggerFactory.getLogger": 5, "Logger.ROOT_LOGGER_NAME": 5, ".trace": 1, "break": 5, ".debug": 1, ".info": 1, ".warn": 1, "ERROR": 1, "FATAL": 1, ".error": 1, "CacheStore": 3, "REQUEST": 3, "SESSION": 3, "APPLICATION": 3, "cache": 1, "": 2, "value": 4, "T": 2, "store": 10, "or": 2, "_CONFIG.RequestCache.getValue": 1, "_CONFIG.SessionCache.getValue": 1, "invalidate": 1, "_CONFIG.RequestCache.invalidate": 1, "_CONFIG.SessionCache.invalidate": 1, "loadChanges": 1, "enhancement": 1, "Hello": 1, "toPerson": 1, "vals": 4, "this.split": 1, "hello": 1, "%": 8, "defined": 1, "Hello.gst": 1, "@": 1, "params": 1, "users": 2, "Collection": 1, "": 1, "user": 1, "user.LastName": 1, "user.FirstName": 1, "user.Department": 1 }, "Grace": { "method": 10, "ack": 4, "(": 215, "m": 5, "Number": 4, "n": 4, ")": 215, "-": 16, "{": 61, "print": 2, "if": 23, "<": 5, "then": 24, "+": 29, "}": 61, "elseif": 1, "else": 7, "import": 7, "as": 7, "gtk": 1, "io": 1, "collections": 1, "button_factory": 1, "dialog_factory": 1, "highlighter": 1, "aComp": 1, "//TODO": 1, "def": 56, "window": 2, "gtk.window": 3, "gtk.GTK_WINDOW_TOPLEVEL": 3, "window.title": 1, "window.set_default_size": 1, "var": 33, "popped": 3, "mBox": 2, "gtk.box": 6, "gtk.GTK_ORIENTATION_VERTICAL": 4, "buttonBox": 2, "gtk.GTK_ORIENTATION_HORIZONTAL": 5, "consoleButtons": 2, "consoleBox": 2, "editorBox": 2, "splitPane": 4, "gtk.paned": 1, "menuBox": 2, "runButton": 2, "button_factory.make": 10, "clearButton": 2, "outButton": 2, "errorButton": 2, "popButton": 2, "newButton": 2, "openButton": 2, "saveButton": 2, "saveAsButton": 2, "closeButton": 2, "tEdit": 3, "gtk.text_view": 5, "tEdit.set_size_request": 1, "scrolled_main": 4, "gtk.scrolled_window": 5, "scrolled_main.set_size_request": 1, "scrolled_main.add": 1, "notebook": 8, "gtk.notebook": 1, "notebook.scrollable": 1, "true": 8, "editor_map": 8, "collections.map.new": 4, "editor_map.put": 1, "scrolled_map": 6, "scrolled_map.put": 1, "lighter": 3, "tEdit.buffer.on": 1, "do": 14, "lighter.highlightLine": 1, "completer": 1, "aComp.Auto_Completer.new": 1, "deleteCompileFiles": 3, "page_num": 7, "cur_scrolled": 9, "scrolled_map.get": 8, "filename": 6, "notebook.get_tab_label_text": 3, "filename.substringFrom": 1, "to": 1, "filename.size": 1, "//Removes": 1, ".grace": 1, "extension": 1, "io.system": 13, "currentConsole": 17, "//": 3, "Which": 1, "console": 1, "is": 1, "being": 1, "shown": 1, "out": 9, "false": 9, "outText": 4, "errorText": 4, "runButton.on": 1, "clearConsoles": 4, "cur_page_num": 15, "notebook.current_page": 6, "cur_page": 5, "editor_map.get": 7, "cur_page_label": 6, "sIter": 9, "gtk.text_iter": 6, "eIter": 9, "text": 4, "cur_page.buffer.get_text": 2, "file": 2, "io.open": 4, "file.write": 2, "file.close": 2, "outputFile": 1, "errorFile": 1, "outputFile.read": 1, "errorFile.read": 1, "switched": 4, "outText.size": 2, "&&": 4, "switch_to_output": 3, "errorText.size": 2, "switch_to_errors": 3, "populateConsoles": 4, "clearButton.on": 1, "outButton.on": 1, "errorButton.on": 1, "popButton.on": 1, "popIn": 2, "popOut": 2, "newButton.on": 1, "new_window_class": 1, "dialog_factory.new.new": 1, "new_window": 1, "new_window_class.window": 1, "new_window.show_all": 1, "openButton.on": 1, "open_window_class": 1, "dialog_factory.open.new": 1, "open_window": 1, "open_window_class.window": 1, "open_window.show_all": 1, "saveButton.on": 1, "saveAs_window_class": 2, "dialog_factory.save.new": 2, "saveAs_window": 2, "saveAs_window_class.window": 2, "saveAs_window.show_all": 2, "saveAsButton.on": 1, "closeButton.on": 1, "num_pages": 3, "notebook.n_pages": 2, "e_map": 2, "s_map": 2, "x": 21, "while": 3, "eValue": 4, "sValue": 4, "e_map.put": 2, "s_map.put": 2, "notebook.remove_page": 1, "notebook.show_all": 1, "outConsole": 4, "outScroll": 5, "errorConsole": 4, "errorScroll": 4, "errorTag": 3, "errorConsole.buffer.create_tag": 2, "createOut": 3, "outScroll.add": 1, "outConsole.set_size_request": 5, "outScroll.set_size_request": 5, "outConsole.editable": 1, "outConsole.buffer.set_text": 3, "createError": 3, "errorScroll.add": 1, "errorConsole.set_size_request": 5, "errorScroll.set_size_request": 5, "errorConsole.editable": 1, "errorConsole.buffer.set_text": 3, "consoleBox.remove": 2, "This": 2, "destroys": 2, "the": 2, "consoleBox.add": 5, "popped.show_all": 3, "window.show_all": 3, "errorConsole.buffer.apply_tag": 1, "popInBlock": 2, "consoleBox.reparent": 3, "popButton.label": 3, "cur_page.set_size_request": 3, "cur_scrolled.set_size_request": 3, "popped.visible": 3, "popped.connect": 1, "hSeparator1": 2, "gtk.separator": 2, "hSeparator2": 2, "menuBox.add": 4, "buttonBox.add": 2, "consoleButtons.add": 4, "editorBox.add": 2, "notebook.add": 1, "notebook.set_tab_label_text": 1, "splitPane.add1": 1, "splitPane.add2": 1, "mBox.add": 3, "window.add": 1, "exit": 2, "gtk.main_quit": 1, "window.connect": 1, "gtk.main": 1 }, "Gradle": { "apply": 4, "plugin": 2, "GreetingPlugin": 4, "greeting.message": 1, "class": 4, "implements": 2, "Plugin": 2, "": 2, "{": 9, "void": 2, "(": 6, "Project": 2, "project": 2, ")": 6, "project.extensions.create": 2, "GreetingPluginExtension": 4, "project.task": 2, "<<": 2, "println": 2, "project.greeting.message": 1, "}": 9, "def": 1, "String": 3, "message": 3, "greeting": 1, "greeter": 2 }, "Grammatical Framework": { "concrete": 33, "FoodsEng": 1, "of": 81, "Foods": 34, "{": 577, "flags": 32, "language": 2, "en_US": 1, ";": 1392, "lincat": 28, "Comment": 31, "Quality": 34, "s": 365, "Str": 393, "}": 578, "Kind": 33, "Number": 206, "Item": 31, "n": 207, "lin": 28, "Pred": 29, "item": 35, "quality": 89, "item.s": 23, "+": 476, "copula": 28, "item.n": 27, "quality.s": 49, "This": 29, "det": 86, "Sg": 183, "That": 29, "These": 28, "Pl": 181, "Those": 28, "Mod": 29, "kind": 115, "kind.s": 46, "Wine": 29, "regNoun": 38, "Cheese": 29, "Fish": 29, "noun": 51, "Pizza": 28, "Very": 29, "a": 56, "a.s": 8, "Fresh": 29, "adj": 37, "Warm": 29, "Italian": 29, "Expensive": 29, "Delicious": 29, "Boring": 29, "param": 22, "|": 122, "oper": 29, "-": 482, "noun.s": 7, "man": 10, "men": 10, "table": 148, "car": 6, "(": 223, ")": 223, "cold": 4, "#": 14, "path": 14, ".": 13, "prelude": 2, "FoodsIce": 1, "open": 23, "Prelude": 11, "in": 31, "coding": 29, "utf8": 29, "SS": 6, "Gender": 93, "Defin": 9, "g": 131, "ss": 12, "item.g": 10, "Ind": 14, "kind.g": 38, "Def": 21, "Neutr": 21, "Masc": 68, "Fem": 66, "qual": 8, "defOrInd": 2, "qual.s": 8, "regAdj": 61, "adjective": 22, "masc": 3, "fem": 2, "neutr": 2, "cn": 11, "case": 42, "cn.g": 10, "cn.s": 8, "x1": 3, "_": 70, "x9": 1, "ferskur": 5, "fersk": 11, "ferskt": 2, "ferskir": 2, "ferskar": 2, "fersk_pl": 2, "ferski": 2, "ferska": 2, "fersku": 2, "t": 29, "": 1, "<": 10, "let": 8, "Predef.tk": 2, "instance": 5, "LexFoodsFin": 2, "LexFoods": 12, "SyntaxFin": 2, "ParadigmsFin": 1, "wine_N": 7, "mkN": 46, "pizza_N": 7, "cheese_N": 7, "fish_N": 8, "fresh_A": 7, "mkA": 47, "warm_A": 8, "italian_A": 7, "expensive_A": 7, "delicious_A": 7, "boring_A": 7, "present": 7, "FoodsIta": 1, "FoodsI": 6, "with": 5, "Syntax": 7, "SyntaxIta": 2, "LexFoodsIta": 2, "FoodsChi": 1, "c": 41, "p": 11, "quality.p": 2, "kind.c": 11, "geKind": 5, "longQuality": 8, "mkKind": 2, "/GF/lib/src/prelude": 1, "FoodsMon": 1, "prefixSS": 1, "d": 6, "x": 74, "FoodsPes": 1, "optimize": 1, "noexpand": 1, "Add": 8, "prep": 11, "Indep": 4, "Attr": 9, "kind.prep": 1, "quality.prep": 1, "regN": 15, "at": 2, "a.prep": 1, "it": 1, "must": 1, "be": 1, "written": 1, "as": 2, "x4": 2, "pytzA": 3, "pytzAy": 1, "pytzAhA": 3, "pr": 4, "": 1, "": 2, "": 2, "mrd": 8, "tAzh": 8, "mkAdj": 27, "tAzhy": 2, "interface": 1, "N": 4, "A": 6, "FoodsEpo": 1, "vino": 3, "nova": 3, "FoodsFin": 1, "ParadigmsIta": 1, "alltenses": 3, "FoodsTha": 1, "SyntaxTha": 1, "LexiconTha": 1, "ParadigmsTha": 1, "R": 4, "ResTha": 1, "Utt": 4, "NP": 4, "CN": 4, "AP": 4, "mkUtt": 4, "mkCl": 4, "mkNP": 16, "this_Det": 2, "that_Det": 2, "these_Det": 2, "those_Det": 2, "mkCN": 20, "mkAP": 28, "very_AdA": 4, "R.thword": 4, "FoodsRon": 1, "NGender": 6, "NMasc": 2, "NFem": 3, "NNeut": 2, "mkTab": 5, "mkNoun": 5, "getAgrGender": 3, "acesta": 2, "aceasta": 2, "gg": 3, "noun.g": 3, "det.s": 1, "peste": 2, "pesti": 2, "scump": 2, "scumpa": 2, "scumpi": 2, "scumpe": 2, "": 1, "": 2, "": 2, "ng": 1, "": 1, "": 1, "": 1, "": 2, "LexFoodsCat": 2, "SyntaxCat": 2, "ParadigmsCat": 1, "M": 1, "MorphoCat": 1, "M.Masc": 2, "LexFoodsSwe": 2, "SyntaxSwe": 2, "ParadigmsSwe": 1, "FoodsUrd": 1, "coupla": 2, "f": 16, "FoodsCze": 1, "ResCze": 2, "Adjective": 9, "Noun": 9, "NounPhrase": 3, "regnfAdj": 2, "FoodsHin": 2, "lark": 8, "ms": 4, "mp": 4, "acch": 6, "../lib/src/prelude": 1, "FoodsJpn": 1, "Style": 3, "AdjUse": 4, "AdjType": 4, "quality.t": 3, "IAdj": 4, "Plain": 3, "APred": 8, "Polite": 4, "NaAdj": 4, "na": 1, "adjectives": 1, "have": 1, "different": 1, "forms": 1, "attributes": 1, "and": 1, "predicates": 2, "for": 1, "phrase": 1, "types": 1, "can": 1, "form": 1, "without": 1, "the": 1, "cannot": 1, "sakana": 6, "chosenna": 2, "chosen": 2, "akai": 2, "FoodsPor": 1, "mkAdjReg": 7, "QualityT": 5, "Type": 9, "bonito": 2, "bonita": 2, "bonitos": 2, "bonitas": 2, "adjSozinho": 2, "sozinho": 3, "sozinh": 4, "adjUtil": 2, "util": 3, "uteis": 3, "last": 3, "ItemT": 2, "KindT": 4, "num": 6, "animal": 2, "animais": 2, "gen": 4, "carro": 3, "FoodsDut": 1, "AForm": 4, "AAttr": 3, "regadj": 6, "wijn": 3, "koud": 3, "duur": 2, "dure": 2, "FoodsGer": 1, "SyntaxGer": 2, "LexFoodsGer": 2, "FoodsTur": 1, "Predef": 3, "Case": 10, "softness": 4, "Softness": 5, "h": 4, "Harmony": 5, "quality.softness": 1, "quality.h": 1, "quality.c": 1, "Nom": 9, "Gen": 5, "a.c": 1, "a.softness": 1, "a.h": 1, "I_Har": 4, "Ih_Har": 4, "U_Har": 4, "Uh_Har": 4, "Ih": 1, "Uh": 1, "Soft": 3, "Hard": 3, "overload": 1, "mkn": 1, "peynir": 2, "peynirler": 2, "[": 2, "]": 2, "sarap": 2, "saraplar": 2, "sarabi": 2, "saraplari": 2, "italyan": 4, "ca": 2, "getSoftness": 2, "getHarmony": 2, "base": 4, "c@": 3, "*": 1, "Dana": 1, "Dannells": 1, "FoodsHeb": 2, "Species": 8, "mod": 7, "Modified": 5, "sp": 11, "Indef": 6, "T": 2, "regAdj2": 3, "F": 2, "Adj": 4, "m": 9, "cn.mod": 2, "gvina": 6, "hagvina": 3, "gvinot": 6, "hagvinot": 3, "defH": 7, "replaceLastLetter": 7, "tov": 6, "tova": 3, "tovim": 3, "tovot": 3, "to": 5, "italki": 3, "italk": 4, "FoodsNep": 1, "adjPl": 2, "bor": 2, "FoodsCat": 1, "FoodsOri": 1, "incomplete": 1, "FoodsSwe": 1, "**": 1, "sv_SE": 1, "FoodsSpa": 1, "SyntaxSpa": 1, "StructuralSpa": 1, "ParadigmsSpa": 1, "this_QuantSg": 2, "that_QuantSg": 2, "these_QuantPl": 2, "those_QuantPl": 2, "ParadigmsGer": 1, "feminine": 2, "masculine": 4, "../foods": 1, "FoodsFre": 1, "SyntaxFre": 1, "ParadigmsFre": 1, "FoodsLav": 1, "Q": 5, "Q1": 5, "q": 10, "spec": 2, "Q2": 3, "specAdj": 2, "skaists": 5, "skaista": 2, "skaisti": 2, "skaistas": 2, "skaistais": 2, "skaistaa": 2, "skaistie": 2, "skaistaas": 2, "skaist": 8, "init": 4, "resource": 1, "ne": 2, "muz": 2, "muzi": 2, "msg": 3, "fsg": 3, "nsg": 3, "mpl": 3, "fpl": 3, "npl": 3, "mlad": 7, "vynikajici": 7, "FoodsBul": 1, "Agr": 3, "ASg": 23, "APl": 11, "item.a": 2, "FoodsAfr": 1, "AdjAP": 10, "Predic": 3, "declNoun_e": 2, "declNoun_aa": 2, "declNoun_ss": 2, "declNoun_s": 2, "veryAdj": 2, "smartAdj_e": 4, "operations": 2, "wyn": 1, "kaas": 1, "vis": 1, "pizza": 1, "v": 6, "tk": 1, "y": 3, "declAdj_e": 2, "declAdj_g": 2, "w": 15, "declAdj_oog": 2, "i": 2, "x.s": 8, "abstract": 1, "startcat": 1, "cat": 1, "fun": 1, "FoodsMlt": 1, "uniAdj": 2, "Create": 6, "an": 2, "full": 1, "function": 1, "Params": 4, "Sing": 4, "Plural": 2, "iswed": 2, "sewda": 2, "suwed": 3, "regular": 1, "Param": 2, "frisk": 4, "eg": 1, "tal": 1, "buzz": 1, "uni": 4, "Singular": 1, "inherent": 1, "ktieb": 2, "kotba": 2, "Copula": 1, "is": 1, "linking": 1, "verb": 1, "article": 3, "taking": 1, "into": 1, "account": 1, "first": 1, "letter": 1, "next": 1, "word": 1, "pre": 1, "cons@": 1, "cons": 1, "determinant": 1, "Sg/Pl": 1, "string": 1, "default": 1, "gender": 1, "number": 1, "FoodsAmh": 1, "FoodsTsn": 1, "NounClass": 28, "r": 9, "b": 9, "Bool": 5, "p_form": 18, "TType": 16, "mkPredDescrCop": 2, "item.c": 1, "quality.p_form": 1, "kind.w": 4, "mkDemPron1": 3, "kind.q": 4, "mkDemPron2": 3, "mkMod": 2, "mkNounNC14_6": 2, "mkNounNC9_10": 4, "smartVery": 2, "mkVarAdj": 2, "mkOrdAdj": 4, "mkPerAdj": 2, "mkVerbRel": 2, "NC9_10": 14, "NC14_6": 14, "P": 4, "V": 4, "ModV": 4, "y.b": 1, "True": 3, "y.w": 2, "y.r": 2, "y.c": 14, "y.q": 4, "smartQualRelPart": 5, "x.t": 10, "smartDescrCop": 5, "False": 3, "mkVeryAdj": 2, "x.p_form": 2, "mkVeryVerb": 3, "mkQualRelPart_PName": 2, "mkQualRelPart": 2, "mkDescrCop_PName": 2, "mkDescrCop": 2 }, "Graph Modeling Language": { "graph": 3, "[": 18, "comment": 2, "directed": 3, "id": 10, "label": 16, "node": 8, "extraAttribute": 6, "]": 18, "edge": 7, "source": 7, "target": 7, "value": 2 }, "GraphQL": { "#": 2, "query": 3, "queryName": 1, "(": 19, "foo": 5, "ComplexType": 1, "site": 1, "Site": 2, "MOBILE": 2, ")": 19, "{": 25, "whoever123is": 1, "node": 1, "id": 7, "[": 4, "]": 4, "...": 3, "on": 4, "User": 1, "@defer": 2, "field2": 1, "alias": 1, "field1": 1, "first": 1, "after": 1, "@include": 2, "if": 3, "...frag": 1, "}": 25, "@skip": 2, "unless": 1, "mutation": 2, "likeStory": 1, "like": 1, "story": 3, "subscription": 1, "StoryLikeSubscription": 1, "input": 4, "StoryLikeSubscribeInput": 1, "storyLikeSubscribe": 1, "likers": 1, "count": 1, "likeSentence": 1, "text": 1, "fragment": 1, "frag": 1, "Friend": 1, "size": 2, "bar": 1, "b": 1, "obj": 1, "key": 3, "unnamed": 1, "truthy": 1, "true": 1, "falsey": 1, "false": 1, "schema": 1, "QueryType": 1, "MutationType": 1, "type": 2, "Foo": 2, "implements": 1, "Bar": 2, "one": 2, "Type": 5, "two": 1, "argument": 7, "InputType": 4, "three": 1, "other": 1, "String": 9, "Int": 2, "four": 2, "five": 1, "six": 1, "interface": 1, "union": 1, "Feed": 1, "Story": 1, "|": 6, "Article": 1, "Advert": 1, "scalar": 1, "CustomScalar": 1, "enum": 1, "DESKTOP": 1, "answer": 1, "extend": 1, "seven": 1, "directive": 2, "Boolean": 2, "FIELD": 2, "FRAGMENT_SPREAD": 2, "INLINE_FRAGMENT": 2 }, "Graphviz (DOT)": { "digraph": 2, "G": 6, "{": 2, "edge": 2, "[": 78, "label": 75, "]": 78, ";": 100, "graph": 2, "ranksep": 2, "T": 4, "shape": 17, "record": 17, "S": 4, "SPACE": 4, "A": 4, "H": 4, "U": 4, "L": 4, "N": 4, "I": 4, "O": 4, "F": 4, "GF": 3, "W": 4, "Y": 4, "B": 2, "D": 4, "BD": 3, "WYBD": 3, "GFWYBD": 3, "-": 82, "}": 2, "node": 1, "K": 2, "_3": 2, "_9": 2, "_39": 3, "X": 2, "YX": 3, "J": 2, "JW": 3, "YXJW": 3, "M": 2, "E": 2, "DOT": 2, "_1": 2, "DOT1": 3, "_7": 2, "R": 2, "C": 2 }, "Groovy": { "html": 3, "{": 19, "head": 2, "title": 2, "}": 19, "body": 1, "p": 1, "task": 1, "echoDirListViaAntBuilder": 1, "(": 13, ")": 13, "description": 1, "//Docs": 1, "http": 1, "//Echo": 1, "the": 3, "Gradle": 1, "project": 1, "name": 4, "via": 1, "ant": 1, "echo": 3, "plugin": 1, "ant.echo": 3, "message": 2, "project.name": 1, "path": 2, "//Gather": 1, "list": 1, "of": 1, "files": 1, "in": 1, "a": 1, "subdirectory": 1, "ant.fileScanner": 1, "fileset": 1, "dir": 2, ".each": 1, "//Print": 1, "each": 1, "file": 1, "to": 1, "screen": 1, "with": 1, "CWD": 1, "projectDir": 1, "removed.": 1, "println": 3, "it.toString": 1, "-": 2, "component": 1, "jettyUrl": 1, "def": 3, "servers": 5, "stage": 4, "node": 4, "checkout": 2, "scm": 2, "load": 1, "mvn": 3, "stash": 1, "includes": 1, "parallel": 1, "longerTests": 1, "runTests": 3, "quickerTests": 1, "concurrency": 2, "servers.deploy": 2, "input": 1, "sh": 2, "args": 1, "duration": 1, "servers.runWithServer": 1, "id": 1, "SHEBANG#!groovy": 2 }, "Groovy Server Pages": { "<": 1, "%": 2, "@": 1, "page": 2, "contentType": 1, "": 4, "": 4, "": 4, "Using": 1, "directive": 1, "tag": 1, "": 4, "": 4, "": 4, "": 2, "Print": 1, "": 4, "": 4, "": 4, "http": 3, "equiv=": 3, "content=": 4, "Testing": 3, "with": 3, "SiteMesh": 2, "and": 2, "Resources": 2, "name=": 1, "": 2, "require": 2, "module=": 2, "{": 1, "example": 1, "}": 1 }, "HAProxy": { "global": 8, "log": 11, "local0": 4, "info": 1, "chroot": 3, "/var/lib/haproxy": 3, "user": 5, "haproxy": 10, "group": 5, "defaults": 4, "mode": 6, "tcp": 1, "balance": 5, "leastconn": 1, "option": 10, "tcplog": 1, "timeout": 13, "connect": 4, "5s": 5, "client": 4, "5m": 2, "server": 21, "frontend": 4, "fe_mysql": 1, "bind": 15, "*": 1, "default_backend": 4, "be_mysql": 2, "backend": 6, "stick": 3, "-": 144, "table": 1, "type": 1, "ip": 1, "size": 1, "1m": 3, "expire": 1, "1h": 1, "match": 1, "src": 4, "store": 1, "request": 4, "tag": 1, "mysql": 1, "db1": 1, "check": 15, "slowstart": 4, "60s": 4, "weight": 2, "db2": 1, "db3": 1, "backup": 2, "db4": 1, "listen": 3, "stats": 16, "ssl": 12, "crt": 5, "/etc/ssl/certs/mycert.pem": 1, "enable": 3, "uri": 3, "/report": 2, "refresh": 3, "30s": 3, "http": 7, "deny": 2, "unless": 3, "{": 3, "192.168.50.0/24": 2, "}": 3, "/dev/log": 4, "local1": 2, "notice": 2, "socket": 2, "/run/haproxy/admin.sock": 2, "level": 2, "admin": 4, "ca": 1, "base": 2, "/etc/ssl/certs": 1, "/etc/ssl/private": 1, "default": 7, "ciphers": 3, "ECDHE": 30, "ECDSA": 15, "AES256": 12, "GCM": 12, "SHA384": 12, "RSA": 15, "CHACHA20": 6, "POLY1305": 6, "AES128": 12, "SHA256": 12, "options": 3, "no": 3, "sslv3": 1, "description": 1, "HAProxy": 1, "Statistics": 1, "Page": 1, "httplog": 3, "dontlognull": 2, "roundrobin": 4, "errorfile": 14, "/etc/haproxy/errors/400.http": 2, "/etc/haproxy/errors/403.http": 2, "/etc/haproxy/errors/408.http": 2, "/etc/haproxy/errors/500.http": 2, "/etc/haproxy/errors/502.http": 2, "/etc/haproxy/errors/503.http": 2, "/etc/haproxy/errors/504.http": 2, "fe_main": 1, "mysite.pem": 1, "redirect": 3, "scheme": 2, "https": 2, "ssl_fc": 2, "webservers": 4, "web1": 2, "maxconn": 10, "web2": 2, "web3": 1, "web4": 1, "mycert.pem": 1, "auth": 1, "password": 1, "show": 1, "desc": 1, "nbproc": 1, "nbthread": 1, "cpu": 1, "map": 1, "auto": 1, "1/1": 1, "min": 2, "ver": 2, "TLSv1.2": 2, "tls": 2, "tickets": 2, "public": 1, "/etc/ssl/certs/mysite.pem": 1, "if": 4, "acl": 3, "static_files": 2, "path_end": 1, ".gif": 1, ".png": 1, ".jpg": 1, ".css": 1, ".js": 1, ".svg": 1, ".ttf": 1, ".woff": 1, ".woff2": 1, "use_backend": 2, "nginx": 2, "nodejs": 2, "cookie": 3, "PHPSESSID": 1, "prefix": 2, "nocache": 1, "httpchk": 4, "HEAD": 4, "/": 2, "server1": 3, "server2": 3, "/monitor": 1, "mywebsite": 1, "apipath": 2, "path_beg": 1, "/api/": 1, "apihost": 2, "req.hdr": 1, "(": 1, "Host": 1, ")": 1, "i": 1, "m": 1, "dom": 1, "api.mywebsite.com": 1, "//api.mywebsite.com": 1, "apiservers": 2, "/health": 2, "api1": 1, "api2": 1 }, "HCL": { "resource": 8, "{": 41, "description": 3, "vpc_id": 3, "ingress": 3, "from_port": 6, "to_port": 6, "protocol": 6, "cidr_blocks": 5, "[": 24, "]": 24, "}": 41, "egress": 3, "security_groups": 2, "ami": 1, "instance_type": 1, "associate_public_ip_address": 1, "false": 3, "key_name": 1, "subnet_id": 1, "vpc_security_group_ids": 1, "tags": 2, "Name": 2, "connection": 1, "user": 1, "private_key": 1, "bastion_host": 1, "bastion_port": 1, "bastion_user": 1, "bastion_private_key": 1, "provisioner": 4, "source": 3, "destination": 3, "inline": 1, "name": 3, "subnets": 1, "listener": 1, "instance_port": 1, "instance_protocol": 1, "lb_port": 1, "lb_protocol": 1, "health_check": 1, "healthy_threshold": 1, "unhealthy_threshold": 1, "timeout": 1, "target": 1, "interval": 1, "instances": 1, "cross_zone_load_balancing": 1, "idle_timeout": 1, "zone_id": 2, "type": 2, "ttl": 2, "records": 2, "consul": 1, "template": 1, "bar": 1, "terragrunt": 1, "remote_state": 1, "backend": 1, "config": 1, "encrypt": 1, "true": 2, "bucket": 1, "key": 1, "region": 2, "dynamodb_table": 1, "terraform": 1, "extra_arguments": 1, "commands": 1, "optional_var_files": 1, "account.tfvars": 1, "skip": 3, "-": 15, "account": 1, "if": 3, "does": 3, "not": 3, "exist": 3, "region.tfvars": 1, "env.tfvars": 1, "env": 1, "key1": 2, "key2": 2, "key3": 2, "key4": 1, "key5": 1, "key6": 1, "key7": 1, "key8": 1, "keyA": 2, "keyB": 2, "workflow": 1, "on": 1, "resolves": 1, "action": 8, "uses": 8, "args": 7, "needs": 5, "secrets": 1 }, "HLSL": { "float4x4": 6, "matWorldViewProjection": 5, "WORLDVIEWPROJECTION": 2, ";": 208, "matWorldView": 5, "WORLDVIEW": 2, "matWorld": 1, "WORLD": 1, "matView": 1, "VIEW": 1, "uniform": 4, "float4": 29, "vViewPosition": 1, "struct": 8, "VS_INPUT": 4, "{": 35, "float3": 23, "Pos": 2, "POSITION": 5, "Normal": 2, "NORMAL": 2, "Tangent": 2, "TANGENT": 2, "Binormal": 2, "BINORMAL": 2, "}": 35, "VS_OUTPUT": 12, "reflection": 3, "TEXCOORD1": 4, "refraction": 3, "TEXCOORD2": 2, "float": 8, "fresnel": 5, "TEXCOORD3": 1, "amt": 1, "scale": 2, "phase": 2, "deform": 4, "(": 134, "p": 3, ")": 134, "s": 30, "p2": 6, "*": 37, "+": 49, "sin": 3, "p2.x": 1, "amt.x": 1, "p2.y": 1, "amt.y": 1, "p2.z": 1, "amt.z": 1, "return": 15, "/": 9, "vs_main": 4, "In": 3, "Out": 6, "pos": 10, "In.Pos": 1, "norm": 7, "In.Normal": 1, "p1": 5, "In.Tangent": 1, "In.Binormal": 1, "-": 18, "normalize": 7, "cross": 1, "view": 4, "vViewPosition.xyz": 1, "Out.Pos": 1, "mul": 7, "Out.reflection": 1, "reflect": 2, "Out.refraction": 1, "Out.fresnel": 1, "dot": 1, "#define": 2, "PS_INPUT": 2, "#if": 2, "textureCUBE": 1, "reflectionMap": 4, "samplerCUBE": 2, "reflectionMapSampler": 4, "sampler_state": 7, "Texture": 7, "MipFilter": 7, "LINEAR": 9, "MinFilter": 7, "MagFilter": 7, "#else": 2, "texture": 7, "<": 1, "string": 2, "type": 1, "name": 1, "#endif": 3, "PS_OUTPUT": 6, "color": 1, "COLOR0": 3, "ps_main": 4, "texCUBE": 2, "In.reflection": 1, "In.refraction": 1, "In.fresnel": 1, "//": 3, "abs": 1, "In.normal": 1, ".z": 1, "Out.color": 1, "lerp": 1, "pow": 1, "technique": 3, "blur_ps_vs_2_0": 2, "pass": 3, "P0": 2, "VertexShader": 3, "compile": 6, "vs_2_0": 2, "PixelShader": 3, "ps_2_0": 2, "Position": 2, "POSITION0": 2, "float2": 14, "TexCoord0": 2, "TEXCOORD0": 5, "TexCoord1": 2, "float3x3": 1, "TangentToView": 1, "input": 3, "output": 2, "output.Position": 1, "input.Position": 1, "output.TexCoord0": 1, "input.TexCoord0": 1, "output.TexCoord1": 1, "input.TexCoord1": 1, "output.TangentToView": 3, "[": 3, "]": 3, "input.Tangent": 1, ".xyz": 4, "input.Binormal": 1, "input.Normal": 1, "gbuffer0": 1, "gbuffer1": 1, "COLOR1": 1, "albedo_tex": 2, "sampler": 6, "albedo_samp": 2, "Linear": 12, "AddressU": 5, "Wrap": 8, "AddressV": 5, "sRGBTexture": 4, "True": 4, "normal_tex": 2, "normal_samp": 2, "False": 2, "specular_tex": 2, "specular_samp": 2, "ao_tex": 2, "ao_samp": 2, "Input": 1, "o": 2, "tangentNormal": 2, "tex2D": 27, "Input.TexCoord0": 3, "eyeNormal": 2, "Input.TangentToView": 1, "albedo": 2, ".rgb": 1, "ao": 3, "Input.TexCoord1": 1, ".r": 2, "spec": 2, "o.gbuffer0": 1, "o.gbuffer1": 1, "mesh": 1, "Geometry": 1, "vs_3_0": 1, "ps_3_0": 1, "AlphaBlendEnable": 1, "ZWriteEnable": 1, "Vertex": 3, "position": 1, "texCoord": 3, "t": 1, "vertexMain": 1, "pixelMain": 1, "#ifndef": 1, "__BLOOM__": 3, "#include": 1, "half": 6, "Brightness": 5, "half3": 15, "c": 6, "Max3": 1, "Median": 1, "a": 4, "b": 4, "min": 2, "max": 2, "DownsampleFilter": 1, "sampler2D": 3, "tex": 29, "uv": 24, "texelSize": 3, "d": 4, "texelSize.xyxy": 4, "DecodeHDR": 21, "d.xy": 5, "d.zy": 5, "d.xw": 4, "d.zw": 4, "DownsampleAntiFlickerFilter": 1, "s1": 3, "s2": 3, "s3": 3, "s4": 3, "s1w": 3, "s2w": 3, "s3w": 3, "s4w": 3, "one_div_wsum": 2, "UpsampleFilter": 1, "sampleScale": 3, "MOBILE_OR_CONSOLE": 1, "d.wy": 2, "alpha": 2, "tex_sampler": 2, "WRAP": 2, "vertex": 2, "ipos": 2, "Out.pos": 1, "Out.tex": 1, "pixel": 2, "COLOR": 1, "In.tex": 1 }, "HTML": { "": 5, "html": 4, "": 6, "": 6, "": 9, "rel=": 9, "charset=": 3, "type=": 9, "href=": 73, "": 10, "": 5, "": 6, "
": 56, "id=": 63, "

": 29, "

": 29, "
": 57, "": 12, "": 1, "": 14, "": 28, "+": 6, "-": 164, "": 14, "": 1, "
": 28, "
": 12, "": 6, "": 1, "

": 1, "": 1, "HREF=": 1, "Supported": 1, "Targets": 1, "": 1, "

": 1, "": 1, "": 1, "PUBLIC": 3, "W3C": 3, "DTD": 5, "XHTML": 4, "1": 2, "0": 3, "Transitional": 1, "EN": 3, "http": 6, "www": 3, "w3": 3, "org": 3, "TR": 3, "xhtml1": 4, "transitional": 1, "dtd": 3, "xmlns=": 2, "equiv=": 3, "content=": 8, "": 4, "Related": 2, "Pages": 2, "": 4, "class=": 139, "": 70, "Main": 1, "Page": 1, "": 70, "&": 3, "middot": 3, ";": 39, "Class": 2, "Overview": 2, "Hierarchy": 1, "All": 1, "Classes": 1, "": 1, "Here": 2, "is": 10, "a": 23, "list": 1, "of": 10, "all": 3, "related": 1, "documentation": 4, "pages": 2, "": 12, "src=": 21, "alt=": 12, "width=": 1, "height=": 6, "target=": 6, "16": 1, "The": 4, "Layout": 1, "System": 1, "Generated": 1, "with": 3, "Doxygen": 1, "": 5, "lang=": 1, "name=": 3, "Make": 1, "Static": 1, "HTML": 4, "Documentation": 1, "for": 7, "Package": 1, "pkgdown": 15, "": 11, "property=": 3, "converts": 1, "your": 11, "vignettes": 1, "README": 1, "and": 17, "more": 3, "to": 20, "making": 1, "it": 5, "easy": 2, "share": 1, "information": 2, "about": 2, "package": 8, "online": 1, "
": 1, "role=": 4, "": 15, "placement=": 1, "title=": 1, "
    ": 8, "
  • ": 31, "
    • ": 31, "Get": 1, "started": 1, "Reference": 1, "Articles": 1, "Test": 8, "Details": 1, "tag": 1, "External": 1, "file": 3, "tests": 1, "Figures": 1, "Highlighting": 1, "JSS": 1, "article": 1, "(": 170, "PDF": 3, ")": 170, "Custom": 1, "output": 3, "Widgets": 1, "
": 8, "Changelog": 1, "
": 1, "": 1, "placeholder=": 1, "label=": 1, "autocomplete=": 1, "
": 1, "": 1, "UnescapedStringRecipe": 1, "Unescaped": 1, "unescaped_string_main": 1, "url": 7, "Try": 1, "setting": 1, "myStrParam": 1, "GET": 3, "nice": 1, "innocent": 1, "button...": 1, "myStrParam=": 1, "GetAndPostRecipe": 1, "get_and_post_main": 1, "myIntParam=": 2, "myIntParam": 2, "boom": 1, "
": 2, "action=": 2, "method=": 2, "": 4, "name=": 2, "value=": 4, "
": 2, "these": 1, "types": 1, "ints": 1, "They": 1, "know": 1, "assert_user_id": 1, "Everyone": 2, "all": 2, "ids": 2, "odd": 1, "2": 2, "Invalid": 2, "assert_cow_id": 1, "even": 1, "0": 1 }, "Haml": { "%": 7, "p": 1, "Hello": 1, "World": 1, "/": 1, "replace": 1, ".pull": 1, "-": 16, "right": 1, ".btn": 2, "group": 2, "link_to": 4, "page.url": 1, "target": 1, "title": 5, "t": 5, "(": 10, ")": 10, "class": 4, "do": 4, "i.icon": 5, "picture.row": 1, "black": 1, "refinery.edit_admin_page_path": 1, "page.nested_url": 2, "switch_locale": 1, "page.translations.first.locale": 1, "unless": 1, "scope": 4, "edit.row": 1, "blue": 1, "if": 1, "page.deletable": 1, "refinery.admin_page_path": 1, "methode": 1, "delete": 1, "data": 1, "{": 1, "confirm": 1, "page_title_with_translations": 1, "page": 1, "}": 1, "trash.row": 1, "red": 1, "else": 1, "button.btn.btn": 1, "xs.btn": 1, "default.disabled": 1, "trash": 1, "refinery.new_admin_page_path": 1, "parent_id": 1, "page.id": 1, "plus.row": 1, "green": 1 }, "Handlebars": { "
": 5, "class=": 5, "

": 3, "{": 16, "title": 1, "}": 16, "

": 3, "body": 3, "
": 5, "By": 2, "fullName": 2, "author": 2, "Comments": 1, "#each": 1, "comments": 1, "

": 1, "

": 1, "/each": 1 }, "Haskell": { "module": 3, "Sudoku": 9, "(": 69, "solve": 13, "isSolved": 4, "pPrint": 5, ")": 69, "where": 11, "import": 19, "Data.Maybe": 4, "Data.List": 2, "Data.List.Split": 1, "type": 1, "[": 28, "Int": 20, "]": 28, "-": 93, "Maybe": 3, "sudoku": 36, "|": 10, "Just": 2, "otherwise": 2, "do": 3, "index": 27, "<->": 1, "elemIndex": 1, "0": 4, "let": 4, "sudokus": 2, "nextTest": 5, "i": 7, "1": 2, "9": 7, "checkRow": 2, "checkColumn": 2, "checkBox": 2, "listToMaybe": 1, "mapMaybe": 1, "take": 1, "drop": 1, "length": 14, "getRow": 3, "nub": 6, "getColumn": 3, "getBox": 3, "filter": 4, "chunksOf": 10, "quot": 3, "transpose": 4, "mod": 2, "map": 14, "concat": 2, "concatMap": 3, "3": 4, "27": 1, "Bool": 6, "product": 1, "False": 5, ".": 11, "sudokuRows": 4, "/": 4, "sudokuColumns": 3, "sudokuBoxes": 3, "True": 2, "String": 21, "intercalate": 2, "show": 1, "Main": 1, "main": 7, "IO": 2, "putStrLn": 3, "+": 13, "fromMaybe": 1, "SHEBANG#!runhaskell": 1, "average": 3, "x": 24, "y": 10, "div": 1, "notBlocked": 3, "maze": 13, "_": 7, "substitute": 4, "a": 3, "orig": 2, "pos": 5, "el": 2, "before": 2, "after": 2, "splitAt": 1, "in": 2, "tail": 17, "draw": 2, "row": 2, "tryMoves": 5, "Nothing": 2, "prevPos": 3, "newPos": 2, "wallPos": 2, "more": 2, "case": 1, "of": 1, "newPositions": 4, "notPrev": 1, "wallPositions": 1, "zipped": 2, "zip": 1, "legalMoves": 2, "startx": 2, "head": 1, "starty": 2, "start": 1, "interact": 1, "t": 1, "Data.Char": 1, "hello": 2, "toUpper": 1, "Language.Haskell.HsColour": 1, "Output": 6, "..": 3, "ColourPrefs": 4, "hscolour": 15, "qualified": 7, "Language.Haskell.HsColour.TTY": 1, "as": 7, "TTY": 2, "Language.Haskell.HsColour.HTML": 1, "HTML": 2, "Language.Haskell.HsColour.CSS": 1, "CSS": 2, "Language.Haskell.HsColour.ACSS": 1, "ACSS": 2, "ICSS": 2, "Language.Haskell.HsColour.LaTeX": 1, "LaTeX": 2, "Language.Haskell.HsColour.MIRC": 1, "MIRC": 2, "mapAccumL": 1, "isPrefixOf": 3, "Language.Haskell.HsColour.Output": 1, "Debug.Trace": 1, "format.": 1, "Colour": 2, "preferences": 2, "for": 4, "formats": 2, "that": 2, "support": 2, "them": 2, "Whether": 4, "to": 2, "include": 2, "anchors.": 2, "output": 6, "document": 2, "is": 2, "partial": 5, "or": 2, "complete.": 1, "Title": 2, "output.": 1, "input": 1, "literate": 1, "haskell": 1, "not": 1, "Haskell": 4, "source": 4, "code.": 4, "Coloured": 2, "pref": 2, "anchor": 2, "title": 14, "if": 2, "then": 2, "id": 8, "else": 2, "top": 11, "chunk": 3, "joinL": 9, "classify": 9, "inlines": 3, "Code": 7, "c": 8, "Lit": 12, "format": 1, "transformer": 1, "TTYg": 1, "LaTeX.top": 1, "HTML.top": 1, "CSS.top": 2, "ICSS.top": 1, "data": 1, "{": 2, "unL": 2, "}": 2, "deriving": 1, "Show": 1, "s": 5, "lines": 6, "M": 2, "n": 5, "DOS": 1, "MacOS": 1, "Unix": 1, "acc": 1, "xs": 16, "allProg": 5, "Should": 1, "give": 1, "an": 1, "error": 1, "message": 1, "c2": 4, "any": 2 }, "HiveQL": { "set": 3, "hive.mapred.mode": 1, "nonstrict": 2, ";": 10, "hive.exec.dynamic.partition": 1, "true": 1, "hive.exec.dynamic.partition.mode": 1, "create": 2, "table": 2, "nzhang_t1": 4, "like": 2, "srcpart": 3, "nzhang_t2": 4, "FROM": 1, "INSERT": 2, "OVERWRITE": 2, "TABLE": 2, "PARTITION": 2, "(": 2, "ds": 7, "hr": 7, ")": 2, "SELECT": 2, "key": 3, "value": 3, "WHERE": 2, "AND": 1, "and": 1, "GROUP": 1, "BY": 1, "show": 2, "partitions": 2, "select": 2, "*": 2, "from": 2 }, "Hy": { ";": 4, "The": 1, "concurrent.futures": 2, "example": 2, "in": 2, "Hy.": 2, "(": 51, "import": 1, "[": 19, "ThreadPoolExecutor": 2, "as": 3, "-": 10, "completed": 2, "]": 19, "random": 1, "randint": 2, "sh": 1, "sleep": 2, ")": 51, "defn": 5, "task": 2, "to": 2, "do": 2, "with": 1, "executor": 2, "setv": 1, "jobs": 2, "list": 1, "comp": 1, ".submit": 1, "x": 3, "range": 2, "for": 3, "future": 2, ".result": 1, "Fibonacci": 1, "fib": 4, "n": 5, "if": 2, "<": 1, "+": 1, "__name__": 1, "print": 5, "SHEBANG#!hy": 1, "fizz": 2, "buzz": 2, "fizzbuzz": 2, "defmain": 1, "&": 1, "rest": 1, "args": 1, "i": 6, "cond": 1, "and": 1, "%": 4, "True": 1 }, "HyPhy": { "INTEGRATION_PRECISION_FACTOR": 1, ";": 685, "END_OF_FILE": 1, "LIKELIHOOD_FUNCTION_OUTPUT": 7, "ACCEPT_BRANCH_LENGTHS": 1, "#include": 6, "fprintf": 332, "(": 536, "stdout": 215, ")": 527, "DataSet": 6, "data": 156, "ReadDataFile": 6, "assert": 275, "data.sites": 3, "%": 1, "totalcodons": 5, "data.species": 2, "DataSetFilter": 79, "codonfilter": 2, "CreateFilter": 79, "codonfilter.species": 2, "codonfilter.sites": 3, "-": 134, "CheckCodonFilter": 69, "fscanf": 6, "String": 3, "treestring": 68, "CreateGY94Model": 1, "UseModel": 69, "model": 160, "ExecuteCommands": 389, "TipCount": 271, "tree": 475, "LikelihoodFunction": 76, "likelihood": 78, "Optimize": 83, "mlestimates": 7, "[": 198, "]": 198, "+": 158, "BranchCount": 69, "GetString": 11, "associativearray": 2, "globalindependentvariables": 3, "for": 415, "ivariable": 3, "": 1, "ivariable=": 1, "1": 854, "variable": 71, "cmdstring": 3, "Format": 222, "0": 553, "30": 139, "nFixing": 1, "as": 3, "follows": 1, "n": 276, "persitelikelihoods": 70, "sitelikelihoods": 1, "txt": 1, "nNow": 1, "computing": 1, "per": 1, "site": 137, "likelihoods": 1, "and": 78, "writing": 1, "to": 4, "SITE": 1, "tSITE_LOG_LIKELIHOODS": 1, "nComputing": 68, "sitecodonfilter": 338, "3": 115, "2": 93, "TAA": 68, "TAG": 68, "TGA": 68, "sites": 75, "Codon": 71, "filtered": 68, "does": 68, "not": 135, "have": 136, "one": 68, "Tree": 78, "sitetree": 403, "species": 137, "Number": 134, "of": 203, "number": 68, "tips": 134, "differ": 134, "ibranch=": 134, "ibranch": 134, "branchname": 201, "BranchName": 69, "branchlength": 134, "t": 405, "itip=": 134, "itip": 134, "tipname": 201, "TipName": 67, "tiplength": 134, "sitelikelihood": 134, "sitemlestimates": 201, "Found": 67, "a": 142, "optimized": 67, "Either": 67, "or": 68, "branch": 70, "parameter": 68, "must": 67, "been": 67, "fixed": 67, "4": 70, "5": 60, "6": 22, "7": 7, "8": 18, "9": 5, "10": 23, "11": 4, "12": 7, "13": 5, "14": 12, "15": 33, "16": 42, "17": 6, "18": 4, "19": 4, "20": 4, "21": 4, "22": 4, "23": 4, "24": 4, "25": 6, "26": 4, "27": 4, "28": 4, "29": 4, "31": 4, "32": 4, "33": 6, "34": 4, "35": 4, "36": 4, "37": 4, "38": 4, "39": 4, "40": 4, "41": 4, "42": 4, "43": 4, "44": 4, "45": 4, "46": 4, "47": 4, "48": 4, "49": 4, "50": 4, "51": 4, "52": 4, "53": 4, "54": 4, "55": 4, "56": 4, "57": 4, "58": 4, "59": 4, "60": 4, "61": 4, "62": 4, "63": 4, "64": 23, "65": 4, "66": 4, "67": 4, "68": 3, "69": 1, "70": 1, "71": 1, "72": 1, "73": 1, "74": 1, "75": 3, "76": 1, "77": 1, "78": 1, "79": 1, "80": 1, "81": 1, "82": 1, "83": 1, "84": 1, "85": 3, "86": 1, "87": 1, "88": 1, "89": 1, "90": 1, "91": 1, "92": 1, "93": 1, "94": 5, "95": 2, "96": 1, "97": 1, "98": 1, "99": 1, "100": 1, "101": 1, "102": 1, "103": 1, "104": 1, "105": 1, "106": 1, "107": 1, "108": 1, "109": 1, "110": 1, "111": 1, "112": 1, "113": 1, "114": 1, "115": 1, "116": 1, "117": 1, "118": 1, "119": 1, "120": 1, "121": 1, "122": 1, "123": 1, "124": 1, "125": 1, "126": 1, "127": 1, "128": 4, "129": 1, "130": 1, "131": 1, "132": 1, "133": 1, "134": 1, "135": 1, "136": 1, "137": 1, "138": 1, "139": 1, "140": 1, "141": 1, "142": 1, "143": 1, "144": 1, "145": 1, "146": 1, "147": 1, "148": 1, "149": 1, "150": 1, "151": 1, "152": 1, "153": 1, "154": 1, "155": 1, "156": 1, "157": 1, "158": 1, "159": 1, "160": 1, "161": 1, "162": 1, "163": 1, "164": 1, "165": 1, "166": 1, "167": 1, "168": 1, "169": 1, "170": 1, "171": 1, "172": 1, "173": 1, "174": 1, "175": 1, "176": 1, "177": 1, "178": 1, "179": 1, "180": 1, "181": 1, "182": 1, "183": 1, "184": 1, "185": 1, "186": 1, "187": 1, "188": 1, "189": 1, "190": 1, "191": 1, "192": 1, "193": 1, "194": 1, "195": 1, "196": 1, "197": 1, "198": 1, "199": 1, "200": 2, "201": 1, "202": 1, "203": 4, "RequireVersion": 1, "function": 21, "BuildCodonFrequencies": 5, "obsF": 28, "{": 187, "PIStop": 16, "result": 12, "ModelMatrixDimension": 21, "}": 196, "hshift": 109, "h": 208, "<64>": 3, "h=": 27, "first": 12, "second": 12, "third": 12, "if": 217, "_Genetic_Code": 51, "continue": 16, "return": 35, "ReportDistributionString": 16, "rc": 3, "freqStrMx": 19, "infix": 36, "skip0": 2, "distroString": 6, "1024": 3, "reportMx": 12, "dN": 10, "dS": 11, "Prob": 1, "mi=": 24, "mi": 77, "S_": 9, "c_": 5, "scale": 3, "NS_": 5, "*": 16, "DefineNucleotideBiases": 3, "dummy": 4, "ModelTitle": 9, "modelDesc": 22, "modelConstraintString": 16, "customLoopCounter2": 20, "<6>": 3, "customLoopCounter2=": 4, "rateBiasTerms": 15, "global": 78, "customLoopCounter=": 5, "customLoopCounter": 8, "else": 105, "break": 8, "Abs": 13, "defineRateDistribution": 3, "": 3, "categDef1": 17, "nglobal": 3, "randomizeInitValues": 5, "categDef1*": 3, "resp": 33, "": 1, "mi2=": 4, "mi2": 4, "P_": 4, "R_": 6, "stratDNDS": 2, "respN": 7, "respP": 12, "nR_": 7, "Random": 5, "05": 2, "ChoiceList": 10, "branchLengths": 13, "Branch": 1, "Lengths": 1, "SKIP_NONE": 10, "Model": 14, "Jointly": 1, "optimize": 1, "rate": 4, "parameters": 11, "lengths": 3, "slow": 1, "thorough": 1, "Nucleotide": 3, "Estimate": 1, "once": 1, "using": 1, "an": 2, "appropriate": 1, "nucleotide": 7, "quick": 1, "dirty": 1, "fileCount": 6, "include": 14, "TemplateModels": 8, "chooseGeneticCode": 4, "def": 5, "ExecuteAFile": 4, "2RatesAnalyses": 1, "MG94xREVxBivariate": 1, "mdl": 5, "nReading": 2, "input": 2, "file": 7, "SetDialogPrompt": 8, "Please": 4, "specify": 4, "codon": 7, "ds_1": 4, "PROMPT_FOR_FILE": 8, "nData": 2, "LAST_FILE_PATH": 18, "sequences": 3, "nucleotides": 2, "filteredData_1": 6, "GeneticCodeExclusions": 5, "HarvestFrequencies": 10, "observedFreq_1": 2, "observedFreqSingle_1": 2, "done": 10, "while": 5, "nPlease": 2, "enter": 2, "character": 2, "designation": 2, "e": 2, "g": 2, "010010": 3, "defines": 2, "HKY85": 3, "stdin": 5, "MG94x": 2, "AC_1": 6, "AT_1": 6, "CG_1": 6, "CT_1": 6, "GT_1": 6, "modelConstraintString_1": 3, "ModelTitle_1": 2, "Using": 2, "on": 4, "alignment": 3, "queryTree": 5, "bf": 5, "treeString_1": 2, "treeString": 5, "ds_2": 4, "filteredData_2": 5, "observedFreq_2": 2, "observedFreqSingle_2": 2, "AC_2": 6, "AT_2": 6, "CG_2": 6, "CT_2": 6, "GT_2": 6, "modelConstraintString_2": 3, "ModelTitle_2": 2, "treeString_2": 2, "totalCodonCount": 9, "Initial": 1, "Value": 4, "Options": 1, "Default": 1, "Use": 1, "default": 1, "inital": 1, "values": 2, "distribution": 2, "Randomized": 1, "Select": 1, "initial": 1, "at": 2, "random": 1, "respM": 2, "nUsing": 1, "negatively": 1, "selected": 2, "classes": 4, "neutrally": 1, "evolving": 1, "positively": 1, "lfDef": 11, "fileID": 62, "Log": 6, "1_": 4, "categDef_1": 2, "freqStrMx_1": 10, "SITE_LIKELIHOOD": 2, "2_": 4, "categDef_2": 2, "freqStrMx_2": 9, "lfDef1": 8, "Save": 1, "resulting": 1, "fits": 1, "CLEAR_FILE": 9, "resToPath": 10, "vectorOfFrequencies_1": 1, "vectorOfFrequencies_2": 1, "Fitting": 1, "approximate": 1, "get": 1, "starting": 1, "bias": 1, "estimates": 1, "nucModelMatrix_1": 2, "nucModel_1": 1, "nucFilter_1": 2, "nucTree_1": 2, "nucModelMatrix_2": 2, "nucModel_2": 1, "nucFilter_2": 2, "nucTree_2": 2, "nuc_lf": 2, "nuc_res": 1, "codonFactor_1": 4, "codonFactor_2": 4, "lfParts": 7, "lf": 44, "tree_1_0": 1, "rateMultipliers": 1, "AC_": 2, "AT_": 2, "CG_": 2, "CT_": 2, "GT_": 2, "part": 12, "PopulateModelMatrix": 6, "rate_matrix_": 2, "_": 6, "observedFreq_": 1, "_scale": 2, "MG94model_": 1, "vectorOfFrequencies_": 1, "treeID": 6, "tree_": 2, "treeString_": 1, "ReplicateConstraint": 3, "this1": 2, "synRate": 54, "this2": 2, "t__": 1, "codonFactor_": 2, "nucTree_": 3, "bnames": 4, "nlfDef": 5, "lc": 4, "Columns": 15, "lc=": 1, "_0": 1, "sumPath": 19, "treeBranchParameters": 6, "<": 34, "sop": 2, "Max": 6, "OPTIMIZATION_PRECISION": 4, "P_1_1": 5, "P_1_2": 4, "P_1_3": 3, "P_2_1": 5, "P_2_2": 5, "P_2_3": 2, "S_1_0": 3, "S_1_1": 4, "S_1_2": 4, "S_1_3": 2, "S_2_0": 3, "S_2_1": 4, "S_2_2": 4, "S_2_3": 2, "R_1_0": 2, "R_1_1": 2, "R_1_2": 2, "R_2_0": 2, "R_2_1": 2, "R_2_2": 2, "res": 20, "USE_LAST_RESULTS": 7, "SKIP_CONJUGATE_GRADIENT": 2, "d1": 21, "d2": 18, "codonFactor_1__": 1, "codonFactor_2__": 1, "AC_1__": 1, "AT_1__": 1, "CG_1__": 1, "CT_1__": 1, "GT_1__": 1, "AC_2__": 1, "AT_2__": 1, "CG_2__": 1, "CT_2__": 1, "GT_2__": 1, "2/filteredData_1.sites": 1, "baseLineLL": 4, "LFCompute": 7, "LF_START_COMPUTE": 3, "bestDiff": 20, "1e100": 6, "bestAlpha": 13, "bestBeta": 9, "bestLL": 1, "step": 13, "step2": 3, "v1": 26, "v1c": 26, "v2": 59, "v2c": 16, "checkASample": 7, "saveBD": 6, "1/filteredData_2.sites": 1, "LF_DONE_COMPUTE": 3, "S_1_0*R_1_0": 1, "S_2_0*R_2_0": 1, "1/": 4, "filteredData_1.sites*": 2, "filteredData_2.sites*": 2, "1/16": 1, "2/": 2, "step/2": 2, "S_1_2*R_1_2": 1, "S_2_2*R_2_2": 1, "paramList": 10, "degF": 6, "2*branchLengths": 2, "LogL": 13, "AIC": 30, "2*": 14, "AICc": 3, "degF*totalCodonCount/": 1, "k": 89, "": 1, "k=": 39, "R_1_": 6, "R_2_": 4, "degFPSS": 7, "Global": 3, "Independent": 3, "nRunning": 4, "shared": 3, "positive": 9, "selection": 7, "strengths": 3, "res_PSS": 2, "LogLPSS": 7, "AICPSS": 3, "AICcPSS": 3, "nShared": 6, "fit": 6, "summary": 6, "nLog": 6, "nParameters": 6, "nAIC": 8, "nc": 6, "regime": 5, "Inferred": 12, "rates": 13, "set": 12, "fpath": 8, "SharedStrength": 1, "SHARED": 3, "POSITIVE": 2, "SELECTION": 2, "PROPORTIONS": 1, "RELOAD": 2, "INDEPENDENT": 2, "FIT": 2, "DeleteObject": 3, "P_1_": 6, "P_2_": 4, "degFPSP": 7, "proportions": 3, "res_PSP": 2, "LogLPSP": 7, "AICPSP": 3, "AICcPSP": 3, "SharedProportion": 1, "REGIME": 1, "degFPSH": 7, "res_PSH": 2, "LogLPSH": 7, "AICPSH": 3, "AICcPSH": 3, "SharedPositiveSelection": 1, "MODEL": 1, "S_1_": 2, "S_2_": 1, "degFJ": 6, "res_J": 2, "LogLJ": 7, "AICJ": 3, "AICcJ": 3, "degFJ*totalCodonCount/": 1, "whichRate": 3, "res_n": 2, "localDiff": 3, "v2/v1": 1, "Rows": 7, "modelMatrixList": 10, "runAModel": 2, "modelID": 3, "fileName": 2, "xtraP": 2, "midx": 8, "givenTree": 7, "filteredData": 14, "lf_info": 2, "locals": 5, "branchLengthStash": 4, "_iv": 16, "currentBL": 1, "BranchLength": 3, "currentBN": 3, "/currentBL": 1, "": 1, "params": 6, "cAIC": 8, "params*": 1, "filteredData.sites/": 1, "filteredData.sites": 1, "TL": 5, "*Columns": 1, "sepString": 9, "resultMatrix": 6, "bestAIC": 4, "bestAICidx": 3, "bestCAIC": 4, "bestCAICidx": 4, "maxModelWidth": 5, "skipCodeSelectionStep": 3, "doREV": 3, "modelCount": 4, "2*doREV": 1, "": 1, "capString": 7, "256": 2, "Likelihood": 2, "prms": 1, "Score": 2, "c": 58, "Length": 1, "SKIP_MODEL_PARAMETER_LIST": 2, "modelParameters2": 1, "modelType": 20, "defineGamma": 1, "defineHM": 1, "load": 1, "amino": 2, "acid": 2, "ds": 12, "aminoacid": 1, "comparisons": 1, "nThe": 1, "has": 1, "_DO_TREE_REBALANCE_": 3, "mid=": 2, "mid": 5, "nBest": 1, "with": 10, "the": 7, "score": 1, "labelMatrix": 2, "aaString": 4, "fC": 5, "OpenWindow": 1, "CHARTWINDOW": 1, "#profile": 1, "START": 1, "s": 3, "m": 3, "<250000>": 1, "profile": 2, "PAUSE": 1, "s2": 3, "10000": 1, "_hyphy_profile_dump": 4, "stats": 5, "STATS": 1, "_profile_summer": 5, "_instructions": 3, "INSTRUCTION": 2, "_indices": 2, "INDEX": 1, "nTotal": 2, "run": 1, "time": 2, "seconds": 3, "1000000": 2, "steps": 1, "tCall": 1, "count": 1, "tTime": 1, "aMatrix": 13, "r": 17, "template": 5, "ReceiveJobs": 5, "sendOrNot": 2, "MPI_NODE_COUNT": 11, "MPIReceive": 1, "fromNode": 22, "result_String": 2, "jobModelNum": 24, "MPINodeState": 29, "vv1": 4, "vv2": 6, "vv3": 6, "vv4": 6, "vv5": 6, "vv6": 6, "MPISend": 3, "modelNum": 11, "v3": 28, "v4": 16, "v5": 15, "v6": 9, "stdl": 6, "lf_MLES": 12, "fullnp": 6, "addOn": 7, "resultCache": 63, "<203>": 1, "lnL": 16, "np": 13, "LRT": 21, "PRINT_DIGITS": 14, "LRT=": 3, "pValue": 19, "CChi2": 5, "rejectAt": 10, "rejectCount": 7, "&&": 3, "<0>": 4, "ModelMatrixName": 78, "EFV": 3, "vshift": 90, "v": 197, "v=": 19, "diff": 24, "nucPosInCodon": 9, "4=": 18, "16=": 18, "transition": 26, "transition2=": 18, "rateType": 36, "mSpecMatrix": 5, "transition2": 6, "AC": 10, "EFV__": 56, "transition__": 28, "nucPosInCodon__": 52, "transition2__": 28, "R": 26, "AT": 10, "CG": 10, "CT": 10, "GT": 10, "setElement": 6, "cc": 3, "printModelMatrix": 2, "modelString": 23, "mstrConv": 25, "B": 1, "C": 3, "D": 11, "E": 8, "F": 1, "sep": 7, "A": 4, "G": 2, "T": 6, "nt": 3, "synonymous": 1, "substitutions": 1, "t=": 1, "non": 1, "synonumous": 1, "ones": 1, "n______________READ": 1, "THE": 3, "FOLLOWING": 1, "DATA______________": 1, "observedFreq": 14, "modelParameters5": 1, "BASE_PATH": 11, "KEEP_OPTIMAL_ORDER": 1, "MESSAGE_LOGGING": 1, "MG94custom": 2, "MULTIPLY_BY_FREQS": 6, "vectorOfFrequencies": 8, "MG94customModel": 1, "USE_POSITION_SPECIFIC_FREQS": 1, "tr": 4, "TreeScaler": 1, "GTRMatrix": 2, "AC*nt": 2, "AT*nt": 2, "CG*nt": 2, "CT*nt": 2, "GT*nt": 2, "nucFilter": 3, "nucFreq": 2, "GTRModel": 1, "givenTreeString": 2, "nucTree": 3, "lfn": 2, "nres": 3, "OPTIMIZE_SUMMATION_ORDER": 2, "ub4": 5, "ub5": 5, "ub6": 3, "paramCount": 1, "mpiNode": 16, "nodeCounter": 6, "checkEmbedding": 2, "_m1": 6, "_m2": 6, "r=": 1, "Reject": 1, "position": 5, "r2": 6, "<202>": 1, "nPerforming": 1, "nested": 1, "tests": 1, "remaining": 1, "models": 3, "v2=": 4, "v3=": 3, "modelString2": 12, "v4=": 1, "H": 3, "npd": 2, "P": 61, "Value=": 1, "Rejected": 1, "Failed": 1, "reject": 1, "Discarding": 1, "nRemaining": 2, "prm": 2, "1e10": 1, "based": 2, "winner": 4, "000000": 1, "F81": 1, "010020": 1, "TrN": 1, "nThis": 2, "is": 4, "better": 2, "known": 2, "nGeneral": 2, "Reversible": 2, "RESTORE_GLOBALS": 1, "VERBOSITY_LEVEL": 1, "RestoreGlobalValues": 1, "lfIndex": 2, "i": 10, "": 1, "i=": 5, "SetParameter": 2, "globalSpoolMatrix": 3, "lfIndex=": 1, "SAVE_GLOBALS2": 1, "lfConstrained": 4, "globalSpoolMatrix2": 1, "RUNNING": 1, "MOLECULAR": 1, "CLOCK": 3, "ANALYSIS": 1, "dataType": 4, "Data": 1, "type": 1, "Protein": 1, "protein": 1, "several": 1, "available": 3, "genetic": 1, "codes": 1, "NICETY_LEVEL": 2, "Choose": 4, "The": 1, "following": 1, "was": 1, "read": 1, "SelectTemplateModel": 1, "RelRatio": 3, "relationString": 1, "parameter2Constrain": 8, "LAST_MODEL_PARAMETER_LIST": 7, "parameter2Constrain=": 2, "parameter2ConstrainString": 8, "funnyString": 4, "timer": 2, "Time": 2, "separator": 4, "nRESULTS": 2, "WITHOUT": 1, "fullModelLik": 2, "fullVars": 2, "now": 2, "constraint": 1, "clockTree": 3, "MolecularClock": 1, "res1": 5, "SAVE_GLOBALS": 4, "WITH": 1, "lnLikDiff": 3, "degFDiff": 3, "Ln": 1, "Ratio": 1, "Constrained": 1, "nP": 1, "nCPU": 1, "taken": 1, "ModelNames": 1, "ParameterCount": 1, "MAXIMUM_ITERATIONS_PER_VARIABLE": 1, "SetWDistribution": 1, ".5": 7, "<1>": 5, "categFreqMatrix": 18, "categRateMatrix": 10, "category": 16, "MEAN": 16, "1e25": 14, "P1": 36, "P2": 16, "W": 8, "W1": 4, "R1": 4, "R2": 4, "*P2": 2, "W1*R1": 2, "W1*R1*R2": 2, "1/5": 1, "1/4": 1, "P3": 5, "1/3": 3, "P4": 4, "1/2": 1, "alpha": 35, "beta": 35, "<100>": 6, "<200>": 4, "EQUAL": 9, "GammaDist": 5, "_x_": 86, "CGammaDist": 11, "alpha2=": 1, "alpha2": 8, "betaP": 42, "betaQ": 40, "<85>": 8, "Beta": 15, "IBeta": 5, "*/": 2, "<0.9999999>": 1, "resp__": 2, "Min": 12, "P*IBeta": 3, "*betaP/": 1, "*W*": 1, "<500>": 1, "*GammaDist": 1, "*CGammaDist": 1, "P*betaP/": 2, "*IBeta": 2, "alpha/beta*CGammaDist": 1, "mu": 36, "sigma": 26, "01": 1, "sqrt2pi": 4, "Sqrt": 4, "8*Arctan": 3, "*Exp": 1, "/": 6, "2*sigma*sigma": 5, "sqrt2pi__*sigma": 1, "/ZCDF": 7, "/sigma": 8, "ZCDF": 26, "mu*": 2, "sigma*": 2, "Exp": 18, "/sqrt2pi__": 3, "sigma1": 22, "sqrt2pi__": 8, "/sigma1": 2, "mu/sigma1": 3, "P1*": 1, "1/sigma": 3, "sigma1*": 1, "mu*mu/": 1, "2*sigma1*sigma1": 2, ".25": 1, "sigma2": 16, "<10>": 1, "Arctan": 1, "1e200": 2, "density": 1, "CDF": 1, "1e": 1, "left": 1, "bound": 2, "right": 1, "CONSTANT_ON_PARTITION": 3, "FrameText": 2, "frameChar": 3, "vertChar": 3, "parOff": 3, "theText": 3, "": 1, "BuildCodonFrequencies4": 3, "BuildCodonFrequencies12": 3, "GetDistributionParameters": 1, "sigLevel": 7, "GetInformation": 1, "distrInfo": 11, "sampleVar": 14, "ndN": 1, "sample": 1, "variance": 1, "nRate": 1, "weight=": 1, "": 1, "ConstructCategoryMatrix": 1, "marginals": 15, "COMPLETE": 1, "CC": 4, "CC/numberOfSubsets": 1, "subsetMarginals": 5, "numberOfSubsets": 7, "": 3, "l=": 8, "l": 26, "Subsets": 1, "Posterior": 2, "cutoff": 2, "positiveProb": 16, "Sites": 1, "": 2, "No": 1, "&": 3, "modelType=": 5, "kappa": 11, "PopulateModelMatrix2": 2, "spawnLikelihood": 1, "kappaSharedOrNot": 2, "modelMatrix": 7, "theModel": 2, "partitionTreeString=": 2, "subsetTree": 3, "partitionTreeString": 2, "lfSpawnString": 8, "subsetFilter": 4, "MFPSreader": 1, "spawn": 1, "dataset": 1, "filters": 1, "lowerSeqBound": 4, "speciesIndex": 2, "": 1, "partitionLengths": 2, "chosenModelList": 3, "Distributions": 2, "Run": 3, "All": 2, "all": 2, "distributions": 2, "Custom": 1, "from": 1, "rateType=": 1, "modelTypes": 5, "Single": 2, "Rate": 2, "Neutral": 2, "Selection": 2, "Discrete": 2, "Freqs": 2, "Gamma": 8, "w": 2, "Normal": 2, "shareType": 2, "sharing": 1, "mode": 1, "Share": 2, "transversion": 1, "ratio": 2, "applicable": 2, "base": 2, "frequencies": 2, "subsets": 1, "Only": 1, "only": 1, "Transversion": 1, "are": 1, "separate": 1, "each": 1, "subset": 1, "MG94": 2, "1x4": 2, "Muse": 2, "Gaut": 2, "frequency": 4, "intra": 4, "independent": 2, "3x4": 2, "specific": 2, "GY94": 2, "Goldman": 2, "Yang": 2, "shareType=": 2, "psigLevel": 5, "||": 1, ".95": 1, "categCount": 6, "dummyVar": 1, "tableSeparator": 3, "cachedBranchLengths": 1 }, "IDL": { ";": 59, "docformat": 3, "+": 8, "Find": 1, "the": 7, "greatest": 1, "common": 1, "denominator": 1, "(": 26, "GCD": 1, ")": 26, "for": 2, "two": 1, "positive": 2, "integers.": 1, "Returns": 3, "integer": 5, "Params": 3, "a": 4, "in": 4, "required": 4, "type": 5, "first": 1, "b": 4, "second": 1, "-": 14, "function": 4, "mg_gcd": 2, "compile_opt": 3, "strictarr": 3, "on_error": 1, "if": 5, "n_params": 1, "ne": 1, "then": 5, "message": 2, "mg_isinteger": 2, "||": 1, "begin": 2, "endif": 2, "_a": 3, "abs": 2, "_b": 3, "minArg": 5, "<": 1, "maxArg": 3, "eq": 2, "return": 5, "remainder": 3, "mod": 1, "end": 5, "MODULE": 1, "mg_analysis": 1, "DESCRIPTION": 1, "Tools": 1, "analysis": 1, "VERSION": 1, "SOURCE": 1, "mgalloy": 1, "BUILD_DATE": 1, "January": 1, "FUNCTION": 2, "MG_ARRAY_EQUAL": 1, "KEYWORDS": 1, "MG_TOTAL": 1, "Inverse": 1, "hyperbolic": 2, "cosine.": 1, "Uses": 1, "formula": 1, "text": 1, "{": 3, "acosh": 1, "}": 3, "z": 9, "ln": 1, "sqrt": 4, "Examples": 2, "The": 1, "arc": 1, "sine": 1, "looks": 1, "like": 2, "IDL": 5, "x": 8, "*": 2, "findgen": 1, "/": 1, "plot": 1, "mg_acosh": 2, "xstyle": 1, "This": 1, "should": 1, "look": 1, "..": 1, "image": 1, "acosh.png": 1, "float": 1, "double": 2, "complex": 2, "or": 1, "depending": 1, "on": 1, "input": 2, "numeric": 1, "alog": 1, "Truncate": 1, "argument": 2, "towards": 1, "i.e.": 1, "takes": 1, "FLOOR": 1, "of": 4, "values": 2, "and": 1, "CEIL": 1, "negative": 1, "values.": 1, "Try": 1, "main": 2, "level": 2, "program": 2, "at": 1, "this": 1, "file.": 1, "It": 1, "does": 1, "print": 4, "mg_trunc": 3, "[": 6, "]": 6, "floor": 2, "ceil": 2, "array": 2, "same": 1, "as": 1, "float/double": 1, "containing": 1, "to": 1, "truncate": 1, "result": 3, "posInd": 3, "where": 1, "gt": 2, "nposInd": 2, "example": 1 }, "IGOR Pro": { "#pragma": 2, "rtGlobals": 2, "Function": 6, "FooBar": 1, "(": 10, ")": 10, "return": 7, "End": 7, "FooBarSubType": 1, "ButtonControl": 1, "Function/D": 1, "FooBarVar": 1, "static": 3, "FooBarStatic": 1, "threadsafe": 2, "FooBarStaticThreadsafe": 1, "FooBarThread": 1, "CallOperationsAndBuiltInFuncs": 1, "string": 4, "var": 3, "someDQString": 2, "Make/N": 1, "myWave": 2, "Redimension/N": 1, "-": 3, "print": 1, "strlen": 1, "StrConstant": 1, "myConstString": 1, "constant": 1, "myConst": 1, "Structure": 2, "struct1": 1, "str": 2, "variable": 2, "EndStructure": 2, "struct2": 1, "#include": 1, "#ifdef": 1, "NOT_DEFINED": 1, "#endif": 1 }, "INI": { "title": 3, "Mindstorms": 2, "isbn": 2, "author": 3, "Seymour": 2, "Papert": 2, "pubmonth": 2, "subject": 2, "children": 2, "computers": 2, "powerful": 2, "ideas": 2, "LOGO": 2, "education": 2, "url": 3, "http": 2, "//www.papert.org/": 2, "update": 2, "Sun": 1, "Feb": 1, "PM": 1, "EST": 1, "last_client": 2, "eeschema": 3, "[": 24, "pcbnew": 2, "]": 24, "version": 9, "PageLayoutDescrFile": 2, "LastNetListRead": 2, "UseCmpFile": 2, "PadDrill": 2, "PadDrillOvalY": 2, "PadSizeH": 2, "PadSizeV": 2, "PcbTextSizeV": 2, "PcbTextSizeH": 2, "PcbTextThickness": 2, "ModuleTextSizeV": 2, "ModuleTextSizeH": 2, "ModuleTextSizeThickness": 2, "SolderMaskClearance": 2, "SolderMaskMinWidth": 2, "DrawSegmentWidth": 2, "BoardOutlineThickness": 2, "ModuleOutlineThickness": 2, "pcbnew/libraries": 1, "LibDir": 3, "general": 2, "SubpartIdSeparator": 1, "SubpartFirstId": 1, "/home/hschmale/KiCad/LibMods": 1, "-": 119, "3rdParty": 1, "NetFmtName": 1, "RptD_X": 1, "RptD_Y": 1, "RptLab": 1, "LabSize": 1, "eeschema/libraries": 2, "LibName1": 2, "power": 2, "LibName2": 2, "device": 2, "LibName3": 2, "transistors": 2, "LibName4": 2, "conn": 2, "LibName5": 2, "linear": 2, "LibName6": 2, "regul": 2, "LibName7": 2, "74xx": 2, "LibName8": 2, "cmos4000": 2, "LibName9": 2, "adc": 2, "dac": 2, "LibName10": 2, "memory": 2, "LibName11": 2, "xilinx": 2, "LibName12": 2, "special": 1, "LibName13": 2, "microcontrollers": 2, "LibName14": 2, "dsp": 2, "LibName15": 2, "microchip": 2, "LibName16": 2, "analog_switches": 2, "LibName17": 2, "motorola": 2, "LibName18": 2, "texas": 2, "LibName19": 2, "intel": 2, "LibName20": 2, "audio": 4, "LibName21": 2, "interface": 2, "LibName22": 2, "digital": 2, "LibName23": 2, "philips": 2, "LibName24": 2, "display": 2, "LibName25": 2, "cypress": 2, "LibName26": 2, "siliconi": 2, "LibName27": 2, "opto": 2, "LibName28": 2, "atmel": 2, "LibName29": 2, "contrib": 2, "LibName30": 1, "valves": 2, "LibName31": 1, "arduino_shieldsNCL": 1, "LibName32": 1, "con": 1, "usb": 1, "LibName33": 1, "2axispotwselect": 1, "app": 4, "Kivy": 1, "Kazam": 1, "package.name": 1, "kivykazam": 1, "package.domain": 1, "org.test": 1, "source.dir": 4, ".": 1, "source.include_exts": 1, "py": 1, "png": 1, "jpg": 1, "kv": 1, "atlas": 1, "#source.include_patterns": 1, "assets/*": 1, "images/*.png": 1, "#source.exclude_exts": 1, "spec": 1, "#source.exclude_dirs": 1, "tests": 1, "bin": 1, "#source.exclude_patterns": 2, "license": 2, "images/*/*.jpg": 1, "requirements": 1, "kivy": 1, "#garden_requirements": 1, "#presplash.filename": 1, "%": 4, "(": 5, ")": 5, "s/data/presplash.png": 1, "#icon.filename": 1, "s/data/icon.png": 1, "orientation": 1, "all": 1, "#services": 1, "NAME": 1, "ENTRYPOINT_TO_PY": 1, "NAME2": 1, "ENTRYPOINT2_TO_PY": 1, "#": 21, "fullscreen": 1, "#android.permissions": 1, "INTERNET": 1, "#android.api": 1, "android.minapi": 1, "#android.sdk": 1, "#android.ndk": 1, "9c": 1, "#android.private_storage": 1, "True": 1, "#android.ndk_path": 1, "#android.sdk_path": 1, "#android.ant_path": 1, "#android.p4a_dir": 1, "#android.p4a_whitelist": 1, "#android.entrypoint": 1, "org.renpy.android.PythonActivity": 1, "#android.add_jars": 1, "foo.jar": 1, "bar.jar": 1, "path/to/more/*.jar": 1, "#android.add_src": 1, "#android.branch": 1, "master": 1, "#android.ouya.category": 1, "GAME": 1, "#android.ouya.icon.filename": 1, "s/data/ouya_icon.png": 1, "#android.manifest.intent_filters": 1, "#android.add_libs_armeabi": 1, "libs/android/*.so": 1, "#android.add_libs_armeabi_v7a": 1, "libs/android": 3, "v7/*.so": 1, "#android.add_libs_x86": 1, "x86/*.so": 1, "#android.add_libs_mips": 1, "mips/*.so": 1, "#android.wakelock": 1, "False": 1, "#android.meta_data": 1, "#android.library_references": 1, "#android.logcat_filters": 1, "*": 1, "S": 1, "python": 1, "D": 1, "#android.copy_libs": 1, "#ios.kivy_ios_dir": 1, "../kivy": 1, "ios": 1, "#ios.codesign.debug": 1, "#ios.codesign.release": 1, "ios.codesign.debug": 1, "s": 1, "buildozer": 1, "log_level": 1, "warn_on_root": 1, "data/audio/*.wav": 1, "data/images/original/*": 1, "source.exclude_patterns": 1, "#license": 1, "#data/audio/*.wav": 1, "#data/images/original/*": 1, "app@demo": 1, "#title": 1, "My": 1, "Application": 1, "demo": 2, "source.exclude_patterns@demo": 1, "#images/hd/*": 1, "#buildozer": 1, "profile": 1, "android": 1, "debug": 1, ";": 8, "These": 1, "taskdefs": 1, "are": 1, "loaded": 1, "at": 1, "startup.": 1, "Internal": 1, "system": 1, "tasks": 3, "adhoc": 3, "phing.tasks.system.AdhocTask": 1, "task": 1, "type": 1, "append": 1, "phing.tasks.system.AppendTask": 2, "available": 1, "phing.tasks.system.AvailableTask": 1, "chmod": 1, "phing.tasks.system.ChmodTask": 1, "chown": 1, "phing.tasks.system.ChownTask": 1, "concat": 1, "condition": 1, "phing.tasks.system.ConditionTask": 1, "copy": 1, "phing.tasks.system.CopyTask": 1, "cvs": 1, "phing.tasks.system.CvsTask": 1, "cvspass": 1, "phing.tasks.system.CvsPassTask": 1, "delete": 1, "phing.tasks.system.DeleteTask": 1, "echo": 1, "phing.tasks.system.EchoTask": 1, "exec": 1, "phing.tasks.system.ExecTask": 1, "fail": 1, "phing.tasks.system.ExitTask": 1, "foreach": 1, "phing.tasks.system.ForeachTask": 1, "includepath": 1, "input": 1, "phing.tasks.system.InputTask": 1, "mkdir": 1, "phing.tasks.system.MkdirTask": 1, "move": 1, "phing.tasks.system.MoveTask": 1, "phing": 1, "phing.tasks.system.PhingTask": 1, "phingcall": 1, "phing.tasks.system.PhingCallTask": 1, "php": 1, "phing.tasks.system.PhpEvalTask": 1, "property": 1, "phing.tasks.system.PropertyTask": 1, "propertyprompt": 1, "reflexive": 1, "phing.tasks.system.ReflexiveTask": 1, "resolvepath": 1, "taskdef": 2, "phing.tasks.system.TaskdefTask": 1, "touch": 1, "phing.tasks.system.TouchTask": 1, "tstamp": 1, "phing.tasks.system.TstampTask": 1, "typedef": 1, "phing.tasks.system.TypedefTask": 1, "uptodate": 1, "phing.tasks.system.UpToDateTask": 1, "xslt": 1, "phing.tasks.system.XsltTask": 1, "if": 1, "phing.tasks.system.IfTask": 1, "warn": 1, "phing.tasks.system.WarnTask": 1, "contributed": 1, "i.e.": 1, "no": 1, "needed.": 1, "creole": 1, "pdo": 1, "package": 1, "as": 1, "path": 1, "smarty": 1, "phing.tasks.ext.SmartyTask": 1, "capsule": 1, "phing.tasks.ext.CapsuleTask": 1, "tar": 1, "phing.tasks.ext.TarTask": 1, "untar": 1, "phing.tasks.ext.UntarTask": 1, "pearpkg": 1, "phing.tasks.ext.PearPackageTask": 1, "pearpkg2": 1, "phing.tasks.ext.PearPackage2Task": 1, "mail": 1, "phing.tasks.ext.MailTask": 1, "zip": 1, "phing.tasks.ext.ZipTask": 1, "unzip": 1, "phing.tasks.ext.UnzipTask": 1, "scpsend": 1, "phing.tasks.ext.ScpSendTask": 1, "phpdoc": 1, "phpdocext": 1, "svnlastrevision": 1, "svncheckout": 1, "svnexport": 1, "svnupdate": 1, "phpunit3": 1, "phpunit3report": 1, "phpunit2": 1, "phpunit2report": 1, "phpunit": 1, "phpunitreport": 1, "coverage": 3, "setup": 1, "merger": 1, "report": 1, "ioncubeencoder": 1, "ioncubelicense": 1, "simpletest": 1, "phplint": 1, "phing.tasks.ext.PhpLintTask": 1, "xmllint": 1, "phing.tasks.ext.XmlLintTask": 1, "analyze": 1, "jsllint": 1, "phing.tasks.ext.JslLintTask": 1, "manifest": 1, "phing.tasks.ext.ManifestTask": 1, "phpcodesniffer": 1, "ftpdeploy": 1, "phing.tasks.ext.FtpDeployTask": 1, "22/05/2015": 1, "kicad": 1, "RootSch": 1, "BoardNm": 1, "cvpcb": 1, "NetIExt": 1, "net": 1, "project": 1, "name": 6, "Spyder": 1, "Website": 1, "themes": 1, "hugo": 1, "icon": 1, "url_style": 1, "absolute": 1, "https": 6, "//www.spyder": 1, "ide.org": 3, "packages": 1, "lektor": 4, "webpack": 1, "support": 1, "markdown": 1, "header": 1, "anchors": 1, "disqus": 1, "comments": 1, "atom": 1, "servers.develop": 1, "Develop": 1, "target": 2, "ghpages": 2, "+": 2, "//spyder": 2, "ide//website": 2, "develop": 1, "cname": 2, "develop.spyder": 1, "servers.production": 1, "Production": 1, "production": 1, "www.spyder": 1, "alternatives.en": 1, "English": 1, "primary": 1, "yes": 1, "locale": 3, "en_US": 1, "alternatives.es": 1, "Spanish": 1, "url_prefix": 2, "/es/": 1, "es": 1, "alternatives.fr": 1, "French": 1, "/fr/": 1, "fr": 1, "theme_settings": 1, "description": 1, "other_css": 1, "content_lang": 1, "hero_img": 1, "hero_title": 1, "hero_description": 1, "nav_mission": 1, "mission_2_nav": 1, "nav_services": 1, "nav_team": 1, "nav_work": 1, "spyder_nav_content": 1, "true": 9, "mission_enable": 1, "mission_images_enable": 1, "overview_enable": 1, "download_enable": 1, "services_enable": 1, "service_video_url": 1, "work_enable": 1, "team_enable": 1, "donate_enable": 1, "donate_name": 1, "Donate": 1, "donate_description": 1, "Help": 1, "us": 1, "to": 1, "provide": 1, "the": 1, "best": 1, "Scientific": 1, "Python": 1, "Development": 1, "Environment": 1, "footer_enable": 1, "footer_note": 1, "//www.freepik.com/": 1, "_blank": 3, "Freepik": 1, "//www.flaticon.com/": 1, "Flaticon": 1, "pipe": 2, "red": 2, "//freehtml5.co/icon": 1, "free": 1, "website": 1, "template": 1, "using": 1, "bootstrap/": 1, "footer_github": 1, "footer_twitter": 1, "footer_facebook": 1, "footer_google": 1, "extension_nav": 1, "ext_1_ref": 1, "ext_1_title": 1, "ext_2_ref": 1, "ext_2_title": 1, "ext_3_ref": 1, "ext_3_title": 1, "opencollective": 1, "spyder": 1, "gitter_room": 1, "donate_nav": 1 }, "Idris": { "module": 1, "Prelude.Char": 1, "import": 1, "Builtins": 1, "isUpper": 4, "Char": 13, "-": 11, "Bool": 8, "x": 36, "&&": 3, "<": 3, "isLower": 4, "isAlpha": 3, "||": 9, "isDigit": 3, "(": 8, ")": 8, "isAlphaNum": 2, "isSpace": 2, "isNL": 2, "toUpper": 3, "if": 2, "then": 2, "prim__intToChar": 2, "prim__charToInt": 2, "else": 2, "toLower": 2, "+": 1, "isHexDigit": 2, "elem": 1, "hexChars": 3, "where": 1, "List": 1, "[": 1, "]": 1 }, "Ignore List": { "*.bak": 1, "*.db": 1, "*.avi": 1, "*.pdf": 1, "*.ps": 1, "*.mid": 1, "*.midi": 1, "*.mp3": 1, "*.aif": 1, "*.wav": 1, "*copy.mus": 1, ".DS_Store": 4, "node_modules": 4, "/browser.js": 1, "/index.js": 1, "*.log": 3, "package": 2, "-": 17, "lock.json": 2, "*.pyc": 1, "Desktop.ini": 2, "._*": 2, "Thumbs.db": 2, ".Spotlight": 1, "V100": 1, ".Trashes": 1, ".vscode/**": 1, ".vscode": 1, "test/**": 2, "out/test/**": 1, "src/**": 1, "**/*.map": 1, ".gitignore": 2, "tsconfig.json": 1, "vsc": 1, "extension": 1, "quickstart.md": 1, "*.imp": 1, ".git": 3, "*.spec.scss": 1, "**/node_modules/**": 1, "**/test/assets/**": 1, "spec/fixtures": 1, "test/**/*.js": 1, ".purify": 1, "autom4te.cache": 1, "config.log": 1, "config.cache": 1, "config.status": 1, "config.status.lineno": 1, "db_home": 1, "Makefile": 2, "buildno": 1, "python": 2, "build": 1, "Makefile.pre": 1, "platform": 1, "pybuilddir.txt": 1, "pyconfig.h": 1, "libpython*.a": 1, "libpython*.so*": 1, "python.exe": 1, "gdb.py": 1, "reflog.txt": 1, "tags": 1, "TAGS": 1, ".gdb_history": 1, "Doc/tools/sphinx": 1, "Doc/tools/jinja": 1, "Doc/tools/jinja2": 1, "Doc/tools/pygments": 1, "Doc/tools/docutils": 1, "Misc/python.pc": 1, "Modules/Setup": 1, "Modules/Setup.config": 1, "Modules/Setup.local": 1, "Modules/config.c": 1, "Parser/pgen": 1, "Lib/test/data/*": 1, "Lib/lib2to3/Grammar*.pickle": 1, ".coverage": 1, "coverage/*": 1, "htmlcov/*": 1, ".env": 1, ".env.*": 1, ".bundle": 1, "log/*": 1, "tmp/*": 1, "vendor/bundle/*": 1, ".": 1, "#*": 2, "#": 1, "*": 2, "*.lock": 1, "[": 16, "._": 6, "]": 16, "*.s": 2, "a": 10, "v": 2, "z": 4, "*.sw": 1, "p": 2, "s": 2, "sw": 1, "urls.log": 1, "/test.mjs": 1, "/test.js": 1, "*.class": 1, ".cache/": 1, ".history/": 1, ".lib/": 1, "dist/*": 1, "target/": 2, "lib_managed/": 2, "src_managed/": 2, "project/boot/": 2, "project/plugins/project/": 1, ".scala_dependencies": 1, ".worksheet": 1, ".history": 1, ".cache": 1, "w": 2, "*.un": 1, "Session.vim": 1, ".netrwhist": 1, "examples/*": 1, "/build": 1, "/material": 1, "/site": 1, "/public/*": 1, "/views/*": 1, "./README.md": 1, "blib": 1, "pm_to_blib": 1, "adm": 1 }, "Inform 7": { "by": 3, "Andrew": 3, "Plotkin.": 2, "Include": 2, "Trivial": 3, "Extension": 3, "Volume": 4, "-": 29, "overview": 1, "Chapter": 3, "setting": 1, "the": 23, "scene": 1, "The": 3, "Kitchen": 1, "is": 17, "a": 18, "room.": 1, "[": 10, "Comment": 1, "this": 4, "kitchen": 2, "modelled": 1, "after": 4, "one": 2, "in": 5, "Zork": 1, "although": 1, "it": 3, "lacks": 1, "detail": 1, "to": 4, "establish": 1, "player.": 1, "]": 10, "Section": 2, "table": 1, "spicerack": 2, "container": 1, "Kitchen.": 2, "Table": 1, "of": 14, "Spices": 1, "Name": 1, "Flavor": 1, "description": 2, "character": 1, "A": 5, "purple": 2, "cow": 6, "called": 2, "Gelett": 8, "This": 1, "comment": 2, "spans": 1, "multiple": 1, "lines..": 1, "...and": 1, "line": 7, "contains": 1, "nested": 1, "square": 1, "brackets": 1, "...": 1, "...which": 1, "legal": 1, "Inform": 4, "Instead": 3, "examining": 2, "say": 10, "Check": 2, "smelling": 1, "blank": 2, "displayed": 1, "as": 4, "paragraph": 1, "break": 2, "but": 1, "simple": 1, "not.": 1, "stop": 1, "action.": 1, "catching": 1, "has": 3, "number": 1, "mooness.": 1, "taking": 1, "increment": 2, "mooness": 2, ";": 11, "if": 1, "else": 1, "turn": 2, "cycle": 1, "Every": 2, "Version": 1, "Plotkin": 1, "begins": 1, "here.": 2, "Note": 1, "two": 1, "special": 1, "quoted": 1, "lines": 3, "above.": 1, "kind": 3, "animal.": 1, "can": 1, "be": 2, "purple.": 1, "Understand": 2, "cow.": 2, "pushing": 1, "instead": 1, "Here": 1, "are": 4, "possible": 1, "levels": 1, "heading": 1, "One": 1, "Text": 1, "always": 1, "Book": 1, "Part": 1, "third": 1, "indented": 2, "headings": 1, "still": 1, "count": 1, "IV": 1, "not": 2, "for": 2, "release": 1, "Heading": 1, "labels": 1, "case": 1, "insensitive.": 1, "section": 2, "foobar": 1, "beginning": 1, "that": 1, "does": 1, "have": 2, "before": 1, "and": 2, "*not*": 1, "header": 2, "line.": 2, "So": 2, "following": 1, "should": 2, "all": 1, "part": 1, "foobar.": 1, "Sadly": 1, "gets": 1, "colored": 1, "because": 1, "Atom": 1, "t": 1, "recognize": 1, "Measure": 1, "value.": 1, "measure.": 3, "Length": 1, "Area": 1, "And": 1, "now": 1, "some": 1, "inclusions.": 1, "To": 2, "em": 1, "running": 2, "on": 2, "(": 4, "style": 2, "underline": 1, ")": 4, ".": 3, "/em": 1, "roman": 1, "comments": 1, "start": 1, "with": 3, "mark": 1, "run": 1, "end": 1, "Global": 1, "cowcount": 2, "inform6func": 1, "arg": 1, "print": 1, "address": 1, "+": 2, "variable": 1, "Object": 1, "i6cow": 1, "name": 1, "animate": 1, "scenery": 1, "ends": 1, "DOCUMENTATION": 1, "Everything": 1, "documentation": 2, "so": 1, "style.": 1, "However": 1, "tab": 1, "sample": 1, "code": 1, "within": 1, "Horns": 1, "thing.": 1, "horns.": 1, "we": 1, "need": 1, "allow": 1, "that.": 1 }, "Inno Setup": { ";": 74, "Basic": 1, "setup": 1, "script": 2, "for": 2, "the": 5, "Inno": 2, "Setup": 4, "installer": 2, "builder.": 1, "For": 1, "more": 1, "information": 1, "on": 2, "free": 1, "builder": 1, "see": 1, "www.jrsoftware.org.": 1, "This": 3, "was": 2, "contributed": 1, "by": 1, "Tim": 1, "Peters.": 1, "It": 1, "designed": 1, "but": 1, "works": 1, "with": 2, "later": 1, "versions": 1, "as": 1, "well.": 1, "[": 4, "]": 4, "AppName": 1, "Expat": 7, "AppId": 1, "expat": 1, "AppVersion": 1, "AppVerName": 1, "AppCopyright": 1, "Copyright": 1, "-": 2, "Thai": 1, "Open": 1, "Source": 34, "Software": 1, "Center": 1, "Clark": 1, "Cooper": 1, "and": 3, "maintainers": 1, "AppPublisher": 1, "The": 1, "Developers": 1, "AppPublisherURL": 1, "http": 3, "//www.libexpat.org/": 3, "AppSupportURL": 1, "AppUpdatesURL": 1, "UninstallDisplayName": 1, "XML": 4, "Parser": 2, "VersionInfoVersion": 1, "DefaultDirName": 1, "{": 2, "pf": 1, "}": 2, "UninstallFilesDir": 1, "app": 1, "Uninstall": 1, "Compression": 1, "lzma": 1, "SolidCompression": 1, "yes": 5, "SourceDir": 1, "..": 1, "OutputDir": 1, "win32": 6, "DisableStartupPrompt": 1, "AllowNoIcons": 1, "DisableProgramGroupPage": 1, "DisableReadyPage": 1, "Files": 1, "Flags": 33, "ignoreversion": 33, "bin": 3, "Release": 3, "xmlwf.exe": 1, "DestDir": 33, "MANIFEST.txt": 1, "Changes": 1, "DestName": 3, "Changes.txt": 1, "COPYING": 1, "COPYING.txt": 1, "README": 1, "README.txt": 4, "doc": 3, "*.html": 1, "*.css": 1, "*.png": 1, "*.dll": 1, "*.lib": 1, "expat.dsw": 1, "bcb5": 5, "*.bp*": 1, "*.mak": 1, "*.def": 2, "*.txt": 1, "*.bat": 1, "lib": 4, "*.c": 4, "*.h": 3, "*.dsp": 3, "examples": 2, "tests": 7, "*.cpp": 1, "benchmark": 3, "*.ds*": 1, "xmlwf": 3, "*.c*": 1, "Messages": 1, "WelcomeLabel1": 1, "Welcome": 1, "to": 3, "Wizard": 1, "WelcomeLabel2": 1, "will": 2, "install": 1, "name/ver": 1, "your": 1, "computer.": 1, "%": 4, "n": 2, "nExpat": 1, "is": 3, "an": 1, "parser": 1, "a": 2, "C": 1, "language": 1, "API": 2, "primarily": 1, "made": 1, "available": 1, "allow": 1, "developers": 1, "build": 1, "applications": 2, "which": 1, "use": 1, "using": 1, "portable": 1, "fast": 1, "implementation.": 1, "nIt": 1, "strongly": 1, "recommended": 1, "that": 1, "you": 2, "close": 1, "all": 1, "other": 1, "have": 1, "running": 1, "before": 1, "continuing.": 1, "help": 1, "prevent": 1, "any": 1, "conflicts": 1, "during": 1, "installation": 1, "process.": 1 }, "Ioke": { "SHEBANG#!ioke": 1, "println": 1 }, "Isabelle": { "theory": 1, "HelloWorld": 3, "imports": 1, "Main": 1, "begin": 1, "section": 1, "{": 5, "*Playing": 1, "around": 1, "with": 2, "Isabelle*": 1, "}": 5, "text": 4, "*": 4, "creating": 1, "a": 2, "lemma": 2, "the": 2, "name": 1, "hello_world*": 1, "hello_world": 2, "by": 9, "simp": 8, "thm": 1, "defining": 1, "string": 1, "constant": 1, "definition": 1, "where": 1, "theorem": 2, "(": 5, "fact": 1, "List.rev_rev_ident": 4, ")": 5, "*now": 1, "we": 1, "delete": 1, "already": 1, "proven": 1, "lema": 1, "and": 1, "show": 2, "it": 2, "hand*": 1, "declare": 1, "[": 1, "del": 1, "]": 1, "hide_fact": 1, "corollary": 2, "apply": 1, "add": 1, "HelloWorld_def": 1, "done": 1, "*does": 1, "hold": 1, "in": 1, "general": 1, "rev_rev_ident": 2, "proof": 1, "induction": 1, "l": 2, "case": 3, "Nil": 1, "thus": 1, "next": 1, "Cons": 1, "ls": 1, "assume": 1, "IH": 2, "have": 2, "hence": 1, "also": 1, "finally": 1, "using": 1, "qed": 1, "fastforce": 1, "intro": 1, "end": 1 }, "Isabelle ROOT": { "chapter": 1, "HOL": 50, "session": 75, "(": 19, "main": 8, ")": 19, "Pure": 2, "+": 75, "description": 43, "{": 56, "*": 86, "Classical": 3, "Higher": 5, "-": 57, "order": 2, "Logic.": 4, "}": 55, "options": 65, "[": 101, "document_graph": 23, "]": 101, "global_theories": 1, "Main": 2, "Complex_Main": 1, "files": 5, "document_files": 35, "with": 5, "explicit": 1, "proof": 3, "terms.": 1, "document": 54, "false": 61, "quick_and_dirty": 9, "theories": 107, "Proofs": 1, "in": 81, "Library": 2, "Logic": 2, "batteries": 1, "included.": 1, "List_lexord": 1, "Sublist_Order": 1, "Product_Lexorder": 1, "Product_Order": 1, "Finite_Lattice": 1, "AList_Mapping": 1, "Code_Binary_Nat": 1, "Code_Char": 1, "Code_Prolog": 1, "Code_Real_Approx_By_Float": 1, "Code_Target_Numeral": 1, "DAList": 1, "DAList_Multiset": 1, "RBT_Mapping": 1, "RBT_Set": 1, "Refute": 1, "Old_Datatype": 1, "Old_Recdef": 1, "Old_SMT": 1, "Hahn_Banach": 2, "Author": 20, "Gertrud": 1, "Bauer": 1, "TU": 7, "Munich": 1, "The": 8, "Hahn": 3, "Banach": 3, "theorem": 6, "for": 10, "real": 3, "vector": 1, "spaces.": 1, "This": 6, "is": 8, "the": 15, "of": 34, "vectorspaces": 2, "following": 1, "H.": 1, "Heuser": 1, "Funktionalanalysis": 1, "p.": 1, "one": 3, "fundamental": 1, "theorems": 1, "functional": 2, "analysis.": 2, "It": 1, "a": 17, "conclusion": 1, "Zorn": 1, "Two": 2, "different": 1, "formaulations": 1, "are": 4, "presented": 1, "general": 1, "and": 25, "its": 4, "application": 1, "to": 5, "normed": 1, "vectorspaces.": 1, "says": 1, "that": 1, "every": 1, "continous": 2, "linearform": 2, "defined": 1, "on": 5, "arbitrary": 1, "subspaces": 2, "not": 1, "only": 1, "dimensional": 2, "can": 1, "be": 1, "extended": 2, "whole": 2, "vectorspace.": 1, "Induct": 1, "Examples": 4, "Co": 2, "Inductive": 1, "Definitions.": 1, "Comb": 2, "proves": 3, "Church": 1, "Rosser": 1, "combinators": 1, "see": 7, "http": 6, "lcp": 3, "generic": 1, "automatic": 1, "tools.ps.gz": 1, ".": 6, "Mutil": 1, "famous": 1, "Mutilated": 1, "Chess": 1, "Board": 1, "problem": 1, "mutilated": 1, "chess": 1, "board.dvi.gz": 1, "PropLog": 2, "completeness": 1, "formalization": 4, "propositional": 1, "logic": 2, "set": 1, "II.ps.gz": 1, "Exp": 1, "demonstrates": 1, "use": 1, "iterated": 1, "inductive": 1, "definitions": 1, "reason": 1, "about": 1, "mutually": 2, "recursive": 2, "relations.": 1, "Common_Patterns": 1, "QuoDataType": 1, "QuoNestedDataType": 1, "Term": 1, "SList": 1, "ABexp": 1, "Tree": 1, "Ordinals": 2, "Sigma_Algebra": 1, "Com": 1, "IMP": 3, "document_variants": 1, "BExp": 1, "ASM": 1, "Finite_Reachable": 1, "Denotational": 1, "Compiler2": 1, "Poly_Types": 1, "Sec_Typing": 1, "Sec_TypingT": 1, "Def_Init_Big": 1, "Def_Init_Small": 1, "Fold": 1, "Live": 1, "Live_True": 1, "Hoare_Examples": 1, "VCG": 1, "Hoare_Total": 1, "Collecting1": 1, "Collecting_Examples": 1, "Abs_Int_Tests": 1, "Abs_Int1_parity": 1, "Abs_Int1_const": 1, "Abs_Int3": 1, "Procs_Dyn_Vars_Dyn": 1, "Procs_Stat_Vars_Dyn": 1, "Procs_Stat_Vars_Stat": 1, "C_like": 1, "OO": 1, "IMPP": 2, "David": 2, "von": 2, "Oheimb": 2, "Copyright": 6, "TUM": 1, "An": 1, "imperative": 3, "language": 3, "procedures.": 2, "an": 2, "extension": 2, "local": 1, "variables": 1, "For": 2, "documentation": 1, "Local": 1, "Variables": 1, "EvenOdd": 1, "Import": 1, "HOL_Light_Maps": 1, "condition": 21, "HOL_LIGHT_BUNDLE": 1, "HOL_Light_Import": 1, "Number_Theory": 2, "Fundamental": 2, "Theorem": 6, "Arithmetic": 2, "Chinese": 4, "Remainder": 2, "Fermat/Euler": 2, "Wilson": 2, "Pocklington": 2, "Gauss": 1, "Euclidean_Algorithm": 1, "Old_Number_Theory": 1, "Fib": 1, "Factorization": 1, "WilsonRuss": 1, "WilsonBij": 1, "Quadratic_Reciprocity": 1, "Primes": 1, "Hoare": 4, "Verification": 3, "programs": 2, "verification": 2, "conditions": 3, "generated": 2, "automatically": 2, "from": 2, "pre/post": 1, "loop": 1, "invariants": 1, "Hoare_Parallel": 2, "shared": 1, "variable": 1, "la": 1, "Owicki": 1, "Gries.": 1, "Codegenerator_Test": 1, "browser_info": 1, "Generate": 1, "Generate_Binary_Nat": 1, "Generate_Target_Nat": 1, "Generate_Pretty_Char": 1, "ISABELLE_GHC": 2, "Code_Test_GHC": 1, "ISABELLE_MLTON": 1, "Code_Test_MLton": 1, "ISABELLE_OCAMLC": 1, "Code_Test_OCaml": 1, "ISABELLE_POLYML": 1, "Code_Test_PolyML": 1, "ISABELLE_SCALA": 1, "Code_Test_Scala": 1, "ISABELLE_SMLNJ": 1, "Code_Test_SMLNJ": 1, "Metis_Examples": 1, "Lawrence": 2, "C": 2, "Paulson": 2, "Cambridge": 4, "University": 5, "Computer": 2, "Laboratory": 2, "Jasmin": 3, "Blanchette": 3, "Muenchen": 5, "Testing": 1, "Metis": 1, "Sledgehammer.": 1, "Abstraction": 1, "Big_O": 1, "Binary_Tree": 1, "Clausification": 1, "Message": 1, "Proxies": 1, "Tarski": 2, "Trans_Closure": 1, "Sets": 1, "Nitpick_Examples": 2, "Algebra": 1, "Clemens": 1, "Ballarin": 1, "started": 1, "September": 1, "Isabelle": 1, "Algebraic": 1, "Library.": 1, "FiniteProduct": 1, "Sylow": 1, "Bij": 1, "Divisibility": 1, "IntRing": 1, "UnivPoly": 1, "Auth": 1, "A": 5, "new": 1, "approach": 1, "verifying": 1, "authentication": 1, "protocols.": 1, "Auth_Shared": 1, "Auth_Public": 1, "UNITY": 1, "Verifying": 1, "security": 1, "protocols": 2, "using": 1, "Chandy": 1, "Misra": 1, "Unix": 2, "print_mode": 3, "ZF": 1, "MainZF": 1, "Games": 1, "Imperative_HOL": 1, "Imperative_HOL_ex": 1, "Decision_Procs": 2, "Various": 1, "decision": 1, "procedures": 1, "typically": 1, "involving": 1, "reflection.": 1, "ML_SYSTEM_POLYML": 4, "parallel_proofs": 3, "Hilbert_Classical": 1, "XML_Data": 1, "program": 1, "extraction": 1, "Order": 3, "Greatest_Common_Divisor": 1, "Warshall": 1, "Higman_Extraction": 1, "Pigeonhole": 1, "Euclid": 1, "Lambda": 4, "Calculus": 1, "de": 2, "Bruijn": 2, "defines": 1, "lambda": 1, "calculus": 1, "terms": 1, "indixes": 1, "confluence": 1, "beta": 2, "eta": 1, "eta.": 1, "paper": 1, "describes": 1, "theory": 4, "//www.in.tum.de/": 1, "nipkow/pubs/jar2001.html": 1, "Eta": 1, "StrongNorm": 1, "Standardization": 1, "WeakNorm": 1, "Prolog": 3, "based": 3, "lecture": 1, "by": 3, "Nadathur": 1, "bare": 1, "bones": 1, "implementation": 2, "Prolog.": 1, "simple": 2, "exploratory": 1, "including": 3, "some": 1, "minimal": 1, "examples": 4, "Test.thy": 1, "more": 1, "typical": 1, "example": 1, "little": 1, "type": 2, "system.": 1, "Test": 1, "Type": 1, "MicroJava": 2, "Formalization": 1, "fragment": 2, "Java": 1, "together": 1, "corresponding": 1, "virtual": 1, "machine": 1, "specification": 1, "bytecode": 2, "verifier": 2, "lightweight": 1, "proofs": 2, "safety.": 1, "NanoJava": 1, "tiny": 1, "Java.": 1, "Example": 1, "Bali": 1, "AxExample": 1, "AxSound": 1, "AxCompl": 1, "Trans": 1, "IOA": 7, "Tobias": 3, "Nipkow": 5, "Konrad": 3, "Slind": 4, "Olaf": 7, "M": 3, "ller": 1, "meta": 1, "I/O": 6, "Automata": 3, "HOL.": 1, "has": 1, "been": 2, "significantly": 1, "changed": 1, "HOLCF/IOA.": 1, "There": 1, "also": 1, "two": 1, "communication": 1, "which": 1, "formerly": 1, "have": 1, "here.": 1, "@inproceedings": 2, "author": 2, "title": 2, "Isabelle/HOL": 1, "booktitle": 2, "Proc.": 2, "TYPES": 1, "Workshop": 2, "publisher": 1, "Springer": 1, "series": 1, "LNCS": 1, "note": 1, "To": 1, "appear": 1, "ftp": 2, "//ftp.informatik.tu": 2, "Mueller": 5, "Combining": 1, "Model": 1, "Checking": 1, "Deduction": 1, "TACAS": 1, "organization": 1, "Aarhus": 1, "BRICS": 1, "report": 1, "year": 1, "Solve": 1, "Lattice": 1, "Markus": 1, "Wenzel": 1, "Basic": 1, "lattices": 1, "orders.": 1, "CompleteLattice": 1, "ex": 1, "Miscellaneous": 3, "Code_Binary_Nat_examples": 1, "Eval_Examples": 1, "Normalization_by_Evaluation": 1, "Hebrew": 1, "Serbian": 1, "Cartouche_Examples": 1, "Adhoc_Overloading_Examples": 1, "Iff_Oracle": 1, "Coercion_Examples": 1, "Higher_Order_Logic": 1, "Abstract_NAT": 1, "Guess": 1, "Fundefs": 1, "Induction_Schema": 1, "LocaleTest2": 1, "Records": 1, "While_Combinator_Example": 1, "MonoidGroup": 1, "BinEx": 1, "Hex_Bin_Examples": 1, "Antiquote": 1, "Multiquote": 1, "PER": 1, "NatSum": 1, "ThreeDivides": 1, "Intuitionistic": 1, "CTL": 1, "Arith_Examples": 1, "BT": 1, "Tree23": 1, "Bubblesort": 1, "MergeSort": 1, "Lagrange": 1, "Groebner_Examples": 1, "MT": 1, "Unification": 1, "Primrec": 1, "Set_Theory": 1, "Termination": 1, "Coherent": 1, "PresburgerEx": 1, "Reflection_Examples": 1, "Sqrt": 1, "Sqrt_Script": 1, "Transfer_Ex": 1, "Transfer_Int_Nat": 1, "Transitive_Closure_Table_Ex": 1, "HarmonicSeries": 1, "Refute_Examples": 1, "Execute_Choice": 1, "Gauge_Integration": 1, "Dedekind_Real": 1, "Quicksort": 1, "Birthday_Paradox": 1, "Seq": 1, "Simproc_Tests": 1, "Executable_Relation": 1, "FinFunPred": 1, "Parallel_Example": 1, "IArray_Examples": 1, "SVC_Oracle": 1, "Simps_Case_Conv_Examples": 1, "ML": 1, "SAT_Examples": 1, "SOS": 1, "SOS_Cert": 1, "skip_proofs": 2, "Meson_Test": 1, "SVC_HOME": 1, "svc_test": 1, "ISABELLE_FULL_TEST": 6, "Sudoku": 1, "Isar_Examples": 1, "Isabelle/Isar": 1, "Basic_Logic": 1, "Cantor": 1, "Drinker": 1, "Expr_Compiler": 1, "Fibonacci": 1, "Group": 1, "Group_Context": 1, "Group_Notepad": 1, "Hoare_Ex": 1, "Knaster_Tarski": 1, "Mutilated_Checkerboard": 1, "Nested_Datatype": 1, "Peirce": 1, "Puzzle": 1, "Summation": 1, "SET_Protocol": 2, "SET": 1, "Protocol.": 1, "Matrix_LP": 1, "matrices": 1, "linear": 1, "programming.": 1, "Cplex": 1, "TLA": 2, "Lamport": 1, "Inc": 1, "DBuffer": 1, "MemoryImplementation": 1, "TPTP": 2, "Nik": 1, "Sultana": 1, "related": 1, "extensions.": 1, "ATP_Theory_Export": 1, "MaSh_Eval": 1, "TPTP_Interpret": 1, "THF_Arith": 1, "TPTP_Proof_Reconstruction": 1, "ATP_Problem_Import": 1, "Multivariate_Analysis": 2, "Determinants": 1, "PolyRoots": 1, "Complex_Analysis_Basics": 1, "Probability": 1, "Nominal": 2, "Nominal_Examples_Base": 1, "Nominal_Examples": 1, "VC_Condition": 1, "Cardinals": 3, "Full": 1, "Theories.": 1, "Datatype_Examples": 1, "datatype": 1, "large": 2, "ones": 1, "John": 1, "Harrison.": 1, "Compat": 1, "Lambda_Term": 1, "Process": 1, "TreeFsetI": 1, "Koenig": 1, "Stream_Processor": 1, "Misc_Codatatype": 1, "Misc_Datatype": 1, "Misc_Primcorec": 1, "Misc_Primrec": 1, "Brackin": 1, "IsaFoR": 1, "Misc_N2M": 1, "Word": 2, "WordExamples": 1, "Statespace": 1, "StateSpaceEx": 1, "NSA": 1, "Nonstandard": 1, "Hypercomplex": 1, "NSPrimes": 1, "Mirabelle": 1, "Mirabelle_Test": 1, "timeout": 1, "Ex": 1, "SMT_Examples": 2, "Boogie": 1, "SMT_Word_Examples": 1, "SMT_Tests": 1, "SPARK": 1, "show_question_marks": 1, "Example_Verification": 1, "VC_Principles": 1, "Reference": 1, "Complex_Types": 1, "Mutabelle": 1, "MutabelleExtra": 1, "Quickcheck_Examples": 2, "Quickcheck_Lattice_Examples": 1, "Completeness": 1, "Quickcheck_Interfaces": 1, "Hotel_Example": 1, "Quickcheck_Narrowing_Examples": 1, "Quickcheck_Benchmark": 1, "Find_Unused_Assms_Examples": 1, "Quotient_Examples": 1, "Cezary": 1, "Kaliszyk": 1, "Christian": 1, "Urban": 1, "DList": 1, "FSet": 1, "Quotient_Int": 1, "Quotient_Message": 1, "Lift_FSet": 1, "Lift_Set": 1, "Lift_Fun": 1, "Quotient_Rat": 1, "Lift_DList": 1, "Int_Pow": 1, "Predicate_Compile_Examples": 1, "Predicate_Compile_Tests": 1, "Specialisation_Examples": 1, "IMP_1": 1, "IMP_2": 1, "Code_Prolog_Examples": 1, "Context_Free_Grammar_Example": 1, "Hotel_Example_Prolog": 1, "Lambda_Example": 1, "List_Examples": 1, "Reg_Exp_Example": 1, "HOLCF": 11, "Franz": 1, "Regensburger": 1, "Brian": 1, "Huffman": 1, "semantic": 1, "LCF": 1, "logic.": 1, "Plain_HOLCF": 1, "Fixrec": 1, "Domain_ex": 1, "Fixrec_ex": 1, "New_Domain": 1, "HOLCF_Library": 1, "WHILE": 2, "Semantics.": 1, "denotational": 1, "semantics": 1, "language.": 1, "HoareEx": 1, "HOLCF.": 2, "Dnat": 1, "Dagstuhl": 1, "Focus_ex": 1, "Fix2": 1, "Concurrency_Monad": 1, "Loop": 1, "Powerdomain_ex": 1, "Domain_Proofs": 1, "Letrec": 1, "Pattern_Match": 1, "FOCUS": 3, "stream": 1, "processing": 1, "functions": 1, "Isabelle/HOLCF.": 1, "introductions": 1, "//www4.in.tum.de/publ/html.php": 2, "e": 2, "Interfaces": 1, "Refinement": 1, "Fstreams": 1, "Buffer_adm": 1, "nchen": 1, "automata": 2, "distribution": 1, "contains": 1, "simulation": 1, "relations": 1, "temporal": 1, "abstraction": 1, "theory.": 1, "Everything": 1, "upon": 1, "domain": 1, "theoretic": 1, "model": 1, "finite": 1, "infinite": 1, "sequences.": 1, "Alternating": 1, "Bit": 1, "Protocol": 1, "performed": 2, "Automata.": 1, "Correctness": 3, "&": 1, "network": 1, "transmission": 1, "protocol": 1, "Mueller.": 1, "Memory": 1, "storage": 1, "case": 1, "study.": 1, "TrivEx": 1, "TrivEx2": 1, "Record_Benchmark": 2, "Some": 1, "benchmark": 1, "record.": 1 }, "J": { "SHEBANG#!jconsole": 1, "echo": 17, "exit": 1, "NB.": 11, "From": 1, ".": 7, "See": 1, "http": 1, "empno": 1, "payrate": 2, "billrate": 3, "clientlist": 3, "emp_client": 2, "hoursworked": 2, "Finds": 2, "the": 13, "number": 1, "of": 4, "hours": 1, "each": 5, "employee": 4, "worked": 1, "in": 6, "given": 3, "month.": 2, "emphours": 2, "Determines": 2, "wages": 1, "earned": 1, "by": 4, "empearnings": 3, "profit": 3, "brought": 2, "employee.": 1, "empprofit": 2, "(": 7, "-": 1, ")": 8, "*": 2, "+": 4, "/": 4, "Returns": 3, "amount": 1, "to": 1, "bill": 1, "a": 1, "client.": 1, "billclient": 2, "mask": 2, "y": 1, "#": 1, "for": 1, "day": 1, "month": 1, "who": 1, "billed": 1, "most": 1, "hours.": 1, "dailydrudge": 2, "|": 2, "i.": 1, "employees": 1, "descending": 2, "order": 2, "each.": 2, "producers": 2, "clients": 1, "generated": 1, "custbyprofit": 2, "Calculates": 1, "withholding": 1, "tax": 1, "on": 1, "renderuntocaesar": 2, "bktmin": 3, "Four": 1, "brackets": 1, "0..6000..10000..20000.._": 1, "bktrate": 2, "bktearns": 2, "._": 1, "<.>": 1, "1": 5, "0": 1, "NB": 1, "Main": 1, "Problem": 8, "2": 1, "3": 1, "4": 1, "10025": 1, "5": 1, "6": 1, "7": 1, "8": 1, "0j2": 1 }, "JFlex": { "package": 1, "jflex": 1, ";": 533, "import": 9, "java_cup.runtime.Symbol": 1, "java.io.*": 1, "java.util.Stack": 1, "java.util.ArrayList": 1, "java.util.List": 1, "java.util.Map": 1, "java.util.HashMap": 1, "jflex.unicode.UnicodeProperties": 1, "%": 41, "final": 1, "public": 8, "class": 2, "LexScan": 1, "implements": 2, "sym": 2, "java_cup.runtime.Scanner": 1, "function": 1, "next_token": 1, "type": 12, "Symbol": 11, "unicode": 3, "column": 2, "line": 2, "eofclose": 7, "state": 6, "COMMENT": 4, "STATELIST": 3, "MACROS": 13, "REGEXPSTART": 6, "REGEXP": 9, "JAVA_CODE": 4, "STATES": 2, "STRING_CONTENT": 2, "CHARCLASS": 4, "COPY": 2, "REPEATEXP": 2, "EATWSPNL": 2, "CTOR_ARG": 2, "REGEXP_CODEPOINT_SEQUENCE": 2, "STRING_CODEPOINT_SEQUENCE": 2, "CHARCLASS_CODEPOINT": 2, "inputstreamctor": 1, "false": 6, "cupdebug": 2, "{": 659, "int": 32, "balance": 7, "commentbalance": 4, "action_line": 6, "bufferSize": 2, "File": 6, "file": 48, "Stack": 2, "": 2, "files": 1, "new": 79, "(": 672, ")": 673, "StringBuilder": 8, "userCode": 2, "String": 26, "classCode": 3, "initCode": 3, "initThrow": 5, "eofCode": 3, "eofThrow": 5, "lexThrow": 7, "eofVal": 8, "scanErrorException": 2, "cupSymbol": 3, "actionText": 1, "string": 8, "private": 12, "UnicodeProperties": 4, "unicodeProperties": 6, "boolean": 22, "charCount": 2, "lineCount": 3, "columnCount": 3, "cupCompatible": 3, "cup2Compatible": 2, "cupDebug": 2, "isInteger": 4, "isIntWrap": 2, "isYYEOF": 2, "notUnix": 2, "isPublic": 2, "isFinal": 2, "isAbstract": 2, "bolUsed": 2, "standalone": 2, "debugOption": 2, "caseless": 2, "inclusive_states": 4, "isASCII": 4, "emitInputStreamCtor": 3, "Options.emitInputStreamCtor": 1, "isImplementing": 7, "isExtending": 2, "className": 2, "functionName": 6, "tokenType": 6, "visibility": 2, "List": 3, "": 4, "ctorArgs": 1, "ArrayList": 3, "ctorTypes": 1, "LexicalStates": 2, "states": 1, "": 2, "actions": 1, "nextState": 5, "macroDefinition": 5, "Timer": 2, "t": 11, "CharClasses": 3, "charClasses": 2, "getCharClasses": 1, "return": 208, "}": 663, "currentLine": 1, "yyline": 39, "void": 3, "setFile": 1, "this.file": 1, "symbol": 189, "Object": 7, "value": 7, "yycolumn": 23, "symbol_countUpdate": 5, "lc": 3, "cc": 4, "text": 1, "yytext": 58, "for": 2, "i": 8, "<": 7, "text.length": 1, "+": 107, "char": 7, "c": 6, "text.charAt": 1, "if": 37, "&&": 7, "else": 13, "makeMacroIdent": 2, "matched": 1, ".trim": 25, "matched.substring": 1, "matched.length": 1, "-": 45, "static": 2, "conc": 4, "a": 9, "b": 12, "null": 24, "b.toString": 4, "a.toString": 4, "concExc": 11, "getUnicodeProperties": 1, "try": 3, "catch": 3, "e": 3, "throw": 45, "ScannerException": 40, "charClasses.init": 2, "Options.jlex": 4, "this": 2, "includeFile": 3, "filePath": 2, "f": 8, "file.getParentFile": 1, "f.canRead": 1, "ErrorMessages.NOT_READABLE": 2, "files.search": 1, "ErrorMessages.FILE_CYCLE": 1, "yypushStream": 1, "FileReader": 1, "files.push": 1, "Out.println": 1, "FileNotFoundException": 1, "init": 2, "states.insert": 2, "true": 31, "Digit": 2, "[": 60, "]": 54, "HexDigit": 11, "9a": 2, "fA": 2, "F": 2, "OctDigit": 10, "Number": 4, "HexNumber": 3, "x": 1, "OctNumber": 3, "Unicode4": 3, "u": 2, "Unicode6": 3, "U": 1, "WSP": 72, "WSPNL": 43, "u2028": 6, "u2029": 6, "u000A": 7, "u000B": 6, "u000C": 6, "u000D": 7, "u0085": 6, "NWSPNL": 2, "NL": 19, "|": 41, "NNL": 11, "Ident": 12, "IdentStart": 3, "IdentPart": 3, "*": 99, "QualIdent": 6, "QUIL": 5, "Array": 2, "ParamPart": 2, "GenParam": 4, "ClassT": 2, "QClassT": 3, "ArrType": 3, "jletter": 2, "jletterdigit": 2, "JFlexCommentChar": 2, "*/": 4, "JFlexComment": 2, "JavaComment": 2, "TraditionalComment": 4, "EndOfLineComment": 5, "CommentContent": 2, ".*": 15, "StringCharacter": 3, "CharLiteral": 2, "StringLiteral": 2, "EscapeSequence": 1, "JavaRest": 2, "/": 1, "JavaCode": 2, "DottedVersion": 2, ".": 11, "": 2, "t.start": 1, "yybegin": 42, "USERCODE": 1, "userCode.append": 1, "<<": 15, "EOF": 18, "": 4, "string.setLength": 2, "": 1, "string.toString": 2, "string.append": 23, "ErrorMessages.EOF_IN_MACROS": 3, "": 1, "UNICODE": 3, "//": 3, ".substring": 34, "Out.warning": 2, "ErrorMessages.CUPSYM_AFTER_CUP": 1, "ErrorMessages.QUIL_CUPSYM": 1, "ctorTypes.add": 1, "ASCII": 1, "FULL": 1, "v": 2, "v.length": 1, "Skeleton.makePrivate": 1, "Integer.parseInt": 14, "ErrorMessages.NO_BUFFER_SIZE": 1, "ErrorMessages.QUIL_INITTHROW": 1, "ErrorMessages.QUIL_EOFTHROW": 1, "ErrorMessages.QUIL_YYLEXTHROW": 1, "ErrorMessages.QUIL_THROW": 1, "ErrorMessages.QUIL_SCANERROR": 1, "IDENT": 2, "EQUALS": 1, "DELIMITER": 1, "ErrorMessages.UNKNOWN_OPTION": 2, "ErrorMessages.NOT_AT_BOL": 1, "yypushback": 3, "yymoreStreams": 2, "files.pop": 2, "yypopStream": 2, "": 1, "ctorArgs.add": 1, "ErrorMessages.CTOR_ARG": 1, "": 1, "LESSTHAN": 1, "RBRACE": 3, "actionText.setLength": 3, "s": 2, "EOFRULE": 2, "s.left": 1, "yylength": 19, "": 1, "COMMA": 2, "MORETHAN": 1, "ErrorMessages.EOF_IN_STATES": 1, "": 2, "ErrorMessages.EOF_WO_ACTION": 1, "BAR": 2, "NOACTION": 1, "LBRACE": 2, "BANG": 1, "TILDE": 1, "OPENBRACKET": 1, "CLOSEBRACKET": 1, "STAR": 1, "PLUS": 2, "QUESTION": 2, "DOLLAR": 1, "HAT": 2, "POINT": 1, "NEWLINE": 1, "OPENCLASS": 2, "LOOKAHEAD": 1, "MACROUSE": 2, "REPEAT": 2, "Integer": 6, "REGEXPEND": 2, "": 2, "JLETTERCLASS": 1, "JLETTERDIGITCLASS": 1, "LETTERCLASS": 1, "UPPERCLASS": 1, "LOWERCLASS": 1, "DIGITCLASS": 2, "DIGITCLASSNOT": 1, "WHITESPACECLASS": 1, "WHITESPACECLASSNOT": 1, "WORDCLASS": 1, "WORDCLASSNOT": 1, "trimmedText": 2, "propertyValue": 4, "trimmedText.substring": 2, "trimmedText.length": 2, "IntCharSet": 2, "set": 6, "unicodeProperties.getIntCharSet": 2, "UNIPROPCCLASS": 1, "UNIPROPCCLASSNOT": 1, "CHAR": 15, ".codePointAt": 3, "": 1, "": 1, "ErrorMessages.EOF_IN_REGEXP": 4, "CLOSECLASS": 1, "DASH": 1, "DIFFERENCE": 1, "INTERSECTION": 1, "SYMMETRICDIFFERENCE": 1, "n": 9, "ErrorMessages.EOL_IN_CHARCLASS": 1, "": 1, "ErrorMessages.UNTERMINATED_STR": 2, "codePoint": 15, "Character.toChars": 3, "r": 8, ".offsetByCodePoints": 1, "ErrorMessages.EOF_IN_STRING": 2, "": 1, "actionText.append": 3, "Action": 2, "actionText.toString": 1, "actions.add": 1, "ACTION": 1, "ErrorMessages.EOF_IN_ACTION": 1, "": 1, "ErrorMessages.EOF_IN_COMMENT": 1, "": 1, "STRING": 2, "": 1, "Specialized": 2, "form": 2, "newlines": 1, "disallowed": 1, "and": 1, "doesn": 1, "": 1, "only": 1, "one": 1, "codepoint": 1, "allowed": 2, "no": 1, "whitespace": 1, "ErrorMessages.UNEXPECTED_CHAR": 1, "R": 1, "ErrorMessages.UNEXPECTED_NL": 1, "java_cup.runtime.*": 1, "Scanner": 1, "cup": 1, "JavaSymbol": 2, "long": 3, "parseLong": 5, "start": 2, "end": 2, "radix": 3, "result": 3, "digit": 3, "Character.digit": 1, "yycharat": 1, "result*": 1, "LineTerminator": 5, "InputCharacter": 2, "WhiteSpace": 2, "Comment": 2, "DocumentationComment": 2, "Identifier": 2, "DecIntegerLiteral": 3, "DecLongLiteral": 2, "lL": 3, "HexIntegerLiteral": 2, "xX": 2, "0*": 2, "HexLongLiteral": 2, "OctIntegerLiteral": 2, "OctLongLiteral": 2, "FloatLiteral": 2, "FLit1": 3, "FLit2": 3, "FLit3": 3, "Exponent": 3, "fF": 1, "DoubleLiteral": 3, "eE": 1, "SingleCharacter": 2, "CHARLITERAL": 1, "ABSTRACT": 1, "BOOLEAN": 1, "BREAK": 1, "BYTE": 1, "CASE": 1, "CATCH": 1, "CLASS": 1, "CONST": 1, "CONTINUE": 1, "DO": 1, "DOUBLE": 1, "ELSE": 1, "EXTENDS": 1, "FINAL": 1, "FINALLY": 1, "FLOAT": 1, "FOR": 1, "DEFAULT": 1, "IMPLEMENTS": 1, "IMPORT": 1, "INSTANCEOF": 1, "INT": 1, "INTERFACE": 1, "LONG": 1, "NATIVE": 1, "NEW": 1, "GOTO": 1, "IF": 1, "PUBLIC": 1, "SHORT": 1, "SUPER": 1, "SWITCH": 1, "SYNCHRONIZED": 1, "PACKAGE": 1, "PRIVATE": 1, "PROTECTED": 1, "TRANSIENT": 1, "RETURN": 1, "VOID": 1, "STATIC": 1, "WHILE": 1, "THIS": 1, "THROW": 1, "THROWS": 1, "TRY": 1, "VOLATILE": 1, "STRICTFP": 1, "BOOLEAN_LITERAL": 2, "NULL_LITERAL": 1, "LPAREN": 1, "RPAREN": 1, "LBRACK": 1, "RBRACK": 1, "SEMICOLON": 1, "DOT": 1, "EQ": 1, "GT": 1, "LT": 1, "NOT": 1, "COMP": 1, "COLON": 1, "EQEQ": 1, "LTEQ": 1, "GTEQ": 1, "NOTEQ": 1, "ANDAND": 1, "OROR": 1, "PLUSPLUS": 1, "MINUSMINUS": 1, "MINUS": 1, "MULT": 1, "DIV": 1, "AND": 1, "OR": 1, "XOR": 1, "MOD": 1, "LSHIFT": 1, "RSHIFT": 1, "URSHIFT": 1, "PLUSEQ": 1, "MINUSEQ": 1, "MULTEQ": 1, "DIVEQ": 1, "ANDEQ": 1, "OREQ": 1, "XOREQ": 1, "MODEQ": 1, "LSHIFTEQ": 1, "RSHIFTEQ": 1, "URSHIFTEQ": 1, "INTEGER_LITERAL": 7, "Integer.MIN_VALUE": 1, "Long": 3, "FLOATING_POINT_LITERAL": 3, "Float": 1, "Double": 2, "dD": 1, "IDENTIFIER": 1, "": 1, "val": 4, "RuntimeException": 5, "": 1, "CHARACTER_LITERAL": 1 }, "JSON": { "{": 426, "[": 13502, "]": 13499, "}": 425, "false": 14, "true": 28, "-": 9980 }, "JSON with Comments": { "[": 265, "{": 226, "]": 265, "}": 226, "true": 98, "//": 290, "Defines": 89, "a": 96, "hyperlink": 1, "an": 24, "abbreviation": 1, "Not": 12, "supported": 12, "in": 44, "HTML5.": 12, "Use": 10, "": 1, "instead.": 9, "//Defines": 11, "acronym": 1, "contact": 1, "information": 3, "for": 32, "the": 25, "author/owner": 1, "of": 28, "document": 19, "": 1, "embedded": 2, "applet": 1, "area": 2, "inside": 2, "image": 3, "-": 293, "map": 2, "article": 1, "content": 12, "aside": 1, "from": 7, "page": 1, "sound": 1, "bold": 1, "text": 25, "Specifies": 6, "base": 1, "URL/target": 1, "all": 5, "relative": 1, "URLs": 2, "CSS": 5, "//Specifies": 1, "default": 3, "color": 2, "size": 3, "and": 12, "font": 2, "Isolates": 1, "part": 2, "that": 11, "might": 1, "be": 8, "formatted": 1, "different": 2, "direction": 3, "other": 1, "outside": 1, "it": 2, "Overrides": 1, "current": 1, "big": 1, "section": 6, "is": 2, "quoted": 1, "another": 1, "source": 1, "single": 1, "line": 5, "break": 1, "clickable": 1, "button": 16, "Used": 1, "to": 9, "draw": 1, "graphics": 1, "on": 1, "fly": 1, "via": 1, "scripting": 1, "(": 34, "usually": 1, "JavaScript": 1, ")": 34, "table": 9, "caption": 3, "centered": 1, "title": 2, "work": 1, "piece": 1, "computer": 2, "code": 4, "column": 2, "properties": 1, "each": 1, "within": 3, "": 1, "element": 6, "group": 2, "one": 1, "or": 8, "more": 1, "columns": 1, "formatting": 1, "command": 1, "user": 3, "can": 3, "invoke": 1, "list": 11, "pre": 1, "defined": 3, "options": 2, "input": 6, "controls": 1, "description/value": 1, "term": 2, "description": 3, "has": 2, "been": 2, "deleted": 1, "additional": 2, "details": 1, "view": 1, "hide": 2, "definition": 1, "dialog": 1, "box": 1, "window": 3, "