$: << File.expand_path(File.dirname(__FILE__) + '/../lib') $: << File.expand_path('.') require 'rubygems' require 'bio/db/sam' require "test/unit" #gem 'ruby-prof' gem 'test-unit' #require "ruby-prof" class TestBioDbSam < Test::Unit::TestCase # include RubyProf::Test class << self def shutdown File.delete("test/samples/small/different_index.bam.bai") File.delete("test/samples/small/dupes_rmdup.bam") File.delete("test/samples/small/mates_fixed.bam") File.delete("test/samples/small/reheader.bam") File.delete("test/samples/small/test_chr.fasta.fai") File.delete("test/samples/small/test_sorted.bam") File.delete("test/samples/small/maps_merged.bam") File.delete("test/samples/small/maps_cated.bam") File.delete("test/samples/small/testu.out") end end def setup @test_folder = "test/samples/small" @testTAMFile = @test_folder + "/test.tam" @testBAMFile = @test_folder + "/testu.bam" @testLCI = "test/samples/LCI/test.bam" @testLCIref = "test/samples/LCI/NC_001988.ffn" @testReference = @test_folder + "/test_chr.fasta" @bed_file = @test_folder + "/testu.bed" @sam = Bio::DB::Sam.new( :fasta => @testReference, :bam => @testBAMFile ) end def test_new assert_kind_of(Bio::DB::Sam, @sam) assert_raise(IOError) do Bio::DB::Sam.new( :fasta => @testReference, :bam => @testBAMFile + "ads" ) end assert_raise(ArgumentError) do Bio::DB::Sam.new() end end def test_index test_bai_file = @testBAMFile+".bai" #test to see if the index file exists. If so, delete it if File.exist?(test_bai_file) == true puts "bam index exists....deleting..." File.delete(test_bai_file) end #No bam file assert_equal(@sam.indexed?, false) #index the bam file @sam.index() assert_equal(@sam.indexed?, true) #make sure the .bai file exists assert_nothing_thrown do File.open(test_bai_file, "r") end assert(File.size(test_bai_file) > 0, "From test_index: .bai file is empty") #as above, but give the output a different name test_bai_file = @test_folder+"/different_index.bam.bai" @sam.index(:out_index=> test_bai_file) assert_nothing_thrown do File.open(test_bai_file, "r") end assert(File.size(test_bai_file) > 0, "From test_index: .bai file is empty") end def test_view #how to get Bio::DB::Alignment objects .. @sam.view() do |sam| #test that all the objects are Bio::DB::Alignment objects and their reference is 'chr_1' assert_equal(sam.class, Bio::DB::Alignment) assert_equal(sam.rname, "chr_1") end end def test_fetch #puts @sam.inspect i = 0 @sam.index @sam.fetch("chr_1", 10,1000) do |sam| #test that all the objects are Bio::DB::Alignment objects assert_equal(sam.class, Bio::DB::Alignment) assert_equal(sam.rname, "chr_1") i += 1 end assert(i>0) assert_equal(i,9) bam=Bio::DB::Sam.new(:bam=>@testLCI,:fasta=>@testLCIref) bam.open count = 0 bam.fetch("NC_001988.2",0,200) do|x| count += 1 end assert_equal(count, 36) count = 0 bam.fetch("NC_001988.2",75, 75) do|x| #puts "#{x.pos} #{x.seq}" count += 1 end assert_equal(count, 7) end def test_fetch_with_function #pass the assert to method count = 0 block = Proc.new do |a| assert_equal(a.class, Bio::DB::Alignment) count += 1 end @sam.fetch_with_function("chr_1", 10, 1000, &block) assert_equal(count, 9) count = 0 @sam.fetch_with_function("chr_1", 82, 140, &block) assert_equal(count, 4) @sam.fetch_with_function("chr_1", 0, 140, &block) assert_equal(count, 8) count2 = 0 @sam.fetch("chr_1",0,200) {|x| count2 += 1} assert_equal(count2, 6) end def test_chromosome_coverage #the coverage should only be 1.0 or 2.0 cov = @sam.chromosome_coverage("chr_1", 10, 1000) cov.each do |pu| assert_send([[1.0 , 2.0, 3.0], :member?, pu]) end end def test_average_coverage #there should be 10 positions with cov of 1.0 and 10 with cov of 2.0, so average of 1.5 test_bai_file = @testBAMFile+".bai" if File.exist?(test_bai_file) == false @sam.index() end avcov = @sam.average_coverage("chr_1", 33, 19) assert_equal(avcov, 1.5) File.delete(test_bai_file) end def test_faidx @sam.faidx() test_fai_file = @testReference+".fai" #test that the .fai file exists assert_nothing_thrown do File.open(test_fai_file, "r") end #test that the file is not empty assert(File.size(test_fai_file) > 0, "From test_faidx: .fai file is empty") end def test_index_stats #puts "Stats: #{@sam.index_stats.inspect}" @sam.index_stats.each_pair do |seq, stat| assert_send([['chr_1' , '*'], :member?, seq]) end assert_equal(@sam.index_stats['chr_1'][:length], 69930) assert_equal(@sam.index_stats['chr_1'][:mapped_reads], 9) assert_equal(@sam.index_stats['chr_1'][:unmapped_reads], 0) assert_equal(@sam.index_stats['*'][:length], 0) assert_equal(@sam.index_stats['*'][:mapped_reads], 0) assert_equal(@sam.index_stats['*'][:unmapped_reads], 0) assert_equal(@sam.index_stats.size, 2) end def test_fetch_reference #this is the first 70 nucleotides of the test seqeunce seq_expected = "CCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTA" #fetch the first 70 nuclotides seq_fetched = @sam.fetch_reference("chr_1", 1, 70, :as_bio => false) #test they're the same assert_equal(seq_fetched, seq_expected) end def test_sort #sort the bam file sortedsam = @test_folder + "/test_sorted.bam" @sam.sort(:prefix=>@test_folder + "/test_sorted") #create a new Bio::DB::Sam from the sorted bam @sortsam = Bio::DB::Sam.new( :fasta => @testReference, :bam => sortedsam ) pos = 0 #iterate over the sorted sam file and make sure that the it's sorted by checking the order of the start positions for each read. @sortsam.view()do |sam| assert(sam.pos > pos, "Not sorted by position") pos = sam.pos end end def test_reheader sam_header = @test_folder + "/map_for_reheader.sam" outfile = @test_folder + "/reheader.bam" @sam.reheader(sam_header, :out=>outfile) reheader_bam = Bio::DB::Sam.new(:fasta => @testReference, :bam => outfile) #check that the reference is 'chr_2' reheader_bam.view()do |sam| assert_equal(sam.rname, "chr_2") end end def test_calmd no_md_sam = @test_folder + "/no_md.sam" md = Bio::DB::Sam.new(:fasta => @testReference, :bam => no_md_sam) block = Proc.new {|a| assert(a.tags.has_key?('MD'), "From test_calmd: couldn't find the MD tag")} md.calmd(:S=>true, &block) end def test_mpileup #create an mpileup # @sam.index @sam.mpileup(:g => false) do |pileup| #test that all the objects are Bio::DB::Pileup objects assert_kind_of(Bio::DB::Pileup, pileup) #test that the reference name is 'chr_1' for all objects assert_equal(pileup.ref_name, 'chr_1') end #do the same for Vcf output @sam.mpileup(:u => true) do |pileup| assert_kind_of(Bio::DB::Vcf, pileup) assert_equal(pileup.chrom, 'chr_1') end end def test_region_new reg1 = Bio::DB::Fasta::Region.new(:entry=>"chr_1", :start=>1, :end=>334) reg2 = Bio::DB::Fasta::Region.new reg2.entry = "chr_1" reg2.start = 1 reg2.end = 334 assert_equal(reg1.entry, reg2.entry) assert_equal(reg1.start, reg2.start) assert_equal(reg1.end, reg2.end) end def test_mpileup_reg #create an mpileup reg = Bio::DB::Fasta::Region.new(:entry=>"chr_1", :start=>1, :end=>334) @sam.mpileup_cached(:r=>reg,:g => false, :min_cov => 1, :min_per =>0.2) do |pileup| #test that all the objects are Bio::DB::Pileup objects assert_kind_of(Bio::DB::Pileup, pileup) #test that the reference name is 'chr_1' for all objects #puts pileup assert_equal(pileup.ref_name, 'chr_1') end region = @sam.cached_regions[reg.to_s] #puts "cahced_region: #{region.inspect}" #puts "AVG COV: #{region.average_coverage}" #puts "Reference: #{region.reference}" # puts "Consensus: #{region.consensus}" # puts "called: #{region.called}" #, :snps, :reference, :base_ratios, :consensus, :coverages snps_tot = Bio::Sequence.snps_between(region.reference, region.consensus) assert_equal(snps_tot, 5) assert_equal(region.called, 220) end def test_mpileup_reg_05 #create an mpileup reg = Bio::DB::Fasta::Region.new(:entry=>"chr_1", :start=>1, :end=>334) @sam.mpileup_cached(:r=>reg, :g => false, :min_cov => 1, :min_per =>0.4) do |pileup| #test that all the objects are Bio::DB::Pileup objects assert_kind_of(Bio::DB::Pileup, pileup) #test that the reference name is 'chr_1' for all objects #puts pileup assert_equal(pileup.ref_name, 'chr_1') end region = @sam.cached_regions[reg.to_s] #, :snps, :reference, :base_ratios, :consensus, :coverages snps_tot = Bio::Sequence.snps_between(region.reference, region.consensus) assert_equal(snps_tot, 1) assert_equal(region.called, 220) end def test_depth #the depth of coverage should be '1' at all given positions @sam.depth(:r=>"chr_1:25-42") do |al| assert_equal(al[2].to_i, 1) end end def test_fixmate mates_fixed_bam = @test_folder + "/mates_fixed.bam" @sam.fix_mates(:out_bam=>mates_fixed_bam) assert_nothing_thrown do File.open(mates_fixed_bam, "r") end assert(File.size(mates_fixed_bam) > 0, "From test_fixmate: .bam file is empty") end def test_flagstats #get the stats stats = @sam.flag_stats() #the number of reads mapped will be the first character on the first line. no_reads_mapped = stats[0][0].to_i #check that it's '9' assert_equal(no_reads_mapped, 9) end def test_merge bam1 = @test_folder + "/map_to_merge1.bam" bam2 = @test_folder + "/map_to_merge2.bam" bam_to_merge1 = Bio::DB::Sam.new(:fasta => @testReference, :bam => bam1) bam_to_merge2 = Bio::DB::Sam.new(:fasta => @testReference, :bam => bam2) bam_files = [bam_to_merge1, bam_to_merge2] merged_bam_file = @test_folder + "/maps_merged.bam" File.delete merged_bam_file if File.exist?(merged_bam_file) # File.delete("test/samples/small/maps_merged.bam") @sam.merge(:out=>merged_bam_file, :bams=>bam_files, :n=>true) merged_bam = Bio::DB::Sam.new(:fasta => @testReference, :bam => merged_bam_file) no_reads_mapped = 0; merged_bam.view() do |al| assert_kind_of(Bio::DB::Alignment, al) no_reads_mapped+=1 end assert_equal(no_reads_mapped, 10) end def test_cat #same files used for merge, but we'll cat them instead bam1 = @test_folder + "/map_to_merge1.bam" bam2 = @test_folder + "/map_to_merge2.bam" bam_files = [bam1, bam2] cat_bam_file = @test_folder + "/maps_cated.bam" File.delete cat_bam_file if File.exist?(cat_bam_file) @sam.merge(:out=>cat_bam_file, :bams=>bam_files) cated_bam = Bio::DB::Sam.new(:fasta => @testReference, :bam => cat_bam_file) no_reads_mapped = 0; cated_bam.view() do |al| assert_kind_of(Bio::DB::Alignment, al) no_reads_mapped+=1 end #there should be 10 reads in the cat'd maps assert_equal(no_reads_mapped, 10) end def test_rmdup #dupes contains 4 reads mapped once and one read mapped to the same place 268 times. dupes = @test_folder + "/dupes.bam" unduped = @test_folder + "/dupes_rmdup.bam" bam_with_dupes = Bio::DB::Sam.new(:fasta => @testReference, :bam => dupes) bam_with_dupes.remove_duplicates(:s=>true, :out=>unduped) unduped_bam = Bio::DB::Sam.new(:fasta => @testReference, :bam => unduped) #rmdup should remove 267 of the 268 reads mapping to the same place, so producing a bam file with 5 reads readcount = 0 unduped_bam.view()do |sam| readcount +=1 end assert_equal(readcount, 5) end def test_targetcut sorted_bam = @test_folder + "/sorted.bam" cut = Bio::DB::Sam.new(:fasta => @testReference, :bam => sorted_bam) assert_nothing_thrown do cut.targetcut end end def test_docs #force an error (use 'samtool' instead of 'samtools') output = Bio::DB::Sam.docs('samtool', 'tview') assert_equal(output, "program must be 'samtools' or 'bcftools'") end def test_bedcov out_file = @test_folder + "/testu.out" @sam.bedcov(:bed=>@bed_file, :out=>out_file) f = File.open(out_file, "r") f.each_line do |line| f_array= line.split(/\t/) assert_equal(f_array[3], 630) end f.close end end