{ "extnames": { "1C Enterprise": [ ".bsl", ".os" ], "ABAP": [ ".abap" ], "ABNF": [ ".abnf" ], "AGS Script": [ ".asc", ".ash" ], "AMPL": [ ".ampl", ".mod" ], "API Blueprint": [ ".apib" ], "APL": [ ".apl", ".dyalog" ], "ASN.1": [ ".asn" ], "ATS": [ ".dats", ".hats", ".sats" ], "Agda": [ ".agda" ], "Alloy": [ ".als" ], "ApacheConf": [ ".vhost" ], "Apex": [ ".cls" ], "Apollo Guidance Computer": [ ".agc" ], "AppleScript": [ ".applescript" ], "Arduino": [ ".ino" ], "AsciiDoc": [ ".adoc", ".asc", ".asciidoc" ], "AspectJ": [ ".aj" ], "Assembly": [ ".a51", ".asm", ".inc", ".nasm" ], "AutoHotkey": [ ".ahk" ], "Awk": [ ".awk" ], "BitBake": [ ".bb" ], "Blade": [ ".blade", ".php" ], "BlitzBasic": [ ".bb" ], "BlitzMax": [ ".bmx" ], "Bluespec": [ ".bsv" ], "Brainfuck": [ ".b", ".bf" ], "Brightscript": [ ".brs" ], "C": [ ".C", ".H", ".c", ".cats", ".h" ], "C#": [ ".cake", ".cs", ".cshtml" ], "C++": [ ".cc", ".cp", ".cpp", ".h", ".hh", ".hpp", ".inc", ".inl", ".ipp" ], "CLIPS": [ ".clp" ], "CMake": [ ".cmake", ".in" ], "COBOL": [ ".cbl", ".ccp", ".cob", ".cpy" ], "CSON": [ ".cson" ], "CSS": [ ".css" ], "CSV": [ ".csv" ], "CartoCSS": [ ".mss" ], "Ceylon": [ ".ceylon" ], "Chapel": [ ".chpl" ], "Charity": [ ".ch" ], "Cirru": [ ".cirru" ], "Clarion": [ ".clw" ], "Clean": [ ".dcl", ".icl" ], "Click": [ ".click" ], "Clojure": [ ".boot", ".cl2", ".clj", ".cljc", ".cljs", ".cljscm", ".cljx", ".hic", ".hl" ], "CoffeeScript": [ ".cake", ".cjsx", ".coffee" ], "ColdFusion": [ ".cfm" ], "ColdFusion CFC": [ ".cfc" ], "Common Lisp": [ ".cl", ".l", ".lisp", ".lsp", ".sexp" ], "Component Pascal": [ ".cp", ".cps" ], "Cool": [ ".cl" ], "Coq": [ ".v" ], "Creole": [ ".creole" ], "Crystal": [ ".cr" ], "Csound": [ ".orc" ], "Csound Document": [ ".csd" ], "Csound Score": [ ".sco" ], "Cuda": [ ".cu", ".cuh" ], "Cycript": [ ".cy" ], "D": [ ".d" ], "DIGITAL Command Language": [ ".com" ], "DM": [ ".dm" ], "DNS Zone": [ ".arpa", ".zone" ], "DTrace": [ ".d" ], "Dart": [ ".dart" ], "Diff": [ ".patch" ], "Dogescript": [ ".djs" ], "E": [ ".E" ], "EBNF": [ ".ebnf" ], "ECL": [ ".ecl" ], "ECLiPSe": [ ".ecl" ], "EJS": [ ".ejs" ], "EQ": [ ".eq" ], "Eagle": [ ".brd", ".sch" ], "Eiffel": [ ".e" ], "Elm": [ ".elm" ], "Emacs Lisp": [ ".desktop", ".el" ], "EmberScript": [ ".em" ], "Erlang": [ ".erl", ".es", ".escript", ".src", ".xrl", ".yrl" ], "F#": [ ".fs" ], "FLUX": [ ".fx" ], "FORTRAN": [ ".F", ".f", ".for" ], "Filebench WML": [ ".f" ], "Filterscript": [ ".fs" ], "Formatted": [ ".for", ".fs" ], "Forth": [ ".4TH", ".F", ".f", ".for", ".forth", ".fr", ".frt", ".fs", ".fth" ], "FreeMarker": [ ".ftl" ], "Frege": [ ".fr" ], "G-code": [ ".g" ], "GAMS": [ ".gms" ], "GAP": [ ".g", ".gd", ".gi", ".tst" ], "GAS": [ ".ms", ".s" ], "GCC Machine Description": [ ".md" ], "GDB": [ ".gdb", ".gdbinit" ], "GDScript": [ ".gd" ], "GLSL": [ ".fp", ".frag", ".frg", ".fs", ".fsh", ".glsl", ".vrx", ".vsh" ], "GN": [ ".gn", ".gni" ], "Game Maker Language": [ ".gml" ], "Gnuplot": [ ".gnu", ".gp" ], "Go": [ ".go" ], "Golo": [ ".golo" ], "Gosu": [ ".gs", ".gst", ".gsx", ".vark" ], "Grace": [ ".grace" ], "Gradle": [ ".gradle" ], "Grammatical Framework": [ ".gf" ], "Graph Modeling Language": [ ".gml" ], "GraphQL": [ ".graphql" ], "Graphviz (DOT)": [ ".DOT", ".dot" ], "Groff": [ ".4", ".l", ".ms", ".n", ".rno", ".tmac" ], "Groovy": [ ".grt", ".gtpl", ".gvy" ], "Groovy Server Pages": [ ".gsp" ], "HCL": [ ".hcl", ".tf" ], "HLSL": [ ".fx", ".hlsl" ], "HTML": [ ".hl", ".html", ".inc", ".st", ".xht" ], "HTML+Django": [ ".njk" ], "HTML+ECR": [ ".ecr" ], "HTML+EEX": [ ".eex" ], "HTML+ERB": [ ".deface", ".erb" ], "Hack": [ ".hh", ".php" ], "Haml": [ ".deface", ".haml" ], "Handlebars": [ ".handlebars", ".hbs" ], "Haskell": [ ".hs" ], "Hy": [ ".hy" ], "HyPhy": [ ".bf" ], "IDL": [ ".dlm", ".pro" ], "IGOR Pro": [ ".ipf" ], "INI": [ ".pro" ], "Idris": [ ".idr" ], "Inform 7": [ ".i7x", ".ni" ], "Inno Setup": [ ".iss" ], "Ioke": [ ".ik" ], "Isabelle": [ ".thy" ], "J": [ ".ijs" ], "JFlex": [ ".flex", ".jflex" ], "JSON": [ ".JSON-tmLanguage", ".geojson", ".json", ".topojson" ], "JSON5": [ ".json5" ], "JSONLD": [ ".jsonld" ], "JSONiq": [ ".jq" ], "JSX": [ ".jsx" ], "Jade": [ ".jade", ".pug" ], "Jasmin": [ ".j" ], "Java": [ ".java" ], "JavaScript": [ ".es", ".frag", ".gs", ".js", ".jsb", ".jscad", ".xsjs", ".xsjslib" ], "Julia": [ ".jl" ], "Jupyter Notebook": [ ".ipynb" ], "KRL": [ ".krl" ], "KiCad": [ ".brd", ".kicad_pcb", ".sch" ], "Kit": [ ".kit" ], "Kotlin": [ ".kt" ], "LFE": [ ".lfe" ], "LOLCODE": [ ".lol" ], "LSL": [ ".lsl", ".lslp" ], "Lasso": [ ".las", ".lasso", ".lasso9", ".ldml" ], "Latte": [ ".latte" ], "Lean": [ ".hlean", ".lean" ], "Less": [ ".less" ], "Lex": [ ".l" ], "Limbo": [ ".b", ".m" ], "Linker Script": [ ".ld", ".lds" ], "Linux Kernel Module": [ ".mod" ], "Liquid": [ ".liquid" ], "Literate Agda": [ ".lagda" ], "Literate CoffeeScript": [ ".litcoffee" ], "LiveScript": [ ".ls" ], "Logos": [ ".xm" ], "Logtalk": [ ".lgt" ], "LookML": [ ".lookml" ], "LoomScript": [ ".ls" ], "Lua": [ ".fcgi", ".pd_lua" ], "M": [ ".m" ], "M4": [ ".m4" ], "M4Sugar": [ ".m4" ], "MAXScript": [ ".mcr", ".ms" ], "MQL4": [ ".mq4", ".mqh" ], "MQL5": [ ".mq5", ".mqh" ], "MTML": [ ".mtml" ], "MUF": [ ".m", ".muf" ], "Makefile": [ ".d", ".make" ], "Markdown": [ ".md" ], "Mask": [ ".mask" ], "Mathematica": [ ".m", ".mt", ".nb", ".wl", ".wlt" ], "Matlab": [ ".m" ], "Max": [ ".maxhelp", ".maxpat", ".mxt" ], "MediaWiki": [ ".mediawiki", ".wiki" ], "Mercury": [ ".m", ".moo" ], "Metal": [ ".metal" ], "Modelica": [ ".mo" ], "Modula-2": [ ".mod" ], "Module Management System": [ ".mmk", ".mms" ], "Monkey": [ ".monkey" ], "Moocode": [ ".moo" ], "MoonScript": [ ".moon" ], "NCL": [ ".ncl" ], "NL": [ ".nl" ], "NSIS": [ ".nsh", ".nsi" ], "Nemerle": [ ".n" ], "NetLinx": [ ".axi", ".axs" ], "NetLinx+ERB": [ ".erb" ], "NetLogo": [ ".nlogo" ], "NewLisp": [ ".lisp", ".lsp", ".nl" ], "Nginx": [ ".vhost" ], "Nimrod": [ ".nim" ], "Nit": [ ".nit" ], "Nix": [ ".nix" ], "Nu": [ ".nu" ], "OCaml": [ ".eliom", ".ml" ], "Objective-C": [ ".h", ".m" ], "Objective-C++": [ ".mm" ], "Objective-J": [ ".j" ], "Omgrofl": [ ".omgrofl" ], "Opa": [ ".opa" ], "Opal": [ ".opal" ], "OpenCL": [ ".cl" ], "OpenEdge ABL": [ ".cls", ".p" ], "OpenSCAD": [ ".scad" ], "Org": [ ".org" ], "Ox": [ ".ox", ".oxh", ".oxo" ], "Oxygene": [ ".oxygene" ], "Oz": [ ".oz" ], "PAWN": [ ".inc", ".pwn" ], "PHP": [ ".fcgi", ".inc", ".php", ".phps" ], "PLSQL": [ ".pck", ".pkb", ".pks", ".plsql", ".sql" ], "PLpgSQL": [ ".sql" ], "POV-Ray SDL": [ ".inc", ".pov" ], "Pan": [ ".pan" ], "Papyrus": [ ".psc" ], "Parrot Assembly": [ ".pasm" ], "Parrot Internal Representation": [ ".pir" ], "Pascal": [ ".dpr", ".inc", ".pascal", ".pp" ], "Perl": [ ".al", ".cgi", ".fcgi", ".pl", ".pm", ".pod", ".t" ], "Perl6": [ ".p6", ".pl", ".pm", ".pm6", ".t" ], "Pic": [ ".chem", ".pic" ], "Pickle": [ ".pkl" ], "PicoLisp": [ ".l" ], "PigLatin": [ ".pig" ], "Pike": [ ".pike", ".pmod" ], "Pod": [ ".pod" ], "PogoScript": [ ".pogo" ], "Pony": [ ".pony" ], "PostScript": [ ".ps" ], "PowerBuilder": [ ".pbt", ".sra", ".sru", ".srw" ], "PowerShell": [ ".ps1", ".psd1", ".psm1" ], "Processing": [ ".pde" ], "Prolog": [ ".pl", ".pro", ".prolog", ".yap" ], "Propeller Spin": [ ".spin" ], "Protocol Buffer": [ ".proto" ], "Public Key": [ ".asc", ".pub" ], "Puppet": [ ".pp" ], "PureBasic": [ ".pb", ".pbi" ], "PureScript": [ ".purs" ], "Python": [ ".bzl", ".cgi", ".fcgi", ".gypi", ".py", ".py3", ".pyde", ".pyp", ".rpy", ".spec" ], "QML": [ ".qbs" ], "QMake": [ ".pri", ".pro" ], "R": [ ".R", ".Rd", ".r", ".rsx" ], "RAML": [ ".raml" ], "RDoc": [ ".rdoc" ], "REXX": [ ".pprx", ".rexx" ], "RMarkdown": [ ".rmd" ], "RPM Spec": [ ".spec" ], "RUNOFF": [ ".RNH", ".rnh", ".rno" ], "Racket": [ ".scrbl" ], "Ragel in Ruby Host": [ ".rl" ], "Rascal": [ ".rsc" ], "Rebol": [ ".r", ".r2", ".r3", ".reb", ".rebol" ], "Red": [ ".red", ".reds" ], "Ren'Py": [ ".rpy" ], "RenderScript": [ ".rs", ".rsh" ], "RobotFramework": [ ".robot" ], "Ruby": [ ".fcgi", ".jbuilder", ".pluginspec", ".rabl", ".rake", ".rb", ".spec" ], "Rust": [ ".rs" ], "SAS": [ ".sas" ], "SCSS": [ ".scss" ], "SMT": [ ".smt", ".smt2" ], "SPARQL": [ ".sparql" ], "SQF": [ ".hqf", ".sqf" ], "SQL": [ ".cql", ".ddl", ".inc", ".prc", ".sql", ".tab", ".udf", ".viw" ], "SQLPL": [ ".db2", ".sql" ], "SRecode Template": [ ".srt" ], "STON": [ ".ston" ], "Sage": [ ".sagews" ], "SaltStack": [ ".sls" ], "Sass": [ ".sass" ], "Scala": [ ".sbt", ".sc" ], "Scaml": [ ".scaml" ], "Scheme": [ ".sld", ".sls", ".sps" ], "Scilab": [ ".sce", ".sci", ".tst" ], "Shell": [ ".bash", ".cgi", ".command", ".fcgi", ".sh", ".tool", ".zsh" ], "ShellSession": [ ".sh-session" ], "Shen": [ ".shen" ], "Slash": [ ".sl" ], "Slim": [ ".slim" ], "Smali": [ ".smali" ], "Smalltalk": [ ".cs", ".st" ], "SourcePawn": [ ".inc", ".sma", ".sp" ], "Squirrel": [ ".nut" ], "Stan": [ ".stan" ], "Standard ML": [ ".ML", ".fun", ".sig", ".sml" ], "Stata": [ ".ado", ".do", ".doh", ".ihlp", ".mata", ".matah", ".sthlp" ], "Stylus": [ ".styl" ], "SubRip Text": [ ".srt" ], "Sublime Text Config": [ ".sublime-build", ".sublime-commands", ".sublime-completions", ".sublime-keymap", ".sublime-macro", ".sublime-menu", ".sublime-mousemap", ".sublime-project", ".sublime-settings", ".sublime-theme" ], "SuperCollider": [ ".sc", ".scd" ], "Swift": [ ".swift" ], "SystemVerilog": [ ".sv", ".svh", ".vh" ], "TI Program": [ ".txt" ], "TLA": [ ".tla" ], "TXL": [ ".txl" ], "Tcl": [ ".tm" ], "TeX": [ ".bbx", ".cbx", ".cls", ".lbx", ".toc" ], "Tea": [ ".tea" ], "Terra": [ ".t" ], "Text": [ ".fr", ".nb", ".ncl", ".no", ".txt" ], "Thrift": [ ".thrift" ], "Turing": [ ".t" ], "Turtle": [ ".ttl" ], "TypeScript": [ ".ts", ".tsx" ], "Unity3D Asset": [ ".anim", ".asset", ".mat", ".meta", ".prefab" ], "Uno": [ ".uno" ], "UnrealScript": [ ".uc" ], "UrWeb": [ ".ur", ".urs" ], "VCL": [ ".vcl" ], "VHDL": [ ".vhd" ], "Verilog": [ ".v" ], "VimL": [ ".vim" ], "Visual Basic": [ ".cls", ".vb", ".vbhtml" ], "Volt": [ ".volt" ], "Vue": [ ".vue" ], "Wavefront Material": [ ".mtl" ], "Wavefront Object": [ ".obj" ], "Web Ontology Language": [ ".owl" ], "WebIDL": [ ".webidl" ], "World of Warcraft Addon Data": [ ".toc" ], "X10": [ ".x10" ], "XC": [ ".xc" ], "XML": [ ".ant", ".builds", ".config", ".csl", ".csproj", ".dist", ".filters", ".fsproj", ".fxml", ".gml", ".iml", ".ivy", ".jsproj", ".mdpolicy", ".mm", ".mod", ".nproj", ".nuspec", ".odd", ".pkgproj", ".pluginspec", ".props", ".resx", ".sch", ".sfproj", ".storyboard", ".targets", ".ts", ".tsx", ".ux", ".vbproj", ".vcxproj", ".xib", ".xml" ], "XPages": [ ".metadata", ".xsp-config" ], "XProc": [ ".xpl" ], "XQuery": [ ".xqm" ], "XS": [ ".xs" ], "XSLT": [ ".xslt" ], "Xojo": [ ".xojo_code", ".xojo_menu", ".xojo_report", ".xojo_script", ".xojo_toolbar", ".xojo_window" ], "Xtend": [ ".xtend" ], "YAML": [ ".YAML-tmLanguage", ".sublime-syntax", ".syntax", ".yml" ], "YANG": [ ".yang" ], "Zephir": [ ".zep" ], "Zimpl": [ ".zmpl" ], "desktop": [ ".desktop" ], "eC": [ ".ec" ], "edn": [ ".edn" ], "fish": [ ".fish" ], "reStructuredText": [ ".txt" ], "wisp": [ ".wisp" ], "xBase": [ ".ch", ".prg", ".prw" ] }, "interpreters": { "APL": [ "apl" ], "Awk": [ "awk" ], "Crystal": [ "crystal" ], "DTrace": [ "dtrace" ], "E": [ "rune" ], "Erlang": [ "escript" ], "Gnuplot": [ "gnuplot" ], "Groovy": [ "groovy" ], "Haskell": [ "runhaskell" ], "Ioke": [ "ioke" ], "J": [ "jconsole" ], "JavaScript": [ "node" ], "Julia": [ "julia" ], "Lua": [ "lua" ], "Makefile": [ "make" ], "NewLisp": [ "newlisp" ], "Nu": [ "nush" ], "OpenRC runscript": [ "openrc-run" ], "PHP": [ "php" ], "Parrot Assembly": [ "parrot" ], "Parrot Internal Representation": [ "parrot" ], "Pascal": [ "instantfpc" ], "Perl": [ "perl" ], "Perl6": [ "perl6" ], "Pike": [ "pike" ], "Prolog": [ "swipl" ], "Python": [ "python", "python2" ], "QMake": [ "qmake" ], "R": [ "Rscript" ], "Ruby": [ "jruby", "macruby", "rake", "rbx", "ruby" ], "Scala": [ "scala" ], "Shell": [ "bash", "sh", "zsh" ] }, "filenames": { "Alpine Abuild": [ "APKBUILD" ], "Ant Build System": [ "ant.xml", "build.xml" ], "ApacheConf": [ ".htaccess", "apache2.conf", "httpd.conf" ], "C": [ "script" ], "CMake": [ "CMakeLists.txt" ], "Dockerfile": [ "Dockerfile" ], "Elixir": [ "mix.lock" ], "Emacs Lisp": [ ".abbrev_defs", ".gnus", ".spacemacs", ".viper", "Project.ede", "_emacs", "abbrev_defs" ], "Erlang": [ "rebar.config", "rebar.config.lock", "rebar.lock" ], "GN": [ ".gn" ], "Groovy": [ "Jenkinsfile" ], "INI": [ ".editorconfig", ".gitconfig" ], "Isabelle ROOT": [ "ROOT" ], "JSON": [ ".arcconfig", "composer.lock", "mcmod.info" ], "JSON5": [ ".babelrc" ], "Linker Script": [ "ld.script" ], "M4Sugar": [ "configure.ac" ], "Makefile": [ "BSDmakefile", "Kbuild", "Makefile", "Makefile.boot", "Makefile.frag", "Makefile.inc", "makefile.sco", "mkfile" ], "Maven POM": [ "pom.xml" ], "Nginx": [ "nginx.conf" ], "PHP": [ ".php", ".php_cs", ".php_cs.dist" ], "Perl": [ "ack" ], "Python": [ ".gclient", "BUCK", "BUILD" ], "R": [ "expr-dist" ], "Ruby": [ ".pryrc", "Appraisals", "Brewfile", "Capfile", "Dangerfile", "Deliverfile", "Fastfile", "Gemfile.lock", "Podfile", "Rakefile", "Snapfile" ], "Shell": [ ".bash_logout", ".bash_profile", ".bashrc", ".cshrc", ".login", ".profile", ".zlogin", ".zlogout", ".zprofile", ".zshenv", ".zshrc", "9fs", "PKGBUILD", "bash_logout", "bash_profile", "bashrc", "cshrc", "gradlew", "login", "man", "profile", "zlogin", "zlogout", "zprofile", "zshenv", "zshrc" ], "Tcl": [ "owh", "starfield" ], "Text": [ "README.me", "click.me", "delete.me", "keep.me", "read.me", "readme.1st", "test.me" ], "VimL": [ ".gvimrc", ".nvimrc", ".vimrc", "_vimrc" ], "XML": [ ".cproject" ], "YAML": [ ".clang-format", ".gemrc" ] }, "tokens_total": 1262960, "languages_total": 1732, "tokens": { "1C Enterprise": { "&": 8, "(": 165, ")": 168, ";": 215, ".": 230, "+": 10, "<": 12, "-": 2, "[": 4, "]": 4, "HTML": 2, "DOM": 2, "DOM.": 1, "HTML.": 2, "Null": 1, "_": 9, "//": 24, "XML": 11, "XML.": 7, "////////////////////////////////////////////////////////////////////////////////": 2, "*": 1, "/": 1, "ru": 12, "|": 12, "#": 2 }, "ABAP": { "*/**": 1, "*": 58, "The": 2, "MIT": 2, "License": 1, "(": 14, ")": 14, "Copyright": 1, "c": 3, "Ren": 1, "van": 1, "Mil": 1, "Permission": 1, "is": 4, "hereby": 1, "granted": 1, "free": 1, "of": 8, "charge": 1, "to": 8, "any": 1, "person": 1, "obtaining": 1, "a": 2, "copy": 2, "this": 2, "software": 1, "and": 5, "associated": 1, "documentation": 1, "files": 4, "the": 11, "deal": 1, "in": 2, "Software": 3, "without": 2, "restriction": 1, "including": 1, "limitation": 1, "rights": 1, "use": 1, "modify": 1, "merge": 1, "publish": 1, "distribute": 1, "sublicense": 1, "and/or": 1, "sell": 1, "copies": 2, "permit": 1, "persons": 1, "whom": 1, "furnished": 1, "do": 4, "so": 1, "subject": 1, "following": 1, "conditions": 1, "above": 1, "copyright": 1, "notice": 2, "permission": 1, "shall": 1, "be": 1, "included": 1, "all": 1, "or": 1, "substantial": 1, "portions": 1, "Software.": 1, "THE": 6, "SOFTWARE": 2, "IS": 1, "PROVIDED": 1, "WITHOUT": 1, "WARRANTY": 1, "OF": 4, "ANY": 2, "KIND": 1, "EXPRESS": 1, "OR": 7, "IMPLIED": 1, "INCLUDING": 1, "BUT": 1, "NOT": 1, "LIMITED": 1, "TO": 2, "WARRANTIES": 1, "MERCHANTABILITY": 1, "FITNESS": 1, "FOR": 2, "A": 1, "PARTICULAR": 1, "PURPOSE": 1, "AND": 1, "NONINFRINGEMENT.": 1, "IN": 4, "NO": 1, "EVENT": 1, "SHALL": 1, "AUTHORS": 1, "COPYRIGHT": 1, "HOLDERS": 1, "BE": 1, "LIABLE": 1, "CLAIM": 1, "DAMAGES": 1, "OTHER": 2, "LIABILITY": 1, "WHETHER": 1, "AN": 1, "ACTION": 1, "CONTRACT": 1, "TORT": 1, "OTHERWISE": 1, "ARISING": 1, "FROM": 1, "OUT": 1, "CONNECTION": 1, "WITH": 1, "USE": 1, "DEALINGS": 1, "SOFTWARE.": 1, "*/": 1, "-": 982, "CLASS": 2, "CL_CSV_PARSER": 6, "DEFINITION": 2, "class": 2, "cl_csv_parser": 2, "definition": 1, "public": 3, "inheriting": 1, "from": 1, "cl_object": 1, "final": 1, "create": 1, ".": 13, "section.": 3, "not": 3, "include": 3, "other": 3, "source": 3, "here": 3, "type": 20, "pools": 1, "abap": 1, "methods": 2, "constructor": 2, "importing": 1, "delegate": 1, "ref": 1, "if_csv_parser_delegate": 1, "csvstring": 1, "string": 1, "separator": 1, "skip_first_line": 1, "abap_bool": 2, "parse": 1, "raising": 1, "cx_csv_parse_error": 3, "protected": 1, "private": 1, "constants": 1, "_textindicator": 1, "value": 5, "IMPLEMENTATION": 2, "implementation.": 1, "": 2, "+": 13, "|": 9, "Instance": 2, "Public": 1, "Method": 2, "CONSTRUCTOR": 1, "[": 7, "]": 7, "DELEGATE": 1, "TYPE": 6, "REF": 1, "IF_CSV_PARSER_DELEGATE": 1, "CSVSTRING": 1, "STRING": 2, "SEPARATOR": 1, "C": 1, "SKIP_FIRST_LINE": 1, "ABAP_BOOL": 1, "": 2, "method": 2, "constructor.": 1, "super": 1, "_delegate": 2, "delegate.": 1, "_csvstring": 1, "csvstring.": 1, "_separator": 1, "separator.": 1, "_skip_first_line": 2, "skip_first_line.": 1, "endmethod.": 3, "Get": 1, "lines": 4, "data": 11, "is_first_line": 3, "abap_true.": 4, "standard": 3, "table": 3, "string.": 6, "_lines": 2, "field": 1, "symbols": 1, "": 3, "loop": 1, "at": 1, "assigning": 1, "if": 8, "abap_true": 1, "abap_false.": 3, "continue.": 1, "endif.": 3, "values": 3, "_parse_line": 1, "values_found": 1, "endloop.": 1, "Private": 1, "_PARSE_LINE": 1, "LINE": 1, "<": 6, "RETURNING": 1, "STRINGTAB": 1, "CX": 1, "CX_CSV_PARSE_ERROR": 1, "_parse_line.": 1, "msg": 1, "csvvalue": 1, "csvvalues": 1, "char": 8, "c.": 1, "pos": 8, "i": 1, "len": 3, "i.": 2, "strlen": 1, "line": 5, "while": 3, "len.": 2, "_separator.": 2, "_textindicator.": 2, "text_ended": 5, "abap_bool.": 1, "else.": 2, "initial.": 2, "Reached": 1, "end": 1, "inside": 1, "text": 1, "message": 4, "e003": 2, "csv": 2, "into": 2, "msg.": 4, "raise": 2, "exception": 2, "exporting": 2, "endwhile.": 1, "nextpos": 4, "Don": 1, "t": 1, "forget": 1, "last": 1, "returning": 1, "csvvalues.": 1 }, "ABNF": { ";": 95, "Source": 1, "https": 1, "//github.com/toml": 1, "-": 214, "lang/toml": 1, "License": 1, "MIT": 1, "This": 1, "is": 1, "an": 1, "attempt": 1, "to": 2, "define": 1, "TOML": 2, "in": 4, "ABNF": 2, "according": 1, "the": 1, "grammar": 1, "defined": 2, "RFC": 2, "(": 18, "http": 1, "//www.ietf.org/rfc/rfc4234.txt": 1, ")": 19, ".": 3, "toml": 1, "expression": 3, "*": 9, "newline": 5, "ws": 23, "/": 65, "comment": 8, "keyval": 6, "[": 13, "]": 13, "table": 30, "Newline": 1, "%": 55, "x0A": 1, "LF": 1, "x0D.0A": 1, "CRLF": 1, "newlines": 5, "*newline": 1, "Whitespace": 1, "x20": 6, "Space": 1, "x09": 4, "Horizontal": 1, "tab": 2, "Comment": 1, "start": 2, "symbol": 2, "x23": 2, "#": 1, "non": 4, "eol": 2, "*non": 1, "Key": 1, "Value": 1, "pairs": 1, "sep": 12, "x3D": 1, "key": 15, "val": 6, "unquoted": 2, "quoted": 2, "ALPHA": 2, "DIGIT": 15, "x2D": 2, "x5F": 2, "A": 5, "Z": 2, "a": 2, "z": 2, "_": 2, "quotation": 9, "mark": 9, "*basic": 2, "char": 8, "See": 1, "Basic": 3, "Strings": 1, "integer": 4, "float": 2, "string": 16, "boolean": 2, "date": 10, "time": 20, "array": 18, "inline": 13, "Table": 4, "std": 6, "Standard": 1, "open": 8, "x5B": 2, "Left": 1, "square": 4, "bracket": 4, "close": 8, "x5D": 4, "Right": 1, "x2E": 2, "Period": 1, "Array": 2, "x5B.5B": 1, "Double": 2, "left": 1, "x5D.5D": 1, "right": 1, "Integer": 1, "minus": 2, "plus": 2, "int": 4, "x2B": 1, "+": 11, "digit1": 2, "x31": 1, "underscore": 3, "Float": 1, "frac": 3, "exp": 3, "zero": 2, "prefixable": 2, "decimal": 2, "point": 2, "e": 3, "x65": 1, "x45": 1, "E": 1, "String": 5, "basic": 14, "ml": 20, "literal": 12, "x22": 1, "U": 10, "x5C": 2, "reverse": 1, "solidus": 2, "C": 2, "x2F": 1, "x62": 1, "b": 1, "backspace": 1, "x66": 1, "f": 1, "form": 1, "feed": 2, "x6E": 1, "n": 1, "line": 1, "x72": 1, "r": 1, "carriage": 1, "return": 1, "D": 1, "x74": 1, "t": 1, "x75": 1, "HEXDIG": 3, "uXXXX": 1, "XXXX": 1, "x55": 1, "UXXXXXXXX": 1, "XXXXXXXX": 1, "unescaped": 3, "B": 2, "escape": 2, "Multiline": 2, "delim": 6, "body": 4, "escaped": 1, "Literal": 2, "apostraphe": 6, "*literal": 1, "x27": 1, "Apostrophe": 1, "x28": 1, "Boolean": 1, "true": 3, "false": 3, "x74.72.75.65": 1, "x66.61.6C.73.65": 1, "Datetime": 1, "as": 1, "fullyear": 2, "month": 2, "mday": 2, "based": 2, "on": 2, "month/year": 1, "hour": 3, "minute": 3, "second": 3, "leap": 1, "rules": 1, "secfrac": 2, "*DIGIT": 1, "numoffset": 2, "offset": 2, "partial": 2, "full": 4, "values": 3, "x2C": 2, "Comma": 2, "Inline": 1, "x7B": 1, "{": 1, "x7D": 1, "}": 1, "keyvals": 5, "empty": 3, "Built": 1, "terms": 1, "reproduced": 1, "here": 1, "for": 1, "clarity": 1, "x41": 1, "x61": 1, "x30": 1 }, "AGS Script": { "function": 54, "initialize_control_panel": 2, "(": 281, ")": 282, "{": 106, "gPanel.Centre": 1, ";": 235, "gRestartYN.Centre": 1, "if": 96, "IsSpeechVoxAvailable": 3, "lblVoice.Visible": 1, "false": 26, "btnVoice.Visible": 1, "sldVoice.Visible": 1, "}": 107, "else": 44, "SetVoiceMode": 6, "eSpeechVoiceAndText": 4, "btnVoice.Text": 9, "System.SupportsGammaControl": 3, "sldGamma.Visible": 1, "lblGamma.Visible": 1, "//And": 1, "now": 1, "set": 7, "all": 2, "the": 15, "defaults": 1, "System.Volume": 5, "sldAudio.Value": 3, "SetGameSpeed": 3, "sldSpeed.Value": 3, "sldVoice.Value": 3, "SetSpeechVolume": 3, "System.Gamma": 3, "sldGamma.Value": 3, "game_start": 1, "KeyboardMovement.SetMode": 1, "eKeyboardMovement_Tapping": 3, "repeatedly_execute": 2, "IsGamePaused": 4, "return": 8, "repeatedly_execute_always": 1, "show_inventory_window": 3, "gInventory.Visible": 2, "true": 18, "mouse.Mode": 13, "eModeInteract": 3, "mouse.UseModeGraphic": 8, "eModePointer": 8, "show_save_game_dialog": 3, "gSaveGame.Visible": 3, "lstSaveGamesList.FillSaveGameList": 2, "lstSaveGamesList.ItemCount": 3, "txtNewSaveName.Text": 5, "lstSaveGamesList.Items": 3, "[": 6, "]": 6, "gIconbar.Visible": 15, "show_restore_game_dialog": 3, "gRestoreGame.Visible": 3, "lstRestoreGamesList.FillSaveGameList": 1, "close_save_game_dialog": 4, "mouse.UseDefaultGraphic": 9, "close_restore_game_dialog": 4, "on_key_press": 2, "eKeyCode": 1, "keycode": 27, "eKeyEscape": 5, "&&": 8, "gRestartYN.Visible": 6, "//Use": 1, "ESC": 1, "to": 14, "cancel": 1, "restart.": 1, "gPanel.Visible": 11, "eKeyReturn": 1, "RestartGame": 2, "||": 12, "IsInterfaceEnabled": 3, "eKeyCtrlQ": 1, "QuitGame": 3, "//": 66, "Ctrl": 1, "-": 217, "Q": 1, "eKeyF5": 1, "F5": 1, "eKeyF7": 1, "F7": 1, "eKeyF9": 1, "eKeyF12": 1, "SaveScreenShot": 1, "F12": 1, "eKeyTab": 1, "Tab": 1, "show": 1, "inventory": 2, "eModeWalkto": 2, "//Notice": 1, "this": 1, "alternate": 1, "way": 1, "indicate": 1, "keycodes.": 1, "eModeLookat": 1, "//Note": 1, "that": 1, "we": 1, "do": 1, "here": 1, "is": 10, "modes.": 1, "//If": 1, "you": 1, "want": 1, "something": 1, "happen": 1, "such": 1, "as": 2, "GUI": 3, "buttons": 1, "highlighting": 1, "eModeTalkto": 2, "//you": 1, "I": 1, "P": 1, "G": 1, "t": 1, "allow": 1, "mouse": 2, "click": 1, "button": 33, "eMouseLeft": 4, "ProcessClick": 2, "mouse.x": 2, "mouse.y": 2, "eMouseRight": 1, "eMouseWheelSouth": 1, "mouse.SelectNextMode": 1, "eMouseMiddle": 1, "eMouseWheelNorth": 1, "player.ActiveInventory": 2, "null": 2, "//...and": 1, "player": 13, "has": 1, "a": 1, "selected": 1, "item": 1, "mode": 10, "UseInv.": 1, "eModeUseinv": 2, "interface_click": 1, "int": 18, "interface": 3, "btnInvUp_Click": 1, "GUIControl": 31, "*control": 31, "MouseButton": 26, "invCustomInv.ScrollUp": 1, "btnInvDown_Click": 1, "invCustomInv.ScrollDown": 1, "btnInvOK_Click": 1, "They": 2, "pressed": 4, "OK": 1, "close": 1, "btnInvSelect_Click": 1, "SELECT": 1, "so": 1, "switch": 1, "Get": 1, "cursor": 1, "But": 1, "override": 1, "appearance": 1, "look": 1, "like": 1, "arrow": 9, "btnIconInv_Click": 1, "btnIconCurInv_Click": 1, "btnIconSave_Click": 2, "btnIconLoad_Click": 2, "btnIconExit_Click": 1, "btnIconAbout_Click": 1, "cEgo_Look": 1, "Display": 4, "cEgo_Interact": 1, "cEgo_Talk": 1, "//START": 1, "OF": 2, "CONTROL": 2, "PANEL": 2, "FUNCTIONS": 2, "btnSave_OnClick": 1, "Wait": 3, "btnIconSave": 1, "gControl_OnClick": 1, "*theGui": 1, "btnAbout_OnClick": 1, "btnQuit_OnClick": 1, "btnLoad_OnClick": 1, "btnIconLoad": 1, "btnResume_OnClick": 1, "sldAudio_OnChange": 1, "sldVoice_OnChange": 1, "btnVoice_OnClick": 1, "eSpeechVoiceOnly": 1, "eSpeechTextOnly": 1, "sldGamma_OnChange": 1, "btnDefault_OnClick": 1, "//END": 1, "dialog_request": 1, "param": 1, "sldSpeed_OnChange": 1, "btnRestart_OnClick": 1, "btnRestartYes_OnClick": 1, "btnRestartNo_OnClick": 1, "btnCancelSave_OnClick": 1, "btnSaveGame_OnClick": 2, "gameSlotToSaveInto": 3, "+": 7, "i": 5, "while": 1, "<": 1, "lstSaveGamesList.SaveGameSlots": 2, "SaveGameSlot": 1, "btnCancelRestore_OnClick": 1, "btnRestoreGame_OnClick": 1, "lstRestoreGamesList.SelectedIndex": 2, "RestoreGameSlot": 1, "lstRestoreGamesList.SaveGameSlots": 1, "lstSaveGamesList_OnSelectionCh": 1, "lstSaveGamesList.SelectedIndex": 3, "txtNewSaveName_OnActivate": 1, "control": 2, "btnDeleteSave_OnClick": 1, "DeleteSaveSlot": 1, "//****************************************************************************************************": 8, "#define": 2, "DISTANCE": 25, "distance": 1, "walks": 1, "in": 1, "Tapping": 2, "before": 1, "he": 1, "stops": 1, "enum": 2, "KeyboardMovement_Directions": 4, "eKeyboardMovement_Stop": 9, "eKeyboardMovement_DownLeft": 5, "eKeyboardMovement_Down": 5, "eKeyboardMovement_DownRight": 5, "eKeyboardMovement_Left": 5, "eKeyboardMovement_Right": 5, "eKeyboardMovement_UpLeft": 5, "eKeyboardMovement_Up": 5, "eKeyboardMovement_UpRight": 5, "KeyboardMovement_KeyDown": 5, "down": 9, "KeyboardMovement_KeyLeft": 5, "left": 4, "KeyboardMovement_KeyRight": 5, "right": 5, "KeyboardMovement_KeyUp": 5, "up": 4, "KeyboardMovement_KeyDownRight": 3, "PgDn": 2, "numpad": 8, "KeyboardMovement_KeyUpRight": 3, "PgUp": 2, "KeyboardMovement_KeyDownLeft": 3, "End": 2, "KeyboardMovement_KeyUpLeft": 3, "Home": 2, "KeyboardMovement_KeyStop": 3, "KeyboardMovement_Modes": 4, "KeyboardMovement_Mode": 4, "eKeyboardMovement_None": 2, "stores": 2, "current": 8, "keyboard": 1, "disabled": 5, "by": 1, "default": 1, "KeyboardMovement_CurrentDirection": 7, "walking": 1, "direction": 22, "of": 6, "character": 11, "static": 2, "KeyboardMovement": 2, "SetMode": 2, "Pressing": 1, "eKeyboardMovement_Pressing": 2, "player.on": 2, "game": 2, "paused": 2, "module": 2, "or": 8, "hidden": 2, "quit": 2, "newdirection": 43, "declare": 4, "variable": 2, "storing": 4, "new": 19, "get": 2, "IsKeyPressed": 17, "&": 4, "arrows": 4, "numeric": 2, "pad": 2, "held": 4, "Down": 2, "Right": 2, "none": 1, "above": 2, "it": 1, "stop": 7, "regardless": 1, "whether": 1, "some": 1, "are": 1, "different": 2, "from": 2, "player.StopMoving": 3, "Stop": 4, "command": 4, "movement": 2, "NOT": 2, "dx": 20, "dy": 20, "variables": 2, "walk": 4, "coordinates": 4, "player.WalkStraight": 2, "player.x": 2, "player.y": 2, "eNoBlock": 2, "update": 3, "key": 2, "same": 1, "on_event": 1, "EventType": 1, "event": 2, "data": 1, "eEventLeaveRoom": 1, "KeyboardMovement_VERSION": 1, "struct": 1, "import": 1 }, "AMPL": { "param": 13, "num_beams": 2, ";": 32, "#": 6, "number": 3, "of": 6, "beams": 2, "num_rows": 2, "integer": 2, "rows": 2, "num_cols": 2, "columns": 2, "set": 9, "BEAMS": 7, "..": 3, "ROWS": 6, "COLUMNS": 6, "beam_values": 5, "{": 23, "}": 23, "tumor_values": 2, "critical_values": 2, "critical_max": 2, "tumor_min": 2, "var": 4, "X": 5, "i": 19, "in": 19, "tumor_area": 5, "k": 20, "h": 20, "[": 18, "]": 18, "critical_area": 5, "S": 3, "(": 8, ")": 8, "T": 3, "maximize": 2, "total_tumor_dosage": 1, "sum": 10, "*": 6, "minimize": 3, "total_critical_dosage": 1, "total_tumor_slack": 1, "total_critical_slack": 1, "subject": 2, "to": 2, "tumor_limit": 1, "-": 1, "critical_limit": 1, "+": 1, "I": 7, "Value": 3, "Weight": 3, "KnapsackBound": 3, "Take": 3, "binary": 1, "TotalValue": 1, "s.t.": 1, "WeightLimit": 1, "<": 1, "data": 1 }, "API Blueprint": { "FORMAT": 3, "A": 6, "resource": 3, "action": 2, "is": 7, "in": 7, "fact": 1, "a": 8, "state": 3, "transition.": 1, "This": 7, "API": 12, "example": 5, "demonstrates": 2, "an": 1, "-": 11, "transition": 2, "to": 11, "another": 2, "resource.": 1, "##": 7, "Blueprint": 8, "+": 25, "[": 18, "Previous": 2, "Resource": 6, "Model": 1, "]": 18, "(": 26, "%": 20, "Model.md": 1, ")": 26, "Raw": 4, "https": 6, "//raw.github.com/apiaryio/api": 4, "blueprint/master/examples/11.": 1, "Advanced": 5, "Action.md": 1, "Parameters": 4, "status": 1, "string": 4, "priority": 1, "number": 4, "List": 1, "All": 1, "Tasks": 1, "GET": 3, "Response": 5, "application/json": 3, "{": 7, "false": 2, "}": 7, "true": 1, "Retrieve": 2, "Task": 2, "/task/": 2, "id": 6, "Delete": 1, "DELETE": 1, "how": 3, "describe": 1, "body": 2, "attributes": 2, "of": 4, "request": 1, "or": 3, "response": 1, "message.": 1, "In": 1, "this": 2, "case": 1, "the": 17, "description": 1, "complementary": 1, "and": 9, "duplicate": 1, "provided": 1, "JSON": 1, "section.": 1, "The": 1, "Attributes": 3, "Attributes.md": 3, "will": 3, "demonstrate": 1, "avoid": 1, "duplicates": 1, "reuse": 1, "descriptions.": 1, "Parameters.md": 1, "blueprint/master/examples/08.": 1, "Next": 2, "Coupon": 2, "/coupons/": 1, "coupon": 4, "contains": 1, "information": 1, "about": 1, "percent": 1, "off": 2, "amount": 1, "discount": 2, "you": 2, "might": 1, "want": 1, "apply": 1, "customer.": 1, "###": 1, "Retrieves": 1, "with": 3, "given": 1, "ID.": 1, "object": 1, "created": 1, "Time": 1, "stamp": 1, "percent_off": 1, "positive": 1, "integer": 1, "between": 1, "that": 3, "represents": 1, "apply.": 1, "redeem_by": 1, "Date": 1, "after": 1, "which": 1, "can": 2, "no": 1, "longer": 1, "be": 1, "redeemed": 1, "Body": 1, "null": 1, "one": 2, "simplest": 1, "APIs": 1, "written": 1, "**API": 1, "Blueprint**.": 1, "One": 1, "plain": 1, "combined": 1, "method": 1, "s": 1, "it": 2, "We": 1, "explain": 1, "what": 2, "going": 2, "on": 2, "next": 1, "installment": 1, "Actions": 2, "Actions.md": 2, ".": 2, "**Note": 1, "**": 1, "As": 1, "we": 1, "progress": 1, "through": 1, "examples": 1, "do": 1, "not": 1, "also": 1, "forget": 1, "view": 1, "blueprint/master/examples/01.": 2, "Simplest": 2, "API.md": 2, "code": 1, "see": 1, "really": 1, "as": 2, "opposed": 1, "just": 1, "seeing": 1, "output": 1, "Github": 1, "Markdown": 1, "parser.": 1, "Also": 1, "please": 1, "keep": 1, "mind": 1, "every": 1, "single": 1, "course": 1, "**real": 1, "Blueprint**": 1, "such": 1, "**parse**": 1, "parser": 1, "//github.com/apiaryio/drafter": 1, "its": 1, "bindings": 1, "//github.com/apiaryio/drafter#bindings": 1, "text/plain": 1, "Hello": 1, "World": 1 }, "APL": { "You": 1, "can": 2, "try": 1, "this": 2, "at": 1, "http": 2, "//tryapl.org/": 1, "I": 3, "not": 1, "explain": 1, "how": 1, "much": 1, "suddenly": 1, "love": 1, "crypto": 1, "-": 50, "language": 1, "Starts": 2, "Middles": 2, "Qualifiers": 2, "Finishes": 2, "rf": 2, "{": 21, "(": 21, ")": 21, "}": 21, "erf": 2, "deepak": 2, "SHEBANG#!apl": 1, "NEWLINE": 2, "UCS": 1, "HEADERS": 3, "TS": 5, "OFF": 1, "NameSpace": 1, "UT": 1, "sac": 1, "expect_orig": 1, "expect": 1, "NS": 2, "exception": 1, "nexpect_orig": 1, "nexpect": 1, "Z": 28, "Conf": 5, "run": 1, "Argument": 12, ";": 25, "PRE_test": 4, "POST_test": 4, "TEST_step": 6, "COVER_step": 4, "FromSpace": 9, "load_display_if_not_already_loaded": 2, "load_salt_scripts_into_current_namespace_if_configured": 2, "RSI": 1, "If": 10, "NC": 4, "has": 3, "PROFILE": 2, "EndIf": 10, "is_function": 1, "single_function_test_function": 2, "COVER_file": 4, "ElseIf": 3, "is_list_of_functions": 1, "list_of_functions_test_function": 2, "is_file": 1, "file_test_function": 2, "get_file_name": 2, "is_dir": 1, "test_files": 2, "test_files_in_dir": 1, "test_dir_function": 2, "generate_coverage_page": 1, "#.": 1, "CY": 1, "#.UT.appdir": 3, "SE.SALT.Load": 3, "TestName": 2, "run_ut": 3, "ListOfNames": 2, "t": 11, "print_passed_crashed_failed": 2, "FilePath": 3, "FileNS": 3, "Functions": 3, "TestFunctions": 4, "FileNS.": 1, "NL": 2, "is_test": 1, "/Functions": 1, "/": 5, "Else": 2, "Test_files": 3, "#.UT.run": 1, "separator": 2, "data": 1, "cover_target": 1, "clear": 1, ".": 5, "Coverage": 1, "%": 3, "": 1, "": 1, "equiv=": 1, "content=": 1, "": 1, "
": 1,
      "
": 1, "": 1, "": 2, "": 2, "": 1, "": 1, "Page": 1, "generated": 1, "|": 2, "cover_out": 1, "cover_file": 1, "UTF": 1, "_TEST": 2, ".dyalog": 1, "Linux": 2, "APLVersion": 2, "yes": 2, "test": 1, "d": 1, "&&": 1, "echo": 2, "||": 1, "no": 1, "gfa": 1, "kernel32": 1, "GetFileAttributes*": 1, "<": 1, "find": 1, "name": 1, "*_tests.dyalog": 2, "files": 1, "Passed": 2, "Crashed": 1, "Failed": 1, "Runtime": 1, "m": 2, "s": 2, "ms": 2, "CRASHED": 1, "FAILED": 1, "Expected": 1, "Got": 1, "gotterm": 6, "term_to_text": 1, "returned": 1, "align_and_join_message_parts": 2, "hdr": 5, "exp": 5, "expterm": 5, "got": 5, "Parts": 2, "R1": 3, "C1": 2, "R2": 3, "C2": 3, "W": 7, "/C1": 1, "[": 1, "]": 1, "confparam": 4, "in": 1, "config": 4, "/config": 1, "EndNameSpace": 1 }, "ASN.1": { "MyShopPurchaseOrders": 1, "DEFINITIONS": 1, "AUTOMATIC": 1, "TAGS": 1, "BEGIN": 1, "PurchaseOrder": 1, "SEQUENCE": 5, "{": 4, "dateOfOrder": 1, "DATE": 1, "customer": 1, "CustomerInfo": 2, "items": 1, "ListOfItems": 2, "}": 4, "companyName": 1, "VisibleString": 5, "(": 21, "SIZE": 7, ")": 21, "billingAddress": 1, "Address": 2, "contactPhone": 1, "NumericString": 2, "street": 1, "..": 3, "OPTIONAL": 1, "city": 1, "state": 1, "FROM": 1, "zipCode": 1, "|": 5, "OF": 1, "Item": 2, "itemCode": 1, "INTEGER": 4, "color": 1, "power": 1, "deliveryTime": 1, "quantity": 1, "unitPrice": 1, "REAL": 1, "isTaxable": 1, "BOOLEAN": 1, "END": 1 }, "ATS": { "//": 324, "staload": 29, "fun": 48, "{": 270, "}": 268, "channel_cap": 1, "(": 863, ")": 864, "intGte": 2, "abstype": 6, "session_msg": 2, "i": 129, "int": 55, "j": 66, "a": 63, "vt@ype": 2, "ssession_nil": 2, "ssession_cons": 3, "type": 64, "ssn": 53, "stadef": 7, "msg": 9, "nil": 6, "cons": 2, "session_append": 2, "ssn1": 13, "ssn2": 13, "append": 4, "session_choose": 2, "choose": 4, "session_repeat": 2, "repeat": 6, "typedef": 11, "session_sing": 1, "absvtype": 2, "channel1_vtype": 3, "G": 87, "iset": 23, "n": 120, "ptr": 3, "vtypedef": 5, "channel1": 39, "cchannel1": 3, "ncomp": 1, "channel1_get_nrole": 1, "chan": 4, "channel1_get_group": 1, "intset": 2, "vt0p": 8, "channel1_close": 1, "void": 24, "channel1_skipin": 1, "nat": 14, "|": 23, "ismbr": 20, ";": 22, "end": 87, "-": 50, "of": 50, "function": 2, "praxi": 2, "lemma_channel1_skipin": 2, "channel1_skipex": 1, "lemma_channel1_skipex": 2, "channel1_send": 2, "<": 29, "[": 46, "]": 46, "channel1_recv": 2, "&": 1, "channel1_recv_val": 1, "channel1_append": 2, "fserv": 2, "": 2, "datatype": 5, "choosetag": 3, "b": 18, "c": 6, "choosetag_l": 1, "choosetag_r": 1, "channel1_choose_l": 2, "channel1_choose_r": 2, "channel1_choose_tag": 1, "isnil": 2, "ssn_chosen": 6, "#": 4, "channel1_repeat_0": 1, "channel1_repeat_nil": 1, "channel1_repeat_1": 1, "channel1_repeat_more": 1, "channel1_repeat_tag": 1, "channel1_link": 1, "G1": 3, "G2": 3, "isful": 1, "+": 8, "G1*G2": 1, "channel1_link_elim": 1, "cchannel1_create_exn": 2, "nrole": 1, "#include": 12, "_": 7, "sortdef": 2, "ftype": 13, "infixr": 2, "": 3, "functor": 12, "F": 34, "list0": 9, "extern": 19, "val": 167, "functor_list0": 7, "implement": 101, "f": 22, "lam": 20, "xs": 4, "list0_map": 2, "": 3, "": 3, "CoYoneda": 7, "r": 31, "CoYoneda_phi": 2, "CoYoneda_psi": 3, "ftor": 9, "fx": 8, "x": 120, "int0": 4, "I": 7, "bool": 37, "True": 7, "False": 8, "boxed": 2, "boolean": 2, "bool2string": 4, "string": 3, "case": 2, "fprint_val": 2, "": 2, "out": 8, "fprint": 2, "int2bool": 2, "let": 37, "in": 44, "if": 30, "then": 28, "else": 25, "myintlist0": 2, "g0ofg1": 1, "list": 1, "myboolist0": 9, "fprintln": 3, "stdout_ref": 4, "main0": 3, "#ifdef": 2, "MYGRADING_HATS": 1, "#then": 1, "#else": 1, "csv_parse_line": 3, "line": 7, "List0_vt": 2, "Strptr1": 3, "#endif": 1, "local": 14, "UN": 4, "getpos": 3, "is_end": 3, "char_at": 4, "Strptr1_at": 4, "i0": 11, "rmove": 4, "rmove_while": 5, "test": 4, "char": 2, "c0": 3, "int2char0": 1, "g1ofg0": 1, "var": 2, "p_i": 4, "addr@i": 1, "n0": 5, "sz2i": 1, "length": 1, "macdef": 4, "get_i": 6, "UN.ptr0_get": 1, "": 3, "inc_i": 2, "UN.ptr0_addby": 1, "set_i": 1, "UN.ptr0_set": 1, "ckastloc_gintGte": 2, "char2u2int0": 1, "i1": 4, "ckastloc_gintBtwe": 1, "UN.castvwtp0": 1, "string_make_substring": 1, "i2sz": 5, "res_vt": 3, "loop": 3, "res": 3, "f0": 4, "lam@": 1, "": 1, "UN.cast": 20, "addr@f0": 1, "s0": 2, "list_vt_cons": 1, "list_vt_reverse": 1, "list_vt_nil": 1, "phil_left": 3, "phil_right": 3, "nmod": 1, "NPHIL": 6, "randsleep": 6, "ignoret": 2, "sleep": 2, "uInt": 1, "rand": 1, "mod": 1, "phil_think": 3, "println": 9, "phil_dine": 3, "lf": 5, "rf": 5, "phil_loop": 9, "nl": 2, "nr": 2, "ch_lfork": 2, "fork_changet": 5, "ch_rfork": 2, "channel_takeout": 3, "HX": 2, "try": 1, "to": 1, "actively": 1, "induce": 1, "deadlock": 1, "ch_forktray": 3, "forktray_changet": 4, "channel_insert": 4, "cleaner_wash": 3, "fork_get_num": 4, "cleaner_return": 3, "ch": 7, "cleaner_loop": 5, "dynload": 3, "mythread_create_cloptr": 6, "llam": 6, "while": 1, "true": 13, "%": 3, "#define": 2, "nphil": 12, "natLt": 1, "fork_vtype": 3, "fork": 11, "channel": 3, "datavtype": 1, "FORK": 3, "assume": 2, "the_forkarray": 2, "t": 1, "array_tabulate": 1, "fopr": 1, "": 2, "where": 26, "channel_create_exn": 2, "": 2, "arrayref_tabulate": 1, "the_forktray": 2, "GMP": 2, "mpz": 2, "GMP.mpz_vt0ype": 1, "i2u": 8, "g1int2uint_int_uint": 1, "intinf_vtype": 1, "is": 1, "fake": 1, "l": 4, "addr": 1, "@": 1, "mfree_gc_v": 1, "intinf_make_int": 1, "ptr_alloc": 15, "": 15, "GMP.mpz_init_set_int": 1, "x.2": 47, "intinf_make_uint": 1, "GMP.mpz_init_set_uint": 1, "intinf_make_lint": 1, "GMP.mpz_init_set_lint": 1, "intinf_make_ulint": 1, "GMP.mpz_init_set_ulint": 1, "intinf_free": 2, "pfat": 2, "pfgc": 2, "p": 3, "GMP.mpz_clear": 1, "ptr_free": 1, "intinf_get_int": 1, "GMP.mpz_get_int": 1, "intinf_get_lint": 1, "GMP.mpz_get_lint": 1, "intinf_get_strptr": 1, "base": 5, "GMP.mpz_get_str_null": 1, "fprint_intinf_base": 2, "nsz": 2, "GMP.mpz_out_str": 1, "exit_errmsg": 1, "neg_intinf0": 6, "GMP.mpz_neg": 2, "neg_intinf1": 1, "y": 80, "GMP.mpz_init": 11, "y.2": 22, "abs_intinf0": 1, "GMP.mpz_abs": 2, "abs_intinf1": 1, "succ_intinf0": 1, "add_intinf0_int": 3, "succ_intinf1": 1, "add_intinf1_int": 3, "pred_intinf0": 1, "sub_intinf0_int": 3, "pred_intinf1": 1, "sub_intinf1_int": 3, "GMP.mpz_add2_int": 1, "z": 21, "z.2": 17, "GMP.mpz_add3_int": 1, "add_int_intinf0": 1, "add_int_intinf1": 1, "add_intinf0_intinf1": 1, "GMP.mpz_add2_mpz": 2, "add_intinf1_intinf0": 1, "add_intinf1_intinf1": 1, "GMP.mpz_add3_mpz": 1, "GMP.mpz_sub2_int": 1, "GMP.mpz_sub3_int": 1, "sub_int_intinf0": 1, "sub_int_intinf1": 1, "sub_intinf0_intinf1": 2, "GMP.mpz_sub2_mpz": 1, "sub_intinf1_intinf0": 1, "sub_intinf1_intinf1": 1, "GMP.mpz_sub3_mpz": 1, "mul_intinf0_int": 2, "GMP.mpz_mul2_int": 1, "mul_intinf1_int": 2, "GMP.mpz_mul3_int": 1, "mul_int_intinf0": 1, "mul_int_intinf1": 1, "mul_intinf0_intinf1": 1, "GMP.mpz_mul2_mpz": 2, "mul_intinf1_intinf0": 1, "mul_intinf1_intinf1": 1, "GMP.mpz_mul3_mpz": 1, "div_intinf0_int": 2, "GMP.mpz_tdiv2_q_uint": 2, "div_intinf1_int": 2, "GMP.mpz_tdiv3_q_uint": 2, "div_intinf0_intinf1": 1, "GMP.mpz_tdiv2_q_mpz": 1, "div_intinf1_intinf1": 1, "GMP.mpz_tdiv3_q_mpz": 1, "ndiv_intinf0_int": 1, "ndiv_intinf1_int": 1, "nmod_intinf0_int": 1, "GMP.mpz_fdiv_uint": 2, "intBtw": 2, "nmod_intinf1_int": 1, "lt_intinf_int": 2, "sgn": 54, "GMP.mpz_cmp_int": 7, "ans": 12, "false": 12, "lt_intinf_intinf": 2, "GMP.mpz_cmp_mpz": 7, "lte_intinf_int": 2, "lte_intinf_intinf": 2, "<=>": 1, "gt_intinf_int": 2, "mpz_cmp_int": 1, "2": 1, "gt_intinf_intinf": 2, "gte_intinf_int": 2, "gte_intinf_intinf": 2, "eq_intinf_int": 2, "eq_intinf_intinf": 2, "neq_intinf_int": 2, "neq_intinf_intinf": 2, "compare_intinf_int": 2, "compare_int_intinf": 2, "compare_intinf_intinf": 2, "pow_intinf_int": 1, "exp": 2, "r.2": 2, "GMP.mpz_pow_uint": 1, "base.2": 1, "print_intinf": 1, "fprint_intinf": 3, "prerr_intinf": 1, "stderr_ref": 1, "option0": 3, "functor_option0": 2, "opt": 2, "option0_map": 1, "functor_homres": 2, "Yoneda_phi": 3, "Yoneda_psi": 3, "m": 4, "mf": 4, "natrans": 3, "Yoneda_phi_nat": 2, "Yoneda_psi_nat": 2, "*": 1, "list_t": 1, "g0ofg1_list": 1, "Yoneda_bool_list0": 3, "myboolist1": 2 }, "Agda": { "module": 3, "NatCat": 1, "where": 2, "open": 2, "import": 2, "Relation.Binary.PropositionalEquality": 1, "EasyCategory": 3, "(": 36, "obj": 4, "Set": 2, ")": 36, "_": 6, "{": 10, "x": 34, "y": 28, "z": 18, "}": 10, "id": 9, "single": 4, "-": 17, "inhabitant": 4, "r": 26, "s": 29, "assoc": 2, "w": 4, "t": 6, "Data.Nat": 1, "same": 5, ".0": 2, "n": 14, "refl": 6, ".": 5, "suc": 6, "m": 6, "cong": 1, "trans": 5, ".n": 1, "zero": 1, "Nat": 1 }, "Alloy": { "module": 3, "examples/systems/file_system": 1, "abstract": 2, "sig": 20, "Object": 10, "{": 53, "}": 59, "Name": 2, "File": 1, "extends": 10, "some": 3, "d": 3, "Dir": 8, "|": 19, "this": 14, "in": 18, "d.entries.contents": 1, "entries": 3, "set": 10, "DirEntry": 2, "parent": 3, "lone": 6, "this.": 4, "@contents.": 1, "@entries": 1, "all": 16, "e1": 2, "e2": 2, "e1.name": 1, "e2.name": 1, "@parent": 2, "Root": 5, "one": 8, "no": 6, "Cur": 1, "name": 1, "contents": 2, "pred": 16, "OneParent_buggyVersion": 2, "-": 20, "d.parent": 2, "OneParent_correctVersion": 2, "(": 10, "&&": 2, "contents.d": 1, ")": 7, "NoDirAliases": 3, "o": 1, "o.": 1, "check": 6, "for": 6, "expect": 6, "examples/systems/marksweepgc": 1, "Node": 10, "HeapState": 5, "left": 3, "right": 1, "marked": 1, "freeList": 1, "clearMarks": 1, "[": 82, "hs": 16, ".marked": 3, ".right": 4, "hs.right": 3, "fun": 1, "reachable": 1, "n": 5, "]": 80, "+": 12, "n.": 1, "hs.left": 2, "mark": 1, "from": 2, "hs.reachable": 1, "setFreeList": 1, ".freeList.*": 3, ".left": 5, "hs.marked": 1, "GC": 1, "root": 5, "assert": 3, "Soundness1": 2, "h": 9, "live": 3, "h.reachable": 1, "h.right": 1, "Soundness2": 2, ".reachable": 2, "h.GC": 1, ".freeList": 1, "Completeness": 1, "examples/systems/views": 1, "open": 2, "util/ordering": 1, "State": 16, "as": 2, "so": 1, "util/relation": 1, "rel": 1, "Ref": 16, "refs": 6, "obj": 1, "views": 1, "ViewType": 8, "dirty": 2, "Map": 2, "keys": 3, "map": 2, "s": 6, "Ref.map": 1, "s.refs": 3, "MapRef": 4, "fact": 4, "State.obj": 3, "Iterator": 2, "done": 3, "lastRef": 2, "IteratorRef": 5, "Set": 2, "elts": 2, "SetRef": 5, "KeySetView": 6, "State.views": 1, "IteratorView": 3, "s.views": 2, "t": 14, "handle": 1, "possibility": 1, "of": 1, "modifying": 1, "an": 1, "object": 1, "and": 1, "its": 1, "view": 1, "at": 1, "once": 1, "*": 1, "should": 1, "we": 1, "limit": 1, "frame": 1, "conds": 1, "to": 1, "non": 1, "*/": 1, "modifies": 5, "pre": 15, "post": 14, "rs": 4, "let": 5, "vr": 1, "pre.views": 8, "mods": 3, "rs.*vr": 1, "r": 3, "pre.refs": 6, "pre.obj": 10, "post.obj": 7, "b": 11, "v": 23, "viewFrame": 4, "post.dirty": 1, "pre.dirty": 1, "allocates": 5, "&": 1, "post.refs": 1, ".map": 3, ".elts": 3, "dom": 1, "<:>": 1, "setRefs": 1, "MapRef.put": 1, "k": 5, "none": 4, "post.views": 4, "SetRef.iterator": 1, "iterRef": 4, "i": 7, "i.left": 3, "i.done": 1, "i.lastRef": 1, "IteratorRef.remove": 1, ".lastRef": 2, "IteratorRef.next": 1, "ref": 3, "IteratorRef.hasNext": 1, "s.obj": 1, "zippishOK": 2, "ks": 3, "vs": 3, "m": 3, "ki": 2, "vi": 2, "s0": 4, "so/first": 1, "s1": 4, "so/next": 7, "s2": 6, "s3": 4, "s4": 4, "s5": 4, "s6": 4, "s7": 2, "precondition": 2, "s0.dirty": 1, "ks.iterator": 1, "vs.iterator": 1, "ki.hasNext": 1, "vi.hasNext": 1, "ki.this/next": 1, "vi.this/next": 1, "m.put": 1, "ki.remove": 1, "vi.remove": 1, "State.dirty": 1, "but": 1, "#s.obj": 1, "<": 1 }, "Alpine Abuild": { "pkgname": 1, "abuild": 2, "pkgver": 2, "_ver": 1, "{": 6, "%": 1, "_git*": 1, "}": 6, "pkgrel": 1, "pkgdesc": 3, "url": 1, "arch": 3, "license": 1, "depends": 4, "if": 1, "[": 1, "]": 1, ";": 4, "then": 1, "fi": 1, "makedepends_build": 1, "makedepends_host": 1, "makedepends": 1, "install": 4, "subpackages": 1, "options": 1, "pkggroups": 1, "source": 2, "_builddir": 1, "prepare": 1, "(": 5, ")": 6, "cd": 3, "for": 1, "i": 5, "in": 2, "do": 1, "case": 1, "*.patch": 1, "msg": 1, "patch": 1, "-": 13, "p1": 1, "/": 1, "||": 5, "return": 5, "esac": 1, "done": 1, "sed": 1, "e": 1, "abuild.conf": 2, "build": 1, "make": 2, "package": 1, "DESTDIR": 1, "m": 2, "/etc/abuild.conf": 1, "d": 1, "g": 1, "/var/cache/distfiles": 1, "cpan": 2, "mkdir": 2, "p": 2, "/usr/bin": 2, "mv": 2, "/usr/bin/apkbuild": 2, "/usr/bin/": 2, "gems": 1, "gem": 1, "resolver": 1, "md5sums": 1, "sha256sums": 1, "sha512sums": 1 }, "Ant Build System": { "": 2, "version=": 2, "encoding=": 2, "": 2, "name=": 64, "": 2, "": 32, "file=": 38, "": 2, "property=": 4, "": 2, "": 34, "location=": 32, "": 30, "depends=": 30, "description=": 16, "": 2, "": 2, "": 2 }, "ApacheConf": { "#######################": 1, "######################": 1, "": 1, "127": 1, "0": 2, "1": 1, "PORT": 1, "ServerAdmin": 3, "patrick@heysparkbox.com": 1, "DocumentRoot": 3, "ServerName": 1, "HOSTNAME": 2, "": 7, "var": 3, "www": 1, "Options": 7, "Indexes": 3, "MultiViews": 2, "FollowSymLinks": 5, "AllowOverride": 7, "All": 5, "Order": 11, "allow": 11, "deny": 11, "Allow": 5, "from": 11, "all": 11, "DirectoryIndex": 3, "index.php": 2, "": 7, "": 1, "ServerSignature": 1, "Off": 1, "RewriteCond": 15, "%": 48, "{": 16, "REQUEST_METHOD": 1, "}": 16, "(": 16, "HEAD": 1, "|": 80, "TRACE": 1, "DELETE": 1, "TRACK": 1, ")": 17, "[": 17, "NC": 13, "OR": 14, "]": 17, "THE_REQUEST": 1, "r": 1, "n": 1, "A": 6, "D": 6, "HTTP_REFERER": 1, "<|>": 6, "C": 5, "E": 5, "HTTP_COOKIE": 1, "REQUEST_URI": 1, "/": 3, ";": 2, "<": 1, ".": 7, "HTTP_USER_AGENT": 5, "java": 1, "curl": 2, "wget": 2, "winhttp": 1, "HTTrack": 1, "clshttp": 1, "archiver": 1, "loader": 1, "email": 1, "harvest": 1, "extract": 1, "grab": 1, "miner": 1, "libwww": 1, "-": 43, "perl": 1, "python": 1, "nikto": 1, "scan": 1, "#Block": 1, "mySQL": 1, "injects": 1, "QUERY_STRING": 5, ".*": 3, "*": 1, "union": 1, "select": 1, "insert": 1, "cast": 1, "set": 1, "declare": 1, "drop": 1, "update": 1, "md5": 1, "benchmark": 1, "./": 1, "localhost": 1, "loopback": 1, ".0": 2, ".1": 1, "a": 1, "z0": 1, "RewriteRule": 1, "F": 1, "#": 182, "ServerRoot": 2, "#Listen": 2, "Listen": 2, "LoadModule": 126, "authn_file_module": 2, "/usr/lib/apache2/modules/mod_authn_file.so": 1, "authn_dbm_module": 2, "/usr/lib/apache2/modules/mod_authn_dbm.so": 1, "authn_anon_module": 2, "/usr/lib/apache2/modules/mod_authn_anon.so": 1, "authn_dbd_module": 2, "/usr/lib/apache2/modules/mod_authn_dbd.so": 1, "authn_default_module": 2, "/usr/lib/apache2/modules/mod_authn_default.so": 1, "authn_alias_module": 1, "/usr/lib/apache2/modules/mod_authn_alias.so": 1, "authz_host_module": 2, "/usr/lib/apache2/modules/mod_authz_host.so": 1, "authz_groupfile_module": 2, "/usr/lib/apache2/modules/mod_authz_groupfile.so": 1, "authz_user_module": 2, "/usr/lib/apache2/modules/mod_authz_user.so": 1, "authz_dbm_module": 2, "/usr/lib/apache2/modules/mod_authz_dbm.so": 1, "authz_owner_module": 2, "/usr/lib/apache2/modules/mod_authz_owner.so": 1, "authnz_ldap_module": 1, "/usr/lib/apache2/modules/mod_authnz_ldap.so": 1, "authz_default_module": 2, "/usr/lib/apache2/modules/mod_authz_default.so": 1, "auth_basic_module": 2, "/usr/lib/apache2/modules/mod_auth_basic.so": 1, "auth_digest_module": 2, "/usr/lib/apache2/modules/mod_auth_digest.so": 1, "file_cache_module": 1, "/usr/lib/apache2/modules/mod_file_cache.so": 1, "cache_module": 2, "/usr/lib/apache2/modules/mod_cache.so": 1, "disk_cache_module": 2, "/usr/lib/apache2/modules/mod_disk_cache.so": 1, "mem_cache_module": 2, "/usr/lib/apache2/modules/mod_mem_cache.so": 1, "dbd_module": 2, "/usr/lib/apache2/modules/mod_dbd.so": 1, "dumpio_module": 2, "/usr/lib/apache2/modules/mod_dumpio.so": 1, "ext_filter_module": 2, "/usr/lib/apache2/modules/mod_ext_filter.so": 1, "include_module": 2, "/usr/lib/apache2/modules/mod_include.so": 1, "filter_module": 2, "/usr/lib/apache2/modules/mod_filter.so": 1, "charset_lite_module": 1, "/usr/lib/apache2/modules/mod_charset_lite.so": 1, "deflate_module": 2, "/usr/lib/apache2/modules/mod_deflate.so": 1, "ldap_module": 1, "/usr/lib/apache2/modules/mod_ldap.so": 1, "log_forensic_module": 2, "/usr/lib/apache2/modules/mod_log_forensic.so": 1, "env_module": 2, "/usr/lib/apache2/modules/mod_env.so": 1, "mime_magic_module": 2, "/usr/lib/apache2/modules/mod_mime_magic.so": 1, "cern_meta_module": 2, "/usr/lib/apache2/modules/mod_cern_meta.so": 1, "expires_module": 2, "/usr/lib/apache2/modules/mod_expires.so": 1, "headers_module": 2, "/usr/lib/apache2/modules/mod_headers.so": 1, "ident_module": 2, "/usr/lib/apache2/modules/mod_ident.so": 1, "usertrack_module": 2, "/usr/lib/apache2/modules/mod_usertrack.so": 1, "unique_id_module": 2, "/usr/lib/apache2/modules/mod_unique_id.so": 1, "setenvif_module": 2, "/usr/lib/apache2/modules/mod_setenvif.so": 1, "version_module": 2, "/usr/lib/apache2/modules/mod_version.so": 1, "proxy_module": 2, "/usr/lib/apache2/modules/mod_proxy.so": 1, "proxy_connect_module": 2, "/usr/lib/apache2/modules/mod_proxy_connect.so": 1, "proxy_ftp_module": 2, "/usr/lib/apache2/modules/mod_proxy_ftp.so": 1, "proxy_http_module": 2, "/usr/lib/apache2/modules/mod_proxy_http.so": 1, "proxy_ajp_module": 2, "/usr/lib/apache2/modules/mod_proxy_ajp.so": 1, "proxy_balancer_module": 2, "/usr/lib/apache2/modules/mod_proxy_balancer.so": 1, "ssl_module": 4, "/usr/lib/apache2/modules/mod_ssl.so": 1, "mime_module": 4, "/usr/lib/apache2/modules/mod_mime.so": 1, "dav_module": 2, "/usr/lib/apache2/modules/mod_dav.so": 1, "status_module": 2, "/usr/lib/apache2/modules/mod_status.so": 1, "autoindex_module": 2, "/usr/lib/apache2/modules/mod_autoindex.so": 1, "asis_module": 2, "/usr/lib/apache2/modules/mod_asis.so": 1, "info_module": 2, "/usr/lib/apache2/modules/mod_info.so": 1, "suexec_module": 1, "/usr/lib/apache2/modules/mod_suexec.so": 1, "cgid_module": 3, "/usr/lib/apache2/modules/mod_cgid.so": 1, "cgi_module": 2, "/usr/lib/apache2/modules/mod_cgi.so": 1, "dav_fs_module": 2, "/usr/lib/apache2/modules/mod_dav_fs.so": 1, "dav_lock_module": 1, "/usr/lib/apache2/modules/mod_dav_lock.so": 1, "vhost_alias_module": 2, "/usr/lib/apache2/modules/mod_vhost_alias.so": 1, "negotiation_module": 2, "/usr/lib/apache2/modules/mod_negotiation.so": 1, "dir_module": 4, "/usr/lib/apache2/modules/mod_dir.so": 1, "imagemap_module": 2, "/usr/lib/apache2/modules/mod_imagemap.so": 1, "actions_module": 2, "/usr/lib/apache2/modules/mod_actions.so": 1, "speling_module": 2, "/usr/lib/apache2/modules/mod_speling.so": 1, "userdir_module": 2, "/usr/lib/apache2/modules/mod_userdir.so": 1, "alias_module": 4, "/usr/lib/apache2/modules/mod_alias.so": 1, "rewrite_module": 2, "/usr/lib/apache2/modules/mod_rewrite.so": 1, "": 17, "mpm_netware_module": 2, "User": 2, "daemon": 2, "Group": 2, "": 17, "you@example.com": 2, "#ServerName": 2, "www.example.com": 2, "None": 8, "Deny": 6, "usr": 2, "share": 1, "apache2": 1, "default": 1, "site": 1, "htdocs": 1, "index.html": 2, "": 2, "ht": 1, "Satisfy": 4, "": 2, "ErrorLog": 2, "/var/log/apache2/error_log": 1, "LogLevel": 2, "warn": 2, "log_config_module": 3, "LogFormat": 6, "combined": 4, "common": 4, "logio_module": 3, "combinedio": 2, "CustomLog": 2, "/var/log/apache2/access_log": 2, "#CustomLog": 2, "ScriptAlias": 1, "/cgi": 2, "bin/": 2, "#Scriptsock": 2, "/var/run/apache2/cgisock": 1, "lib": 1, "cgi": 3, "bin": 1, "DefaultType": 2, "text/plain": 2, "TypesConfig": 2, "/etc/apache2/mime.types": 1, "#AddType": 4, "application/x": 6, "gzip": 6, ".tgz": 6, "#AddEncoding": 4, "x": 4, "compress": 4, ".Z": 4, ".gz": 4, "AddType": 4, "#AddHandler": 4, "script": 2, ".cgi": 2, "type": 2, "map": 2, "text/html": 2, ".shtml": 4, "#AddOutputFilter": 2, "INCLUDES": 2, "#MIMEMagicFile": 2, "/etc/apache2/magic": 1, "#ErrorDocument": 8, "/missing.html": 2, "http": 2, "//www.example.com/subscription_info.html": 2, "#EnableMMAP": 2, "off": 5, "#EnableSendfile": 2, "#Include": 17, "/etc/apache2/extra/httpd": 11, "mpm.conf": 2, "multilang": 2, "errordoc.conf": 2, "autoindex.conf": 2, "languages.conf": 2, "userdir.conf": 2, "info.conf": 2, "vhosts.conf": 2, "manual.conf": 2, "dav.conf": 2, "default.conf": 2, "ssl.conf": 2, "SSLRandomSeed": 4, "startup": 2, "builtin": 4, "connect": 2, "libexec/apache2/mod_authn_file.so": 1, "libexec/apache2/mod_authn_dbm.so": 1, "libexec/apache2/mod_authn_anon.so": 1, "libexec/apache2/mod_authn_dbd.so": 1, "libexec/apache2/mod_authn_default.so": 1, "libexec/apache2/mod_authz_host.so": 1, "libexec/apache2/mod_authz_groupfile.so": 1, "libexec/apache2/mod_authz_user.so": 1, "libexec/apache2/mod_authz_dbm.so": 1, "libexec/apache2/mod_authz_owner.so": 1, "libexec/apache2/mod_authz_default.so": 1, "libexec/apache2/mod_auth_basic.so": 1, "libexec/apache2/mod_auth_digest.so": 1, "libexec/apache2/mod_cache.so": 1, "libexec/apache2/mod_disk_cache.so": 1, "libexec/apache2/mod_mem_cache.so": 1, "libexec/apache2/mod_dbd.so": 1, "libexec/apache2/mod_dumpio.so": 1, "reqtimeout_module": 1, "libexec/apache2/mod_reqtimeout.so": 1, "libexec/apache2/mod_ext_filter.so": 1, "libexec/apache2/mod_include.so": 1, "libexec/apache2/mod_filter.so": 1, "substitute_module": 1, "libexec/apache2/mod_substitute.so": 1, "libexec/apache2/mod_deflate.so": 1, "libexec/apache2/mod_log_config.so": 1, "libexec/apache2/mod_log_forensic.so": 1, "libexec/apache2/mod_logio.so": 1, "libexec/apache2/mod_env.so": 1, "libexec/apache2/mod_mime_magic.so": 1, "libexec/apache2/mod_cern_meta.so": 1, "libexec/apache2/mod_expires.so": 1, "libexec/apache2/mod_headers.so": 1, "libexec/apache2/mod_ident.so": 1, "libexec/apache2/mod_usertrack.so": 1, "#LoadModule": 4, "libexec/apache2/mod_unique_id.so": 1, "libexec/apache2/mod_setenvif.so": 1, "libexec/apache2/mod_version.so": 1, "libexec/apache2/mod_proxy.so": 1, "libexec/apache2/mod_proxy_connect.so": 1, "libexec/apache2/mod_proxy_ftp.so": 1, "libexec/apache2/mod_proxy_http.so": 1, "proxy_scgi_module": 1, "libexec/apache2/mod_proxy_scgi.so": 1, "libexec/apache2/mod_proxy_ajp.so": 1, "libexec/apache2/mod_proxy_balancer.so": 1, "libexec/apache2/mod_ssl.so": 1, "libexec/apache2/mod_mime.so": 1, "libexec/apache2/mod_dav.so": 1, "libexec/apache2/mod_status.so": 1, "libexec/apache2/mod_autoindex.so": 1, "libexec/apache2/mod_asis.so": 1, "libexec/apache2/mod_info.so": 1, "libexec/apache2/mod_cgi.so": 1, "libexec/apache2/mod_dav_fs.so": 1, "libexec/apache2/mod_vhost_alias.so": 1, "libexec/apache2/mod_negotiation.so": 1, "libexec/apache2/mod_dir.so": 1, "libexec/apache2/mod_imagemap.so": 1, "libexec/apache2/mod_actions.so": 1, "libexec/apache2/mod_speling.so": 1, "libexec/apache2/mod_userdir.so": 1, "libexec/apache2/mod_alias.so": 1, "libexec/apache2/mod_rewrite.so": 1, "perl_module": 1, "libexec/apache2/mod_perl.so": 1, "php5_module": 1, "libexec/apache2/libphp5.so": 1, "hfs_apple_module": 1, "libexec/apache2/mod_hfs_apple.so": 1, "mpm_winnt_module": 1, "_www": 2, "Library": 2, "WebServer": 2, "Documents": 1, "Hh": 1, "Tt": 1, "Dd": 1, "Ss": 2, "_": 1, "": 1, "rsrc": 1, "": 1, "": 1, "namedfork": 1, "": 1, "ScriptAliasMatch": 1, "i": 1, "webobjects": 1, "/private/var/run/cgisock": 1, "CGI": 1, "Executables": 1, "/private/etc/apache2/mime.types": 1, "/private/etc/apache2/magic": 1, "#MaxRanges": 1, "unlimited": 1, "TraceEnable": 1, "Include": 6, "/private/etc/apache2/extra/httpd": 11, "/private/etc/apache2/other/*.conf": 1 }, "Apex": { "global": 70, "class": 7, "ArrayUtils": 1, "{": 219, "static": 83, "String": 60, "[": 102, "]": 102, "EMPTY_STRING_ARRAY": 1, "new": 60, "}": 219, ";": 308, "Integer": 34, "MAX_NUMBER_OF_ELEMENTS_IN_LIST": 5, "get": 4, "return": 106, "List": 71, "": 30, "objectToString": 1, "(": 481, "": 22, "objects": 3, ")": 481, "strings": 3, "null": 92, "if": 91, "objects.size": 1, "for": 24, "Object": 23, "obj": 3, "instanceof": 1, "strings.add": 1, "reverse": 2, "anArray": 14, "i": 55, "j": 10, "anArray.size": 2, "-": 18, "tmp": 6, "while": 8, "+": 75, "SObject": 19, "lowerCase": 1, "strs": 9, "returnValue": 22, "strs.size": 3, "str": 10, "returnValue.add": 3, "str.toLowerCase": 1, "upperCase": 1, "str.toUpperCase": 1, "trim": 1, "str.trim": 3, "mergex": 2, "array1": 8, "array2": 9, "merged": 6, "array1.size": 4, "array2.size": 2, "<": 32, "": 19, "sObj": 4, "merged.add": 2, "Boolean": 38, "isEmpty": 7, "objectArray": 17, "true": 12, "objectArray.size": 6, "isNotEmpty": 4, "pluck": 1, "fieldName": 3, "||": 12, "fieldName.trim": 2, ".length": 2, "plucked": 3, ".get": 4, "toString": 3, "void": 9, "assertArraysAreEqual": 2, "expected": 16, "actual": 16, "//check": 2, "to": 4, "see": 2, "one": 2, "param": 2, "is": 5, "but": 2, "the": 4, "other": 2, "not": 3, "System.assert": 6, "&&": 46, "ArrayUtils.toString": 12, "expected.size": 4, "actual.size": 2, "merg": 2, "list1": 15, "list2": 9, "returnList": 11, "list1.size": 6, "list2.size": 2, "throw": 6, "IllegalArgumentException": 5, "elmt": 8, "returnList.add": 8, "subset": 6, "aList": 4, "count": 10, "startIndex": 9, "<=>": 2, "size": 2, "1": 2, "list1.get": 2, "//": 11, "//LIST/ARRAY": 1, "SORTING": 1, "//FOR": 2, "FORCE.COM": 1, "PRIMITIVES": 1, "Double": 1, "ID": 1, "etc.": 1, "qsort": 18, "theList": 72, "PrimitiveComparator": 2, "sortAsc": 24, "ObjectComparator": 3, "comparator": 14, "theList.size": 2, "SALESFORCE": 1, "OBJECTS": 1, "sObjects": 1, "ISObjectComparator": 3, "private": 10, "lo0": 6, "hi0": 8, "lo": 42, "hi": 50, "else": 25, "comparator.compare": 12, "prs": 8, "pivot": 14, "/": 4, "BooleanUtils": 1, "isFalse": 1, "bool": 32, "false": 13, "isNotFalse": 1, "isNotTrue": 1, "isTrue": 1, "negate": 1, "toBooleanDefaultIfNull": 1, "defaultVal": 2, "toBoolean": 2, "value": 10, "strToBoolean": 1, "StringUtils.equalsIgnoreCase": 1, "//Converts": 1, "an": 4, "int": 1, "a": 6, "boolean": 1, "specifying": 1, "//the": 2, "conversion": 1, "values.": 1, "//Returns": 1, "//Throws": 1, "trueValue": 2, "falseValue": 2, "toInteger": 1, "toStringYesNo": 1, "toStringYN": 1, "trueString": 2, "falseString": 2, "xor": 1, "boolArray": 4, "boolArray.size": 1, "firstItem": 2, "EmailUtils": 1, "sendEmailWithStandardAttachments": 3, "recipients": 11, "emailSubject": 10, "body": 8, "useHTML": 6, "": 1, "attachmentIDs": 2, "": 2, "stdAttachments": 4, "SELECT": 1, "id": 1, "name": 2, "FROM": 1, "Attachment": 2, "WHERE": 1, "Id": 1, "IN": 1, "": 3, "fileAttachments": 5, "attachment": 1, "Messaging.EmailFileAttachment": 2, "fileAttachment": 2, "fileAttachment.setFileName": 1, "attachment.Name": 1, "fileAttachment.setBody": 1, "attachment.Body": 1, "fileAttachments.add": 1, "sendEmail": 4, "sendTextEmail": 1, "textBody": 2, "sendHTMLEmail": 1, "htmlBody": 2, "recipients.size": 1, "Messaging.SingleEmailMessage": 3, "mail": 2, "email": 1, "saved": 1, "as": 1, "activity.": 1, "mail.setSaveAsActivity": 1, "mail.setToAddresses": 1, "mail.setSubject": 1, "mail.setBccSender": 1, "mail.setUseSignature": 1, "mail.setHtmlBody": 1, "mail.setPlainTextBody": 1, "fileAttachments.size": 1, "mail.setFileAttachments": 1, "Messaging.sendEmail": 1, "isValidEmailAddress": 2, "split": 5, "str.split": 1, "split.size": 2, ".split": 1, "isNotValidEmailAddress": 1, "public": 10, "GeoUtils": 1, "generate": 1, "KML": 1, "string": 7, "given": 2, "page": 1, "reference": 1, "call": 1, "getContent": 1, "then": 1, "cleanup": 1, "output.": 1, "generateFromContent": 1, "PageReference": 2, "pr": 1, "ret": 7, "try": 1, "pr.getContent": 1, ".toString": 1, "ret.replaceAll": 4, "content": 1, "produces": 1, "quote": 1, "chars": 1, "we": 1, "need": 1, "escape": 1, "these": 2, "in": 1, "node": 1, "catch": 1, "exception": 1, "e": 2, "system.debug": 2, "must": 1, "use": 1, "ALL": 1, "since": 1, "many": 1, "line": 1, "may": 1, "also": 1, "Map": 33, "": 2, "geo_response": 1, "accountAddressString": 2, "account": 2, "acct": 1, "form": 1, "address": 1, "object": 1, "adr": 9, "acct.billingstreet": 1, "acct.billingcity": 1, "acct.billingstate": 1, "acct.billingpostalcode": 2, "acct.billingcountry": 2, "adr.replaceAll": 4, "testmethod": 1, "t1": 1, "pageRef": 3, "Page.kmlPreviewTemplate": 1, "Test.setCurrentPage": 1, "system.assert": 1, "GeoUtils.generateFromContent": 1, "Account": 2, "billingstreet": 1, "billingcity": 1, "billingstate": 1, "billingpostalcode": 1, "billingcountry": 1, "insert": 1, "system.assertEquals": 1, "LanguageUtils": 1, "final": 6, "HTTP_LANGUAGE_CODE_PARAMETER_KEY": 2, "DEFAULT_LANGUAGE_CODE": 3, "Set": 6, "SUPPORTED_LANGUAGE_CODES": 2, "//Chinese": 2, "Simplified": 1, "Traditional": 1, "//Dutch": 1, "//English": 1, "//Finnish": 1, "//French": 1, "//German": 1, "//Italian": 1, "//Japanese": 1, "//Korean": 1, "//Polish": 1, "//Portuguese": 1, "Brazilian": 1, "//Russian": 1, "//Spanish": 1, "//Swedish": 1, "//Thai": 1, "//Czech": 1, "//Danish": 1, "//Hungarian": 1, "//Indonesian": 1, "//Turkish": 1, "": 29, "DEFAULTS": 1, "getLangCodeByHttpParam": 4, "LANGUAGE_CODE_SET": 1, "getSuppLangCodeSet": 2, "ApexPages.currentPage": 4, ".getParameters": 2, "LANGUAGE_HTTP_PARAMETER": 7, "StringUtils.lowerCase": 3, "StringUtils.replaceChars": 2, "//underscore": 1, "//dash": 1, "DEFAULTS.containsKey": 3, "DEFAULTS.get": 3, "StringUtils.isNotBlank": 1, "SUPPORTED_LANGUAGE_CODES.contains": 2, "getLangCodeByBrowser": 4, "LANGUAGES_FROM_BROWSER_AS_STRING": 2, ".getHeaders": 1, "LANGUAGES_FROM_BROWSER_AS_LIST": 3, "splitAndFilterAcceptLanguageHeader": 2, "LANGUAGES_FROM_BROWSER_AS_LIST.size": 1, "languageFromBrowser": 6, "getLangCodeByUser": 3, "UserInfo.getLanguage": 1, "getLangCodeByHttpParamOrIfNullThenBrowser": 1, "StringUtils.defaultString": 4, "getLangCodeByHttpParamOrIfNullThenUser": 1, "getLangCodeByBrowserOrIfNullThenHttpParam": 1, "getLangCodeByBrowserOrIfNullThenUser": 1, "header": 2, "tokens": 3, "StringUtils.split": 1, "token": 7, "token.contains": 1, "token.substring": 1, "token.indexOf": 1, "StringUtils.length": 1, "StringUtils.substring": 1, "langCodes": 2, "langCode": 3, "langCodes.add": 1, "getLanguageName": 1, "displayLanguageCode": 13, "languageCode": 2, "translatedLanguageNames.get": 2, "filterLanguageCode": 4, "getAllLanguages": 3, "translatedLanguageNames.containsKey": 1, "translatedLanguageNames": 1, "TwilioAPI": 2, "MissingTwilioConfigCustomSettingsException": 2, "extends": 1, "Exception": 1, "TwilioRestClient": 5, "client": 2, "getDefaultClient": 2, "TwilioConfig__c": 5, "twilioCfg": 7, "getTwilioConfig": 3, "TwilioAPI.client": 2, "twilioCfg.AccountSid__c": 3, "twilioCfg.AuthToken__c": 3, "TwilioAccount": 1, "getDefaultAccount": 1, ".getAccount": 2, "TwilioCapability": 2, "createCapability": 1, "createClient": 1, "accountSid": 2, "authToken": 2, "Test.isRunningTest": 1, "dummy": 2, "sid": 1, "TwilioConfig__c.getOrgDefaults": 1, "@isTest": 1, "test_TwilioAPI": 1, "System.assertEquals": 5, "TwilioAPI.getTwilioConfig": 2, ".AccountSid__c": 1, ".AuthToken__c": 1, "TwilioAPI.getDefaultClient": 2, ".getAccountSid": 1, ".getSid": 2, "TwilioAPI.getDefaultAccount": 1 }, "Apollo Guidance Computer": { "#": 253, "It": 2, "is": 1, "part": 1, "of": 9, "the": 16, "source": 1, "code": 1, "for": 1, "Lunar": 1, "Module": 1, "s": 2, "notes": 1, "on": 1, "naming": 2, "this": 2, "function": 1, "which": 1, "he": 1, "got": 1, "from": 2, "Don": 2, "Eyles.": 1, "Assemble": 1, "revision": 1, "AGC": 2, "program": 1, "LMY99": 1, "by": 2, "NASA": 1, "-": 79, "JULY": 1, "##": 11, "At": 1, "get": 1, "together": 1, "developers": 1, "celebrating": 1, "th": 1, "anniversary": 1, "first": 1, "moonwalk": 1, "Eyles": 1, "(": 83, "one": 1, "authors": 1, "routine": 1, "along": 1, "with": 1, "Peter": 1, "Adler": 1, ")": 83, "has": 1, "related": 1, "to": 3, "us": 1, "a": 1, "little": 1, "interesting": 1, "history": 1, "behind": 1, "routine.": 1, "
": 2, "traces": 1, "back": 1, "and": 4, "Los": 2, "Angeles": 2, "riots": 1, "was": 2, "inspired": 1, "disc": 1, "jockey": 1, "extraordinaire": 1, "radio": 1, "station": 1, "owner": 1, "Magnificent": 3, "Montague.": 1, "Montague": 2, "used": 1, "phrase": 1, "when": 1, "spinning": 1, "hottest": 1, "new": 1, "records.": 1, "charismatic": 1, "voice": 1, "soul": 1, "music": 1, "in": 1, "Chicago": 1, "New": 1, "York": 1, "mid": 2, "s.": 1, "BANK": 7, "SETLOC": 3, "P40S": 2, "EBANK": 16, "WHICH": 13, "COUNT*": 3, "/P40": 3, "***********************************************": 2, "TABLES": 1, "FOR": 28, "THE": 21, "IGNITION": 6, "ROUTINE": 4, "NOLI": 1, "SE": 1, "TANGERE": 1, "P12TABLE": 1, "VN": 6, "TCF": 91, "ULLGNOT": 6, "COMFAIL3": 3, "GOCUTOFF": 3, "TASKOVER": 11, "P12SPOT": 2, "DEC": 11, "NO": 2, "ULLAGE": 7, "CADR": 34, "SERVEXIT": 2, "DISPCHNG": 3, "WAITABIT": 5, "P12IGN": 1, "P40TABLE": 2, "COMFAIL4": 2, "GOPOST": 3, "P40SPOT": 4, "OMEGAQ": 3, "STEERING": 2, "P40SJUNK": 2, "P40IGN": 1, "REP40ALM": 3, "P41TABLE": 2, "P41SPOT": 3, "CALCN85": 1, "COMMON": 1, "TIGTASK": 1, "P42TABLE": 2, "WANTAPS": 1, "P42SPOT": 2, "P42IGN": 1, "P42STAGE": 1, "P63TABLE": 2, "V99RECYC": 2, "P63SPOT": 2, "P63IGN": 1, "ABRTABLE": 1, "NOOP": 5, "ABRTIGN": 1, "*********************************": 2, "GENERAL": 1, "PURPOSE": 1, "ROUTINES": 1, "BURNBABY": 1, "TC": 60, "PHASCHNG": 6, "GROUP": 3, "RESTARTS": 3, "HERE": 1, "OCT": 13, "CAF": 25, "ZERO": 4, "EXTIRPATE": 1, "JUNK": 1, "LEFT": 1, "IN": 15, "DVTOTAL": 3, "TS": 23, "+": 10, "BANKCALL": 12, "P40AUTO": 3, "MUST": 6, "BE": 6, "BANKCALLED": 2, "EVEN": 2, "FROM": 2, "ITS": 2, "OWN": 2, "TO": 19, "SET": 11, "UP": 9, "RETURN": 8, "PROPERLY": 1, "B*RNB*B*": 1, "EXTEND": 24, "DCA": 9, "TIG": 32, "STORE": 3, "NOMINAL": 1, "OBLATENESS": 1, "COMP.": 1, "DXCH": 13, "GOBLTIME": 1, "AND": 5, "P70": 1, "OR": 4, "P71.": 1, "INHINT": 10, "IBNKCALL": 4, "ENGINOF3": 1, "RELINT": 2, "INDEX": 12, "P63": 5, "CLOKTASK": 11, "ALREADY": 1, "GOING": 2, "CS": 18, "CNTDNDEX": 5, "GENERALIZED": 2, "STCLOK2": 2, "INTPRET": 2, "DLOAD": 1, "DSU": 1, "D29.9SEC": 3, "STCALL": 2, "TDEC1": 3, "INITCDUW": 1, "BOFF": 1, "CALL": 1, "MUNFLAG": 1, "GOMIDAV": 2, "CSMPREC": 1, "VLOAD": 2, "MXV": 2, "VATT1": 1, "REFSMMAT": 2, "VSR1": 1, "STOVL": 1, "V": 1, "CSM": 6, "VELOCITY": 1, "M/CS*2": 2, "RATT1": 1, "VSL4": 1, "R": 1, "POSITION": 1, "M*2": 1, "MUNGRAV": 1, "STODL": 1, "G": 3, "GRAVITY": 1, "VEC.": 1, "TAT": 1, "RELOAD": 1, "MIDTOAV.": 1, "CALRB": 1, "MIDTOAV1": 1, "CALLT": 2, "MADE": 1, "IT": 5, "TIME.": 3, "WAS": 1, "SLIPPED": 1, "SO": 3, "RESET": 2, "PIPTIME1": 1, "SECONDS": 6, "AFTER": 1, "TIME": 3, "WE": 5, "DID": 1, "INTEGRATE.": 1, "DAS": 4, "MPAC": 4, "SAVET": 3, "DELTA": 2, "T": 3, "UNTIL": 2, "DCS": 3, "SECDP": 1, "LONGCALL": 1, "TTOGO": 7, "SPOT": 4, "RESTART.": 2, "CHECKMM": 1, "ENDOFJOB": 13, "NOT": 5, "CAN": 2, "START": 3, "DISPLAYING": 2, "NOW.": 1, "DISPDEX": 16, "ABVAL": 1, "VN1": 1, "ABVEL": 2, "INITIALIZE": 1, "DISPLAY": 7, "EXIT": 1, "********************************": 4, "SEC": 4, "TWIDDLE": 6, "ADRES": 14, "RESTART": 6, "BLANKDEX": 2, "BLANK": 4, "DSKY": 3, "CHECK": 4, "BZMF": 2, "TASK": 9, "RESTORE": 4, "AT": 9, "PRIO17": 3, "A": 21, "NEGATIVE": 5, "INDICATES": 3, "P41": 1, "NOVAC": 3, "CASE": 1, "HAVE": 2, "JOB": 3, "FIVE": 1, "SINCE": 3, "P41BLANK": 2, "CLOKJOB": 5, "IS": 15, "RUNNING": 2, "DURING": 1, "P41.": 1, "DSKY.": 2, "CLEANDSP": 2, "V16N85B": 1, "DISPLAY.": 2, "REGODSP": 4, "DOES": 2, "S24.9SEC": 2, "AGAIN": 2, "PICK": 1, "APPROPRIATE": 3, "ON": 7, "CA": 11, "Was": 3, "RSB": 3, "DON": 3, "DAP": 3, "WILL": 1, "INITIALIZED": 1, "ADS": 2, "FLGWRD10": 2, "ASCENT": 1, "VALUES": 1, "BY": 5, "/ACCS": 1, "SECONDS.": 1, "LOAD": 1, "AVEGEXIT": 2, "WITH": 3, "TWO": 4, "IMMEDIATELY": 1, "REDO4.2": 2, "L": 9, "ALSO": 1, "CORRECT": 1, "PHASE4": 2, "TIME1": 2, "TBASE4": 4, "REDO2.17": 1, "NEG0": 2, "CLEAR": 1, "OUT": 1, "LAMBERT": 1, "PHASE2": 1, "IF": 4, "NEEDED.": 1, "CCS": 7, "PHASE5": 1, "SERVICER": 1, "YES": 3, "S": 3, "STILL": 1, "COME": 2, "ZOOM": 1, "COMMAND": 1, "ENGINE": 1, "OFF": 4, "ENGINOF4": 1, "UPFLAG": 3, "DRIFT": 1, "BIT": 1, "DAP.": 1, "DRIFTDFL": 1, "INVFLAG": 2, "USE": 1, "OTHER": 2, "RCS": 1, "SYSTEM": 1, "AORBTFLG": 1, "TURN": 5, "ULLAGFLG": 1, "BIT1": 2, "***********************************": 4, "SUBROUTINES": 1, "OF": 7, "Q": 6, "DEBIT": 1, "COM": 3, "RXOR": 1, "LCHAN": 1, "COMFLAG": 1, "NOULLAGE": 2, "ULLAGER": 2, "CALLED": 4, "UNDER": 1, "MASK": 8, "DAPBOOLS": 4, "ONULLAGE": 1, "ULLAGE.": 2, "WHILE": 1, "INHINTED.": 1, "STCLOK1": 1, "THIS": 6, "STARTS": 1, "COUNT": 1, "DOWN": 1, ".": 2, "SETTING": 2, "STCLOK3": 1, "MAKECADR": 2, "POSITIVE": 3, "KILLS": 1, "IT.": 2, "SAVE": 1, "TIME2": 3, "UNDOUBTEDLY": 1, "NUMBER": 2, "TPAGREE": 1, "PASSED": 1, "SECOND": 3, "CHECK.": 1, "LOW5": 1, "RESTRICT": 1, "MAGNITUDE": 1, "DV": 1, "GET": 1, "REMAINDER": 1, "AD": 4, "PHSCHNG": 1, "BANKJUMP": 2, "TBASE6": 2, "KILLCLOK": 2, "PRIO27": 1, "FIXDELAY": 1, "WAIT": 1, "BEFORE": 1, "STARTING": 1, "OVER": 1, "KILL": 3, "PHASE6": 1, "HAS": 1, "BEEN": 2, "HIGHER": 1, "PRIORITY": 2, "LAST": 1, "AVOID": 1, "USING": 1, "AS": 1, "AN": 1, "INDEX.": 1, "*****": 2, "NEVER": 1, "B": 1, "DISPNOT": 2, "DUE": 1, "EFFECT": 1, "VB97DEX": 1, "OCT35": 1, "PROPER": 4, "INDICATE": 3, "VERB": 2, "PASTE": 2, "NVWORD1": 2, "NVWORD": 2, "CONTAINS": 1, "V06": 1, "&": 2, "NOUN": 2, "CLOCPLAY": 2, "STOPCLOK": 4, "TERMINATE": 4, "WAY": 2, "P00H": 1, "COMFAIL1": 1, "COMFAIL2": 1, "VIA": 1, "ASTNCLOK": 1, "V06N61": 2, "PRIMARILY": 1, "USED": 2, "CREW": 2, "HIS": 1, "EVENT": 1, "TIMER": 1, "AGREE": 1, "REFLASH": 1, "TIG.": 1, "ASTNRETN": 2, "LOW4": 1, "OCT17": 1, "COMES": 1, "ONE": 1, "INTERVALS.": 1, "NORMALLY": 1, "OPERATED": 1, "BETWEEN": 1, "VB99DEX": 1, "ELEVEN": 1, "OCT13": 1, "EQUALS": 2, "BIT9": 1, ";": 1, "INITIATED": 1, "SEC.": 1, "V99NXX": 1, "WHERE": 1, "XX": 1, "THAT": 2, "HAD": 1, "PREVIOUSLY": 1, "DISPLAYED": 1, "GOTOP00H": 6, "TURNS": 1, "*PROCEED": 2, "*ENTER": 2, "BLANKED": 1, "AVERAGE": 1, "STARTING.": 1, "NULLCLOK": 4, "STOP": 2, "P00": 1, "RELINTS": 1, "QXCH": 2, "P40/RET": 2, "...": 1, "KILLTASK": 2, "Z": 1, "BUT": 1, "KEEP": 1, "PRIO13": 1, "FINDVAC": 3, "STARIND": 1, "ASTNRET": 1, "ASTNFLAG": 1, "IGNITE": 2, "PRIO12": 1, "LOWER": 1, "THAN": 1, "POSTBURN": 2, "COASTING": 2, "FLIGHT.": 2, "ALLCOAST": 2, "TGO": 2, "CUTOFF": 2, "DOWNFLAG": 1, "FLUNDISP": 1, "FLAGWRD7": 1, "IGNFLBIT": 1, "IGNITE1": 2, "OCT23": 1, "IMMEDIATE": 1, "OLD": 1, "P40ALM": 1, "ALARM": 2, "PROGRAM": 1, "SELECTION": 1, "CONSISTENT": 1, "VEHICLE": 2, "CONFIGURATION": 1, "V05N09": 1, "GOFLASH": 1, "V34E": 2, "PROCEED": 1, "P42": 2, "V32E": 1, "REDISPLAY": 1, "ALLOW": 1, "PRECEED": 1, "THOUGH": 1, "UNSTAGED.": 1, "P40S2": 1, "HELLO": 1, "THERE.": 1, "TEMPR60": 2, "BANKS.": 1, "P40A/P": 2, "SUBROUTINE": 1, "PGNCS": 4, "CONTROL": 1, "N": 1, "AUTO": 6, "STABILIZATION": 1, "MODES": 1, "TURNITON": 2, "AND/OR": 1, "APSFLBIT": 1, "ARE": 2, "DESCENT": 1, "STAGE": 1, "GOBACK": 3, "BIT5": 3, "THROTTLE": 2, "MODE": 2, "RAND": 1, "CHAN30": 1, "BZF": 4, "P40A/PMD": 2, "DISPLAYS": 1, "V50N25": 1, "R1": 1, "PLEASE": 1, "PERFORM": 1, "CHECKLIST": 1, "ETC.": 1, "GOPERF1": 1, "RECYCLE": 1, "GOODBYE.": 1, "SOON.": 1, "**********************************": 2, "CONSTANTS": 1, "SERVCADR": 1, "P40ADRES": 1, "P41ADRES": 1, "P42ADRES": 1, "DVCNTR": 2, "DSP2CADR": 1, "P63DISPS": 1, "ATMAGADR": 1, "ATMAG": 1, "OCT20": 1, "REMOVE": 2, "WAITLIST": 1, "SUBSTITUTING": 1, "NULL": 1, "NULLTASK": 1, "BBANK": 1, "INCR": 3, "ITEMP1": 3, "ADR": 1, "ITEMP2": 1, "ITEMP3": 4, "LOW10": 3, "BIT11": 1, "ITEMP4": 2, "GENADR": 1, "FBANK": 1, "ZL": 1, "ADRSCAN": 2, "LST2": 3, "COMPARE": 3, "GENADRS": 1, "TSTFBANK": 2, "THEY": 1, "MATCH": 3, "FBANKS": 2, "LETITLIV": 2, "LSTLIM": 2, "DONE": 2, "DEAD": 3, "CONTINUE": 1, "LOOP.": 1, "DTCB": 1, "ONLY.": 1, "SU": 1, "KILLDEAD": 2, "CONTINUE.": 1, "TCTSKOVR": 1, "INSERTING": 1 }, "AppleScript": { "set": 107, "windowWidth": 3, "to": 127, "windowHeight": 3, "delay": 3, "AppleScript": 2, "s": 3, "text": 13, "item": 13, "delimiters": 1, "tell": 40, "application": 16, "screen_width": 2, "(": 89, "do": 4, "JavaScript": 2, "in": 13, "document": 2, ")": 88, "screen_height": 2, "end": 67, "myFrontMost": 3, "name": 8, "of": 72, "first": 1, "processes": 2, "whose": 1, "frontmost": 1, "is": 40, "true": 8, "{": 32, "desktopTop": 2, "desktopLeft": 1, "desktopRight": 1, "desktopBottom": 1, "}": 32, "bounds": 2, "desktop": 1, "try": 10, "process": 5, "w": 5, "h": 4, "size": 5, "drawer": 2, "window": 5, "on": 18, "error": 3, "position": 1, "-": 51, "/": 2, "property": 7, "type_list": 6, "extension_list": 6, "html": 2, "not": 5, "currently": 2, "handled": 2, "run": 4, "FinderSelection": 4, "the": 56, "selection": 2, "as": 27, "alias": 8, "list": 9, "FS": 10, "Ideally": 2, "this": 2, "could": 2, "be": 2, "passed": 2, "open": 8, "handler": 2, "SelectionCount": 6, "number": 6, "count": 10, "if": 50, "then": 28, "userPicksFolder": 6, "else": 14, "MyPath": 4, "path": 6, "me": 2, "If": 2, "I": 2, "m": 2, "a": 4, "double": 2, "clicked": 2, "droplet": 2, "these_items": 18, "choose": 2, "file": 6, "with": 11, "prompt": 2, "type": 6, "thesefiles": 2, "item_info": 24, "repeat": 19, "i": 10, "from": 9, "this_item": 14, "info": 4, "for": 4, "folder": 10, "processFolder": 8, "false": 9, "and": 7, "or": 6, "extension": 4, "theFilePath": 8, "string": 17, "thePOSIXFilePath": 8, "POSIX": 4, "processFile": 8, "folders": 2, "theFolder": 6, "without": 2, "invisibles": 2, "&": 63, "thePOSIXFileName": 6, "terminalCommand": 6, "convertCommand": 4, "newFileName": 4, "shell": 2, "script": 2, "need": 1, "pass": 1, "URL": 1, "Terminal": 1, "localMailboxes": 3, "every": 3, "mailbox": 2, "greater": 5, "than": 6, "messageCountDisplay": 5, "return": 16, "my": 3, "getMessageCountsForMailboxes": 4, "everyAccount": 2, "account": 1, "eachAccount": 3, "accountMailboxes": 3, "outputMessage": 2, "make": 2, "new": 2, "outgoing": 2, "message": 2, "properties": 2, "content": 2, "subject": 1, "visible": 2, "font": 2, "theMailboxes": 2, "mailboxes": 1, "returns": 2, "displayString": 4, "eachMailbox": 4, "mailboxName": 2, "messageCount": 2, "messages": 1, "unreadCount": 2, "unread": 1, "padString": 3, "theString": 4, "fieldLength": 5, "integer": 3, "stringLength": 4, "length": 1, "paddedString": 5, "character": 2, "less": 1, "equal": 3, "paddingLength": 2, "times": 1, "space": 1, "lowFontSize": 9, "highFontSize": 6, "messageText": 4, "userInput": 4, "display": 4, "dialog": 4, "default": 4, "answer": 3, "buttons": 3, "button": 4, "returned": 5, "minimumFontSize": 4, "newFontSize": 6, "result": 2, "theText": 3, "exit": 1, "fontList": 2, "activate": 3, "crazyTextMessage": 2, "eachCharacter": 4, "characters": 1, "some": 1, "random": 4, "color": 1, "current": 3, "pane": 4, "UI": 1, "elements": 1, "enabled": 2, "tab": 1, "group": 1, "click": 1, "radio": 1, "get": 1, "value": 1, "field": 1, "isVoiceOverRunning": 3, "isRunning": 3, "contains": 1, "isVoiceOverRunningWithAppleScript": 3, "isRunningWithAppleScript": 3, "VoiceOver": 1, "x": 1, "vo": 1, "cursor": 1, "currentDate": 3, "date": 1, "amPM": 4, "currentHour": 9, "minutes": 1, "<": 2, "currentMinutes": 4, "currentTime": 3, "day": 1, "output": 1, "say": 1 }, "Arduino": { "void": 4, "setup": 2, "(": 31, ")": 31, "{": 14, "Serial.begin": 2, ";": 24, "}": 13, "loop": 2, "Serial.print": 2, "const": 2, "int": 11, "buttons": 5, "[": 5, "]": 5, "octaves": 5, "pinMode": 3, "OUTPUT": 1, "for": 4, "i": 17, "<": 5, "sizeof": 4, "/sizeof": 4, "+": 10, "INPUT": 2, "delay": 1, "//": 1, "wait": 1, "output": 8, "-": 1, "if": 5, "digitalRead": 2, "LOW": 3, "<=0){>": 1, "break": 1, "7": 1, "i=": 1, "1": 2, "Serial.println": 1, "digitalWrite": 2, "HIGH": 1, "else": 1 }, "AsciiDoc": { "Gregory": 2, "Rom": 2, "has": 2, "written": 2, "an": 2, "AsciiDoc": 3, "plugin": 2, "for": 2, "the": 2, "Redmine": 2, "project": 2, "management": 2, "application.": 2, "https": 1, "//github.com/foo": 1, "-": 9, "users/foo": 1, "vicmd": 1, "gif": 1, "tag": 1, "rom": 2, "[": 2, "]": 2, "end": 1, "berschrift": 1, "*": 4, "Codierungen": 1, "sind": 1, "verr": 1, "ckt": 1, "auf": 1, "lteren": 1, "Versionen": 1, "von": 1, "Ruby": 1, "Home": 1, "Page": 1, "Title": 2, "Example": 1, "Articles": 1, "Item": 6, "Document": 1, "Doc": 1, "Writer": 1, "": 1, "idprefix": 1, "id_": 1, "Preamble": 1, "paragraph.": 4, "NOTE": 1, "This": 1, "is": 1, "test": 1, "only": 1, "a": 1, "test.": 1, "Section": 3, "A": 2, "*Section": 3, "A*": 2, "Subsection": 1, "B": 2, "B*": 1, ".Section": 1, "list": 1 }, "AspectJ": { "package": 2, "com.blogspot.miguelinlas3.aspectj.cache": 1, ";": 29, "import": 5, "java.util.Map": 2, "java.util.WeakHashMap": 1, "org.aspectj.lang.JoinPoint": 1, "com.blogspot.miguelinlas3.aspectj.cache.marker.Cachable": 1, "public": 6, "aspect": 2, "CacheAspect": 1, "{": 11, "pointcut": 3, "cache": 3, "(": 46, "Cachable": 2, "cachable": 5, ")": 46, "execution": 1, "@Cachable": 2, "*": 2, "..": 1, "&&": 2, "@annotation": 1, "Object": 15, "around": 2, "String": 3, "evaluatedKey": 6, "this.evaluateKey": 1, "cachable.scriptKey": 1, "thisJoinPoint": 1, "if": 2, "cache.containsKey": 1, "System.out.println": 5, "+": 7, "return": 5, "this.cache.get": 1, "}": 11, "value": 3, "proceed": 2, "cache.put": 1, "protected": 2, "evaluateKey": 1, "key": 2, "JoinPoint": 1, "joinPoint": 1, "//": 1, "TODO": 1, "add": 1, "some": 1, "smart": 1, "staff": 1, "to": 1, "allow": 1, "simple": 1, "scripting": 1, "in": 1, "annotation": 1, "Map": 3, "": 2, "new": 1, "WeakHashMap": 1, "aspects.caching": 1, "abstract": 3, "OptimizeRecursionCache": 2, "@SuppressWarnings": 3, "private": 1, "_cache": 2, "getCache": 2, "operation": 4, "o": 16, "topLevelOperation": 4, "cflowbelow": 1, "before": 1, "cachedValue": 4, "_cache.get": 1, "null": 1, "after": 2, "returning": 2, "result": 3, "_cache.put": 1, "_cache.size": 1 }, "Assembly": { "ORG": 7, "h": 27, "SJMP": 3, "START": 2, "LCALL": 9, "INT0_ISR": 2, "RETI": 5, "Bh": 2, "T0_ISR": 2, "INT1_ISR": 2, "T1_ISR": 2, "UART_ISR": 2, "MOV": 9, "A": 16, "#11111110b": 2, "SETB": 3, "IT0": 1, ";": 1811, "Set": 1, "External": 2, "Interrupt": 2, "to": 20, "be": 6, "falling": 1, "edge": 1, "triggered": 1, "EX0": 1, "Enable": 2, "Interrut": 1, "EA": 1, "LEFT": 3, "CJNE": 2, "#01111111b": 1, "LOOP1": 2, "JMP": 2, "RIGHT": 3, "P1": 4, "RL": 1, "DELAY": 5, "LOOP2": 2, "RR": 1, "R1": 2, "#3": 1, "FLASH": 2, "#00h": 1, "#0FFh": 1, "DJNZ": 4, "RET": 6, "R5": 2, "#20": 1, "R5*20": 1, "mS": 1, "D1": 2, "R6": 2, "#40": 1, "D2": 2, "R7": 2, "#249": 1, "END": 1, "flat": 1, "assembler": 3, "interface": 1, "for": 6, "Win32": 1, "Copyright": 1, "(": 134, "c": 4, ")": 134, "-": 1146, "Tomasz": 1, "Grysztar.": 1, "All": 1, "rights": 1, "reserved.": 1, "format": 2, "PE": 1, "console": 1, "section": 5, "code": 4, "readable": 4, "executable": 1, "start": 12, "mov": 315, "[": 124, "con_handle": 2, "]": 124, "STD_OUTPUT_HANDLE": 1, "esi": 46, "_logo": 2, "call": 85, "display_string": 7, "get_params": 2, "jc": 3, "information": 2, "init_memory": 1, "_memory_prefix": 2, "eax": 175, "memory_end": 1, "sub": 23, "memory_start": 1, "add": 56, "additional_memory_end": 1, "additional_memory": 1, "shr": 6, "display_number": 5, "_memory_suffix": 2, "GetTickCount": 3, "start_time": 3, "preprocessor": 1, "parser": 1, "formatter": 1, "display_user_messages": 1, "movzx": 25, "current_pass": 1, "inc": 10, "_passes_suffix": 2, "xor": 15, "edx": 77, "ebx": 301, "div": 5, "or": 16, "jz": 20, "display_bytes_count": 2, "push": 31, "dl": 3, "display_character": 1, "pop": 24, "_seconds_suffix": 2, "written_size": 1, "_bytes_suffix": 2, "al": 71, "jmp": 29, "exit_program": 2, "_usage": 2, "input_file": 4, "output_file": 3, "symbols_file": 2, "memory_setting": 3, "passes_limit": 2, "GetCommandLine": 2, "edi": 65, "params": 2, "find_command_start": 2, "lodsb": 15, "cmp": 59, "je": 25, "skip_quoted_name": 3, "skip_name": 2, "find_param": 7, "all_params": 5, "option_param": 2, "Dh": 15, "jne": 3, "get_output_file": 2, "process_param": 3, "bad_params": 11, "string_param": 3, "copy_param": 2, "stosb": 8, "param_end": 6, "string_param_end": 2, "memory_option": 4, "passes_option": 4, "symbols_option": 3, "stc": 2, "ret": 145, "get_option_value": 3, "get_option_digit": 2, "option_value_ok": 4, "invalid_option_value": 5, "ja": 3, "imul": 6, "jo": 1, "dec": 7, "clc": 6, "shl": 4, "jae": 1, "dx": 1, "find_symbols_file_name": 2, "include": 15, "data": 18, "writeable": 2, "_copyright": 1, "db": 41, "Ah": 11, "VERSION_STRING": 1, "align": 8, "dd": 256, "bytes_count": 1, "displayed_count": 1, "character": 1, "last_displayed": 1, "rb": 4, "options": 1, "buffer": 9, "stack": 22, "import": 1, "rva": 16, "kernel_name": 2, "kernel_table": 2, "ExitProcess": 1, "_ExitProcess": 2, "CreateFile": 1, "_CreateFileA": 2, "ReadFile": 1, "_ReadFile": 2, "WriteFile": 1, "_WriteFile": 2, "CloseHandle": 1, "_CloseHandle": 2, "SetFilePointer": 1, "_SetFilePointer": 2, "_GetCommandLineA": 2, "GetEnvironmentVariable": 1, "_GetEnvironmentVariable": 2, "GetStdHandle": 1, "_GetStdHandle": 2, "VirtualAlloc": 1, "_VirtualAlloc": 2, "VirtualFree": 1, "_VirtualFree": 2, "_GetTickCount": 2, "GetSystemTime": 1, "_GetSystemTime": 2, "GlobalMemoryStatus": 1, "_GlobalMemoryStatus": 2, "dw": 14, "fixups": 1, "discardable": 1, "Forth": 2, "by": 4, "Chris": 1, "Hinsley": 1, "nasm": 1, "f": 1, "macho": 1, "forth.nasm": 1, "ld": 1, "o": 1, "forth": 1, "e": 1, "_main": 3, "forth.o": 1, "./forth": 1, "%": 243, "define": 36, "VERSION_NUM": 2, "various": 2, "area": 1, "sizes": 1, "DATA_STACK_SIZE": 2, "USER_DEFS_SIZE": 2, "*1024": 1, "NUM_HASH_CHAINS": 2, "MAX_LINE_SIZE": 6, "SYS_exit": 2, "SYS_read": 3, "SYS_write": 2, "SYS_open": 2, "SYS_close": 2, "SYS_unlink": 2, "SYS_mprotect": 2, "SYS_fsync": 2, "SYS_rename": 2, "SYS_stat": 2, "SYS_lseek": 2, "SYS_fstat": 2, "SYS_ftruncate": 2, "PROT_READ": 2, "pages": 3, "can": 5, "read": 2, "PROT_WRITE": 2, "written": 1, "PROT_EXEC": 2, "executed": 1, "PROT_ALL": 2, "|": 2, "PAGE_SIZE": 2, "some": 1, "NASM": 1, "codeing": 1, "macros": 3, "macro": 34, "loopstart": 3, "loop_start": 4, "endmacro": 9, "break": 1, "loop_exit": 4, "breakif": 1, "j": 3, "+": 73, "loopend": 2, "repeat": 3, "until": 2, "if": 32, "ifnot": 3, "else": 14, "ifctx": 2, "repl": 1, "ifend": 2, "error": 3, "endif": 30, "elifctx": 1, "base": 2, "VM": 1, "eip": 1, "Forths": 4, "IP": 1, "esp": 26, "R": 1, "ebp": 58, "S": 1, "TOS": 1, "on": 6, "return": 14, "PUSHRSP": 2, "endm": 25, "top": 4, "of": 22, "POPRSP": 3, "save": 2, "into": 5, "PUTRSP": 4, "elif": 4, "&&": 6, "<": 12, "byte": 32, "long": 4, "load": 3, "from": 8, "PICKRSP": 9, "set": 4, "SETRSP": 2, "get": 3, "GETRSP": 4, "adjust": 2, "ADDRSP": 7, "PUSHDSP": 17, "POPDSP": 19, "PUTDSP": 48, "PICKDSP": 102, "SETDSP": 3, "GETDSP": 2, "ADDDSP": 58, "value": 6, "onto": 1, "LOADTOS": 16, "move": 2, "TORSP": 7, "FROMRSP": 3, "copy": 1, "FETCHRSP": 2, "reg": 1, "DP_ALIGN": 3, "ALIGNREG": 1, "and": 17, "dictionary": 6, "building": 1, "entry": 2, "flag": 5, "F_IMMED": 3, "F_HIDDEN": 2, "F_LENMASK": 4, "NULL": 3, "H_LLINK": 2, "H_HLINK": 2, "H_NSIZE": 4, "H_NAME": 4, "XT_BODY": 3, "XT_LENGTH": 3, "XT_COMPILE": 3, "XT_SIZE": 3, "defword": 134, "newword": 1, "strlen": 1, "len": 3, "dic_": 1, "LATEST": 2, "list": 2, "link": 3, "hash": 3, "chain": 1, "flags": 2, "length": 6, "the": 20, "name": 2, "body": 2, "pointer": 1, "code_end": 2, "compile": 2, "action": 1, "word": 12, "follows": 1, "defword_end": 134, "defvar": 11, "WORD_INLINE_COMMA": 115, "var_": 4, "defvar2": 2, "defconst": 33, "point": 1, "SECTION": 2, ".text": 1, "global": 1, "use": 2, "mprotect": 1, "allow": 1, "read/write/execute": 1, "forth_start": 3, "address": 6, "ecx": 76, "forth_end": 2, "padding": 1, "int": 4, ".data": 1, "init": 1, "stacks": 1, "saving": 1, "initial": 1, "positions": 1, "in": 11, "vars": 1, "R0": 2, "S0": 2, "cld": 4, "var_WORD_SZ": 2, "var_WORD_RZ": 1, "built": 4, "dictionary_start": 3, "lodsd": 1, "cl": 3, "lea": 8, "strhashi": 2, "hash_buckets": 2, "*": 19, "dictionary_end": 2, "z": 4, "var_WORD_LATEST": 1, "run": 1, "temp": 1, "interpreter": 2, "loop": 6, "till": 2, "we": 2, "real": 1, "QUIT": 2, "WORD_LBRAC": 1, "interpret": 1, "state": 1, "q": 1, "octal": 1, "bootfile": 2, "WORD_SYS_OPEN": 2, "WORD_SYSCALL": 1, "fd": 3, "tib_buffer": 3, "addr": 8, "WORD_READLINE": 2, "num": 1, "WORD_DROP2": 4, "WORD_SWAP": 4, "WORD_INHASH": 2, "WORD_STORE2": 2, "WORD_TOIN": 2, "WORD_STORE": 2, "WORD_INTERPRET": 1, "takes": 1, "over": 1, "a": 8, "few": 1, "case": 3, "insensative": 1, "string": 1, "operations": 1, "to_lower": 5, "lower": 2, "check": 1, "ge": 2, "le": 1, "make": 1, "it": 5, "strcpyi": 1, "test": 20, "nz": 5, "strcpyi_l1": 2, "strcmpi": 1, "strcmpi_l1": 2, "bl": 54, "function": 1, "strhashi_l1": 2, "syscall": 3, "functions": 1, "_syscall": 2, "neg": 27, "_lsyscall": 1, "not": 7, "adc": 12, "variables": 1, "STATE": 1, "Is": 1, "executing": 2, "compiling": 2, "non": 1, "zero": 1, "Points": 2, "latest": 1, "most": 1, "recently": 1, "defined": 1, "dictionary.": 1, "DP": 1, "next": 1, "free": 1, "memory.": 1, "When": 1, "compiled": 1, "words": 12, "go": 1, "here.": 1, "Stores": 3, "parameter": 1, "stack.": 2, "The": 19, "BASE": 1, "current": 7, "printing": 1, "reading": 1, "numbers.": 1, "#IN": 1, "input": 5, "descriptor.": 2, "IN": 1, "offset.": 6, "SOURCEFD": 1, "source": 1, "file": 1, "BLK": 1, "block": 1, "number.": 1, "CHARBUF": 1, "Single": 1, "char": 1, "buffer.": 3, "WORD_STATE": 1, "WORD_DP": 1, "WORD_LATEST": 1, "WORD_SZ": 1, "WORD_RZ": 1, "WORD_BASE": 1, "WORD_SOURCEFD": 1, "WORD_BLK": 1, "WORD_CHARBUF": 1, "constants": 1, "VERSION": 1, "version": 2, "this": 4, "FORTH.": 1, "WORDBUF": 1, "WORD": 2, "uses.": 1, "LINESIZE": 1, "line": 1, "size.": 1, "IMMEDIATE": 1, "s": 2, "actual": 1, "value.": 3, "mask": 1, "flags/len": 2, "byte.": 2, "field": 4, "xt": 6, "pointer.": 1, "size": 1, "SYS_*": 1, "numeric": 1, "codes": 1, "syscalls.": 1, "O_*": 1, "Various": 1, "sycall": 1, "flags/modes.": 1, "WORD_VERSION": 1, "WORD_WORDBUF": 1, "word_buf": 2, "WORD_LINESIZE": 1, "WORD__F_IMMED": 1, "WORD__F_HIDDEN": 1, "WORD__F_LENMASK": 1, "WORD__H_NSIZE": 1, "WORD__H_NAME": 1, "WORD__XT_BODY": 1, "WORD__XT_LENGTH": 1, "WORD__XT_COMPILE": 1, "WORD__XT_SIZE": 1, "WORD_SYS_EXIT": 1, "WORD_SYS_CLOSE": 1, "WORD_SYS_READ": 1, "WORD_SYS_WRITE": 1, "WORD_SYS_UNLINK": 1, "WORD_SYS_RENAME": 1, "WORD_SYS_FTRUNCATE": 1, "WORD_SYS_FSYNC": 1, "WORD_SYS_LSEEK": 1, "WORD_SYS_FSTAT": 1, "WORD_SYS_STAT": 1, "WORD_O_RDONLY": 1, "WORD_O_WRONLY": 1, "WORD_O_RDWR": 1, "WORD_O_CREAT": 1, "WORD_O_EXCL": 1, "WORD_O_TRUNC": 1, "WORD_O_APPEND": 1, "WORD_O_NONBLOCK": 1, "ordering": 2, "WORD_DSPFETCH": 1, "WORD_DSPSTORE": 1, "WORD_DROP": 5, "xchg": 1, "WORD_DUP": 1, "WORD_OVER": 8, "WORD_ROT": 1, "WORD_NROT": 2, "WORD_DUP2": 1, "WORD_SWAP2": 4, "WORD_ROT2": 1, "WORD_QDUP": 1, "WORD_NQDUP": 1, "WORD_NIP": 3, "WORD_TUCK": 2, "WORD_PICK": 1, "WORD_TUCK2": 1, "WORD_NIP2": 1, "WORD_OVER2": 1, "WORD_TOR": 1, "WORD_FROMR": 1, "WORD_TOR2": 1, "WORD_FROMR2": 1, "WORD_RSPFETCH": 1, "WORD_RFETCH": 1, "WORD_RSTORE": 1, "WORD_RFETCH2": 1, "WORD_RSPSTORE": 1, "WORD_RDROP": 1, "WORD_RDROP2": 1, "WORD_NTOR": 1, "WORD_CALL_COMMA": 17, "rep": 9, "movsd": 2, "WORD_NFROMR": 1, "memory": 1, "fetch": 1, "store": 1, "WORD_FETCH": 1, "WORD_ADDSTORE": 1, "WORD_SUBSTORE": 1, "WORD_STOREBYTE": 3, "WORD_ADDBYTE": 1, "WORD_FETCHBYTE": 1, "WORD_STORESHORT": 1, "ax": 4, "WORD_FETCHSHORT": 1, "bx": 1, "WORD_FETCH2": 1, "WORD_BLANK": 1, "WORD_ERASE": 1, "WORD_FILL": 1, "WORD_CMOVEB": 1, "std": 2, "movsb": 4, "WORD_CMOVE": 1, "WORD_MOVE": 1, "single": 2, "precision": 5, "alu": 1, "WORD_ADD": 4, "WORD_SUB": 3, "WORD_MULL": 2, "WORD_DIV": 1, "cdq": 4, "idiv": 8, "WORD_MOD": 1, "WORD_INCR": 4, "WORD_DECR": 2, "WORD_INCR4": 1, "WORD_DECR4": 1, "WORD_INCR2": 1, "WORD_DECR2": 1, "WORD_TWOMUL": 1, "WORD_TWODIV": 1, "sar": 3, "WORD_ABS": 1, "WORD_MIN": 1, "g": 1, "WORD_MAX": 1, "l": 3, "WORD_LSHIFT": 1, "WORD_RSHIFT": 1, "WORD_AND": 1, "WORD_OR": 1, "WORD_XOR": 1, "WORD_NEGATE": 1, "WORD_INVERT": 1, "comparision": 2, "WORD_EQ": 1, "sete": 1, "WORD_NE": 1, "setne": 1, "WORD_LT": 1, "setl": 4, "WORD_GT": 1, "setg": 2, "WORD_ULT": 1, "setb": 3, "WORD_UGT": 1, "seta": 1, "WORD_ULTEQ": 1, "setbe": 1, "WORD_UGTEQ": 1, "setae": 1, "WORD_LTEQ": 1, "setle": 2, "WORD_GTEQ": 1, "setge": 2, "WORD_ZEQ": 1, "setz": 3, "WORD_ZNE": 1, "setnz": 3, "WORD_ZLT": 1, "WORD_ZGT": 1, "WORD_ZLTEQ": 1, "WORD_ZGTEQ": 1, "double": 2, "ALU": 1, "WORD_STOD": 1, "WORD_DTOS": 1, "WORD_DPLUS": 1, "WORD_DMINUS": 1, "sbb": 8, "WORD_D2STAR": 1, "rcl": 1, "WORD_D2SLASH": 1, "rcr": 1, "WORD_MULDIV": 1, "WORD_STARSMOD": 1, "WORD_DIVMOD": 1, "WORD_DNEGATE": 2, "WORD_DABS": 1, "WORD_DMAX": 1, "WORD_DMIN": 1, "WORD_DZEQ": 1, "WORD_DZNEQ": 1, "WORD_DZLT": 1, "WORD_DEQ": 1, "WORD_DNEQ": 1, "WORD_DLT": 1, "WORD_DULT": 1, "mixed": 1, "WORD_MPLUS": 1, "WORD_MMINUS": 1, "WORD_MULSTAR": 1, "WORD_MSLASH": 1, "WORD_UMULSTAR": 2, "mul": 2, "WORD_UMDIVMOD": 1, "WORD_FMDIVMOD": 1, "WORD_SMDIVREM": 1, "WORD_UDIVMOD": 1, "WORD_DMULSTAR": 1, "control": 1, "flow": 1, "WORD_BRANCH": 1, "i_jmp": 3, "strict": 2, "near": 2, "i_ret": 3, "WORD_ZBRANCH": 1, "WORD_EXIT": 1, "WORD_EXIT_COMMA": 2, "var_WORD_DP": 3, "lastcall": 2, "are": 1, "just": 1, "after": 2, "instruction": 1, "change": 1, "WORD_EXECUTE": 1, "Get": 1, "After": 1, "runs": 1, "its": 1, "will": 1, "continue": 1, "word.": 1, "jump": 1, "it.": 1, "terminal": 1, "WORD_READCHAR": 3, "var_WORD_CHARBUF": 3, "nd": 1, "param": 2, "rd": 1, "max": 1, "end": 10, "cur": 6, "readline_l1": 2, "readline_l4": 2, "readline_l2": 2, "readline_l5": 2, "LF": 2, "readline_l3": 2, "WORD_KEY": 2, "stdin": 1, "WORD_ACCEPT": 1, "accept_l1": 3, "BS": 1, "accept_l2": 1, "accept_l3": 2, "key": 1, "ud": 2, "tonumber_l1": 1, "tonumber_l3": 1, "tonumber_l4": 1, "WORD_TONUMBER": 1, "tick": 1, "WORD_TICKS": 1, "rdtsc": 1, "WORD_TEST": 1, "read/write": 1, "syscallret": 1, "saved": 1, "last": 2, "layed": 1, "down": 1, "compiler": 1, "keyboard": 1, "times": 4, "static": 2, "where": 2, "returns.": 2, "Subsequent": 2, "calls": 2, "overwrite": 2, "intep_name_buf": 1, "INTERPNAME": 1, "emit_scratch": 1, "scratch": 1, "used": 1, "EMIT": 1, "errmsg": 1, "errmsgend": 1, "errmsgnl": 1, "table": 1, "addresses": 1, "all": 1, "words.": 1, "ends": 1, "up": 1, "as": 3, "part": 1, "user": 2, "space": 1, "booting": 1, "dic_WORD_ABS": 1, "dic_WORD_ACCEPT": 1, "dic_WORD_ADD": 1, "dic_WORD_ADDBYTE": 1, "dic_WORD_ADDSTORE": 1, "dic_WORD_ALIGNDP": 1, "dic_WORD_AND": 1, "dic_WORD_BASE": 1, "dic_WORD_BLANK": 1, "dic_WORD_BLK": 1, "dic_WORD_BRANCH": 1, "dic_WORD_BUCKET": 1, "dic_WORD_CALL_COMMA": 1, "dic_WORD_CHARBUF": 1, "dic_WORD_CHAR_COMMA": 1, "dic_WORD_CLITS": 1, "dic_WORD_CMOVE": 1, "dic_WORD_CMOVEB": 1, "dic_WORD_COLON": 1, "dic_WORD_COMMA": 1, "dic_WORD_COMPARE": 1, "dic_WORD_COMPAREI": 1, "dic_WORD_COMPILE_COMMA": 1, "dic_WORD_COUNT": 1, "dic_WORD_CREATE": 1, "dic_WORD_D2SLASH": 1, "dic_WORD_D2STAR": 1, "dic_WORD_DABS": 1, "dic_WORD_DECR": 1, "dic_WORD_DECR2": 1, "dic_WORD_DECR4": 1, "dic_WORD_DEQ": 1, "dic_WORD_DIV": 1, "dic_WORD_DIVMOD": 1, "dic_WORD_DLT": 1, "dic_WORD_DMAX": 1, "dic_WORD_DMIN": 1, "dic_WORD_DMINUS": 1, "dic_WORD_DMULSTAR": 1, "dic_WORD_DNEGATE": 1, "dic_WORD_DNEQ": 1, "dic_WORD_DODOES": 1, "dic_WORD_DOES": 1, "dic_WORD_DP": 1, "dic_WORD_DPLUS": 1, "dic_WORD_DROP": 1, "dic_WORD_DROP2": 1, "dic_WORD_DSPFETCH": 1, "dic_WORD_DSPSTORE": 1, "dic_WORD_DTOS": 1, "dic_WORD_DULT": 1, "dic_WORD_DUP": 1, "dic_WORD_DUP2": 1, "dic_WORD_DZEQ": 1, "dic_WORD_DZLT": 1, "dic_WORD_DZNEQ": 1, "dic_WORD_EMIT": 1, "dic_WORD_EQ": 1, "dic_WORD_ERASE": 1, "dic_WORD_EXECUTE": 1, "dic_WORD_EXIT": 1, "dic_WORD_FETCH": 1, "dic_WORD_FETCH2": 1, "dic_WORD_FETCHBYTE": 1, "dic_WORD_FETCHSHORT": 1, "dic_WORD_FILL": 1, "dic_WORD_FIND": 1, "dic_WORD_FIND_DICT": 1, "dic_WORD_FMDIVMOD": 1, "dic_WORD_FROMR": 1, "dic_WORD_FROMR2": 1, "dic_WORD_GT": 1, "dic_WORD_GTEQ": 1, "dic_WORD_HEADER_COMMA": 1, "dic_WORD_HIDDEN": 1, "dic_WORD_IMMEDIATE": 1, "dic_WORD_INCR": 1, "dic_WORD_INCR2": 1, "dic_WORD_INCR4": 1, "dic_WORD_INHASH": 1, "dic_WORD_INLINE_COMMA": 1, "dic_WORD_INTERP": 1, "dic_WORD_INTERPNAME": 1, "dic_WORD_INTERPRET": 1, "dic_WORD_INVERT": 1, "dic_WORD_ISNOTSPACE": 1, "dic_WORD_ISSPACE": 1, "dic_WORD_KEY": 1, "dic_WORD_LATEST": 1, "dic_WORD_LBRAC": 1, "dic_WORD_LINESIZE": 1, "dic_WORD_LIT_COMMA": 1, "dic_WORD_LSHIFT": 1, "dic_WORD_LSYSCALL": 1, "dic_WORD_LT": 1, "dic_WORD_LTEQ": 1, "dic_WORD_MAX": 1, "dic_WORD_MIN": 1, "dic_WORD_MMINUS": 1, "dic_WORD_MOD": 1, "dic_WORD_MOVE": 1, "dic_WORD_MPLUS": 1, "dic_WORD_MSLASH": 1, "dic_WORD_MULDIV": 1, "dic_WORD_MULL": 1, "dic_WORD_MULSTAR": 1, "dic_WORD_NE": 1, "dic_WORD_NEGATE": 1, "dic_WORD_NFROMR": 1, "dic_WORD_NIP": 1, "dic_WORD_NIP2": 1, "dic_WORD_NQDUP": 1, "dic_WORD_NROT": 1, "dic_WORD_NTOR": 1, "dic_WORD_OR": 1, "dic_WORD_OVER": 1, "dic_WORD_OVER2": 1, "dic_WORD_O_APPEND": 1, "dic_WORD_O_CREAT": 1, "dic_WORD_O_EXCL": 1, "dic_WORD_O_NONBLOCK": 1, "dic_WORD_O_RDONLY": 1, "dic_WORD_O_RDWR": 1, "dic_WORD_O_TRUNC": 1, "dic_WORD_O_WRONLY": 1, "dic_WORD_PARSENAME": 1, "dic_WORD_PICK": 1, "dic_WORD_POSTPONE": 1, "dic_WORD_QDUP": 1, "dic_WORD_RBRAC": 1, "dic_WORD_RDROP": 1, "dic_WORD_RDROP2": 1, "dic_WORD_READCHAR": 1, "dic_WORD_READLINE": 1, "dic_WORD_REFILL": 1, "dic_WORD_RFETCH": 1, "dic_WORD_RFETCH2": 1, "dic_WORD_ROT": 1, "dic_WORD_ROT2": 1, "dic_WORD_RSHIFT": 1, "dic_WORD_RSPFETCH": 1, "dic_WORD_RSPSTORE": 1, "dic_WORD_RSTORE": 1, "dic_WORD_RZ": 1, "dic_WORD_SEMICOLON": 1, "dic_WORD_SLITS": 1, "dic_WORD_SMDIVREM": 1, "dic_WORD_SOURCE": 1, "dic_WORD_SOURCEFD": 1, "dic_WORD_SSTRING": 1, "dic_WORD_STARSMOD": 1, "dic_WORD_STATE": 1, "dic_WORD_STOD": 1, "dic_WORD_STORE": 1, "dic_WORD_STORE2": 1, "dic_WORD_STOREBYTE": 1, "dic_WORD_STORESHORT": 1, "dic_WORD_SUB": 1, "dic_WORD_SUBSTORE": 1, "dic_WORD_SWAP": 1, "dic_WORD_SWAP2": 1, "dic_WORD_SYSCALL": 1, "dic_WORD_SYS_CLOSE": 1, "dic_WORD_SYS_EXIT": 1, "dic_WORD_SYS_FSTAT": 1, "dic_WORD_SYS_FSYNC": 1, "dic_WORD_SYS_FTRUNCATE": 1, "dic_WORD_SYS_LSEEK": 1, "dic_WORD_SYS_OPEN": 1, "dic_WORD_SYS_READ": 1, "dic_WORD_SYS_RENAME": 1, "dic_WORD_SYS_STAT": 1, "dic_WORD_SYS_UNLINK": 1, "dic_WORD_SYS_WRITE": 1, "dic_WORD_SZ": 1, "dic_WORD_TABSTOSPACES": 1, "dic_WORD_TCFA": 1, "dic_WORD_TICKS": 1, "dic_WORD_TOIN": 1, "dic_WORD_TONUMBER": 1, "dic_WORD_TOR": 1, "dic_WORD_TOR2": 1, "dic_WORD_TOSNUMBER": 1, "dic_WORD_TRAILING": 1, "dic_WORD_TUCK": 1, "dic_WORD_TUCK2": 1, "dic_WORD_TWODIV": 1, "dic_WORD_TWOMUL": 1, "dic_WORD_TYPE": 1, "dic_WORD_TYPE_FD": 1, "dic_WORD_UDIVMOD": 1, "dic_WORD_UGT": 1, "dic_WORD_UGTEQ": 1, "dic_WORD_ULT": 1, "dic_WORD_ULTEQ": 1, "dic_WORD_UMDIVMOD": 1, "dic_WORD_UMULSTAR": 1, "dic_WORD_UNUSED": 1, "dic_WORD_VERSION": 1, "dic_WORD_WORDBUF": 1, "dic_WORD_WORDNAME": 1, "dic_WORD_XOR": 1, "dic_WORD_XTSKIP": 1, "dic_WORD_ZBRANCH": 1, "dic_WORD_ZEQ": 1, "dic_WORD_ZGT": 1, "dic_WORD_ZGTEQ": 1, "dic_WORD_ZLT": 1, "dic_WORD_ZLTEQ": 1, "dic_WORD_ZNE": 1, "dic_WORD__F_HIDDEN": 1, "dic_WORD__F_IMMED": 1, "dic_WORD__F_LENMASK": 1, "dic_WORD__H_NAME": 1, "dic_WORD__H_NSIZE": 1, "dic_WORD__XT_BODY": 1, "dic_WORD__XT_COMPILE": 1, "dic_WORD__XT_LENGTH": 1, "dic_WORD__XT_SIZE": 1, "dic_WORD_TEST": 1, "room": 1, "r2": 2, "dint": 1, "nop": 1, "bis": 1, "#MPYDLYWRTEN": 1, "&": 166, "MPY32CTL0": 2, "bic": 1, "#MPYDLY32": 1, "#SUMEXT": 1, "r13": 1, "clr": 18, "r12": 42, "@r15": 8, "r4": 16, "r5": 16, "r6": 8, "r7": 8, "r8": 9, "r9": 9, "r10": 10, "r11": 10, "#2*8": 1, "r15": 7, "MPY32L": 1, "MPY32H": 1, "OP2L": 25, "OP2H": 25, "RES0": 19, "*0": 1, "r14": 20, "RES1": 19, "RES2": 18, "RES3": 18, "MAC32L": 14, "MAC32H": 14, "SUMEXT": 10, "*2": 1, "@r13": 14, "*4": 1, "*6": 1, "*8": 4, "*9": 2, "*10": 1, "*12": 1, "*14": 1, "*16": 1, "*18": 1, "eint": 1, "AL": 1, "DispAL": 6, "dwDispPos": 6, "ah": 3, "b": 5, ".begin": 2, ".1": 7, ".2": 6, "gs": 3, "DispInt": 2, "DispStr": 3, "pszInfo": 1, "jnz": 1, ".3": 2, "DispReturn": 2, "szReturn": 1, "printf": 1, "memcpy": 1, "void*": 3, "MemCpy": 3, "es": 2, "pDest": 1, "ds": 2, "pSrc": 1, "iSize": 1, "Destination": 1, "Source": 1, "Counter": 1, "BLARGG_MACROS_INCLUDED": 1, "Allows": 1, "extra": 1, "checking": 1, "with": 4, "modified": 1, "ca65.": 1, "Otherwise": 1, "acts": 1, "like": 1, "constant": 1, "ADDR": 1, "Switches": 1, "Segment": 7, "places": 1, "Line": 4, "there.": 1, "an": 1, ".align": 2, "directive": 1, ".res": 3, ".byte": 2, "etc.": 1, "Examples": 1, "seg_data": 5, "BSS": 2, "RODATA": 1, "{": 11, "message": 1, "}": 11, ".macro": 19, ".pushseg": 1, ".segment": 1, ".string": 5, ".popseg": 1, ".endmacro": 19, "Reserves": 1, "Size": 5, "bytes": 2, "Name.": 1, "If": 3, "is": 1, "omitted": 1, "reserves": 1, "one": 1, "seg_res": 5, "Name": 6, ".ifblank": 1, ".else": 7, ".endif": 10, "Shortcuts": 1, "zeropage": 1, "bss": 1, ".define": 5, "zp_res": 2, "ZEROPAGE": 1, "nv_res": 1, "NVRAM": 1, "bss_res": 1, "sp_res": 1, "STACK": 1, "zp_byte": 1, "Copies": 2, "Src": 21, "Addr.": 4, "begins": 2, "#": 16, "sets": 2, "Addr": 24, "immediate": 3, "Out": 4, "copied": 1, "Preserved": 8, "X": 6, "Y": 7, "lda": 14, "sta": 12, "high": 3, "movw": 1, ".if": 4, ".match": 3, ".left": 3, "<(.right(>": 2, "tcount": 2, "1": 2, ".right": 3, ".tcount": 3, "Increments": 2, "bit": 5, "at": 5, "EQ/NE": 1, "based": 2, "resulting": 1, "incw": 1, ".local": 5, "@Skip": 6, "bne": 5, "Adds": 1, "result": 1, "carry": 1, "appropriately": 1, "addw": 1, "addw_": 2, "Imm": 3, "": 1, "bcc": 2, "Splits": 1, "tables": 1, "low": 1, "Example": 1, "split_words": 2, "foo": 1, "expands": 1, "foo_l": 1, "foo_h": 1, "foo_count": 1, "Label": 5, "Words": 3, ".ident": 4, ".concat": 4, ".lobytes": 1, ".hibytes": 1, "SELECT": 1, "Bool": 3, "True": 2, "False": 3, "Extra": 4, ".ifndef": 3, ".elseif": 1, "DEFAULT": 1, "Value": 2, ".ifp02": 1, "doesn": 1, "t": 1, "ca65": 1, "step": 10, "time.": 2, "for_loop": 5, "routine": 8, "@for_loop": 5, "#start": 1, "pha": 3, "jsr": 2, "pla": 3, "#step": 1, "Calls": 1, "n": 4, "times.": 1, "counts": 1, "loop_n_times": 1, "Same": 1, "except": 1, "uses": 1, "YX.": 1, "for_loop16": 1, "||": 1, ".error": 1, "@for_loop_skip": 4, "ldy": 3, "<(start)>": 1, "tax": 1, "tya": 1, "tay": 1, "iny": 2, "bcs": 1, "dey": 1, "<((end)+(step))>": 1, "cpy": 1, "#byte": 1, "setw": 1, "<(word)>": 1, "Loads": 1, "XY": 2, "ldxy": 1, "Arg": 8, "ldx": 3, "register": 1, "CONSTANT": 1, "Z": 1, "entire": 1, "result.": 1, "Time": 1, "clocks": 1, "inxy": 1, "beq": 1, "inx": 2, "Negates": 1, "adds": 1, "operand": 1, "subaf": 1, "Operand": 2, "eor": 1, "FF": 2, "sec": 1, "Initializes": 1, "CPU": 1, "registers": 1, "reasonable": 1, "values": 1, "init_cpu_regs": 1, "sei": 1, "unnecessary": 1, "NES": 1, "but": 1, "might": 1, "help": 1, "clone": 1, "txs": 1, "BUILD_NSF": 1, "stx": 1, "PPUCTRL": 1 }, "AutoHotkey": { "MsgBox": 1, "Hello": 1, "World": 1 }, "Awk": { "SHEBANG#!awk": 1, "BEGIN": 1, "{": 17, "n": 13, ";": 55, "printf": 1, "network_max_bandwidth_in_byte": 3, "network_max_packet_per_second": 3, "last3": 3, "last4": 3, "last5": 3, "last6": 3, "}": 17, "if": 14, "(": 14, "/Average/": 1, ")": 14, "#": 48, "Skip": 1, "the": 12, "Average": 1, "values": 1, "next": 1, "/all/": 1, "This": 8, "is": 7, "cpu": 1, "info": 7, "print": 35, "FILENAME": 35, "-": 2, "/eth0/": 1, "eth0": 1, "network": 1, "Total": 9, "number": 9, "of": 22, "packets": 4, "received": 4, "per": 14, "second.": 8, "else": 4, "transmitted": 4, "bytes": 4, "/proc": 1, "|": 4, "cswch": 1, "tps": 1, "kbmemfree": 1, "totsck/": 1, "/": 2, "[": 1, "]": 1, "proc/s": 1, "context": 1, "switches": 1, "second": 6, "disk": 1, "total": 1, "transfers": 1, "read": 1, "requests": 2, "write": 1, "block": 2, "reads": 1, "writes": 1, "mem": 1, "Amount": 7, "free": 2, "memory": 6, "available": 1, "in": 11, "kilobytes.": 7, "used": 8, "does": 1, "not": 1, "take": 1, "into": 1, "account": 1, "by": 4, "kernel": 3, "itself.": 1, "Percentage": 2, "memory.": 1, "X": 1, "shared": 1, "system": 1, "Always": 1, "zero": 1, "with": 1, "kernels.": 1, "as": 1, "buffers": 1, "to": 1, "cache": 1, "data": 1, "swap": 3, "space": 2, "space.": 1, "socket": 1, "sockets.": 1, "Number": 4, "TCP": 1, "sockets": 3, "currently": 4, "use.": 4, "UDP": 1, "RAW": 1, "IP": 1, "fragments": 1, "END": 1 }, "BitBake": { "include": 1, "gstreamer1.0": 1, "-": 3, "libav.inc": 1, "LIC_FILES_CHKSUM": 1, "SRC_URI": 3, "[": 2, "md5sum": 1, "]": 2, "sha256sum": 1, "LIBAV_EXTRA_CONFIGURE_COMMON_ARG": 1, "S": 1, "require": 2, "qt5": 1, "git.inc": 1, "{": 4, "PN": 1, "}": 4, ".inc": 1, "do_install_append": 1, "(": 1, ")": 1, "ln": 1, "sf": 1, "syncqt.pl": 1, "D": 1, "OE_QMAKE_PATH_QT_BINS": 1, "/syncqt": 1, "QT_MODULE_BRANCH": 1, "SRCREV": 1 }, "Blade": { "": 2, "html": 2, "": 2, "": 2, "": 2, "@yield": 4, "(": 12, ")": 12, "": 2, "@stack": 4, "": 2, "": 2, "@include": 2, "
    ": 2, "@foreach": 2, "foo": 2, "as": 2, "bar": 4, "
  • ": 2, "{": 6, "}": 6, "
  • ": 2, "@endforeach": 2, "
": 2, "raw_content": 2, "": 2, "": 2 }, "BlitzBasic": { "Local": 34, "bk": 3, "CreateBank": 5, "(": 125, ")": 126, "PokeFloat": 3, "-": 24, "Print": 13, "Bin": 4, "PeekInt": 4, "%": 6, "Shl": 7, "ff": 1, "+": 11, "Hex": 2, "FloatToHalf": 3, "HalfToFloat": 1, "FToI": 2, "WaitKey": 2, "End": 58, ";": 57, "Half": 1, "precision": 2, "bit": 2, "arithmetic": 2, "library": 2, "Global": 2, "Half_CBank_": 13, "Function": 101, "f#": 3, "If": 25, "Then": 18, "f": 3, "Return": 36, "HalfToFloat#": 1, "h": 4, "signBit": 6, "exponent": 22, "fraction": 9, "fBits": 8, "And": 8, "<": 18, "Shr": 3, "FF": 2, "ElseIf": 1, "Or": 4, "PokeInt": 2, "PeekFloat": 1, "Abs": 1, "*": 2, "Sgn": 1, "Else": 7, "EndIf": 7, "HalfAdd": 1, "l": 84, "r": 12, "HalfSub": 1, "HalfMul": 1, "HalfDiv": 1, "HalfLT": 1, "HalfGT": 1, "Double": 2, "DoubleOut": 1, "[": 2, "]": 2, "Double_CBank_": 1, "DoubleToFloat#": 1, "d": 1, "FloatToDouble": 1, "IntToDouble": 1, "i": 49, "SefToDouble": 1, "s": 12, "e": 4, "DoubleAdd": 1, "DoubleSub": 1, "DoubleMul": 1, "DoubleDiv": 1, "DoubleLT": 1, "DoubleGT": 1, "IDEal": 3, "Editor": 3, "Parameters": 3, "F#1A#20#2F": 1, "C#Blitz3D": 3, "linked": 2, "list": 32, "container": 1, "class": 1, "with": 3, "thanks": 1, "to": 11, "MusicianKool": 3, "for": 3, "concept": 1, "and": 9, "issue": 1, "fixes": 1, "Type": 8, "LList": 3, "Field": 10, "head_.ListNode": 1, "tail_.ListNode": 1, "ListNode": 8, "pv_.ListNode": 1, "nx_.ListNode": 1, "Value": 37, "Iterator": 2, "l_.LList": 1, "cn_.ListNode": 1, "cni_": 8, "Create": 4, "a": 46, "new": 4, "object": 2, "CreateList.LList": 1, "l.LList": 20, "New": 11, "head_": 35, "tail_": 34, "nx_": 33, "caps": 1, "pv_": 27, "These": 1, "make": 1, "it": 1, "more": 1, "or": 4, "less": 1, "safe": 1, "iterate": 2, "freely": 1, "Free": 1, "all": 3, "elements": 4, "not": 4, "any": 1, "values": 4, "FreeList": 1, "ClearList": 2, "Delete": 6, "Remove": 7, "the": 52, "from": 15, "does": 1, "free": 1, "n.ListNode": 12, "While": 7, "n": 54, "nx.ListNode": 1, "nx": 1, "Wend": 6, "Count": 1, "number": 1, "of": 16, "in": 4, "slow": 3, "ListLength": 2, "i.Iterator": 6, "GetIterator": 3, "elems": 4, "EachIn": 5, "True": 4, "if": 2, "contains": 1, "given": 7, "value": 16, "ListContains": 1, "ListFindNode": 2, "Null": 15, "intvalues": 1, "bank": 8, "ListFromBank.LList": 1, "CreateList": 2, "size": 4, "BankSize": 1, "p": 7, "For": 6, "To": 6, "Step": 2, "ListAddLast": 2, "Next": 7, "containing": 3, "ListToBank": 1, "Swap": 1, "contents": 1, "two": 1, "objects": 1, "SwapLists": 1, "l1.LList": 1, "l2.LList": 1, "tempH.ListNode": 1, "l1": 4, "tempT.ListNode": 1, "l2": 4, "tempH": 1, "tempT": 1, "same": 1, "as": 2, "first": 5, "CopyList.LList": 1, "lo.LList": 1, "ln.LList": 1, "lo": 1, "ln": 2, "Reverse": 1, "order": 1, "ReverseList": 1, "n1.ListNode": 1, "n2.ListNode": 1, "tmp.ListNode": 1, "n1": 5, "n2": 6, "tmp": 4, "Search": 1, "retrieve": 1, "node": 8, "ListFindNode.ListNode": 1, "Append": 1, "end": 5, "fast": 2, "return": 7, "ListAddLast.ListNode": 1, "Attach": 1, "start": 13, "ListAddFirst.ListNode": 1, "occurence": 1, "ListRemove": 1, "RemoveListNode": 6, "element": 4, "at": 5, "position": 4, "backwards": 2, "negative": 2, "index": 13, "ValueAtIndex": 1, "ListNodeAtIndex": 3, "invalid": 1, "ListNodeAtIndex.ListNode": 1, "Beyond": 1, "valid": 2, "Negative": 1, "count": 1, "backward": 1, "Before": 3, "Replace": 1, "added": 2, "by": 3, "ReplaceValueAtIndex": 1, "RemoveNodeAtIndex": 1, "tval": 3, "Retrieve": 2, "ListFirst": 1, "last": 2, "ListLast": 1, "its": 2, "ListRemoveFirst": 1, "val": 6, "ListRemoveLast": 1, "Insert": 3, "into": 2, "before": 2, "specified": 2, "InsertBeforeNode.ListNode": 1, "bef.ListNode": 1, "bef": 7, "after": 1, "then": 1, "InsertAfterNode.ListNode": 1, "aft.ListNode": 1, "aft": 7, "Get": 1, "an": 4, "iterator": 4, "use": 1, "loop": 2, "This": 1, "function": 1, "means": 1, "that": 1, "most": 1, "programs": 1, "won": 1, "available": 1, "moment": 1, "l_": 7, "Exit": 1, "there": 1, "wasn": 1, "t": 1, "create": 1, "one": 1, "cn_": 12, "No": 1, "especial": 1, "reason": 1, "why": 1, "this": 2, "has": 1, "be": 1, "anything": 1, "but": 1, "meh": 1, "Use": 1, "argument": 1, "over": 1, "members": 1, "Still": 1, "items": 1, "Disconnect": 1, "having": 1, "reached": 1, "False": 3, "currently": 1, "pointed": 1, "IteratorRemove": 1, "temp.ListNode": 1, "temp": 1, "Call": 1, "breaking": 1, "out": 1, "disconnect": 1, "IteratorBreak": 1, "F#5#A#10#18#2A#32#3E#47#4C#58#66#6F#78#8F#9B#A9#B7#BD#C5#CC": 1, "F#E3#E9#EF#F4#F9#103#10D#11B#12B#13F#152#163": 1, "result": 4, "s.Sum3Obj": 2, "Sum3Obj": 6, "Handle": 2, "MilliSecs": 4, "Sum3_": 2, "MakeSum3Obj": 2, "Sum3": 2, "b": 7, "c": 7, "isActive": 4, "Last": 1, "Restore": 1, "label": 1, "Read": 1, "foo": 1, ".label": 1, "Data": 1, "a_": 2, "a.Sum3Obj": 1, "Object.Sum3Obj": 1, "return_": 2, "First": 1 }, "BlitzMax": { "SuperStrict": 1, "Framework": 1, "Brl.StandardIO": 1, "Type": 2, "TMyType": 3, "Field": 1, "property": 1, "int": 3, "Function": 1, "A": 1, "(": 5, "param": 1, ")": 5, "do": 1, "nothing": 1, "End": 2, "Method": 1, "Global": 1, "my": 1, "new": 1, "Win32": 1, "my.A": 2, "my.B": 2, "Linux": 1 }, "Bluespec": { "package": 2, "TbTL": 1, ";": 156, "import": 1, "TL": 6, "*": 1, "interface": 2, "Lamp": 3, "method": 42, "Bool": 32, "changed": 2, "Action": 17, "show_offs": 2, "show_ons": 2, "reset": 2, "endinterface": 2, "module": 3, "mkLamp#": 1, "(": 158, "String": 1, "name": 3, "lamp": 5, ")": 163, "Reg#": 15, "prev": 5, "<": 44, "-": 29, "mkReg": 15, "False": 9, "if": 9, "&&": 3, "write": 2, "+": 7, "endmethod": 8, "endmodule": 3, "mkTest": 1, "let": 1, "dut": 2, "sysTL": 3, "Bit#": 1, "ctr": 8, "carN": 4, "carS": 2, "carE": 2, "carW": 2, "lamps": 15, "[": 17, "]": 17, "mkLamp": 12, "dut.lampRedNS": 1, "dut.lampAmberNS": 1, "dut.lampGreenNS": 1, "dut.lampRedE": 1, "dut.lampAmberE": 1, "dut.lampGreenE": 1, "dut.lampRedW": 1, "dut.lampAmberW": 1, "dut.lampGreenW": 1, "dut.lampRedPed": 1, "dut.lampAmberPed": 1, "dut.lampGreenPed": 1, "rule": 10, "start": 1, "dumpvars": 1, "endrule": 10, "detect_cars": 1, "dut.set_car_state_N": 1, "dut.set_car_state_S": 1, "dut.set_car_state_E": 1, "dut.set_car_state_W": 1, "go": 1, "True": 6, "<=>": 3, "12_000": 1, "ped_button_push": 4, "stop": 1, "display": 2, "finish": 1, "function": 10, "do_offs": 2, "l": 3, "l.show_offs": 1, "do_ons": 2, "l.show_ons": 1, "do_reset": 2, "l.reset": 1, "do_it": 4, "f": 2, "action": 3, "for": 3, "Integer": 3, "i": 15, "endaction": 3, "endfunction": 7, "any_changes": 2, "b": 12, "||": 7, ".changed": 1, "return": 9, "show": 1, "time": 1, "endpackage": 2, "set_car_state_N": 2, "x": 8, "set_car_state_S": 2, "set_car_state_E": 2, "set_car_state_W": 2, "lampRedNS": 2, "lampAmberNS": 2, "lampGreenNS": 2, "lampRedE": 2, "lampAmberE": 2, "lampGreenE": 2, "lampRedW": 2, "lampAmberW": 2, "lampGreenW": 2, "lampRedPed": 2, "lampAmberPed": 2, "lampGreenPed": 2, "typedef": 3, "enum": 1, "{": 1, "AllRed": 4, "GreenNS": 9, "AmberNS": 5, "GreenE": 8, "AmberE": 5, "GreenW": 8, "AmberW": 5, "GreenPed": 4, "AmberPed": 3, "}": 1, "TLstates": 11, "deriving": 1, "Eq": 1, "Bits": 1, "UInt#": 2, "Time32": 9, "CtrSize": 3, "allRedDelay": 2, "amberDelay": 2, "nsGreenDelay": 2, "ewGreenDelay": 3, "pedGreenDelay": 1, "pedAmberDelay": 1, "clocks_per_sec": 2, "state": 21, "next_green": 8, "secs": 7, "ped_button_pushed": 4, "car_present_N": 3, "car_present_S": 3, "car_present_E": 4, "car_present_W": 4, "car_present_NS": 3, "cycle_ctr": 6, "dec_cycle_ctr": 1, "Rules": 5, "low_priority_rule": 2, "rules": 4, "inc_sec": 1, "endrules": 4, "next_state": 8, "ns": 4, "0": 2, "green_seq": 7, "case": 2, "endcase": 2, "car_present": 4, "make_from_green_rule": 5, "green_state": 2, "delay": 2, "car_is_present": 2, "from_green": 1, "make_from_amber_rule": 5, "amber_state": 2, "ng": 2, "from_amber": 1, "hprs": 10, "7": 1, "1": 1, "2": 1, "3": 1, "4": 1, "5": 1, "6": 1, "fromAllRed": 2, "else": 4, "noAction": 1, "high_priority_rules": 4, "rJoin": 1, "addRules": 1, "preempts": 1 }, "Brainfuck": { "*": 43, "factor": 1, "an": 1, "arbitrarily": 1, "large": 1, "positive": 1, "integer": 1, "Copyright": 1, "(": 6, "C": 1, ")": 6, "by": 2, "Brian": 1, "Raiter": 1, "under": 1, "the": 22, "GNU": 1, "General": 1, "Public": 1, "License": 1, "-": 361, "read": 1, "in": 1, "number": 6, "<<": 645, "<+>": 33, "]": 229, "[": 238, "+": 656, "<[+>": 1, "<": 34, "display": 3, "and": 17, "initialize": 2, "loop": 21, "variable": 9, "to": 7, "two": 1, ".": 26, "<]>": 16, "main": 1, "make": 2, "copies": 2, "of": 3, "<[->": 28, "divide": 1, "double": 1, "divisor": 16, "until": 2, "above": 1, "dividend": 8, "<]]]]]]]]]]]>": 3, "<--------->": 1, "<[-]>": 2, "subtract": 2, "from": 4, "<->": 9, "if": 10, "difference": 1, "is": 3, "nonnegative": 1, "then": 2, "replace": 2, "increment": 2, "quotient": 17, "halve": 1, "zero": 8, "<+++++>": 2, "break": 1, "out": 1, "larger": 1, "than": 1, "<[+[+[+[+[+[+[+[+[+[[-]>": 1, "partially": 1, "<[-]+>": 1, "examine": 1, "remainder": 9, "for": 4, "nonzero": 1, "digits": 1, "decrement": 1, "with": 1, "normalize": 1, "end": 1, "<-]>": 6, "<[>": 5, "<-[>": 3, "<[-]]>": 2, "<+++++++++>": 1, "<.>": 1, "..": 2, "<+++++++++++++++.>": 1, "<.+++.------.--------.>": 1, "Read": 2, "first": 2, "character": 7, "start": 1, "outer": 2, "reading": 2, "Skip": 2, "forward": 4, "Set": 2, "up": 3, "division": 7, "MEMORY": 2, "LAYOUT": 2, "copy": 6, "x": 1, "minus": 2, "1": 1, "enter": 1, "Increase": 1, "/": 4, "reduce": 1, "Normal": 2, "case": 4, "skip": 4, "<[[>": 1, "Special": 2, "move": 2, "back": 3, "increase": 4, "Decrement": 2, "End": 5, ";": 4, "former": 1, "reuse": 1, "space": 1, "a": 2, "flag": 4, "Zero": 4, "that": 1, "unless": 1, "was": 8, "or": 2, "check": 1, "If": 1, "set": 1, "13": 1, "second": 2, "Reduce": 1, "it": 2, "Decrease": 1, "Add": 1, "get": 1, "useful": 1, "add": 1, "jump": 1, "here": 1, "/32": 1, "not": 1, "Clear": 1, "skipped": 1, "Output": 1, "ROT13ed": 1, "clear": 1, "next": 1 }, "Brightscript": { "**": 17, "Simple": 1, "Grid": 2, "Screen": 2, "Demonstration": 1, "App": 1, "Copyright": 1, "(": 32, "c": 1, ")": 31, "Roku": 1, "Inc.": 1, "All": 3, "Rights": 1, "Reserved.": 1, "************************************************************": 2, "Sub": 2, "Main": 1, "set": 2, "to": 10, "go": 1, "time": 1, "get": 1, "started": 1, "while": 4, "gridstyle": 7, "<": 1, "print": 7, ";": 10, "screen": 5, "preShowGridScreen": 2, "showGridScreen": 2, "end": 2, "End": 4, "Set": 1, "the": 17, "configurable": 1, "theme": 3, "attributes": 2, "for": 10, "application": 1, "Configure": 1, "custom": 1, "overhang": 1, "and": 4, "Logo": 1, "are": 2, "artwork": 2, "colors": 1, "offsets": 1, "specific": 1, "app": 1, "******************************************************": 4, "Screens": 1, "can": 2, "make": 1, "slight": 1, "adjustments": 1, "default": 1, "individual": 1, "attributes.": 1, "these": 1, "greyscales": 1, "theme.GridScreenBackgroundColor": 1, "theme.GridScreenMessageColor": 1, "theme.GridScreenRetrievingColor": 1, "theme.GridScreenListNameColor": 1, "used": 1, "in": 3, "theme.CounterTextLeft": 1, "theme.CounterSeparator": 1, "theme.CounterTextRight": 1, "theme.GridScreenLogoHD": 1, "theme.GridScreenLogoOffsetHD_X": 1, "theme.GridScreenLogoOffsetHD_Y": 1, "theme.GridScreenOverhangHeightHD": 1, "theme.GridScreenLogoSD": 1, "theme.GridScreenOverhangHeightSD": 1, "theme.GridScreenLogoOffsetSD_X": 1, "theme.GridScreenLogoOffsetSD_Y": 1, "theme.GridScreenFocusBorderSD": 1, "theme.GridScreenFocusBorderHD": 1, "use": 1, "your": 1, "own": 1, "description": 1, "background": 1, "theme.GridScreenDescriptionOffsetSD": 1, "theme.GridScreenDescriptionOffsetHD": 1, "return": 5, "Function": 5, "Perform": 1, "any": 1, "startup/initialization": 1, "stuff": 1, "prior": 1, "style": 6, "as": 2, "string": 3, "As": 3, "Object": 2, "m.port": 3, "CreateObject": 2, "screen.SetMessagePort": 1, "screen.": 1, "The": 1, "will": 3, "show": 1, "retreiving": 1, "categoryList": 4, "getCategoryList": 1, "[": 3, "]": 4, "+": 1, "screen.setupLists": 1, "categoryList.count": 2, "screen.SetListNames": 1, "StyleButtons": 3, "getGridControlButtons": 1, "screen.SetContentList": 2, "i": 3, "-": 15, "getShowsForCategoryItem": 1, "screen.Show": 1, "true": 1, "msg": 3, "wait": 1, "getmessageport": 1, "does": 1, "not": 2, "work": 1, "on": 1, "gridscreen": 1, "type": 2, "if": 3, "then": 3, "msg.GetMessage": 1, "msg.GetIndex": 3, "msg.getData": 2, "msg.isListItemFocused": 1, "else": 1, "msg.isListItemSelected": 1, "row": 2, "selection": 3, "yes": 1, "so": 2, "we": 3, "come": 1, "back": 1, "with": 2, "new": 1, ".Title": 1, "endif": 1, "**********************************************************": 1, "this": 3, "function": 1, "passing": 1, "an": 1, "roAssociativeArray": 2, "be": 2, "sufficient": 1, "springboard": 2, "display": 2, "add": 1, "code": 1, "create": 1, "now": 1, "do": 1, "nothing": 1, "Return": 1, "list": 1, "of": 5, "categories": 1, "filter": 1, "all": 1, "categories.": 1, "just": 2, "static": 1, "data": 2, "example.": 1, "********************************************************************": 1, "ContentMetaData": 1, "objects": 1, "shows": 1, "category.": 1, "For": 1, "example": 1, "cheat": 1, "but": 2, "ideally": 1, "you": 1, "dynamically": 1, "content": 2, "each": 1, "category": 1, "is": 1, "dynamic": 1, "s": 1, "one": 3, "small": 1, "step": 1, "a": 4, "man": 1, "giant": 1, "leap": 1, "mankind.": 1, "http": 14, "//upload.wikimedia.org/wikipedia/commons/1/1e/Apollo_11_first_step.jpg": 2, "I": 2, "have": 2, "Dream": 1, "PG": 1, "dream": 1, "that": 1, "my": 1, "four": 1, "little": 1, "children": 1, "day": 1, "live": 1, "nation": 1, "where": 1, "they": 1, "judged": 1, "by": 2, "color": 1, "their": 2, "skin": 1, "character.": 1, "//upload.wikimedia.org/wikipedia/commons/8/81/Martin_Luther_King_": 2, "_March_on_Washington.jpg": 2, "Flat": 6, "Movie": 2, "HD": 6, "x2": 4, "SD": 5, "Netflix": 1, "//upload.wikimedia.org/wikipedia/commons/4/43/Gold_star_on_blue.gif": 2, "Landscape": 1, "x3": 6, "Channel": 1, "Store": 1, "//upload.wikimedia.org/wikipedia/commons/thumb/9/96/Dunkery_Hill.jpg/800px": 2, "Dunkery_Hill.jpg": 2, "Portrait": 1, "x4": 1, "posters": 3, "//upload.wikimedia.org/wikipedia/commons/9/9f/Kane_George_Gurnett.jpg": 2, "Square": 1, "x1": 1, "//upload.wikimedia.org/wikipedia/commons/thumb/d/de/SQUARE_SHAPE.svg/536px": 2, "SQUARE_SHAPE.svg.png": 2, "x9": 1, "//upload.wikimedia.org/wikipedia/commons/thumb/2/22/": 2, "%": 8, "C3": 4, "cran_TV_plat.svg/200px": 2, "cran_TV_plat.svg.png": 2, "}": 1, "buttons": 1 }, "C": { "#include": 258, "": 7, "void": 347, "set_vgabasemem": 2, "(": 6745, ")": 6782, "{": 1668, "ULONG": 1, "vgabase": 3, ";": 6170, "SELECTOR": 1, "tmp": 20, "asm": 1, "mov": 1, "[": 1393, "]": 1393, "ds": 1, "dpmi_get_sel_base": 1, "&": 387, "vgabasemem": 3, "char": 577, "*": 535, "-": 1845, "+": 748, "}": 1687, "drw_chdis": 4, "int": 488, "mode": 7, "//": 413, "change": 2, "the": 126, "display": 3, "regs.b.ah": 1, "seet": 1, "theh": 1, "moode": 1, "regs.b.al": 1, "it": 40, "to": 54, "like": 2, "innit": 1, "regs.h.flags": 1, "Set": 3, "dingoes": 1, "kidneys": 1, "out": 10, "of": 60, "FLAGS": 1, "eh": 1, "regs.h.ss": 1, "Like": 1, "totally": 1, "set": 2, "stack": 28, "segment": 1, "regs.h.sp": 1, "tha": 1, "pointaaaaahhhhh": 1, "dpmi_simulate_real_interrupt": 1, "regs": 2, "drw_pix": 2, "x": 117, "y": 62, "enum": 47, "COLORS": 12, "col": 28, "*VGAPIX": 6, "drw_line": 6, "x0": 10, "y0": 10, "x1": 10, "y1": 9, "stp": 3, "abs": 5, "dx": 4, "dy": 3, "err": 21, "yi": 5, "i": 441, "j": 217, "excrement": 1, "if": 978, "/": 30, "<": 211, "else": 163, "for": 109, "drw_rectl": 2, "w": 21, "h": 12, "drw_rectf": 2, "drw_circl": 1, "rad": 3, "mang": 3, "max": 5, "angle": 1, "haha": 1, "px": 4, "py": 4, "Yeah": 1, "yeah": 1, "I": 1, "ll": 1, "switch": 47, "later": 1, "cos": 15, "*rad": 2, "causes": 1, "some": 2, "really": 1, "cools": 1, "effects": 1, "D": 1, "sin": 17, "drw_tex": 2, "tex": 3, "i*w": 1, "j*w": 1, "D_init": 2, "D_exit": 2, "#ifndef": 98, "__2DGFX": 2, "#define": 1015, "": 10, "": 1, "": 1, "VGAPIX": 1, "DPMI_REGS": 1, "//void": 1, "setvgabasemem": 1, "draw_func_change_display": 1, "drw_cirl": 1, "#endif": 261, "ARDUINO_CATS_ARDUINO": 3, "": 1, "delay_int": 1, "ms": 4, "delay": 2, "delay_ulint": 1, "random_int_1": 1, "random": 4, "random_int_2": 1, "random_lint_1": 1, "random_lint_2": 1, "randomSeed_int": 1, "randomSeed": 2, "randomSeed_uint": 1, "": 1, "unsigned": 158, "__bump_up": 3, "n": 92, "base": 5, "while": 74, "sizeof": 75, "|": 117, "return": 600, "*__array_alloc": 2, "size_t": 77, "size": 130, "length": 70, "allocated": 9, "struct": 487, "__array_header": 4, "*head": 4, "malloc": 5, "assert": 38, "head": 8, "__array_resize": 5, "**array": 2, "difference": 3, "__header": 5, "array": 36, "elem": 8, "ARRAY_H": 2, "value": 39, "": 8, "": 5, "": 7, "type": 51, "name": 36, "initial_length": 2, "*name": 13, "__array_alloc": 1, "aforeach": 1, "alength": 9, "afree": 1, "free": 74, "apush": 1, "**": 9, "*array": 6, "apop": 1, "aremove": 2, "index": 77, "memmove": 3, "ainsert": 1, "acontains": 1, "__array_search": 2, "__arrayallocated": 1, "*elem": 1, "#ifdef": 65, "__SUNPRO_C": 1, "#pragma": 22, "align": 1, "ArrowLeft": 3, "__GNUC__": 12, "static": 554, "const": 350, "uint8_t": 26, "__attribute__": 11, "__aligned__": 1, "#else": 106, "once": 14, "typedef": 227, "uint32_t": 210, "numbits": 2, "uint32_t*": 35, "bits": 1, "bitmap_t": 7, "bitmap_init": 1, "bitmap_get": 1, "bitmap": 5, "bitnum": 3, "bitmap_set": 1, "bitmap_clear": 1, "bitmap_clearAll": 1, "bitmap_findFirstClear": 1, "*blob_type": 2, "blob": 6, "*lookup_blob": 2, "*sha1": 16, "object": 41, "*obj": 9, "lookup_object": 2, "sha1": 20, "obj": 48, "create_object": 2, "OBJ_BLOB": 3, "alloc_blob_node": 1, "error": 102, "sha1_to_hex": 8, "typename": 2, "NULL": 324, "parse_blob_buffer": 2, "*item": 15, "*buffer": 12, "long": 95, "item": 64, "object.parsed": 4, "BLOB_H": 2, "extern": 45, "BOOTSTRAP_H": 2, "*true": 1, "*false": 1, "*eof": 1, "*empty_list": 1, "*global_enviroment": 1, "obj_type": 1, "scm_bool": 1, "scm_empty_list": 1, "scm_eof": 1, "scm_char": 1, "scm_int": 1, "scm_pair": 1, "scm_symbol": 1, "scm_prim_fun": 1, "scm_lambda": 1, "scm_str": 1, "scm_file": 1, "*eval_proc": 1, "*maybe_add_begin": 1, "*code": 2, "init_enviroment": 1, "*env": 4, "eval_err": 1, "*msg": 14, "noreturn": 1, "define_var": 1, "*var": 4, "*val": 6, "set_var": 1, "*get_var": 1, "*cond2nested_if": 1, "*cond": 1, "*let2lambda": 1, "*let": 1, "*and2nested_if": 1, "*and": 1, "*or2nested_if": 1, "*or": 1, "": 13, "background": 1, "foreground": 1, "console_color_t": 3, "CONSOLE_COLOR_BLACK": 1, "CONSOLE_COLOR_BLUE": 1, "CONSOLE_COLOR_GREEN": 1, "CONSOLE_COLOR_CYAN": 1, "CONSOLE_COLOR_RED": 1, "CONSOLE_COLOR_MAGENTA": 1, "CONSOLE_COLOR_BROWN": 1, "CONSOLE_COLOR_LGREY": 1, "CONSOLE_COLOR_DGREY": 1, "CONSOLE_COLOR_LBLUE": 1, "CONSOLE_COLOR_LGREEN": 1, "CONSOLE_COLOR_LCYAN": 1, "CONSOLE_COLOR_LRED": 1, "CONSOLE_COLOR_LMAGENTA": 1, "CONSOLE_COLOR_YELLOW": 1, "CONSOLE_COLOR_WHITE": 1, "save_commit_buffer": 3, "*commit_type": 2, "commit": 59, "*check_commit": 1, "quiet": 5, "OBJ_COMMIT": 5, "*lookup_commit_reference_gently": 2, "deref_tag": 1, "parse_object": 1, "check_commit": 2, "*lookup_commit_reference": 2, "lookup_commit_reference_gently": 1, "*lookup_commit_or_die": 2, "*ref_name": 2, "*c": 69, "lookup_commit_reference": 2, "c": 248, "die": 5, "_": 3, "ref_name": 2, "hashcmp": 2, "object.sha1": 8, "warning": 1, "*lookup_commit": 2, "alloc_commit_node": 1, "*lookup_commit_reference_by_name": 2, "*commit": 10, "get_sha1": 1, "||": 127, "parse_commit": 3, "parse_commit_date": 2, "*buf": 12, "*tail": 2, "*dateptr": 1, "buf": 87, "tail": 13, "memcmp": 6, "&&": 222, "dateptr": 2, "strtoul": 2, "commit_graft": 13, "**commit_graft": 1, "commit_graft_alloc": 4, "commit_graft_nr": 5, "commit_graft_pos": 2, "lo": 6, "hi": 5, "mi": 5, "*graft": 3, "cmp": 6, "graft": 10, "register_commit_graft": 2, "ignore_dups": 2, "pos": 7, "alloc_nr": 1, "xrealloc": 2, "parse_commit_buffer": 3, "buffer": 30, "*bufptr": 1, "parent": 12, "commit_list": 35, "**pptr": 1, "<=>": 18, "bufptr": 12, "46": 1, "tree": 3, "5": 1, "45": 1, "bogus": 1, "s": 188, "get_sha1_hex": 2, "lookup_tree": 1, "pptr": 5, "parents": 4, "lookup_commit_graft": 1, "*new_parent": 2, "48": 1, "7": 1, "47": 1, "bad": 1, "in": 18, "nr_parent": 3, "grafts_replace_parents": 1, "continue": 17, "new_parent": 6, "lookup_commit": 2, "commit_list_insert": 2, "next": 21, "date": 5, "object_type": 1, "ret": 124, "read_sha1_file": 1, "find_commit_subject": 2, "*commit_buffer": 2, "**subject": 2, "*eol": 1, "*p": 7, "commit_buffer": 1, "a": 89, "b_date": 3, "b": 48, "a_date": 2, "*commit_list_get_next": 1, "*a": 3, "commit_list_set_next": 1, "*next": 8, "commit_list_sort_by_date": 2, "**list": 5, "*list": 4, "llist_mergesort": 1, "peel_to_type": 1, "util": 3, "merge_remote_desc": 3, "*desc": 1, "desc": 5, "xmalloc": 2, "strdup": 4, "**commit_list_append": 2, "**next": 2, "*new": 1, "new": 4, "COMMIT_H": 2, "*util": 1, "indegree": 1, "*parents": 4, "*tree": 3, "decoration": 1, "name_decoration": 3, "*commit_list_insert": 1, "commit_list_count": 1, "*l": 1, "*commit_list_insert_by_date": 1, "free_commit_list": 1, "cmit_fmt": 3, "CMIT_FMT_RAW": 1, "CMIT_FMT_MEDIUM": 2, "CMIT_FMT_DEFAULT": 1, "CMIT_FMT_SHORT": 1, "CMIT_FMT_FULL": 1, "CMIT_FMT_FULLER": 1, "CMIT_FMT_ONELINE": 1, "CMIT_FMT_EMAIL": 1, "CMIT_FMT_USERFORMAT": 1, "CMIT_FMT_UNSPECIFIED": 1, "pretty_print_context": 6, "fmt": 4, "abbrev": 1, "*subject": 1, "*after_subject": 1, "preserve_subject": 1, "date_mode": 2, "date_mode_explicit": 1, "need_8bit_cte": 2, "show_notes": 1, "reflog_walk_info": 1, "*reflog_info": 1, "*output_encoding": 2, "userformat_want": 2, "notes": 1, "has_non_ascii": 1, "*text": 1, "rev_info": 2, "*logmsg_reencode": 1, "*reencode_commit_message": 1, "**encoding_p": 1, "get_commit_format": 1, "*arg": 1, "*format_subject": 1, "strbuf": 12, "*sb": 7, "*line_separator": 1, "userformat_find_requirements": 1, "*fmt": 2, "*w": 2, "format_commit_message": 1, "*format": 6, "*context": 1, "pretty_print_commit": 1, "*pp": 4, "pp_commit_easy": 1, "pp_user_info": 1, "*what": 1, "*line": 2, "*encoding": 2, "pp_title_line": 1, "**msg_p": 2, "pp_remainder": 1, "indent": 1, "*pop_most_recent_commit": 1, "mark": 9, "*pop_commit": 1, "**stack": 2, "clear_commit_marks": 1, "clear_commit_marks_for_object_array": 1, "object_array": 2, "sort_in_topological_order": 1, "list": 9, "lifo": 1, "FLEX_ARRAY": 1, "*read_graft_line": 1, "len": 34, "*lookup_commit_graft": 1, "*get_merge_bases": 1, "*rev1": 1, "*rev2": 1, "cleanup": 12, "*get_merge_bases_many": 1, "*one": 1, "**twos": 1, "*get_octopus_merge_bases": 1, "*in": 1, "register_shallow": 1, "unregister_shallow": 1, "for_each_commit_graft": 1, "each_commit_graft_fn": 1, "is_repository_shallow": 1, "*get_shallow_commits": 1, "*heads": 2, "depth": 2, "shallow_flag": 1, "not_shallow_flag": 1, "is_descendant_of": 1, "in_merge_bases": 1, "interactive_add": 1, "argc": 31, "**argv": 6, "*prefix": 3, "patch": 1, "run_add_interactive": 1, "*revision": 1, "*patch_mode": 1, "**pathspec": 1, "inline": 4, "single_parent": 1, "*reduce_heads": 1, "commit_extra_header": 7, "*key": 6, "*value": 5, "append_merge_tag_headers": 1, "***tail": 1, "commit_tree": 1, "*ret": 20, "*author": 2, "*sign_commit": 2, "commit_tree_extended": 1, "*read_commit_extra_headers": 1, "*read_commit_extra_header_lines": 1, "free_commit_extra_headers": 1, "*extra": 1, "merge_remote_util": 1, "*get_merge_parent": 1, "parse_signed_commit": 1, "*message": 1, "*signature": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "SSL_CUSTOM_EXTENSION_free": 3, "SSL_CUSTOM_EXTENSION": 11, "*custom_extension": 1, "OPENSSL_free": 1, "custom_extension": 1, "*custom_ext_find": 1, "STACK_OF": 3, "*stack": 4, "*out_index": 2, "uint16_t": 44, "sk_SSL_CUSTOM_EXTENSION_num": 4, "*ext": 4, "sk_SSL_CUSTOM_EXTENSION_value": 2, "ext": 41, "out_index": 1, "default_add_callback": 3, "SSL": 11, "*ssl": 6, "extension_value": 10, "**out": 1, "*out_len": 2, "*out_alert_value": 1, "*add_arg": 4, "ssl": 22, "server": 5, "custom_ext_add_hello": 3, "CBB": 4, "*extensions": 3, "ctx": 66, "client_custom_extensions": 3, "server_custom_extensions": 3, "s3": 6, "tmp.custom_extensions.received": 3, "<<": 63, "*contents": 1, "contents_len": 5, "alert": 3, "SSL_AD_DECODE_ERROR": 2, "contents_cbb": 3, "add_callback": 2, "contents": 4, "add_arg": 7, "case": 275, "CBB_add_u16": 1, "extensions": 6, "CBB_add_u16_length_prefixed": 1, "CBB_add_bytes": 1, "CBB_flush": 1, "OPENSSL_PUT_ERROR": 5, "ERR_R_INTERNAL_ERROR": 1, "ERR_add_error_dataf": 5, "free_callback": 5, "tmp.custom_extensions.sent": 4, "break": 246, "default": 34, "ssl3_send_alert": 1, "SSL3_AL_FATAL": 1, "SSL_R_CUSTOM_EXTENSION_ERROR": 3, "custom_ext_add_clienthello": 1, "custom_ext_parse_serverhello": 1, "*out_alert": 3, "CBS": 2, "*extension": 2, "custom_ext_find": 3, "SSL_R_UNEXPECTED_EXTENSION": 1, "parse_callback": 5, "CBS_data": 2, "extension": 4, "CBS_len": 2, "out_alert": 2, "parse_arg": 6, "custom_ext_parse_clienthello": 1, "custom_ext_add_serverhello": 1, "MAX_NUM_CUSTOM_EXTENSIONS": 2, "ssl3_state_st": 1, "custom_ext_append": 3, "SSL_custom_ext_add_cb": 3, "add_cb": 9, "SSL_custom_ext_free_cb": 3, "free_cb": 6, "SSL_custom_ext_parse_cb": 3, "parse_cb": 6, "*parse_arg": 3, "SSL_extension_supported": 1, "0": 14, "OPENSSL_malloc": 1, "sk_SSL_CUSTOM_EXTENSION_new_null": 1, "sk_SSL_CUSTOM_EXTENSION_push": 1, "sk_SSL_CUSTOM_EXTENSION_free": 1, "SSL_CTX_add_client_custom_ext": 1, "SSL_CTX": 2, "*ctx": 18, "SSL_CTX_add_server_custom_ext": 1, "": 3, "CONSOLE_DRV_CAP_CLEAR": 1, "CONSOLE_DRV_CAP_SCROLL": 1, "CONSOLE_DRV_CAP_SET_CURSOR": 1, "bool": 36, "shift_left": 1, "shift_right": 1, "control_left": 1, "control_right": 1, "alt": 1, "super": 1, "console_modifiers_t": 1, "character": 12, "console_modifiers_t*": 1, "modifiers": 1, "console_read_t": 1, "capabilities": 1, "scroll": 1, "console_info_t*": 2, "int32_t": 115, "setCursor": 1, "console_driver_t": 5, "": 1, "ELF_TYPE_NONE": 1, "ELF_TYPE_REL": 1, "ELF_TYPE_EXEC": 1, "ELF_TYPE_DYN": 1, "ELF_TYPE_CORE": 1, "ELF_ARCH_NONE": 1, "ELF_ARCH_386": 1, "ELF_VERSION_CURRENT": 1, "magic": 1, "pad": 1, "packed": 8, "elf_ident_t": 2, "offset": 8, "void*": 144, "virtaddr": 1, "physaddr": 1, "filesize": 1, "memsize": 1, "flags": 89, "alignment": 1, "elf_program_t": 1, "ident": 1, "machine": 1, "version": 6, "entry": 3, "phoff": 1, "shoff": 1, "ehsize": 1, "phentsize": 1, "phnum": 1, "shentsize": 1, "shnum": 1, "shstrndx": 1, "elf_t": 1, "task_t*": 8, "elf_load": 1, "elf_t*": 1, "bin": 1, "char*": 182, "char**": 15, "environ": 8, "argv": 58, "elf_load_file": 1, "path": 9, "HAVE_CONFIG_H": 1, "": 1, "": 1, "": 1, "": 1, "ZEPHIR_INIT_CLASS": 2, "Test_Router_Exception": 2, "ZEPHIR_REGISTER_CLASS_EX": 1, "Test": 1, "Router": 1, "Exception": 1, "test": 2, "router_exception": 1, "zend_exception_get_default": 1, "TSRMLS_C": 1, "SUCCESS": 1, "zend_class_entry": 1, "*test_router_exception_ce": 1, "SHEBANG#!tcc": 1, "_XOPEN_SOURCE": 1, "": 4, "": 5, "": 2, "": 2, "": 2, "": 1, "ADDRESS_SPACE_LIMIT": 3, "": 3, "#if": 103, "defined": 55, "ATTRIBUTE_PRINTF": 3, "format": 11, "printf": 12, "N_ELEMENTS": 2, "*strdup_printf": 1, "...": 130, "strdup_vprintf": 3, "va_list": 7, "ap": 15, "aq": 4, "va_copy": 1, "vsnprintf": 3, "va_end": 6, "strdup_printf": 4, "va_start": 5, "*result": 1, "result": 37, "*s": 9, "///": 22, "Buffer": 1, "data": 72, "alloc": 10, "Number": 3, "bytes": 227, "used": 12, "memory_failure": 8, "Memory": 5, "allocation": 4, "failed": 3, "BUFFER_INITIALIZER": 2, "false": 92, "buffer_append": 5, "*self": 10, "self": 36, "realloc": 2, "true": 82, "memcpy": 31, "buffer_append_c": 8, "item_type": 2, "ITEM_STRING": 3, "ITEM_WORD": 2, "ITEM_INTEGER": 2, "ITEM_FLOAT": 2, "ITEM_LIST": 8, "ITEM_HEADER": 3, "item_string": 3, "Length": 1, "string": 28, "sans": 1, "The": 9, "null": 5, "terminated": 2, "get_string": 1, "It": 2, "looks": 1, "but": 4, "doesn": 2, "f": 179, "X": 1, "cursor": 3, "buf.memory_failure": 2, "PARSE_ERROR_MEMORY": 2, "buf.len": 3, "PARSE_ERROR_INVALID_INPUT": 1, "new_word": 1, "buf.s": 5, "*parse_item_list": 1, "tokenizer": 2, "parse_list": 1, "parse_item_list": 1, "PARSE_ERROR_EOF": 1, "item_free_list": 4, "fn": 13, "link": 3, "chain": 2, "handler_fn": 1, "handler": 3, "Internal": 1, "C": 6, "or": 7, "*script": 5, "Alternatively": 1, "runtime": 1, "code": 19, "function": 40, "*g_functions": 1, "Maps": 1, "words": 1, "functions": 5, "context_init": 2, "context": 8, "stack_size": 1, "reduction_count": 1, "reduction_limit": 1, "error_is_fatal": 1, "user_data": 2, "context_free": 2, "set_error": 3, "push": 9, "is": 29, "This": 4, "creates": 2, "form": 1, "trace": 1, "*tmp": 2, "free_function": 2, "*fn": 1, "script": 14, "unregister_function": 1, "**iter": 1, "g_functions": 2, "*iter": 2, "iter": 11, "get_list": 5, "success": 11, "new_integer": 1, "item_free": 10, "defn": 9, "fn_dup": 1, "check_stack": 9, "new_clone": 1, "fn_drop": 1, "pop": 13, "fn_swap": 1, "*second": 1, "*first": 1, "second": 1, "first": 4, "fn_call": 1, "check_type": 5, "execute": 4, "fn_dip": 1, "fn_unit": 1, "new_list": 1, "fn_cons": 1, "item_list": 1, "fn_cat": 1, "*scnd": 1, "*frst": 1, "frst": 2, "scnd": 2, "XXX": 1, "we": 13, "shouldn": 1, "boolean": 1, "cannot": 9, "multiply": 2, "by": 8, "negative": 1, "%": 15, "exponentiate": 1, "division": 2, "zero": 4, "divide": 2, "add": 1, "subtract": 1, "compare": 2, "invalid": 3, "time": 12, "r": 61, "t": 30, "item_to_str": 4, "*x": 3, "string_to_str": 1, "item_word": 2, "*word": 1, "word": 3, "get_integer": 1, "goto": 138, "alloc_failure": 3, "strlen": 21, "get_float": 1, "item_list_to_str": 2, "bit": 1, "hackish": 1, "simplifies": 1, "stuff": 1, "message": 11, "Message": 1, "prefix": 9, "*command": 2, "IRC": 2, "command": 6, "*params": 3, "Command": 2, "parameters": 2, "n_params": 5, "present": 2, "cut_word": 5, "**s": 1, "*start": 1, "*end": 2, "strcspn": 2, "end": 53, "strspn": 2, "start": 12, "parse_message": 2, "memset": 3, "msg": 32, "Ignore": 1, "tags": 1, "Prefix": 1, "Parameters": 1, "params": 7, "read_message": 3, "discard": 4, "discard_this": 3, "do": 24, "fgets": 2, "stdin": 3, "Just": 1, "be": 9, "on": 6, "safe": 1, "side": 1, "line": 5, "overflows": 1, "our": 3, "ignore": 1, "everything": 1, "up": 2, "until": 1, "line.": 1, "strcmp": 16, "Invalid": 1, "messages": 1, "are": 11, "silently": 1, "ignored": 1, "BOT_PRINT": 3, "get_config": 2, "key": 11, "exit": 21, "EXIT_FAILURE": 1, "init_runtime_library_scripts": 2, "ok": 9, "parsing": 1, "unit": 2, "integer": 2, "float": 233, "dup": 1, "drop": 1, "swap": 9, "call": 5, "dip": 1, "try": 1, "map": 1, "filter": 4, "fold": 1, "each": 1, "cons": 1, "cat": 1, "uncons": 1, "<\",>": 1, "fn_lt": 1, "Logical": 1, "operations": 2, "register_handler": 7, "not": 10, "fn_not": 1, "and": 23, "fn_and": 1, "fn_or": 1, "Utilities": 1, "rand": 1, "fn_rand": 1, "fn_time": 1, "strftime": 2, "fn_strftime": 1, "free_runtime_library": 2, "read_db": 2, "TODO": 3, "write_db": 1, "*g_prefix": 1, "user_info": 3, "Context": 2, "channel": 1, "user": 3, "*ctx_quote": 1, "Reply": 1, "quotation": 1, "fn_dot": 2, "*info": 5, "info": 69, "ctx_quote": 1, "process_message": 2, "strcasecmp": 15, "Filter": 1, "only": 1, "commands": 4, "prefix_len": 3, "g_prefix": 4, "strncmp": 1, "Retrieve": 1, "information": 1, "how": 2, "respond": 1, "back": 2, "*msg_ctx": 1, "strchr": 2, "msg_ctx": 6, "*msg_ctx_quote": 1, "msg_ctx_quote": 7, "info.ctx": 1, "info.ctx_quote": 1, "Finally": 1, "parse": 2, "macro": 3, "*error": 1, "ctx.user_data": 1, "*failure": 1, "ctx.memory_failure": 1, "failure": 4, "ctx.error": 2, "main": 4, "*argv": 7, "freopen": 2, "setvbuf": 2, "_IOLBF": 2, "BUFSIZ": 2, "stdout": 7, "rlimit": 2, "limit": 5, ".rlim_cur": 1, ".rlim_max": 1, "Lower": 1, "memory": 7, "limits": 1, "something": 1, "sensible": 1, "prevent": 1, "abuse": 1, "setrlimit": 2, "RLIMIT_AS": 1, "init_runtime_library": 1, "": 2, "console_filter": 2, "General": 1, "callback": 2, "all": 4, "actions": 1, "etc.": 1, "Preferred": 3, "prototype": 3, "": 3, "console_info_t": 5, "*input": 2, "*output": 2, "Specific": 1, "callbacks": 4, "read": 5, "write": 11, "console_filter*": 1, "console_filter_t": 1, "": 1, "": 1, "": 1, "system_node": 8, "root": 13, "clone": 3, "pipe_end": 4, "*endself": 2, "*endtarget": 2, "service_state": 6, "*state": 7, "count": 35, "buffer_rcfifo": 1, "endself": 3, "endtarget": 4, "node.refcount": 1, "list_add": 2, "readlinks": 2, "state": 117, "task_setstatus": 2, "link.data": 2, "TASK_STATUS_BLOCKED": 2, "system_wakeup": 2, "writelinks": 2, "buffer_wcfifo": 1, "end0_read": 2, "pipe": 40, "*pipe": 8, "end0": 4, "end1": 4, "end0_write": 2, "end1_read": 2, "end1_write": 2, "clone_child": 2, "*path": 1, "list_item": 1, "*current": 1, "current": 8, "root.children.head": 1, "*node": 1, "node": 3, "end0.node.refcount": 1, "end1.node.refcount": 1, "child": 1, "pipe_init": 1, "buffer_init": 2, "end0.buffer": 1, "end0.data": 1, "end1.buffer": 1, "end1.data": 1, "system_initnode": 5, "end0.node": 2, "SYSTEM_NODETYPE_NORMAL": 2, "end1.node": 2, "end0.node.read": 1, "end0.node.write": 1, "end1.node.read": 1, "end1.node.write": 1, "SYSTEM_NODETYPE_GROUP": 3, "SYSTEM_NODETYPE_MULTI": 1, "system_addchild": 4, "pipe_register": 1, "pipe_unregister": 1, "system_removechild": 1, "module_init": 1, "clone.child": 1, "module_register": 1, "system_registernode": 1, "module_unregister": 1, "system_unregisternode": 1, "git_usage_string": 2, "git_more_info_string": 2, "N_": 1, "startup_info": 3, "git_startup_info": 2, "use_pager": 8, "pager_config": 3, "*cmd": 5, "want": 3, "pager_command_config": 2, "*data": 11, "prefixcmp": 3, "var": 7, "cmd": 46, "git_config_maybe_bool": 1, "xstrdup": 2, "check_pager_config": 3, "c.cmd": 1, "c.want": 2, "c.value": 3, "git_config": 1, "pager_program": 1, "commit_pager_choice": 4, "setenv": 1, "setup_pager": 1, "handle_options": 2, "***argv": 2, "*argc": 1, "*envchanged": 1, "**orig_argv": 1, "new_argv": 7, "option_count": 1, "alias_command": 4, "trace_argv_printf": 3, "*argcp": 4, "subdir": 3, "chdir": 2, "die_errno": 3, "errno": 20, "saved_errno": 1, "git_version_string": 1, "GIT_VERSION": 1, "RUN_SETUP": 81, "RUN_SETUP_GENTLY": 16, "USE_PAGER": 3, "NEED_WORK_TREE": 18, "cmd_struct": 4, "option": 9, "run_builtin": 2, "status": 20, "help": 4, "stat": 3, "st": 2, "p": 50, "setup_git_directory": 1, "nongit_ok": 2, "setup_git_directory_gently": 1, "have_repository": 1, "trace_repo_setup": 1, "setup_work_tree": 1, "fstat": 1, "fileno": 1, "S_ISFIFO": 1, "st.st_mode": 2, "S_ISSOCK": 1, "fflush": 2, "ferror": 2, "fclose": 5, "handle_internal_command": 3, "cmd_add": 2, "cmd_annotate": 1, "cmd_apply": 1, "cmd_archive": 1, "cmd_bisect__helper": 1, "cmd_blame": 2, "cmd_branch": 1, "cmd_bundle": 1, "cmd_cat_file": 1, "cmd_check_attr": 1, "cmd_check_ref_format": 1, "cmd_checkout": 1, "cmd_checkout_index": 1, "cmd_cherry": 1, "cmd_cherry_pick": 1, "cmd_clean": 1, "cmd_clone": 1, "cmd_column": 1, "cmd_commit": 1, "cmd_commit_tree": 1, "cmd_config": 1, "cmd_count_objects": 1, "cmd_describe": 1, "cmd_diff": 1, "cmd_diff_files": 1, "cmd_diff_index": 1, "cmd_diff_tree": 1, "cmd_fast_export": 1, "cmd_fetch": 1, "cmd_fetch_pack": 1, "cmd_fmt_merge_msg": 1, "cmd_for_each_ref": 1, "cmd_format_patch": 1, "cmd_fsck": 2, "cmd_gc": 1, "cmd_get_tar_commit_id": 1, "cmd_grep": 1, "cmd_hash_object": 1, "cmd_help": 1, "cmd_index_pack": 1, "cmd_init_db": 2, "cmd_log": 1, "cmd_ls_files": 1, "cmd_ls_remote": 2, "cmd_ls_tree": 1, "cmd_mailinfo": 1, "cmd_mailsplit": 1, "cmd_merge": 1, "cmd_merge_base": 1, "cmd_merge_file": 1, "cmd_merge_index": 1, "cmd_merge_ours": 1, "cmd_merge_recursive": 4, "cmd_merge_tree": 1, "cmd_mktag": 1, "cmd_mktree": 1, "cmd_mv": 1, "cmd_name_rev": 1, "cmd_notes": 1, "cmd_pack_objects": 1, "cmd_pack_redundant": 1, "cmd_pack_refs": 1, "cmd_patch_id": 1, "cmd_prune": 1, "cmd_prune_packed": 1, "cmd_push": 1, "cmd_read_tree": 1, "cmd_receive_pack": 1, "cmd_reflog": 1, "cmd_remote": 1, "cmd_remote_ext": 1, "cmd_remote_fd": 1, "cmd_replace": 1, "cmd_repo_config": 1, "cmd_rerere": 1, "cmd_reset": 1, "cmd_rev_list": 1, "cmd_rev_parse": 1, "cmd_revert": 1, "cmd_rm": 1, "cmd_send_pack": 1, "cmd_shortlog": 1, "cmd_show": 1, "cmd_show_branch": 1, "cmd_show_ref": 1, "cmd_status": 1, "cmd_stripspace": 1, "cmd_symbolic_ref": 1, "cmd_tag": 1, "cmd_tar_tree": 1, "cmd_unpack_file": 1, "cmd_unpack_objects": 1, "cmd_update_index": 1, "cmd_update_ref": 1, "cmd_update_server_info": 1, "cmd_upload_archive": 1, "cmd_upload_archive_writer": 1, "cmd_var": 1, "cmd_verify_pack": 1, "cmd_verify_tag": 1, "cmd_version": 1, "cmd_whatchanged": 1, "cmd_write_tree": 1, "STRIP_EXTENSION": 1, "*argv0": 1, "argv0": 2, "ARRAY_SIZE": 1, "execv_dashed_external": 2, "STRBUF_INIT": 1, "strbuf_addf": 1, "cmd.buf": 1, "run_command_v_opt": 1, "RUN_SILENT_EXEC_FAILURE": 1, "RUN_CLEAN_ON_EXIT": 1, "ENOENT": 3, "strbuf_release": 1, "run_argv": 2, "done_alias": 4, "argcp": 2, "handle_alias": 1, "git_extract_argv0_path": 1, "git_setup_gettext": 1, "list_common_cmds_help": 1, "setup_path": 1, "done_help": 3, "was_alias": 3, "fprintf": 18, "stderr": 15, "help_unknown_cmd": 1, "strerror": 4, "__GLK_MATRIX_4_H": 2, "": 3, "__ARM_NEON__": 13, "": 1, "": 1, "": 1, "": 1, "": 1, "__cplusplus": 22, "Prototypes": 1, "GLKMatrix4": 183, "GLKMatrix4Identity": 3, "__inline__": 95, "GLKMatrix4Make": 2, "m00": 6, "m01": 6, "m02": 6, "m03": 6, "m10": 6, "m11": 6, "m12": 6, "m13": 6, "m20": 6, "m21": 6, "m22": 6, "m23": 6, "m30": 6, "m31": 6, "m32": 6, "m33": 6, "GLKMatrix4MakeAndTranspose": 2, "GLKMatrix4MakeWithArray": 2, "values": 67, "GLKMatrix4MakeWithArrayAndTranspose": 2, "GLKMatrix4MakeWithRows": 2, "GLKVector4": 44, "row0": 2, "row1": 2, "row2": 2, "row3": 2, "GLKMatrix4MakeWithColumns": 2, "column0": 2, "column1": 2, "column2": 2, "column3": 2, "GLKMatrix4MakeWithQuaternion": 2, "GLKQuaternion": 2, "quaternion": 4, "GLKMatrix4MakeTranslation": 2, "tx": 8, "ty": 8, "tz": 8, "GLKMatrix4MakeScale": 2, "sx": 10, "sy": 10, "sz": 10, "GLKMatrix4MakeRotation": 5, "radians": 34, "z": 64, "GLKMatrix4MakeXRotation": 3, "GLKMatrix4MakeYRotation": 3, "GLKMatrix4MakeZRotation": 3, "GLKMatrix4MakePerspective": 2, "fovyRadians": 3, "aspect": 3, "nearZ": 17, "farZ": 15, "GLKMatrix4MakeFrustum": 2, "left": 8, "right": 8, "bottom": 8, "top": 10, "GLKMatrix4MakeOrtho": 2, "GLKMatrix4MakeLookAt": 2, "eyeX": 3, "eyeY": 3, "eyeZ": 3, "centerX": 3, "centerY": 3, "centerZ": 3, "upX": 3, "upY": 3, "upZ": 3, "GLKMatrix3": 3, "GLKMatrix4GetMatrix3": 2, "matrix": 64, "GLKMatrix2": 3, "GLKMatrix4GetMatrix2": 2, "GLKMatrix4GetRow": 2, "row": 12, "GLKMatrix4GetColumn": 2, "column": 14, "GLKMatrix4SetRow": 2, "vector": 4, "GLKMatrix4SetColumn": 2, "GLKMatrix4Transpose": 2, "GLKMatrix4Invert": 1, "*isInvertible": 2, "GLKMatrix4InvertAndTranspose": 1, "GLKMatrix4Multiply": 8, "matrixLeft": 21, "matrixRight": 9, "GLKMatrix4Add": 2, "GLKMatrix4Subtract": 2, "GLKMatrix4Translate": 2, "GLKMatrix4TranslateWithVector3": 2, "GLKVector3": 31, "translationVector": 4, "GLKMatrix4TranslateWithVector4": 2, "GLKMatrix4Scale": 2, "GLKMatrix4ScaleWithVector3": 2, "scaleVector": 4, "GLKMatrix4ScaleWithVector4": 2, "GLKMatrix4Rotate": 2, "GLKMatrix4RotateWithVector3": 2, "axisVector": 4, "GLKMatrix4RotateWithVector4": 2, "GLKMatrix4RotateX": 2, "GLKMatrix4RotateY": 2, "GLKMatrix4RotateZ": 2, "GLKMatrix4MultiplyVector3": 3, "vectorRight": 8, "GLKMatrix4MultiplyVector3WithTranslation": 3, "GLKMatrix4MultiplyAndProjectVector3": 3, "GLKMatrix4MultiplyVector3Array": 2, "*vectors": 8, "vectorCount": 12, "GLKMatrix4MultiplyVector3ArrayWithTranslation": 2, "GLKMatrix4MultiplyAndProjectVector3Array": 2, "GLKMatrix4MultiplyVector4": 6, "GLKMatrix4MultiplyVector4Array": 2, "Implementations": 1, "m": 84, "float32x4x4_t": 29, "vld4q_f32": 2, "row0.v": 4, "row1.v": 4, "row2.v": 4, "row3.v": 4, "m.val": 52, "vld1q_f32": 6, "column0.v": 5, "column1.v": 5, "column2.v": 5, "column3.v": 5, "GLKQuaternionNormalize": 1, "quaternion.q": 4, "_2x": 7, "_2y": 5, "_2z": 3, "_2w": 7, "m.m": 54, "v": 22, "GLKVector3Normalize": 3, "GLKVector3Make": 4, "cosf": 4, "cosp": 10, "sinf": 4, "v.v": 27, "cotan": 3, "tanf": 1, "ral": 4, "rsl": 6, "tsb": 6, "tab": 4, "fan": 4, "fsn": 6, "ev": 7, "cv": 2, "uv": 2, "GLKVector3Add": 1, "GLKVector3Negate": 4, "u": 22, "GLKVector3CrossProduct": 2, "u.v": 3, "n.v": 3, "GLKVector3DotProduct": 3, "matrix.m": 171, "float32x4_t": 2, "vector.v": 9, "*dst": 1, "vst1q_f32": 1, "dst": 17, "iMatrixLeft": 3, "iMatrixRight": 3, "vmulq_n_f32": 17, "iMatrixLeft.val": 24, "vgetq_lane_f32": 16, "iMatrixRight.val": 24, "vmlaq_n_f32": 12, "matrixLeft.m": 112, "matrixRight.m": 96, "vaddq_f32": 7, "vsubq_f32": 4, "translationVector.v": 18, "iMatrix": 4, "iMatrix.val": 28, "float32_t": 13, "scaleVector.v": 30, "rm": 12, "axisVector.v": 6, "v4": 3, "GLKVector4Make": 3, "vectorRight.v": 29, "v4.v": 10, "GLKVector3MultiplyScalar": 1, "vectors": 8, "HELLO_H": 2, "hello": 1, "": 2, "ULLONG_MAX": 10, "MIN": 3, "HTTP_PARSER_DEBUG": 4, "SET_ERRNO": 47, "e": 4, "parser": 334, "http_errno": 11, "error_lineno": 3, "__LINE__": 50, "CALLBACK_NOTIFY_": 3, "FOR": 11, "ER": 4, "HTTP_PARSER_ERRNO": 10, "HPE_OK": 10, "settings": 6, "on_##FOR": 4, "HPE_CB_##FOR": 2, "CALLBACK_NOTIFY": 10, "CALLBACK_NOTIFY_NOADVANCE": 2, "CALLBACK_DATA_": 4, "LEN": 2, "FOR##_mark": 7, "CALLBACK_DATA": 10, "CALLBACK_DATA_NOADVANCE": 6, "MARK": 7, "PROXY_CONNECTION": 4, "CONNECTION": 4, "CONTENT_LENGTH": 4, "TRANSFER_ENCODING": 4, "UPGRADE": 4, "CHUNKED": 4, "KEEP_ALIVE": 4, "CLOSE": 4, "*method_strings": 1, "XX": 63, "num": 27, "#string": 1, "HTTP_METHOD_MAP": 3, "#undef": 7, "tokens": 5, "int8_t": 3, "unhex": 3, "HTTP_PARSER_STRICT": 5, "normal_url_char": 3, "T": 3, "s_dead": 10, "s_start_req_or_res": 4, "s_res_or_resp_H": 3, "s_start_res": 5, "s_res_H": 3, "s_res_HT": 4, "s_res_HTT": 3, "s_res_HTTP": 3, "s_res_first_http_major": 3, "s_res_http_major": 3, "s_res_first_http_minor": 3, "s_res_http_minor": 3, "s_res_first_status_code": 3, "s_res_status_code": 3, "s_res_status": 3, "s_res_line_almost_done": 4, "s_start_req": 6, "s_req_method": 4, "s_req_spaces_before_url": 5, "s_req_schema": 6, "s_req_schema_slash": 6, "s_req_schema_slash_slash": 6, "s_req_host_start": 8, "s_req_host_v6_start": 7, "s_req_host_v6": 7, "s_req_host_v6_end": 7, "s_req_host": 8, "s_req_port_start": 7, "s_req_port": 6, "s_req_path": 8, "s_req_query_string_start": 8, "s_req_query_string": 7, "s_req_fragment_start": 7, "s_req_fragment": 7, "s_req_http_start": 3, "s_req_http_H": 3, "s_req_http_HT": 3, "s_req_http_HTT": 3, "s_req_http_HTTP": 3, "s_req_first_http_major": 3, "s_req_http_major": 3, "s_req_first_http_minor": 3, "s_req_http_minor": 3, "s_req_line_almost_done": 4, "s_header_field_start": 12, "s_header_field": 4, "s_header_value_start": 4, "s_header_value": 5, "s_header_value_lws": 3, "s_header_almost_done": 6, "s_chunk_size_start": 4, "s_chunk_size": 3, "s_chunk_parameters": 3, "s_chunk_size_almost_done": 4, "s_headers_almost_done": 4, "s_headers_done": 4, "s_chunk_data": 3, "s_chunk_data_almost_done": 3, "s_chunk_data_done": 3, "s_body_identity": 3, "s_body_identity_eof": 4, "s_message_done": 3, "PARSING_HEADER": 2, "header_states": 1, "h_general": 23, "h_C": 3, "h_CO": 3, "h_CON": 3, "h_matching_connection": 3, "h_matching_proxy_connection": 3, "h_matching_content_length": 3, "h_matching_transfer_encoding": 3, "h_matching_upgrade": 3, "h_connection": 6, "h_content_length": 5, "h_transfer_encoding": 5, "h_upgrade": 4, "h_matching_transfer_encoding_chunked": 3, "h_matching_connection_keep_alive": 3, "h_matching_connection_close": 3, "h_transfer_encoding_chunked": 4, "h_connection_keep_alive": 4, "h_connection_close": 4, "Macros": 1, "classes": 1, "depends": 1, "strict": 2, "define": 14, "CR": 18, "LF": 21, "LOWER": 7, "0x20": 1, "IS_ALPHA": 5, "IS_NUM": 14, "9": 1, "IS_ALPHANUM": 3, "IS_HEX": 2, "TOKEN": 4, "IS_URL_CHAR": 6, "IS_HOST_CHAR": 4, "0x80": 1, "endif": 6, "start_state": 1, "HTTP_REQUEST": 7, "cond": 1, "HPE_STRICT": 1, "HTTP_STRERROR_GEN": 3, "#n": 1, "*description": 1, "http_strerror_tab": 7, "HTTP_ERRNO_MAP": 3, "http_message_needs_eof": 4, "http_parser": 13, "*parser": 9, "parse_url_char": 5, "ch": 145, "http_parser_execute": 2, "http_parser_settings": 5, "*settings": 2, "unhex_val": 7, "*header_field_mark": 1, "*header_value_mark": 1, "*url_mark": 1, "*body_mark": 1, "message_complete": 7, "HPE_INVALID_EOF_STATE": 1, "header_field_mark": 2, "header_value_mark": 2, "url_mark": 2, "nread": 7, "HTTP_MAX_HEADER_SIZE": 2, "HPE_HEADER_OVERFLOW": 1, "reexecute_byte": 7, "HPE_CLOSED_CONNECTION": 1, "content_length": 27, "message_begin": 3, "HTTP_RESPONSE": 3, "HPE_INVALID_CONSTANT": 3, "method": 39, "HTTP_HEAD": 2, "STRICT_CHECK": 15, "HPE_INVALID_VERSION": 12, "http_major": 11, "http_minor": 11, "HPE_INVALID_STATUS": 3, "status_code": 8, "HPE_INVALID_METHOD": 4, "http_method": 4, "HTTP_CONNECT": 4, "HTTP_DELETE": 1, "HTTP_GET": 1, "HTTP_LOCK": 1, "HTTP_MKCOL": 2, "HTTP_NOTIFY": 1, "HTTP_OPTIONS": 1, "HTTP_POST": 2, "HTTP_REPORT": 1, "HTTP_SUBSCRIBE": 2, "HTTP_TRACE": 1, "HTTP_UNLOCK": 2, "*matcher": 1, "matcher": 3, "method_strings": 2, "HTTP_CHECKOUT": 1, "HTTP_COPY": 1, "HTTP_MOVE": 1, "HTTP_MERGE": 1, "HTTP_MSEARCH": 1, "HTTP_MKACTIVITY": 1, "HTTP_SEARCH": 1, "HTTP_PROPFIND": 2, "HTTP_PUT": 2, "HTTP_PATCH": 1, "HTTP_PURGE": 1, "HTTP_UNSUBSCRIBE": 1, "HTTP_PROPPATCH": 1, "url": 4, "HPE_INVALID_URL": 4, "HPE_LF_EXPECTED": 1, "HPE_INVALID_HEADER_TOKEN": 2, "header_field": 5, "header_state": 42, "header_value": 6, "F_UPGRADE": 3, "HPE_INVALID_CONTENT_LENGTH": 4, "uint64_t": 14, "F_CONNECTION_KEEP_ALIVE": 3, "F_CONNECTION_CLOSE": 3, "F_CHUNKED": 11, "F_TRAILING": 3, "NEW_MESSAGE": 6, "upgrade": 3, "on_headers_complete": 3, "F_SKIPBODY": 4, "HPE_CB_headers_complete": 1, "to_read": 6, "body": 6, "body_mark": 2, "HPE_INVALID_CHUNK_SIZE": 2, "HPE_INVALID_INTERNAL_STATE": 1, "1": 2, "HPE_UNKNOWN": 1, "Does": 1, "need": 5, "see": 2, "an": 7, "EOF": 26, "find": 1, "http_should_keep_alive": 2, "http_method_str": 1, "http_parser_init": 2, "http_parser_type": 3, "http_errno_name": 1, "/sizeof": 4, ".name": 1, "http_errno_description": 1, ".description": 1, "http_parser_parse_url": 2, "buflen": 3, "is_connect": 4, "http_parser_url": 3, "*u": 2, "http_parser_url_fields": 2, "uf": 14, "old_uf": 4, "port": 15, "field_set": 5, "UF_MAX": 3, "UF_SCHEMA": 2, "UF_HOST": 3, "UF_PORT": 5, "UF_PATH": 2, "UF_QUERY": 2, "UF_FRAGMENT": 2, "field_data": 5, ".len": 2, ".off": 2, "http_parser_pause": 2, "paused": 3, "HPE_PAUSED": 2, "http_parser_h": 2, "HTTP_PARSER_VERSION_MAJOR": 1, "HTTP_PARSER_VERSION_MINOR": 1, "": 2, "_WIN32": 3, "__MINGW32__": 1, "_MSC_VER": 5, "__int8": 2, "__int16": 2, "int16_t": 1, "__int32": 2, "__int64": 3, "int64_t": 2, "ssize_t": 1, "": 1, "*1024": 4, "DELETE": 2, "GET": 2, "HEAD": 2, "POST": 2, "PUT": 2, "CONNECT": 2, "OPTIONS": 2, "TRACE": 2, "COPY": 2, "LOCK": 2, "MKCOL": 2, "MOVE": 2, "PROPFIND": 2, "PROPPATCH": 2, "SEARCH": 3, "UNLOCK": 2, "REPORT": 2, "MKACTIVITY": 2, "CHECKOUT": 2, "MERGE": 2, "MSEARCH": 1, "M": 1, "NOTIFY": 2, "SUBSCRIBE": 2, "UNSUBSCRIBE": 2, "PATCH": 2, "PURGE": 2, "HTTP_##name": 1, "HTTP_BOTH": 1, "OK": 1, "CB_message_begin": 1, "CB_url": 1, "CB_header_field": 1, "CB_header_value": 1, "CB_headers_complete": 1, "CB_body": 1, "CB_message_complete": 1, "INVALID_EOF_STATE": 1, "HEADER_OVERFLOW": 1, "CLOSED_CONNECTION": 1, "INVALID_VERSION": 1, "INVALID_STATUS": 1, "INVALID_METHOD": 1, "INVALID_URL": 1, "INVALID_HOST": 1, "INVALID_PORT": 1, "INVALID_PATH": 1, "INVALID_QUERY_STRING": 1, "INVALID_FRAGMENT": 1, "LF_EXPECTED": 1, "INVALID_HEADER_TOKEN": 1, "INVALID_CONTENT_LENGTH": 1, "INVALID_CHUNK_SIZE": 1, "INVALID_CONSTANT": 1, "INVALID_INTERNAL_STATE": 1, "STRICT": 1, "PAUSED": 1, "UNKNOWN": 1, "HTTP_ERRNO_GEN": 3, "HPE_##n": 1, "HTTP_PARSER_ERRNO_LINE": 2, "short": 7, "http_cb": 3, "on_message_begin": 1, "http_data_cb": 4, "on_url": 1, "on_header_field": 1, "on_header_value": 1, "on_body": 1, "on_message_complete": 1, "off": 9, "*http_method_str": 1, "*http_errno_name": 1, "*http_errno_description": 1, "": 1, "cursor_x": 1, "cursor_y": 1, "rows": 1, "columns": 4, "tabstop": 1, "default_color": 1, "current_color": 1, "nonblocking": 1, "reverse_video": 1, "bold": 1, "blink": 1, "underline": 1, "newline_mode": 1, "auto_echo": 1, "handle_backspace": 1, "": 1, "console_filter_t*": 2, "input_filter": 1, "output_filter": 1, "console_driver_t*": 2, "input_driver": 1, "output_driver": 1, "console_t": 1, "console_t*": 5, "default_console": 1, "console_init": 1, "console_write": 2, "console": 6, "console_write2": 1, "console_read": 1, "console_scroll": 1, "pages": 1, "console_clear": 1, "": 1, "IP4_TOS_ICMP": 1, "ip4_addr_t": 3, "hl": 1, "tos": 1, "id": 14, "ttl": 1, "checksum": 2, "src": 14, "ip4_header_t": 1, "sequence": 7, "ip4_icmp_header_t": 1, "ip4_receive": 1, "net_device_t*": 1, "origin": 2, "net_l2proto_t": 1, "proto": 1, "raw": 1, "": 1, "_Included_jni_JniLayer": 2, "JNIEXPORT": 6, "jlong": 6, "JNICALL": 6, "Java_jni_JniLayer_jni_1layer_1initialize": 1, "JNIEnv": 6, "jobject": 6, "jintArray": 1, "jint": 7, "Java_jni_JniLayer_jni_1layer_1mainloop": 1, "Java_jni_JniLayer_jni_1layer_1set_1button": 1, "Java_jni_JniLayer_jni_1layer_1set_1analog": 1, "jfloat": 1, "Java_jni_JniLayer_jni_1layer_1report_1analog_1chg": 1, "Java_jni_JniLayer_jni_1layer_1kill": 1, "namespace": 4, "v8": 2, "internal": 6, "RUNTIME_FUNCTION": 8, "Runtime_CompileLazy": 1, "HandleScope": 8, "scope": 8, "isolate": 41, "DCHECK_EQ": 4, "args.length": 8, "CONVERT_ARG_HANDLE_CHECKED": 5, "JSFunction": 5, "DEBUG": 1, "FLAG_trace_lazy": 1, "shared": 6, "is_compiled": 5, "PrintF": 4, "PrintName": 2, "StackLimitCheck": 4, "check": 12, "check.JsHasOverflowed": 4, "KB": 4, "StackOverflow": 4, "Compiler": 8, "Compile": 2, "KEEP_EXCEPTION": 1, "heap": 8, "exception": 6, "DCHECK": 15, "Runtime_CompileBaseline": 1, "CompileBaseline": 1, "Runtime_CompileOptimized_Concurrent": 1, "CompileOptimized": 2, "CONCURRENT": 1, "Runtime_CompileOptimized_NotConcurrent": 1, "NOT_CONCURRENT": 1, "Runtime_NotifyStubFailure": 1, "Deoptimizer*": 2, "deoptimizer": 8, "Deoptimizer": 4, "Grab": 2, "AllowHeapAllocation": 2, "IsAllowed": 2, "delete": 2, "undefined_value": 2, "class": 1, "ActivationsFinder": 3, "public": 2, "ThreadVisitor": 1, "Code*": 2, "code_": 3, "has_code_activations_": 3, "explicit": 2, "VisitThread": 1, "Isolate*": 1, "ThreadLocalTop*": 1, "JavaScriptFrameIterator": 4, "VisitFrames": 2, "JavaScriptFrameIterator*": 1, "done": 2, "Advance": 1, "JavaScriptFrame*": 3, "frame": 8, "contains": 2, "pc": 1, "Runtime_NotifyDeoptimized": 1, "CONVERT_SMI_ARG_CHECKED": 1, "type_arg": 2, "BailoutType": 1, "static_cast": 2, "": 1, "TimerEventScope": 1, "": 1, "timer": 1, "TRACE_EVENT0": 1, "Handle": 8, "": 3, "": 2, "optimized_code": 3, "compiled_code": 1, "kind": 2, "Code": 1, "OPTIMIZED_FUNCTION": 1, "bailout_type": 1, "Make": 1, "sure": 3, "materialize": 1, "objects": 1, "before": 5, "causing": 1, "any": 4, "allocation.": 1, "MaterializeHeapObjects": 1, "Ensure": 1, "register": 1, "updated": 1, "materialized": 2, "objects.": 1, "top_it": 1, "top_frame": 2, "top_it.frame": 1, "set_context": 1, "cast": 2, "LAZY": 1, "Search": 1, "other": 17, "activations": 3, "same": 3, "optimized": 5, "code.": 1, "At": 1, "this": 12, "point": 1, "at": 4, "topmost": 1, "frames": 1, "deoptimizer.": 1, "Note": 1, "that": 14, "does": 3, "necessarily": 1, "represent": 1, "activation": 1, "because": 1, "potential": 1, "inlined": 1, "calls.": 1, "activations_finder": 2, "activations_finder.VisitFrames": 1, "thread_manager": 1, "IterateArchivedThreads": 1, "activations_finder.has_code_activations_": 1, "*optimized_code": 1, "FLAG_trace_deopt": 1, "ReplaceCode": 1, "Evict": 1, "from": 12, "cache": 1, "so": 6, "ve": 1, "succeeded": 1, "optimizing.": 1, "optimization_disabled": 1, "If": 5, "trying": 1, "OSR": 1, "when": 1, "there": 1, "already": 1, "means": 2, "directly": 1, "indirectly": 1, "recursive": 1, "invocation": 1, "has": 3, "been": 2, "deoptimized": 1, "currently": 2, "unoptimized": 1, "activation.": 1, "Check": 1, "function.": 1, "it.done": 1, "it.Advance": 1, "it.frame": 1, "is_optimized": 1, "*function": 1, "Runtime_CompileForOnStackReplacement": 1, "caller_code": 1, "We": 1, "t.": 1, "native_context": 4, "allow_code_gen_from_strings": 1, "IsFalse": 1, "CodeGenerationFromStringsAllowed": 1, "": 5, "error_message": 2, "ErrorMessageForCodeGenerationFromStrings": 1, "MaybeHandle": 1, "maybe_error": 1, "factory": 1, "NewEvalError": 1, "MessageTemplate": 1, "kCodeGenFromStrings": 1, "maybe_error.ToHandle": 1, "Throw": 1, "Deal": 1, "with": 12, "normal": 1, "eval": 2, "argument.": 1, "compiled": 3, "bound": 1, "local": 6, "context.": 1, "ParseRestriction": 1, "restriction": 2, "NO_PARSE_RESTRICTION": 1, "ASSIGN_RETURN_ON_EXCEPTION_VALUE": 1, "GetFunctionFromEval": 1, "source": 9, "outer_info": 3, "language_mode": 3, "eval_scope_position": 1, "eval_position": 1, "*compiled": 1, "Runtime_ResolvePossiblyDirectEval": 1, "callee": 2, "args.at": 3, "didn": 1, "direct": 1, "eval.": 1, "And": 1, "even": 2, "argument": 3, "isn": 1, "just": 2, "let": 1, "execution": 1, "indirect": 1, "which": 2, "will": 5, "also": 1, "without": 1, "doing": 1, "anything": 1, ".": 2, "global_eval_fun": 1, "args": 11, "IsString": 1, "*callee": 1, "IsSmi": 2, "is_valid_language_mode": 1, "args.smi_at": 4, "LanguageMode": 1, "": 1, "": 1, "CompileGlobalEval": 1, "": 1, "strncasecmp": 2, "_strnicmp": 1, "REF_TABLE_SIZE": 1, "BUFFER_BLOCK": 5, "BUFFER_SPAN": 9, "MKD_LI_END": 1, "gperf_case_strncmp": 1, "s1": 6, "s2": 6, "GPERF_DOWNCASE": 1, "GPERF_CASE_STRNCMP": 1, "link_ref": 2, "*link": 1, "*title": 1, "sd_markdown": 6, "tag": 1, "tag_len": 3, "is_empty": 4, "htmlblock_end": 3, "*curtag": 2, "*rndr": 4, "start_of_line": 2, "tag_size": 3, "curtag": 8, "end_tag": 4, "block_lines": 3, "htmlblock_end_tag": 1, "rndr": 25, "parse_htmlblock": 1, "*ob": 3, "do_render": 4, "tag_end": 7, "work": 4, "find_block_tag": 1, "work.size": 5, "cb.blockhtml": 6, "ob": 14, "opaque": 8, "parse_table_row": 1, "*col_data": 1, "header_flag": 3, "*row_work": 1, "cb.table_cell": 3, "cb.table_row": 2, "row_work": 4, "rndr_newbuf": 2, "cell_start": 5, "cell_end": 6, "*cell_work": 1, "cell_work": 3, "_isspace": 3, "parse_inline": 1, "col_data": 2, "rndr_popbuf": 2, "empty_cell": 2, "parse_table_header": 1, "*columns": 2, "**column_data": 1, "pipes": 23, "header_end": 7, "under_end": 1, "*column_data": 1, "calloc": 1, "beg": 10, "doc_size": 6, "document": 9, "UTF8_BOM": 1, "is_ref": 1, "md": 18, "refs": 2, "expand_tabs": 1, "text": 22, "bufputc": 2, "bufgrow": 1, "MARKDOWN_GROW": 1, "cb.doc_header": 2, "parse_block": 1, "cb.doc_footer": 2, "bufrelease": 3, "free_link_refs": 1, "work_bufs": 8, ".size": 2, "sd_markdown_free": 1, "*md": 1, ".asize": 2, ".item": 2, "stack_free": 2, "sd_version": 1, "*ver_major": 2, "*ver_minor": 2, "*ver_revision": 2, "SUNDOWN_VER_MAJOR": 1, "SUNDOWN_VER_MINOR": 1, "SUNDOWN_VER_REVISION": 1, "MULTIBOOT_KERNELMAGIC": 1, "MULTIBOOT_FLAG_MEM": 1, "MULTIBOOT_FLAG_DEVICE": 1, "MULTIBOOT_FLAG_CMDLINE": 1, "MULTIBOOT_FLAG_MODS": 1, "MULTIBOOT_FLAG_AOUT": 1, "MULTIBOOT_FLAG_ELF": 1, "MULTIBOOT_FLAG_MMAP": 1, "MULTIBOOT_FLAG_CONFIG": 1, "MULTIBOOT_FLAG_LOADER": 1, "MULTIBOOT_FLAG_APM": 1, "MULTIBOOT_FLAG_VBE": 1, "tabSize": 1, "strSize": 1, "addr": 3, "reserved": 2, "multiboot_aoutSymbolTable_t": 2, "shndx": 1, "multiboot_elfSectionHeaderTable_t": 2, "multiboot_memoryMap_t": 1, "cmdLine": 2, "multiboot_module_t": 1, "memLower": 1, "memUpper": 1, "bootDevice": 1, "modsCount": 1, "multiboot_module_t*": 1, "modsAddr": 1, "union": 2, "aoutSym": 1, "elfSec": 1, "mmapLength": 1, "mmapAddr": 1, "drivesLength": 1, "drivesAddr": 1, "ROM": 1, "configuration": 1, "table": 2, "configTable": 1, "bootLoaderName": 1, "apmTable": 1, "Video": 1, "vbeControlInfo": 1, "vbeModeInfo": 1, "vbeMode": 1, "vbeInterfaceSeg": 1, "vbeInterfaceOff": 1, "vbeInterfaceLen": 1, "multiboot_info_t": 1, "multiboot_info_t*": 1, "multiboot_info": 1, "arch_multiboot_printInfo": 1, "_NMEX_NIGHTMARE_H": 2, "//#define": 1, "NMEX": 1, "START_HEAD": 2, "END_HEAD": 2, "PQC_ENCRYPT_H": 2, "": 1, "": 1, "ntru_encrypt_poly": 1, "fmpz_poly_t": 6, "msg_tern": 1, "pub_key": 2, "rnd": 2, "ntru_params": 2, "ntru_encrypt_string": 1, "_NME_WMAN_H": 2, "NTS": 1, "NWMan_event": 3, "NSTRUCT": 2, "NWMan": 2, "init": 1, "destroy": 1, "create_window": 1, "destroy_window": 1, "swap_buffers": 1, "next_event": 1, "NWMan_event*": 1, "event": 1, "uint": 2, "get_millis": 1, "sleep": 2, "millis": 1, "rshift_key": 1, "lshift_key": 1, "left_key": 1, "right_key": 1, "NENUM": 1, "NWMan_event_type": 3, "N_WMAN_MOUSE_MOVE": 1, "N_WMAN_MOUSE_BUTTON": 1, "N_WMAN_MOUSE_WHEEL": 1, "N_WMAN_KEYBOARD": 1, "N_WMAN_QUIT": 1, "N_WMAN_RESIZE": 1, "N_WMAN_FOCUS": 1, "N_WMAN_MOUSE_LEFT": 1, "N_WMAN_MOUSE_RIGHT": 1, "N_WMAN_MOUSE_MIDDLE": 1, "NPos2i": 2, "mouse_pos": 1, "mouse_button": 1, "signed": 6, "mouse_wheel": 1, "down": 1, "keyboard": 1, "window_quit": 1, "Will": 1, "always": 3, "WM_QUIT": 1, "window_size": 1, "window_focus": 1, "NWMan_event_new": 1, "NWMan_init": 1, "NWMan_destroy": 1, "N_WMan": 1, "": 1, "outb": 1, "args...": 8, "portio_out8": 2, "outw": 1, "portio_out16": 2, "outl": 1, "portio_out32": 2, "outq": 1, "portio_out64": 2, "inb": 1, "portio_in8": 2, "inw": 1, "portio_in16": 2, "inl": 1, "portio_in32": 2, "inq": 1, "portio_in64": 2, "_PQIV_H_INCLUDED": 2, "": 1, "": 1, "": 1, "PQIV_VERSION": 2, "FILE_FLAGS_ANIMATION": 2, "guint": 5, "FILE_FLAGS_MEMORY_IMAGE": 2, "file_type_handler_struct_t": 2, "file_type_handler_t": 4, "File": 3, "*file_type": 1, "Special": 1, "Animation": 1, "invoked": 1, "file": 14, "handlers": 2, "lives": 1, "file_flags": 1, "sort": 1, "gchar": 2, "*display_name": 1, "URI": 1, "*file_name": 1, "image": 6, "actual": 1, "GBytes": 2, "*file_data": 1, "monitor": 1, "structure": 1, "inotify": 1, "watching": 1, "files": 2, "GFileMonitor": 1, "*file_monitor": 1, "flag": 2, "stores": 1, "whether": 1, "loaded": 2, "valid.": 1, "i.e.": 1, "you": 3, "can": 4, "assume": 2, "private_data": 1, "representation": 3, "NOT": 1, "not.": 1, "gboolean": 1, "is_loaded": 1, "Cached": 1, "width": 4, "height": 4, "specific": 2, "freed": 1, "*private": 1, "file_t": 11, "PARAMETER": 1, "RECURSION": 1, "INOTIFY": 1, "BROWSE_ORIGINAL_PARAMETER": 1, "FILTER_OUTPUT": 1, "load_images_state_t": 3, "BOSNode": 2, "file_type_alloc_fn_t": 2, "*file": 10, "file_type_free_fn_t": 2, "file_type_load_fn_t": 2, "GInputStream": 3, "GError": 3, "**error_pointer": 3, "file_type_unload_fn_t": 2, "double": 128, "file_type_animation_initialize_fn_t": 2, "file_type_animation_next_frame_fn_t": 2, "file_type_draw_fn_t": 2, "cairo_t": 1, "*cr": 1, "All": 2, "filtered": 1, "filter.": 1, "lets": 1, "pass": 1, "assigned": 1, "file.": 1, "none": 1, "discarded": 1, "was": 2, "found": 21, "during": 2, "directory": 1, "traversal": 1, "using": 1, "backend": 1, "parameter.": 1, "GtkFileFilter": 1, "*file_types_handled": 1, "Pointers": 1, "above": 1, "alloc_fn": 1, "free_fn": 1, "load_fn": 1, "unload_fn": 1, "animation_initialize_fn": 1, "animation_next_frame_fn": 1, "draw_fn": 1, "file_type_initializer_fn_t": 1, "GCancellable": 2, "*image_loader_cancellable": 1, "gdouble": 1, "current_scale_level": 1, "*image_loader_stream_file": 1, "*load_images_handle_parameter_add_file": 1, "*g_input_stream_read_completely": 1, "*input_stream": 1, "*cancellable": 1, "file_free": 1, "file_type_handlers": 1, "": 2, "": 1, "": 1, "": 2, "__APPLE__": 2, "TARGET_OS_IPHONE": 1, "**environ": 1, "uv__chld": 2, "EV_P_": 1, "ev_child*": 1, "watcher": 4, "revents": 2, "rstatus": 1, "exit_status": 3, "term_signal": 3, "uv_process_t": 1, "*process": 1, "process": 19, "child_watcher": 5, "EV_CHILD": 1, "ev_child_stop": 2, "EV_A_": 1, "WIFEXITED": 1, "WEXITSTATUS": 2, "WIFSIGNALED": 2, "WTERMSIG": 2, "exit_cb": 3, "uv__make_socketpair": 2, "fds": 20, "SOCK_NONBLOCK": 2, "fl": 8, "SOCK_CLOEXEC": 1, "UV__F_NONBLOCK": 5, "socketpair": 2, "AF_UNIX": 2, "SOCK_STREAM": 2, "EINVAL": 3, "uv__cloexec": 4, "uv__nonblock": 5, "uv__make_pipe": 2, "__linux__": 3, "UV__O_CLOEXEC": 1, "UV__O_NONBLOCK": 1, "uv__pipe2": 1, "ENOSYS": 1, "uv__process_init_stdio": 2, "uv_stdio_container_t*": 4, "container": 17, "writable": 8, "fd": 29, "UV_IGNORE": 2, "UV_CREATE_PIPE": 4, "UV_INHERIT_FD": 3, "UV_INHERIT_STREAM": 2, "data.stream": 7, "UV_NAMED_PIPE": 2, "data.fd": 1, "uv__process_stdio_flags": 2, "uv_pipe_t*": 1, "ipc": 1, "UV_STREAM_READABLE": 2, "UV_STREAM_WRITABLE": 2, "uv__process_open_stream": 2, "child_fd": 3, "close": 13, "uv__stream_open": 1, "uv_stream_t*": 2, "uv__process_close_stream": 2, "uv__stream_close": 1, "uv__process_child_init": 2, "uv_process_options_t": 2, "options": 62, "stdio_count": 7, "int*": 22, "options.flags": 4, "UV_PROCESS_DETACHED": 2, "setsid": 2, "close_fd": 2, "use_fd": 7, "open": 4, "O_RDONLY": 1, "O_RDWR": 2, "perror": 5, "_exit": 6, "dup2": 4, "options.cwd": 2, "UV_PROCESS_SETGID": 2, "setgid": 1, "options.gid": 1, "UV_PROCESS_SETUID": 2, "setuid": 1, "options.uid": 1, "options.env": 1, "execvp": 1, "options.file": 2, "options.args": 1, "SPAWN_WAIT_EXEC": 5, "uv_spawn": 1, "uv_loop_t*": 1, "loop": 9, "uv_process_t*": 3, "save_our_env": 3, "options.stdio_count": 4, "signal_pipe": 7, "pollfd": 1, "pfd": 2, "pid_t": 2, "pid": 14, "ENOMEM": 2, "UV_PROCESS_WINDOWS_VERBATIM_ARGUMENTS": 1, "uv__handle_init": 1, "uv_handle_t*": 1, "UV_PROCESS": 1, "counters.process_init": 1, "uv__handle_start": 1, "options.exit_cb": 1, "options.stdio": 3, "fork": 2, "pfd.fd": 1, "pfd.events": 1, "POLLIN": 1, "POLLHUP": 1, "pfd.revents": 1, "poll": 1, "EINTR": 1, "ev_child_init": 1, "ev_child_start": 1, "child_watcher.data": 1, "uv__set_sys_error": 2, "uv_process_kill": 1, "signum": 4, "kill": 4, "uv_err_t": 1, "uv_kill": 1, "uv__new_sys_error": 1, "uv_ok_": 1, "uv__process_close": 1, "handle": 10, "uv__handle_stop": 1, "VALUE": 13, "rb_cRDiscount": 4, "rb_rdiscount_to_html": 2, "*res": 2, "szres": 8, "encoding": 14, "rb_funcall": 14, "rb_intern": 15, "rb_str_buf_new": 2, "Check_Type": 2, "T_STRING": 2, "rb_rdiscount__get_flags": 3, "MMIOT": 2, "*doc": 2, "mkd_string": 2, "RSTRING_PTR": 2, "RSTRING_LEN": 2, "mkd_compile": 2, "doc": 6, "mkd_document": 1, "res": 4, "rb_str_cat": 4, "mkd_cleanup": 2, "rb_respond_to": 1, "rb_rdiscount_toc_content": 2, "mkd_toc": 1, "ruby_obj": 11, "MKD_TABSTOP": 1, "MKD_NOHEADER": 1, "Qtrue": 10, "MKD_NOPANTS": 1, "MKD_NOHTML": 1, "MKD_TOC": 1, "MKD_NOIMAGE": 1, "MKD_NOLINKS": 1, "MKD_NOTABLES": 1, "MKD_STRICT": 1, "MKD_AUTOLINK": 1, "MKD_SAFELINK": 1, "MKD_NO_EXT": 1, "Init_rdiscount": 1, "rb_define_class": 1, "rb_cObject": 1, "rb_define_method": 2, "READLINE_READLINE_CATS": 3, "": 1, "atscntrb_readline_rl_library_version": 1, "rl_library_version": 1, "atscntrb_readline_rl_readline_version": 1, "rl_readline_version": 1, "atscntrb_readline_readline": 1, "readline": 1, "ifndef": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "sharedObjectsStruct": 1, "R_Zero": 2, "R_PosInf": 2, "R_NegInf": 2, "R_Nan": 2, "redisServer": 1, "redisCommand": 6, "*commandTable": 1, "redisCommandTable": 5, "getCommand": 1, "setCommand": 1, "noPreloadGetKeys": 6, "setnxCommand": 1, "setexCommand": 1, "psetexCommand": 1, "appendCommand": 1, "strlenCommand": 1, "delCommand": 1, "existsCommand": 1, "setbitCommand": 1, "getbitCommand": 1, "setrangeCommand": 1, "getrangeCommand": 2, "incrCommand": 1, "decrCommand": 1, "mgetCommand": 1, "rpushCommand": 1, "lpushCommand": 1, "rpushxCommand": 1, "lpushxCommand": 1, "linsertCommand": 1, "rpopCommand": 1, "lpopCommand": 1, "brpopCommand": 1, "brpoplpushCommand": 1, "blpopCommand": 1, "llenCommand": 1, "lindexCommand": 1, "lsetCommand": 1, "lrangeCommand": 1, "ltrimCommand": 1, "lremCommand": 1, "rpoplpushCommand": 1, "saddCommand": 1, "sremCommand": 1, "smoveCommand": 1, "sismemberCommand": 1, "scardCommand": 1, "spopCommand": 1, "srandmemberCommand": 1, "sinterCommand": 2, "sinterstoreCommand": 1, "sunionCommand": 1, "sunionstoreCommand": 1, "sdiffCommand": 1, "sdiffstoreCommand": 1, "zaddCommand": 1, "zincrbyCommand": 1, "zremCommand": 1, "zremrangebyscoreCommand": 1, "zremrangebyrankCommand": 1, "zunionstoreCommand": 1, "zunionInterGetKeys": 4, "zinterstoreCommand": 1, "zrangeCommand": 1, "zrangebyscoreCommand": 1, "zrevrangebyscoreCommand": 1, "zcountCommand": 1, "zrevrangeCommand": 1, "zcardCommand": 1, "zscoreCommand": 1, "zrankCommand": 1, "zrevrankCommand": 1, "hsetCommand": 1, "hsetnxCommand": 1, "hgetCommand": 1, "hmsetCommand": 1, "hmgetCommand": 1, "hincrbyCommand": 1, "hincrbyfloatCommand": 1, "hdelCommand": 1, "hlenCommand": 1, "hkeysCommand": 1, "hvalsCommand": 1, "hgetallCommand": 1, "hexistsCommand": 1, "incrbyCommand": 1, "decrbyCommand": 1, "incrbyfloatCommand": 1, "getsetCommand": 1, "msetCommand": 1, "msetnxCommand": 1, "randomkeyCommand": 1, "selectCommand": 1, "moveCommand": 1, "renameCommand": 1, "renameGetKeys": 2, "renamenxCommand": 1, "expireCommand": 1, "expireatCommand": 1, "pexpireCommand": 1, "pexpireatCommand": 1, "keysCommand": 1, "dbsizeCommand": 1, "authCommand": 3, "pingCommand": 2, "echoCommand": 2, "saveCommand": 1, "bgsaveCommand": 1, "bgrewriteaofCommand": 1, "shutdownCommand": 2, "lastsaveCommand": 1, "typeCommand": 1, "multiCommand": 2, "execCommand": 2, "discardCommand": 2, "syncCommand": 1, "flushdbCommand": 1, "flushallCommand": 1, "sortCommand": 1, "infoCommand": 4, "monitorCommand": 2, "ttlCommand": 1, "pttlCommand": 1, "persistCommand": 1, "slaveofCommand": 2, "debugCommand": 1, "configCommand": 1, "subscribeCommand": 2, "unsubscribeCommand": 2, "psubscribeCommand": 2, "punsubscribeCommand": 2, "publishCommand": 1, "watchCommand": 2, "unwatchCommand": 1, "clusterCommand": 1, "restoreCommand": 1, "migrateCommand": 1, "askingCommand": 1, "dumpCommand": 1, "objectCommand": 1, "clientCommand": 1, "evalCommand": 1, "evalShaCommand": 1, "slowlogCommand": 1, "scriptCommand": 2, "timeCommand": 2, "bitopCommand": 1, "bitcountCommand": 1, "redisLogRaw": 3, "level": 12, "syslogLevelMap": 2, "LOG_DEBUG": 1, "LOG_INFO": 1, "LOG_NOTICE": 1, "LOG_WARNING": 1, "FILE": 3, "*fp": 3, "rawmode": 2, "REDIS_LOG_RAW": 2, "server.verbosity": 4, "fp": 15, "server.logfile": 8, "fopen": 3, "timeval": 4, "tv": 8, "gettimeofday": 4, "localtime": 1, "tv.tv_sec": 4, "snprintf": 2, "tv.tv_usec/1000": 1, "getpid": 7, "server.syslog_enabled": 3, "syslog": 1, "redisLog": 33, "REDIS_MAX_LOGMSG_LEN": 1, "redisLogFromHandler": 2, "server.daemonize": 5, "O_APPEND": 2, "O_CREAT": 2, "O_WRONLY": 2, "STDOUT_FILENO": 2, "ll2string": 3, "oom": 3, "REDIS_WARNING": 19, "abort": 1, "ustime": 7, "ust": 7, "*1000000": 1, "tv.tv_usec": 3, "mstime": 5, "/1000": 1, "exitFromChild": 1, "retcode": 3, "COVERAGE_TEST": 1, "dictVanillaFree": 1, "*privdata": 8, "DICT_NOTUSED": 6, "privdata": 8, "zfree": 2, "val": 5, "dictListDestructor": 2, "listRelease": 1, "list*": 1, "dictSdsKeyCompare": 6, "*key1": 4, "*key2": 4, "l1": 4, "l2": 3, "sdslen": 14, "sds": 13, "key1": 5, "key2": 5, "dictSdsKeyCaseCompare": 2, "dictRedisObjectDestructor": 7, "decrRefCount": 6, "dictSdsDestructor": 4, "sdsfree": 2, "dictObjKeyCompare": 2, "robj": 7, "*o1": 2, "*o2": 2, "o1": 7, "ptr": 18, "o2": 7, "dictObjHash": 2, "*o": 7, "dictGenHashFunction": 5, "o": 76, "dictSdsHash": 4, "dictSdsCaseHash": 2, "dictGenCaseHashFunction": 1, "dictEncObjKeyCompare": 4, "robj*": 3, "REDIS_ENCODING_INT": 4, "getDecodedObject": 3, "dictEncObjHash": 4, "REDIS_ENCODING_RAW": 1, "hash": 3, "dictType": 8, "setDictType": 1, "zsetDictType": 1, "dbDictType": 2, "keyptrDictType": 2, "commandTableDictType": 2, "hashDictType": 1, "keylistDictType": 4, "clusterNodesDictType": 1, "htNeedsResize": 3, "dict": 11, "*dict": 5, "dictSlots": 3, "dictSize": 10, "DICT_HT_INITIAL_SIZE": 2, "used*100/size": 1, "REDIS_HT_MINFILL": 1, "tryResizeHashTables": 2, "server.dbnum": 8, "server.db": 23, ".dict": 9, "dictResize": 2, ".expires": 8, "incrementallyRehash": 2, "dictIsRehashing": 2, "dictRehashMilliseconds": 2, "updateDictResizePolicy": 2, "server.rdb_child_pid": 12, "server.aof_child_pid": 10, "dictEnableResize": 1, "dictDisableResize": 1, "activeExpireCycle": 2, "iteration": 6, "timelimit": 5, "*REDIS_EXPIRELOOKUPS_TIME_PERC/REDIS_HZ/100": 1, "expired": 4, "redisDb": 3, "*db": 2, "db": 8, "expires": 3, "slots": 2, "now": 5, "num*100/slots": 1, "REDIS_EXPIRELOOKUPS_PER_CRON": 2, "dictEntry": 2, "*de": 2, "de": 12, "dictGetRandomKey": 4, "dictGetSignedIntegerVal": 1, "dictGetKey": 4, "*keyobj": 2, "createStringObject": 11, "propagateExpire": 2, "keyobj": 6, "dbDelete": 2, "server.stat_expiredkeys": 3, "REDIS_EXPIRELOOKUPS_PER_CRON/4": 1, "updateLRUClock": 3, "server.lruclock": 2, "server.unixtime/REDIS_LRU_CLOCK_RESOLUTION": 1, "REDIS_LRU_CLOCK_MAX": 1, "trackOperationsPerSecond": 2, "server.ops_sec_last_sample_time": 3, "ops": 1, "server.stat_numcommands": 4, "server.ops_sec_last_sample_ops": 3, "ops_sec": 3, "ops*1000/t": 1, "server.ops_sec_samples": 4, "server.ops_sec_idx": 4, "REDIS_OPS_SEC_SAMPLES": 3, "getOperationsPerSecond": 2, "sum": 3, "clientsCronHandleTimeout": 2, "redisClient": 12, "time_t": 4, "server.unixtime": 10, "server.maxidletime": 3, "REDIS_SLAVE": 3, "REDIS_MASTER": 2, "REDIS_BLOCKED": 2, "pubsub_channels": 2, "listLength": 14, "pubsub_patterns": 2, "lastinteraction": 3, "REDIS_VERBOSE": 3, "freeClient": 1, "bpop.timeout": 2, "addReply": 13, "shared.nullmultibulk": 2, "unblockClientWaitingData": 1, "clientsCronResizeQueryBuffer": 2, "querybuf_size": 3, "sdsAllocSize": 1, "querybuf": 6, "idletime": 2, "REDIS_MBULK_BIG_ARG": 1, "querybuf_size/": 1, "querybuf_peak": 2, "sdsavail": 1, "sdsRemoveFreeSpace": 1, "clientsCron": 2, "numclients": 3, "server.clients": 7, "iterations": 4, "numclients/": 1, "REDIS_HZ*10": 1, "listNode": 4, "listRotate": 1, "listFirst": 2, "listNodeValue": 3, "run_with_period": 6, "_ms_": 2, "loops": 2, "/REDIS_HZ": 2, "serverCron": 2, "aeEventLoop": 2, "*eventLoop": 2, "*clientData": 1, "server.cronloops": 3, "REDIS_NOTUSED": 5, "eventLoop": 2, "clientData": 1, "server.watchdog_period": 3, "watchdogScheduleSignal": 1, "zmalloc_used_memory": 8, "server.stat_peak_memory": 5, "server.shutdown_asap": 3, "prepareForShutdown": 2, "REDIS_OK": 23, "vkeys": 8, "server.activerehashing": 2, "server.slaves": 9, "server.aof_rewrite_scheduled": 4, "rewriteAppendOnlyFileBackground": 2, "statloc": 5, "wait3": 1, "WNOHANG": 1, "exitcode": 3, "bysignal": 4, "backgroundSaveDoneHandler": 1, "backgroundRewriteDoneHandler": 1, "server.saveparamslen": 3, "saveparam": 1, "*sp": 1, "server.saveparams": 2, "server.dirty": 3, "sp": 4, "changes": 2, "server.lastsave": 3, "seconds": 2, "REDIS_NOTICE": 13, "rdbSaveBackground": 1, "server.rdb_filename": 4, "server.aof_rewrite_perc": 3, "server.aof_current_size": 2, "server.aof_rewrite_min_size": 2, "server.aof_rewrite_base_size": 4, "growth": 3, "server.aof_current_size*100/base": 1, "server.aof_flush_postponed_start": 2, "flushAppendOnlyFile": 2, "server.masterhost": 7, "freeClientsInAsyncFreeQueue": 1, "replicationCron": 1, "server.cluster_enabled": 6, "clusterCron": 1, "beforeSleep": 2, "*ln": 3, "server.unblocked_clients": 4, "ln": 8, "redisAssert": 1, "listDelNode": 1, "REDIS_UNBLOCKED": 1, "server.current_client": 3, "processInputBuffer": 1, "createSharedObjects": 2, "shared.crlf": 2, "createObject": 31, "REDIS_STRING": 31, "sdsnew": 27, "shared.ok": 3, "shared.err": 1, "shared.emptybulk": 1, "shared.czero": 1, "shared.cone": 1, "shared.cnegone": 1, "shared.nullbulk": 1, "shared.emptymultibulk": 1, "shared.pong": 2, "shared.queued": 2, "shared.wrongtypeerr": 1, "shared.nokeyerr": 1, "shared.syntaxerr": 2, "shared.sameobjecterr": 1, "shared.outofrangeerr": 1, "shared.noscripterr": 1, "shared.loadingerr": 2, "shared.slowscripterr": 2, "shared.masterdownerr": 2, "shared.bgsaveerr": 2, "shared.roslaveerr": 2, "shared.oomerr": 2, "shared.space": 1, "shared.colon": 1, "shared.plus": 1, "REDIS_SHARED_SELECT_CMDS": 1, "shared.select": 1, "sdscatprintf": 24, "sdsempty": 8, "shared.messagebulk": 1, "shared.pmessagebulk": 1, "shared.subscribebulk": 1, "shared.unsubscribebulk": 1, "shared.psubscribebulk": 1, "shared.punsubscribebulk": 1, "shared.del": 1, "shared.rpop": 1, "shared.lpop": 1, "REDIS_SHARED_INTEGERS": 1, "shared.integers": 2, "REDIS_SHARED_BULKHDR_LEN": 1, "shared.mbulkhdr": 1, "shared.bulkhdr": 1, "initServerConfig": 2, "getRandomHexChars": 1, "server.runid": 3, "REDIS_RUN_ID_SIZE": 2, "server.arch_bits": 3, "server.port": 7, "REDIS_SERVERPORT": 1, "server.bindaddr": 2, "server.unixsocket": 7, "server.unixsocketperm": 2, "server.ipfd": 9, "server.sofd": 9, "REDIS_DEFAULT_DBNUM": 1, "REDIS_MAXIDLETIME": 1, "server.client_max_querybuf_len": 1, "REDIS_MAX_QUERYBUF_LEN": 1, "server.loading": 4, "server.syslog_ident": 2, "zstrdup": 5, "server.syslog_facility": 2, "LOG_LOCAL0": 1, "server.aof_state": 7, "REDIS_AOF_OFF": 5, "server.aof_fsync": 1, "AOF_FSYNC_EVERYSEC": 1, "server.aof_no_fsync_on_rewrite": 1, "REDIS_AOF_REWRITE_PERC": 1, "REDIS_AOF_REWRITE_MIN_SIZE": 1, "server.aof_last_fsync": 1, "server.aof_rewrite_time_last": 2, "server.aof_rewrite_time_start": 2, "server.aof_delayed_fsync": 2, "server.aof_fd": 4, "server.aof_selected_db": 1, "server.pidfile": 3, "server.aof_filename": 3, "server.requirepass": 4, "server.rdb_compression": 1, "server.rdb_checksum": 1, "server.maxclients": 6, "REDIS_MAX_CLIENTS": 1, "server.bpop_blocked_clients": 2, "server.maxmemory": 6, "server.maxmemory_policy": 11, "REDIS_MAXMEMORY_VOLATILE_LRU": 3, "server.maxmemory_samples": 3, "server.hash_max_ziplist_entries": 1, "REDIS_HASH_MAX_ZIPLIST_ENTRIES": 1, "server.hash_max_ziplist_value": 1, "REDIS_HASH_MAX_ZIPLIST_VALUE": 1, "server.list_max_ziplist_entries": 1, "REDIS_LIST_MAX_ZIPLIST_ENTRIES": 1, "server.list_max_ziplist_value": 1, "REDIS_LIST_MAX_ZIPLIST_VALUE": 1, "server.set_max_intset_entries": 1, "REDIS_SET_MAX_INTSET_ENTRIES": 1, "server.zset_max_ziplist_entries": 1, "REDIS_ZSET_MAX_ZIPLIST_ENTRIES": 1, "server.zset_max_ziplist_value": 1, "REDIS_ZSET_MAX_ZIPLIST_VALUE": 1, "server.repl_ping_slave_period": 1, "REDIS_REPL_PING_SLAVE_PERIOD": 1, "server.repl_timeout": 1, "REDIS_REPL_TIMEOUT": 1, "server.cluster.configfile": 1, "server.lua_caller": 1, "server.lua_time_limit": 1, "REDIS_LUA_TIME_LIMIT": 1, "server.lua_client": 1, "server.lua_timedout": 2, "resetServerSaveParams": 2, "appendServerSaveParams": 3, "*60": 1, "server.masterauth": 1, "server.masterport": 2, "server.master": 3, "server.repl_state": 6, "REDIS_REPL_NONE": 1, "server.repl_syncio_timeout": 1, "REDIS_REPL_SYNCIO_TIMEOUT": 1, "server.repl_serve_stale_data": 2, "server.repl_slave_ro": 2, "server.repl_down_since": 2, "server.client_obuf_limits": 9, "REDIS_CLIENT_LIMIT_CLASS_NORMAL": 3, ".hard_limit_bytes": 3, ".soft_limit_bytes": 3, ".soft_limit_seconds": 3, "REDIS_CLIENT_LIMIT_CLASS_SLAVE": 3, "*1024*256": 1, "*1024*64": 1, "REDIS_CLIENT_LIMIT_CLASS_PUBSUB": 3, "*1024*32": 1, "*1024*8": 1, "/R_Zero": 2, "R_Zero/R_Zero": 1, "server.commands": 1, "dictCreate": 6, "populateCommandTable": 2, "server.delCommand": 1, "lookupCommandByCString": 3, "server.multiCommand": 1, "server.lpushCommand": 1, "server.slowlog_log_slower_than": 1, "REDIS_SLOWLOG_LOG_SLOWER_THAN": 1, "server.slowlog_max_len": 1, "REDIS_SLOWLOG_MAX_LEN": 1, "server.assert_failed": 1, "server.assert_file": 1, "server.assert_line": 1, "server.bug_report_start": 1, "adjustOpenFilesLimit": 2, "rlim_t": 3, "maxfiles": 6, "getrlimit": 1, "RLIMIT_NOFILE": 2, "oldlimit": 5, "limit.rlim_cur": 2, "limit.rlim_max": 1, "initServer": 2, "signal": 2, "SIGHUP": 1, "SIG_IGN": 2, "SIGPIPE": 1, "setupSignalHandlers": 2, "openlog": 1, "LOG_PID": 1, "LOG_NDELAY": 1, "LOG_NOWAIT": 1, "listCreate": 6, "server.clients_to_close": 1, "server.monitors": 2, "server.el": 7, "aeCreateEventLoop": 1, "zmalloc": 2, "*server.dbnum": 1, "anetTcpServer": 1, "server.neterr": 4, "ANET_ERR": 2, "unlink": 3, "anetUnixServer": 1, ".blocking_keys": 1, ".watched_keys": 1, ".id": 1, "server.pubsub_channels": 2, "server.pubsub_patterns": 4, "listSetFreeMethod": 1, "freePubsubPattern": 1, "listSetMatchMethod": 1, "listMatchPubsubPattern": 1, "aofRewriteBufferReset": 1, "server.aof_buf": 3, "server.rdb_save_time_last": 2, "server.rdb_save_time_start": 2, "server.stat_numconnections": 2, "server.stat_evictedkeys": 3, "server.stat_starttime": 2, "server.stat_keyspace_misses": 2, "server.stat_keyspace_hits": 2, "server.stat_fork_time": 2, "server.stat_rejected_conn": 2, "server.lastbgsave_status": 3, "server.stop_writes_on_bgsave_err": 2, "aeCreateTimeEvent": 1, "aeCreateFileEvent": 2, "AE_READABLE": 2, "acceptTcpHandler": 1, "AE_ERR": 2, "acceptUnixHandler": 1, "REDIS_AOF_ON": 2, "REDIS_MAXMEMORY_NO_EVICTION": 2, "clusterInit": 1, "scriptingInit": 1, "slowlogInit": 1, "bioInit": 1, "numcommands": 5, "*f": 1, "sflags": 1, "retval": 3, "arity": 3, "addReplyErrorFormat": 1, "authenticated": 3, "proc": 14, "addReplyError": 6, "getkeys_proc": 1, "firstkey": 1, "hashslot": 3, "server.cluster.state": 1, "REDIS_CLUSTER_OK": 1, "ask": 3, "clusterNode": 1, "*n": 1, "getNodeByQuery": 1, "server.cluster.myself": 1, "addReplySds": 3, "ip": 4, "freeMemoryIfNeeded": 2, "REDIS_CMD_DENYOOM": 1, "REDIS_ERR": 5, "REDIS_CMD_WRITE": 2, "REDIS_REPL_CONNECTED": 3, "tolower": 2, "REDIS_MULTI": 1, "queueMultiCommand": 1, "REDIS_CALL_FULL": 1, "save": 2, "REDIS_SHUTDOWN_SAVE": 1, "nosave": 2, "REDIS_SHUTDOWN_NOSAVE": 1, "SIGKILL": 2, "rdbRemoveTempFile": 1, "aof_fsync": 1, "rdbSave": 1, "addReplyBulk": 1, "addReplyMultiBulkLen": 1, "addReplyBulkLongLong": 2, "bytesToHuman": 3, "d": 11, "sprintf": 10, "n/": 3, "*1024*1024": 2, "*1024*1024*1024": 1, "genRedisInfoString": 2, "*section": 2, "uptime": 2, "rusage": 1, "self_ru": 2, "c_ru": 2, "lol": 3, "bib": 3, "allsections": 12, "defsections": 11, "sections": 11, "section": 15, "getrusage": 2, "RUSAGE_SELF": 1, "RUSAGE_CHILDREN": 1, "getClientsMaxBuffers": 1, "utsname": 1, "sdscat": 14, "uname": 1, "REDIS_VERSION": 4, "redisGitSHA1": 3, "strtol": 2, "redisGitDirty": 3, "name.sysname": 1, "name.release": 1, "name.machine": 1, "aeGetApiName": 1, "__GNUC_MINOR__": 2, "__GNUC_PATCHLEVEL__": 1, "uptime/": 1, "*24": 1, "hmem": 3, "peak_hmem": 3, "zmalloc_get_rss": 1, "lua_gc": 1, "server.lua": 1, "LUA_GCCOUNT": 1, "*1024LL": 1, "zmalloc_get_fragmentation_ratio": 1, "ZMALLOC_LIB": 2, "aofRewriteBufferSize": 2, "bioPendingJobsOfType": 1, "REDIS_BIO_AOF_FSYNC": 1, "perc": 3, "eta": 4, "elapsed": 3, "off_t": 1, "remaining_bytes": 1, "server.loading_total_bytes": 3, "server.loading_loaded_bytes": 3, "server.loading_start_time": 2, "elapsed*remaining_bytes": 1, "/server.loading_loaded_bytes": 1, "REDIS_REPL_TRANSFER": 2, "server.repl_transfer_left": 1, "server.repl_transfer_lastio": 1, "slaveid": 3, "listIter": 2, "li": 6, "listRewind": 2, "listNext": 2, "*slave": 2, "anetPeerToString": 1, "slave": 3, "replstate": 1, "REDIS_REPL_WAIT_BGSAVE_START": 1, "REDIS_REPL_WAIT_BGSAVE_END": 1, "REDIS_REPL_SEND_BULK": 1, "REDIS_REPL_ONLINE": 1, "self_ru.ru_stime.tv_sec": 1, "self_ru.ru_stime.tv_usec/1000000": 1, "self_ru.ru_utime.tv_sec": 1, "self_ru.ru_utime.tv_usec/1000000": 1, "c_ru.ru_stime.tv_sec": 1, "c_ru.ru_stime.tv_usec/1000000": 1, "c_ru.ru_utime.tv_sec": 1, "c_ru.ru_utime.tv_usec/1000000": 1, "calls": 4, "microseconds": 1, "microseconds/c": 1, "keys": 4, "REDIS_MONITOR": 1, "slaveseldb": 1, "listAddNodeTail": 1, "mem_used": 9, "mem_tofree": 3, "mem_freed": 4, "slaves": 3, "obuf_bytes": 3, "getClientOutputBufferMemoryUsage": 1, "k": 15, "keys_freed": 3, "bestval": 5, "bestkey": 9, "REDIS_MAXMEMORY_ALLKEYS_LRU": 2, "REDIS_MAXMEMORY_ALLKEYS_RANDOM": 2, "REDIS_MAXMEMORY_VOLATILE_RANDOM": 1, "thiskey": 7, "thisval": 8, "dictFind": 1, "dictGetVal": 2, "estimateObjectIdleTime": 1, "REDIS_MAXMEMORY_VOLATILE_TTL": 1, "delta": 4, "flushSlavesOutputBuffers": 1, "linuxOvercommitMemoryValue": 2, "atoi": 3, "linuxOvercommitMemoryWarning": 2, "createPidFile": 2, "daemonize": 2, "STDIN_FILENO": 1, "STDERR_FILENO": 2, "usage": 2, "redisAsciiArt": 2, "*16": 2, "ascii_logo": 1, "sigtermHandler": 2, "sig": 2, "sigaction": 6, "act": 6, "sigemptyset": 2, "act.sa_mask": 2, "act.sa_flags": 2, "act.sa_handler": 1, "SIGTERM": 1, "HAVE_BACKTRACE": 1, "SA_NODEFER": 1, "SA_RESETHAND": 1, "SA_SIGINFO": 1, "act.sa_sigaction": 1, "sigsegvHandler": 1, "SIGSEGV": 1, "SIGBUS": 1, "SIGFPE": 1, "SIGILL": 1, "memtest": 2, "megabytes": 1, "passes": 1, "zmalloc_enable_thread_safeness": 1, "srand": 1, "dictSetHashFunctionSeed": 1, "*configfile": 1, "configfile": 2, "sdscatrepr": 1, "loadServerConfig": 1, "loadAppendOnlyFile": 1, "/1000000": 2, "rdbLoad": 1, "aeSetBeforeSleepProc": 1, "aeMain": 1, "aeDeleteEventLoop": 1, "": 1, "": 2, "": 2, "rfUTF8_IsContinuationbyte": 1, "e.t.c.": 1, "rfFReadLine_UTF8": 5, "FILE*": 64, "utf8": 36, "byteLength": 197, "bufferSize": 6, "eof": 53, "bytesN": 98, "bIndex": 5, "RF_NEWLINE_CRLF": 1, "newLineFound": 1, "*bufferSize": 1, "RF_OPTION_FGETS_READBYTESN": 5, "RF_MALLOC": 47, "tempBuff": 6, "RF_LF": 10, "buff": 95, "RF_SUCCESS": 14, "RE_FILE_EOF": 22, "*eofReached": 14, "LOG_ERROR": 64, "RF_HEXEQ_UI": 7, "rfFgetc_UTF32BE": 3, "else//": 14, "undo": 5, "peek": 5, "ahead": 5, "pointer": 5, "fseek": 19, "SEEK_CUR": 19, "rfFgets_UTF32LE": 2, "eofReached": 4, "rfFgetc_UTF32LE": 4, "rfFgets_UTF16BE": 2, "rfFgetc_UTF16BE": 4, "rfFgets_UTF16LE": 2, "rfFgetc_UTF16LE": 4, "rfFgets_UTF8": 2, "rfFgetc_UTF8": 3, "RF_HEXEQ_C": 9, "fgetc": 9, "RE_FILE_READ": 2, "cp": 12, "c2": 13, "c3": 9, "c4": 5, "i_READ_CHECK": 20, "cc": 24, "more": 2, "RE_UTF8_INVALID_SEQUENCE_INVALID_BYTE": 6, "RE_UTF8_INVALID_SEQUENCE_END": 6, "rfUTF8_IsContinuationByte": 12, "RE_UTF8_INVALID_SEQUENCE_CONBYTE": 6, "decoded": 3, "codepoint": 47, "decode": 6, "RF_HEXGE_C": 1, "//invalid": 1, "byte": 6, "//if": 1, "needing": 1, "than": 5, "swapE": 21, "v1": 38, "v2": 26, "rfUTILS_Endianess": 24, "RF_LITTLE_ENDIAN": 23, "fread": 12, "endianess": 40, "needed": 10, "rfUTILS_SwapEndianUS": 10, "RF_HEXGE_US": 4, "RF_HEXLE_US": 4, "RF_HEXL_US": 8, "RF_HEXG_US": 8, "RE_UTF16_INVALID_SEQUENCE": 20, "RE_UTF16_NO_SURRPAIR": 2, "wants": 2, "uint16_t*": 11, "surrogate": 4, "pair": 4, "existence": 2, "RF_BIG_ENDIAN": 10, "rfUTILS_SwapEndianUI": 11, "rfFback_UTF32BE": 2, "i_FSEEK_CHECK": 14, "rfFback_UTF32LE": 2, "rfFback_UTF16BE": 2, "rfFback_UTF16LE": 2, "rfFback_UTF8": 2, "depending": 1, "number": 19, "backwards": 1, "RE_UTF8_INVALID_SEQUENCE": 2, "REFU_IO_H": 2, "": 2, "opening": 2, "bracket": 4, "calling": 4, "RF_CR": 1, "REFU_WIN32_VERSION": 1, "i_PLUSB_WIN32": 2, "foff_rft": 2, "off64_t": 1, "///Fseek": 1, "Ftelll": 1, "definitions": 1, "rfFseek": 2, "i_FILE_": 16, "i_OFFSET_": 4, "i_WHENCE_": 4, "_fseeki64": 1, "rfFtell": 2, "_ftelli64": 1, "fseeko64": 1, "ftello64": 1, "i_DECLIMEX_": 121, "rfFReadLine_UTF16BE": 6, "rfFReadLine_UTF16LE": 4, "rfFReadLine_UTF32BE": 1, "rfFReadLine_UTF32LE": 4, "rfFgets_UTF32BE": 1, "RF_IAMHERE_FOR_DOXYGEN": 22, "rfPopen": 2, "i_rfPopen": 2, "i_CMD_": 2, "i_MODE_": 2, "i_rfLMS_WRAP2": 5, "rfPclose": 1, "stream": 3, "///closing": 1, "#endif//include": 1, "guards": 2, "": 1, "": 2, "RF_OPTION_DEFAULT_ARGUMENTS": 24, "RF_String*": 222, "rfString_Create": 4, "i_rfString_Create": 3, "READ_VSNPRINTF_ARGS": 5, "rfUTF8_VerifySequence": 7, "RF_FAILURE": 24, "RE_STRING_INIT_FAILURE": 8, "buffAllocated": 11, "RF_String": 27, "i_NVrfString_Create": 3, "i_rfString_CreateLocal1": 3, "RF_OPTION_SOURCE_ENCODING": 30, "RF_UTF8": 8, "characterLength": 16, "*codepoints": 2, "rfLMS_MacroEvalPtr": 2, "RF_LMS": 6, "RF_UTF16_LE": 9, "RF_UTF16_BE": 7, "codepoints": 44, "i/2": 2, "#elif": 14, "RF_UTF32_LE": 3, "RF_UTF32_BE": 3, "UTF16": 4, "rfUTF16_Decode": 5, "rfUTF16_Decode_swap": 5, "RF_UTF16_BE//": 2, "RF_UTF32_LE//": 2, "copy": 4, "UTF32": 4, "into": 8, "RF_UTF32_BE//": 2, "": 2, "UTF": 17, "8": 15, "encode": 2, "them": 3, "rfUTF8_Encode": 4, "While": 2, "attempting": 2, "create": 2, "temporary": 4, "given": 5, "could": 2, "properly": 2, "encoded": 2, "RE_UTF8_ENCODING": 2, "End": 2, "Non": 2, "code=": 2, "normally": 1, "since": 5, "here": 5, "have": 2, "validity": 2, "get": 4, "Error": 2, "String": 11, "Allocation": 2, "due": 2, "rfLMS_Push": 4, "Local": 2, "Stack": 2, "Insufficient": 2, "space": 4, "Consider": 2, "compiling": 2, "library": 3, "bigger": 3, "Quitting": 2, "proccess": 2, "RE_LOCALMEMSTACK_INSUFFICIENT": 8, "i_NVrfString_CreateLocal": 3, "rfString_Init": 3, "str": 156, "i_rfString_Init": 3, "i_NVrfString_Init": 3, "rfString_Create_cp": 2, "rfString_Init_cp": 3, "RF_HEXLE_UI": 8, "RF_HEXGE_UI": 6, "RE_UTF8_INVALID_CODE_POINT": 2, "rfString_Create_i": 2, "numLen": 8, "most": 3, "environment": 3, "chars": 3, "certainly": 3, "fit": 3, "strcpy": 4, "rfString_Init_i": 2, "rfString_Create_f": 2, "rfString_Init_f": 2, "rfString_Create_UTF16": 2, "rfString_Init_UTF16": 3, "utf8ByteLength": 34, "last": 1, "utf": 1, "termination": 3, "byteLength*2": 1, "allocate": 1, "as": 5, "different": 1, "RE_INPUT": 1, "ends": 3, "rfString_Create_UTF32": 2, "rfString_Init_UTF32": 3, "codeBuffer": 9, "big": 14, "endian": 20, "little": 7, "according": 1, "standard": 1, "no": 4, "BOM": 1, "rfUTF32_Length": 1, "i_rfString_Assign": 3, "dest": 7, "sourceP": 2, "RF_REALLOC": 9, "rfString_Assign_char": 2, "<5)>": 1, "rfString_Create_nc": 3, "i_rfString_Create_nc": 3, "bytesWritten": 2, "i_NVrfString_Create_nc": 3, "rfString_Init_nc": 4, "i_rfString_Init_nc": 3, "i_NVrfString_Init_nc": 3, "rfString_Destroy": 2, "rfString_Deinit": 3, "rfString_ToUTF16": 4, "charsN": 5, "rfUTF8_Decode": 2, "rfUTF16_Encode": 1, "rfString_ToUTF32": 4, "rfString_Length": 5, "RF_STRING_ITERATE_START": 9, "RF_STRING_ITERATE_END": 9, "rfString_GetChar": 2, "thisstr": 210, "codePoint": 18, "RF_STRING_INDEX_OUT_OF_BOUNDS": 2, "rfString_BytePosToCodePoint": 7, "rfString_BytePosToCharPos": 4, "thisstrP": 32, "bytepos": 12, "charPos": 8, "byteI": 7, "i_rfString_Equal": 3, "s1P": 2, "s2P": 2, "i_rfString_Find": 5, "sstrP": 6, "optionsP": 11, "sstr": 39, "*optionsP": 8, "RF_BITFLAG_ON": 5, "RF_CASE_IGNORE": 2, "strstr": 2, "RF_MATCH_WORD": 5, "exact": 6, "": 1, "0x5a": 1, "match": 2, "0x7a": 1, "substring": 5, "search": 1, "equals": 1, "then": 1, "okay": 1, "rfString_Equal": 4, "RFS_": 8, "ERANGE": 1, "RE_STRING_TOFLOAT_UNDERFLOW": 1, "RE_STRING_TOFLOAT": 1, "rfString_Copy_OUT": 2, "srcP": 6, "rfString_Copy_IN": 2, "rfString_Copy_chars": 2, "bytePos": 23, "terminate": 1, "i_rfString_ScanfAfter": 3, "afterstrP": 2, "afterstr": 5, "sscanf": 1, "<=0)>": 1, "Counts": 1, "many": 1, "times": 1, "occurs": 1, "inside": 2, "i_rfString_Count": 5, "sstr2": 2, "move": 12, "rfString_FindBytePos": 10, "rfString_Tokenize": 2, "sep": 3, "tokensN": 2, "RF_String**": 2, "*tokensN": 1, "rfString_Count": 4, "lstr": 6, "lstrP": 1, "rstr": 24, "rstrP": 5, "temp": 10, "rfString_After": 4, "rfString_Beforev": 4, "parNP": 6, "i_rfString_Beforev": 16, "parN": 10, "*parNP": 2, "minPos": 17, "thisPos": 8, "argList": 8, "va_arg": 2, "i_rfString_Before": 5, "i_rfString_After": 5, "afterP": 2, "after": 6, "rfString_Afterv": 4, "i_rfString_Afterv": 16, "minPosLength": 3, "go": 8, "i_rfString_Append": 3, "otherP": 4, "strncat": 1, "rfString_Append_i": 2, "rfString_Append_f": 2, "i_rfString_Prepend": 3, "goes": 1, "i_rfString_Remove": 6, "numberP": 1, "*numberP": 1, "occurences": 5, "<=thisstr->": 1, "i_rfString_KeepOnly": 3, "keepstrP": 2, "keepLength": 2, "charValue": 12, "*keepChars": 1, "keepstr": 5, "exists": 6, "charBLength": 5, "keepChars": 4, "*keepLength": 1, "rfString_Iterate_Start": 6, "rfString_Iterate_End": 4, "": 1, "exist": 2, "cover": 1, "effectively": 1, "gets": 1, "deleted": 1, "rfUTF8_FromCodepoint": 1, "non": 1, "clean": 1, "way": 1, "internally": 1, "uses": 1, "byteIndex_": 12, "variable": 1, "use": 1, "determine": 1, "backs": 1, "contiuing": 1, "make": 3, "position": 1, "won": 1, "rfString_PruneStart": 2, "nBytePos": 23, "rfString_PruneEnd": 2, "RF_STRING_ITERATEB_START": 2, "RF_STRING_ITERATEB_END": 2, "rfString_PruneMiddleB": 2, "pBytePos": 15, "indexing": 1, "works": 1, "pbytePos": 2, "pth": 2, "include": 6, "rfString_PruneMiddleF": 2, "got": 1, "i_rfString_Replace": 6, "numP": 1, "*numP": 1, "RF_StringX": 2, "finding": 1, "foundN": 10, "diff": 9, "bSize": 4, "bytePositions": 17, "bSize*sizeof": 1, "rfStringX_FromString_IN": 1, "temp.bIndex": 2, "temp.bytes": 1, "temp.byteLength": 1, "rfStringX_Deinit": 1, "replace": 3, "removed": 2, "one": 2, "orSize": 5, "nSize": 4, "number*diff": 1, "strncpy": 3, "smaller": 1, "diff*number": 1, "remove": 1, "strings": 4, "equal": 1, "i_rfString_StripStart": 3, "subP": 7, "RF_String*sub": 2, "noMatch": 8, "*subValues": 2, "subLength": 6, "sub": 10, "subValues": 8, "*subLength": 2, "i_rfString_StripEnd": 3, "lastBytePos": 4, "testity": 2, "i_rfString_Strip": 3, "res1": 2, "rfString_StripStart": 3, "res2": 2, "rfString_StripEnd": 3, "rfString_Create_fUTF8": 2, "rfString_Init_fUTF8": 3, "unused": 3, "rfString_Assign_fUTF8": 2, "FILE*f": 2, "utf8BufferSize": 4, "rfString_Append_fUTF8": 2, "rfString_Append": 5, "rfString_Create_fUTF16": 2, "rfString_Init_fUTF16": 3, "rfString_Assign_fUTF16": 2, "rfString_Append_fUTF16": 2, "char*utf8": 3, "rfString_Create_fUTF32": 2, "rfString_Init_fUTF32": 3, "<0)>": 1, "Failure": 1, "initialize": 1, "reading": 1, "Little": 1, "Endian": 1, "32": 1, "bytesN=": 1, "rfString_Assign_fUTF32": 2, "rfString_Append_fUTF32": 2, "i_rfString_Fwrite": 5, "sP": 2, "encodingP": 1, "*utf32": 1, "utf16": 11, "*encodingP": 1, "fwrite": 5, "logging": 5, "utf32": 10, "i_WRITE_CHECK": 1, "RE_FILE_WRITE": 1, "REFU_USTRING_H": 2, "": 1, "RF_MODULE_STRINGS//": 1, "included": 2, "module": 3, "": 1, "wrapping": 1, "functionality": 1, "": 1, "unicode": 2, "rfUTF8_IsContinuationByte2": 1, "b__": 3, "0xBF": 1, "pragma": 1, "pack": 2, "author": 1, "Lefteris": 1, "09": 1, "12": 1, "2010": 1, "endinternal": 1, "brief": 1, "A": 1, "Refu": 2, "Unicode": 1, "two": 1, "versions": 1, "One": 1, "ref": 1, "what": 1, "performed": 1, "extended": 3, "Strings": 2, "Functions": 1, "convert": 1, "Once": 1, "created": 1, "assumed": 1, "valid": 1, "every": 1, "performs": 1, "unless": 1, "otherwise": 1, "specified": 1, "isinherited": 1, "StringX": 2, "their": 1, "description": 1, "safely": 1, "needs": 1, "manipulate": 1, "Extended": 1, "To": 1, "documentation": 1, "clearer": 1, "should": 2, "marked": 1, "notinherited": 1, "cppcode": 1, "constructor": 1, "i_StringCHandle": 1, "@endcpp": 1, "@endinternal": 1, "*/": 1, "i_rfString_CreateLocal": 2, "__VA_ARGS__": 66, "RP_SELECT_FUNC_IF_NARGIS": 5, "i_SELECT_RF_STRING_CREATE": 1, "i_SELECT_RF_STRING_CREATE1": 1, "i_SELECT_RF_STRING_CREATE0": 1, "///Internal": 1, "i_SELECT_RF_STRING_CREATELOCAL": 1, "i_SELECT_RF_STRING_CREATELOCAL1": 1, "i_SELECT_RF_STRING_CREATELOCAL0": 1, "i_SELECT_RF_STRING_INIT": 1, "i_SELECT_RF_STRING_INIT1": 1, "i_SELECT_RF_STRING_INIT0": 1, "i_SELECT_RF_STRING_CREATE_NC": 1, "i_SELECT_RF_STRING_CREATE_NC1": 1, "i_SELECT_RF_STRING_CREATE_NC0": 1, "i_SELECT_RF_STRING_INIT_NC": 1, "i_SELECT_RF_STRING_INIT_NC1": 1, "i_SELECT_RF_STRING_INIT_NC0": 1, "//@": 1, "rfString_Assign": 2, "i_DESTINATION_": 2, "i_SOURCE_": 2, "rfString_ToUTF8": 2, "i_STRING_": 2, "rfString_ToCstr": 2, "uint32_t*length": 1, "string_": 9, "startCharacterPos_": 4, "characterUnicodeValue_": 4, "j_": 6, "//Two": 1, "macros": 1, "accomplish": 1, "going": 1, "backwards.": 1, "its": 1, "pair.": 1, "rfString_IterateB_Start": 1, "characterPos_": 5, "b_index_": 6, "c_index_": 3, "rfString_IterateB_End": 1, "i_STRING1_": 2, "i_STRING2_": 2, "i_rfLMSX_WRAP2": 4, "rfString_Find": 3, "i_THISSTR_": 60, "i_SEARCHSTR_": 26, "i_OPTIONS_": 28, "i_rfLMS_WRAP3": 4, "i_RFI8_": 54, "RF_SELECT_FUNC_IF_NARGGT": 10, "i_NPSELECT_RF_STRING_FIND": 1, "i_NPSELECT_RF_STRING_FIND1": 1, "RF_COMPILE_ERROR": 33, "i_NPSELECT_RF_STRING_FIND0": 1, "RF_SELECT_FUNC": 10, "i_SELECT_RF_STRING_FIND": 1, "i_SELECT_RF_STRING_FIND2": 1, "i_SELECT_RF_STRING_FIND3": 1, "i_SELECT_RF_STRING_FIND1": 1, "i_SELECT_RF_STRING_FIND0": 1, "rfString_ToInt": 1, "int32_t*": 1, "rfString_ToDouble": 1, "double*": 1, "rfString_ScanfAfter": 2, "i_AFTERSTR_": 8, "i_FORMAT_": 2, "i_VAR_": 2, "i_rfLMSX_WRAP4": 11, "i_NPSELECT_RF_STRING_COUNT": 1, "i_NPSELECT_RF_STRING_COUNT1": 1, "i_NPSELECT_RF_STRING_COUNT0": 1, "i_SELECT_RF_STRING_COUNT": 1, "i_SELECT_RF_STRING_COUNT2": 1, "i_rfLMSX_WRAP3": 5, "i_SELECT_RF_STRING_COUNT3": 1, "i_SELECT_RF_STRING_COUNT1": 1, "i_SELECT_RF_STRING_COUNT0": 1, "rfString_Between": 3, "i_rfString_Between": 4, "i_NPSELECT_RF_STRING_BETWEEN": 1, "i_NPSELECT_RF_STRING_BETWEEN1": 1, "i_NPSELECT_RF_STRING_BETWEEN0": 1, "i_SELECT_RF_STRING_BETWEEN": 1, "i_SELECT_RF_STRING_BETWEEN4": 1, "i_LEFTSTR_": 6, "i_RIGHTSTR_": 6, "i_RESULT_": 12, "i_rfLMSX_WRAP5": 9, "i_SELECT_RF_STRING_BETWEEN5": 1, "i_SELECT_RF_STRING_BETWEEN3": 1, "i_SELECT_RF_STRING_BETWEEN2": 1, "i_SELECT_RF_STRING_BETWEEN1": 1, "i_SELECT_RF_STRING_BETWEEN0": 1, "i_NPSELECT_RF_STRING_BEFOREV": 1, "i_NPSELECT_RF_STRING_BEFOREV1": 1, "RF_SELECT_FUNC_IF_NARGGT2": 2, "i_LIMSELECT_RF_STRING_BEFOREV": 1, "i_NPSELECT_RF_STRING_BEFOREV0": 1, "i_LIMSELECT_RF_STRING_BEFOREV1": 1, "i_LIMSELECT_RF_STRING_BEFOREV0": 1, "i_SELECT_RF_STRING_BEFOREV": 1, "i_SELECT_RF_STRING_BEFOREV5": 1, "i_ARG1_": 56, "i_ARG2_": 56, "i_ARG3_": 56, "i_ARG4_": 56, "i_RFUI8_": 28, "i_SELECT_RF_STRING_BEFOREV6": 1, "i_rfLMSX_WRAP6": 2, "i_SELECT_RF_STRING_BEFOREV7": 1, "i_rfLMSX_WRAP7": 2, "i_SELECT_RF_STRING_BEFOREV8": 1, "i_rfLMSX_WRAP8": 2, "i_SELECT_RF_STRING_BEFOREV9": 1, "i_rfLMSX_WRAP9": 2, "i_SELECT_RF_STRING_BEFOREV10": 1, "i_rfLMSX_WRAP10": 2, "i_SELECT_RF_STRING_BEFOREV11": 1, "i_rfLMSX_WRAP11": 2, "i_SELECT_RF_STRING_BEFOREV12": 1, "i_rfLMSX_WRAP12": 2, "i_SELECT_RF_STRING_BEFOREV13": 1, "i_rfLMSX_WRAP13": 2, "i_SELECT_RF_STRING_BEFOREV14": 1, "i_rfLMSX_WRAP14": 2, "i_SELECT_RF_STRING_BEFOREV15": 1, "i_rfLMSX_WRAP15": 2, "i_SELECT_RF_STRING_BEFOREV16": 1, "i_rfLMSX_WRAP16": 2, "i_SELECT_RF_STRING_BEFOREV17": 1, "i_rfLMSX_WRAP17": 2, "i_SELECT_RF_STRING_BEFOREV18": 1, "i_rfLMSX_WRAP18": 2, "rfString_Before": 3, "i_NPSELECT_RF_STRING_BEFORE": 1, "i_NPSELECT_RF_STRING_BEFORE1": 1, "i_NPSELECT_RF_STRING_BEFORE0": 1, "i_SELECT_RF_STRING_BEFORE": 1, "i_SELECT_RF_STRING_BEFORE3": 1, "i_SELECT_RF_STRING_BEFORE4": 1, "i_SELECT_RF_STRING_BEFORE2": 1, "i_SELECT_RF_STRING_BEFORE1": 1, "i_SELECT_RF_STRING_BEFORE0": 1, "i_NPSELECT_RF_STRING_AFTER": 1, "i_NPSELECT_RF_STRING_AFTER1": 1, "i_NPSELECT_RF_STRING_AFTER0": 1, "i_SELECT_RF_STRING_AFTER": 1, "i_SELECT_RF_STRING_AFTER3": 1, "i_OUTSTR_": 6, "i_SELECT_RF_STRING_AFTER4": 1, "i_SELECT_RF_STRING_AFTER2": 1, "i_SELECT_RF_STRING_AFTER1": 1, "i_SELECT_RF_STRING_AFTER0": 1, "i_NPSELECT_RF_STRING_AFTERV": 1, "i_NPSELECT_RF_STRING_AFTERV1": 1, "i_LIMSELECT_RF_STRING_AFTERV": 1, "i_NPSELECT_RF_STRING_AFTERV0": 1, "i_LIMSELECT_RF_STRING_AFTERV1": 1, "i_LIMSELECT_RF_STRING_AFTERV0": 1, "i_SELECT_RF_STRING_AFTERV": 1, "i_SELECT_RF_STRING_AFTERV5": 1, "i_SELECT_RF_STRING_AFTERV6": 1, "i_SELECT_RF_STRING_AFTERV7": 1, "i_SELECT_RF_STRING_AFTERV8": 1, "i_SELECT_RF_STRING_AFTERV9": 1, "i_SELECT_RF_STRING_AFTERV10": 1, "i_SELECT_RF_STRING_AFTERV11": 1, "i_SELECT_RF_STRING_AFTERV12": 1, "i_SELECT_RF_STRING_AFTERV13": 1, "i_SELECT_RF_STRING_AFTERV14": 1, "i_SELECT_RF_STRING_AFTERV15": 1, "i_SELECT_RF_STRING_AFTERV16": 1, "i_SELECT_RF_STRING_AFTERV17": 1, "i_SELECT_RF_STRING_AFTERV18": 1, "i_OTHERSTR_": 4, "rfString_Prepend": 2, "rfString_Remove": 3, "i_NPSELECT_RF_STRING_REMOVE": 1, "i_NPSELECT_RF_STRING_REMOVE1": 1, "i_NPSELECT_RF_STRING_REMOVE0": 1, "i_SELECT_RF_STRING_REMOVE": 1, "i_SELECT_RF_STRING_REMOVE2": 1, "i_REPSTR_": 16, "i_RFUI32_": 8, "i_SELECT_RF_STRING_REMOVE3": 1, "i_NUMBER_": 12, "i_SELECT_RF_STRING_REMOVE4": 1, "i_SELECT_RF_STRING_REMOVE1": 1, "i_SELECT_RF_STRING_REMOVE0": 1, "rfString_KeepOnly": 2, "I_KEEPSTR_": 2, "rfString_Replace": 3, "i_NPSELECT_RF_STRING_REPLACE": 1, "i_NPSELECT_RF_STRING_REPLACE1": 1, "i_NPSELECT_RF_STRING_REPLACE0": 1, "i_SELECT_RF_STRING_REPLACE": 1, "i_SELECT_RF_STRING_REPLACE3": 1, "i_SELECT_RF_STRING_REPLACE4": 1, "i_SELECT_RF_STRING_REPLACE5": 1, "i_SELECT_RF_STRING_REPLACE2": 1, "i_SELECT_RF_STRING_REPLACE1": 1, "i_SELECT_RF_STRING_REPLACE0": 1, "i_SUBSTR_": 6, "rfString_Strip": 2, "rfString_Fwrite": 2, "i_NPSELECT_RF_STRING_FWRITE": 1, "i_NPSELECT_RF_STRING_FWRITE1": 1, "i_NPSELECT_RF_STRING_FWRITE0": 1, "i_SELECT_RF_STRING_FWRITE": 1, "i_SELECT_RF_STRING_FWRITE3": 1, "i_STR_": 8, "i_ENCODING_": 4, "i_SELECT_RF_STRING_FWRITE2": 1, "i_SELECT_RF_STRING_FWRITE1": 1, "i_SELECT_RF_STRING_FWRITE0": 1, "rfString_Fwrite_fUTF8": 1, "closing": 1, "#error": 4, "Attempted": 1, "manipulation": 1, "off.": 1, "Rebuild": 1, "added": 1, "#endif//": 1, "": 1, "": 1, "SCHEDULER_MAXNAME": 3, "SCHEDULER_TASK_PATH_MAX": 2, "task": 3, "*parent": 1, "cpu_state_t*": 3, "task*": 2, "previous": 1, "vmem_context": 14, "*memory_context": 1, "Current": 1, "TASK_STATE_KILLED": 1, "TASK_STATE_TERMINATED": 1, "TASK_STATE_BLOCKING": 1, "TASK_STATE_STOPPED": 1, "TASK_STATE_RUNNING": 1, "task_state": 1, "Is": 1, "actually": 1, "PATH_MAX": 1, "toolchain": 1, "cwd": 1, "task_t": 3, "scheduler_state": 1, "scheduler_new": 1, "vmem_context*": 1, "memory_context": 1, "map_structs": 1, "scheduler_add": 1, "*task": 1, "scheduler_terminate_current": 1, "scheduler_get_current": 1, "scheduler_select": 1, "lastRegs": 1, "scheduler_init": 1, "scheduler_yield": 1, "scheduler_remove": 1, "*t": 2, "scheduler_fork": 1, "to_fork": 1, "PY_SSIZE_T_CLEAN": 1, "Py_PYTHON_H": 1, "Python": 2, "headers": 1, "compile": 1, "please": 1, "install": 1, "development": 1, "Python.": 1, "PY_VERSION_HEX": 11, "Cython": 1, "requires": 1, "offsetof": 2, "member": 2, "type*": 1, "WIN32": 2, "MS_WINDOWS": 2, "__stdcall": 2, "__cdecl": 2, "__fastcall": 2, "DL_IMPORT": 2, "DL_EXPORT": 2, "PY_LONG_LONG": 5, "LONG_LONG": 1, "Py_HUGE_VAL": 2, "HUGE_VAL": 1, "PYPY_VERSION": 1, "CYTHON_COMPILING_IN_PYPY": 3, "CYTHON_COMPILING_IN_CPYTHON": 6, "Py_ssize_t": 35, "PY_SSIZE_T_MAX": 1, "INT_MAX": 1, "PY_SSIZE_T_MIN": 1, "INT_MIN": 1, "PY_FORMAT_SIZE_T": 1, "CYTHON_FORMAT_SSIZE_T": 2, "PyInt_FromSsize_t": 6, "PyInt_FromLong": 3, "PyInt_AsSsize_t": 3, "__Pyx_PyInt_AsInt": 2, "PyNumber_Index": 1, "PyNumber_Check": 2, "PyFloat_Check": 2, "PyNumber_Int": 1, "PyErr_Format": 4, "PyExc_TypeError": 4, "Py_TYPE": 7, "tp_name": 4, "PyObject*": 24, "__Pyx_PyIndex_Check": 3, "PyComplex_Check": 1, "PyIndex_Check": 2, "PyErr_WarnEx": 1, "category": 2, "stacklevel": 1, "PyErr_Warn": 1, "__PYX_BUILD_PY_SSIZE_T": 2, "Py_REFCNT": 1, "ob_refcnt": 1, "ob_type": 7, "Py_SIZE": 1, "PyVarObject*": 1, "ob_size": 1, "PyVarObject_HEAD_INIT": 1, "PyObject_HEAD_INIT": 1, "PyType_Modified": 1, "PyObject": 276, "itemsize": 1, "readonly": 2, "ndim": 2, "*shape": 1, "*strides": 1, "*suboffsets": 1, "*internal": 1, "Py_buffer": 6, "PyBUF_SIMPLE": 1, "PyBUF_WRITABLE": 3, "PyBUF_FORMAT": 3, "PyBUF_ND": 2, "PyBUF_STRIDES": 6, "PyBUF_C_CONTIGUOUS": 1, "PyBUF_F_CONTIGUOUS": 1, "PyBUF_ANY_CONTIGUOUS": 1, "PyBUF_INDIRECT": 2, "PyBUF_RECORDS": 1, "PyBUF_FULL": 1, "PY_MAJOR_VERSION": 13, "__Pyx_BUILTIN_MODULE_NAME": 2, "__Pyx_PyCode_New": 2, "l": 7, "fv": 4, "cell": 4, "fline": 4, "lnos": 4, "PyCode_New": 2, "PY_MINOR_VERSION": 1, "PyUnicode_FromString": 2, "PyUnicode_Decode": 1, "Py_TPFLAGS_CHECKTYPES": 1, "Py_TPFLAGS_HAVE_INDEX": 1, "Py_TPFLAGS_HAVE_NEWBUFFER": 1, "PyUnicode_KIND": 1, "CYTHON_PEP393_ENABLED": 2, "__Pyx_PyUnicode_READY": 2, "op": 8, "likely": 21, "PyUnicode_IS_READY": 1, "_PyUnicode_Ready": 1, "__Pyx_PyUnicode_GET_LENGTH": 2, "PyUnicode_GET_LENGTH": 1, "__Pyx_PyUnicode_READ_CHAR": 2, "PyUnicode_READ_CHAR": 1, "__Pyx_PyUnicode_READ": 2, "PyUnicode_READ": 1, "PyUnicode_GET_SIZE": 1, "Py_UCS4": 2, "PyUnicode_AS_UNICODE": 1, "Py_UNICODE*": 1, "PyBaseString_Type": 1, "PyUnicode_Type": 2, "PyStringObject": 2, "PyUnicodeObject": 1, "PyString_Type": 2, "PyString_Check": 2, "PyUnicode_Check": 1, "PyString_CheckExact": 2, "PyUnicode_CheckExact": 1, "PyBytesObject": 1, "PyBytes_Type": 1, "PyBytes_Check": 1, "PyBytes_CheckExact": 1, "PyBytes_FromString": 2, "PyString_FromString": 2, "PyBytes_FromStringAndSize": 1, "PyString_FromStringAndSize": 1, "PyBytes_FromFormat": 1, "PyString_FromFormat": 1, "PyBytes_DecodeEscape": 1, "PyString_DecodeEscape": 1, "PyBytes_AsString": 2, "PyString_AsString": 1, "PyBytes_AsStringAndSize": 1, "PyString_AsStringAndSize": 1, "PyBytes_Size": 1, "PyString_Size": 1, "PyBytes_AS_STRING": 1, "PyString_AS_STRING": 1, "PyBytes_GET_SIZE": 1, "PyString_GET_SIZE": 1, "PyBytes_Repr": 1, "PyString_Repr": 1, "PyBytes_Concat": 1, "PyString_Concat": 1, "PyBytes_ConcatAndDel": 1, "PyString_ConcatAndDel": 1, "PySet_Check": 1, "PyObject_TypeCheck": 3, "PySet_Type": 2, "PyFrozenSet_Check": 1, "PyFrozenSet_Type": 1, "PySet_CheckExact": 2, "__Pyx_TypeCheck": 1, "PyTypeObject": 25, "PyIntObject": 1, "PyLongObject": 2, "PyInt_Type": 1, "PyLong_Type": 1, "PyInt_Check": 1, "PyLong_Check": 1, "PyInt_CheckExact": 1, "PyLong_CheckExact": 1, "PyInt_FromString": 1, "PyLong_FromString": 1, "PyInt_FromUnicode": 1, "PyLong_FromUnicode": 1, "PyLong_FromLong": 1, "PyInt_FromSize_t": 1, "PyLong_FromSize_t": 1, "PyLong_FromSsize_t": 1, "PyInt_AsLong": 2, "PyLong_AsLong": 1, "PyInt_AS_LONG": 1, "PyLong_AS_LONG": 1, "PyLong_AsSsize_t": 1, "PyInt_AsUnsignedLongMask": 1, "PyLong_AsUnsignedLongMask": 1, "PyInt_AsUnsignedLongLongMask": 1, "PyLong_AsUnsignedLongLongMask": 1, "PyBoolObject": 1, "Py_hash_t": 1, "__Pyx_PyInt_FromHash_t": 2, "__Pyx_PyInt_AsHash_t": 2, "__Pyx_PySequence_GetSlice": 2, "PySequence_GetSlice": 2, "__Pyx_PySequence_SetSlice": 2, "PySequence_SetSlice": 2, "__Pyx_PySequence_DelSlice": 2, "PySequence_DelSlice": 2, "unlikely": 53, "PyErr_SetString": 3, "PyExc_SystemError": 3, "tp_as_mapping": 3, "PyMethod_New": 2, "func": 3, "klass": 1, "PyInstanceMethod_New": 1, "__Pyx_GetAttrString": 2, "PyObject_GetAttrString": 2, "__Pyx_SetAttrString": 2, "PyObject_SetAttrString": 2, "__Pyx_DelAttrString": 2, "PyObject_DelAttrString": 2, "__Pyx_NAMESTR": 2, "__Pyx_DOCSTR": 2, "__Pyx_PyNumber_Divide": 2, "PyNumber_TrueDivide": 1, "__Pyx_PyNumber_InPlaceDivide": 2, "PyNumber_InPlaceTrueDivide": 1, "PyNumber_Divide": 1, "PyNumber_InPlaceDivide": 1, "__PYX_EXTERN_C": 3, "_USE_MATH_DEFINES": 1, "__PYX_HAVE__sklearn__linear_model__sgd_fast": 1, "__PYX_HAVE_API__sklearn__linear_model__sgd_fast": 1, "_OPENMP": 1, "": 1, "PYREX_WITHOUT_ASSERTIONS": 1, "CYTHON_WITHOUT_ASSERTIONS": 1, "CYTHON_INLINE": 65, "__inline": 1, "__STDC_VERSION__": 2, "CYTHON_UNUSED": 14, "**p": 1, "is_unicode": 1, "is_str": 1, "intern": 1, "__Pyx_StringTabEntry": 2, "__Pyx_PyBytes_FromUString": 1, "__Pyx_PyBytes_AsUString": 1, "__Pyx_Owned_Py_None": 1, "Py_INCREF": 10, "Py_None": 8, "__Pyx_PyBool_FromLong": 1, "Py_True": 2, "Py_False": 2, "__Pyx_PyObject_IsTrue": 1, "__Pyx_PyNumber_Int": 1, "__Pyx_PyIndex_AsSsize_t": 1, "__Pyx_PyInt_FromSize_t": 1, "__Pyx_PyInt_AsSize_t": 1, "__pyx_PyFloat_AsDouble": 12, "PyFloat_CheckExact": 1, "PyFloat_AS_DOUBLE": 1, "PyFloat_AsDouble": 2, "__pyx_PyFloat_AsFloat": 1, "__builtin_expect": 2, "*__pyx_m": 1, "*__pyx_b": 1, "*__pyx_empty_tuple": 1, "*__pyx_empty_bytes": 1, "__pyx_lineno": 58, "__pyx_clineno": 58, "__pyx_cfilenm": 1, "__FILE__": 4, "*__pyx_filename": 7, "CYTHON_CCOMPLEX": 12, "_Complex_I": 3, "": 1, "": 1, "__sun__": 1, "*__pyx_f": 1, "IS_UNSIGNED": 1, "__Pyx_StructField_": 2, "__PYX_BUF_FLAGS_PACKED_STRUCT": 1, "__Pyx_StructField_*": 1, "fields": 1, "arraysize": 1, "typegroup": 1, "is_unsigned": 1, "__Pyx_TypeInfo": 2, "__Pyx_TypeInfo*": 2, "__Pyx_StructField": 2, "__Pyx_StructField*": 1, "field": 1, "parent_offset": 1, "__Pyx_BufFmt_StackElem": 1, "__Pyx_BufFmt_StackElem*": 2, "fmt_offset": 1, "new_count": 1, "enc_count": 1, "struct_alignment": 1, "is_complex": 1, "enc_type": 1, "new_packmode": 1, "enc_packmode": 1, "is_valid_array": 1, "__Pyx_BufFmt_Context": 1, "npy_int8": 1, "__pyx_t_5numpy_int8_t": 1, "npy_int16": 1, "__pyx_t_5numpy_int16_t": 1, "npy_int32": 1, "__pyx_t_5numpy_int32_t": 4, "npy_int64": 1, "__pyx_t_5numpy_int64_t": 1, "npy_uint8": 1, "__pyx_t_5numpy_uint8_t": 1, "npy_uint16": 1, "__pyx_t_5numpy_uint16_t": 1, "npy_uint32": 1, "__pyx_t_5numpy_uint32_t": 1, "npy_uint64": 1, "__pyx_t_5numpy_uint64_t": 1, "npy_float32": 1, "__pyx_t_5numpy_float32_t": 1, "npy_float64": 1, "__pyx_t_5numpy_float64_t": 4, "npy_long": 1, "__pyx_t_5numpy_int_t": 1, "npy_longlong": 2, "__pyx_t_5numpy_long_t": 1, "__pyx_t_5numpy_longlong_t": 1, "npy_ulong": 1, "__pyx_t_5numpy_uint_t": 1, "npy_ulonglong": 2, "__pyx_t_5numpy_ulong_t": 1, "__pyx_t_5numpy_ulonglong_t": 1, "npy_intp": 1, "__pyx_t_5numpy_intp_t": 1, "npy_uintp": 1, "__pyx_t_5numpy_uintp_t": 1, "npy_double": 2, "__pyx_t_5numpy_float_t": 1, "__pyx_t_5numpy_double_t": 1, "npy_longdouble": 1, "__pyx_t_5numpy_longdouble_t": 1, "__pyx_t_7sklearn_5utils_13weight_vector_DOUBLE": 2, "__pyx_t_7sklearn_5utils_13weight_vector_INTEGER": 1, "__pyx_t_7sklearn_5utils_11seq_dataset_DOUBLE": 7, "__pyx_t_7sklearn_5utils_11seq_dataset_INTEGER": 7, "__pyx_t_7sklearn_12linear_model_8sgd_fast_DOUBLE": 4, "__pyx_t_7sklearn_12linear_model_8sgd_fast_INTEGER": 3, "std": 8, "complex": 2, "__pyx_t_float_complex": 27, "_Complex": 2, "real": 2, "imag": 2, "__pyx_t_double_complex": 27, "__pyx_obj_7sklearn_12linear_model_8sgd_fast_LossFunction": 15, "__pyx_obj_7sklearn_12linear_model_8sgd_fast_Regression": 11, "__pyx_obj_7sklearn_12linear_model_8sgd_fast_Huber": 6, "__pyx_obj_7sklearn_5utils_11seq_dataset_SequentialDataset": 5, "__pyx_obj_7sklearn_12linear_model_8sgd_fast_EpsilonInsensitive": 6, "__pyx_obj_7sklearn_12linear_model_8sgd_fast_Classification": 7, "__pyx_obj_7sklearn_5utils_11seq_dataset_CSRDataset": 2, "__pyx_obj_7sklearn_12linear_model_8sgd_fast_Log": 5, "__pyx_obj_7sklearn_12linear_model_8sgd_fast_Hinge": 6, "__pyx_obj_7sklearn_5utils_11seq_dataset_ArrayDataset": 2, "__pyx_obj_7sklearn_12linear_model_8sgd_fast_SquaredHinge": 6, "__pyx_obj_7sklearn_12linear_model_8sgd_fast_ModifiedHuber": 5, "__pyx_obj_7sklearn_5utils_13weight_vector_WeightVector": 3, "__pyx_obj_7sklearn_12linear_model_8sgd_fast_SquaredLoss": 5, "__pyx_obj_7sklearn_12linear_model_8sgd_fast_SquaredEpsilonInsensitive": 6, "npy_cfloat": 1, "__pyx_t_5numpy_cfloat_t": 1, "npy_cdouble": 2, "__pyx_t_5numpy_cdouble_t": 1, "npy_clongdouble": 1, "__pyx_t_5numpy_clongdouble_t": 1, "__pyx_t_5numpy_complex_t": 1, "PyObject_HEAD": 3, "__pyx_vtabstruct_7sklearn_12linear_model_8sgd_fast_LossFunction": 5, "*__pyx_vtab": 3, "__pyx_base": 18, "__pyx_vtabstruct_7sklearn_5utils_11seq_dataset_SequentialDataset": 4, "n_samples": 1, "epsilon": 2, "current_index": 2, "stride": 2, "*X_data_ptr": 2, "*X_indptr_ptr": 1, "*X_indices_ptr": 1, "*Y_data_ptr": 2, "PyArrayObject": 8, "*feature_indices": 2, "*feature_indices_ptr": 2, "*index": 2, "*index_data_ptr": 2, "*sample_weight_data": 2, "threshold": 2, "n_features": 2, "__pyx_vtabstruct_7sklearn_5utils_13weight_vector_WeightVector": 3, "*w_data_ptr": 1, "wscale": 1, "sq_norm": 1, "*__pyx_vtabptr_7sklearn_5utils_11seq_dataset_SequentialDataset": 1, "__pyx_vtabstruct_7sklearn_5utils_11seq_dataset_ArrayDataset": 2, "*__pyx_vtabptr_7sklearn_5utils_11seq_dataset_ArrayDataset": 1, "__pyx_vtabstruct_7sklearn_5utils_11seq_dataset_CSRDataset": 2, "*__pyx_vtabptr_7sklearn_5utils_11seq_dataset_CSRDataset": 1, "__pyx_vtabstruct_7sklearn_12linear_model_8sgd_fast_EpsilonInsensitive": 2, "__pyx_vtabstruct_7sklearn_12linear_model_8sgd_fast_Regression": 3, "*__pyx_vtabptr_7sklearn_12linear_model_8sgd_fast_EpsilonInsensitive": 1, "__pyx_vtabstruct_7sklearn_12linear_model_8sgd_fast_SquaredHinge": 2, "*__pyx_vtabptr_7sklearn_12linear_model_8sgd_fast_SquaredHinge": 1, "__pyx_vtabstruct_7sklearn_12linear_model_8sgd_fast_Huber": 2, "*__pyx_vtabptr_7sklearn_12linear_model_8sgd_fast_Huber": 1, "__pyx_vtabstruct_7sklearn_12linear_model_8sgd_fast_Hinge": 2, "__pyx_vtabstruct_7sklearn_12linear_model_8sgd_fast_Classification": 1, "*__pyx_vtabptr_7sklearn_12linear_model_8sgd_fast_Hinge": 1, "*__pyx_vtabptr_7sklearn_5utils_13weight_vector_WeightVector": 1, "CYTHON_REFNANNY": 3, "__Pyx_RefNannyAPIStruct": 3, "*__Pyx_RefNanny": 1, "*__Pyx_RefNannyImportAPI": 1, "*modname": 1, "__Pyx_RefNannyDeclarations": 11, "*__pyx_refnanny": 1, "WITH_THREAD": 1, "__Pyx_RefNannySetupContext": 12, "acquire_gil": 4, "PyGILState_STATE": 1, "__pyx_gilstate_save": 2, "PyGILState_Ensure": 1, "__pyx_refnanny": 8, "__Pyx_RefNanny": 8, "SetupContext": 3, "PyGILState_Release": 1, "__Pyx_RefNannyFinishContext": 14, "FinishContext": 1, "__Pyx_INCREF": 6, "INCREF": 1, "__Pyx_DECREF": 20, "DECREF": 1, "__Pyx_GOTREF": 24, "GOTREF": 1, "__Pyx_GIVEREF": 9, "GIVEREF": 1, "__Pyx_XINCREF": 2, "__Pyx_XDECREF": 20, "__Pyx_XGOTREF": 2, "__Pyx_XGIVEREF": 5, "Py_DECREF": 2, "Py_XINCREF": 1, "Py_XDECREF": 1, "__Pyx_CLEAR": 1, "__Pyx_XCLEAR": 1, "*__Pyx_GetName": 1, "__Pyx_ErrRestore": 1, "*type": 4, "*tb": 2, "__Pyx_ErrFetch": 1, "**type": 1, "**value": 1, "**tb": 1, "__Pyx_Raise": 4, "*cause": 1, "__Pyx_RaiseArgtupleInvalid": 7, "func_name": 2, "num_min": 1, "num_max": 1, "num_found": 1, "__Pyx_RaiseDoubleKeywordsError": 1, "kw_name": 1, "__Pyx_ParseOptionalKeywords": 4, "*kwds": 1, "**argnames": 1, "*kwds2": 1, "*values": 1, "num_pos_args": 1, "function_name": 1, "__Pyx_ArgTypeTest": 1, "none_allowed": 1, "__Pyx_GetBufferAndValidate": 1, "Py_buffer*": 2, "dtype": 1, "nd": 1, "__Pyx_SafeReleaseBuffer": 1, "__Pyx_TypeTest": 1, "__Pyx_RaiseBufferFallbackError": 1, "*__Pyx_GetItemInt_Generic": 1, "*r": 7, "PyObject_GetItem": 1, "__Pyx_GetItemInt_List": 1, "to_py_func": 6, "__Pyx_GetItemInt_List_Fast": 1, "__Pyx_GetItemInt_Generic": 6, "*__Pyx_GetItemInt_List_Fast": 1, "PyList_GET_SIZE": 5, "PyList_GET_ITEM": 3, "PySequence_GetItem": 3, "__Pyx_GetItemInt_Tuple": 1, "__Pyx_GetItemInt_Tuple_Fast": 1, "*__Pyx_GetItemInt_Tuple_Fast": 1, "PyTuple_GET_SIZE": 14, "PyTuple_GET_ITEM": 15, "__Pyx_GetItemInt": 1, "__Pyx_GetItemInt_Fast": 2, "PyList_CheckExact": 1, "PyTuple_CheckExact": 1, "PySequenceMethods": 1, "*m": 1, "tp_as_sequence": 1, "sq_item": 2, "sq_length": 2, "PySequence_Check": 1, "__Pyx_RaiseTooManyValuesError": 1, "expected": 2, "__Pyx_RaiseNeedMoreValuesError": 1, "__Pyx_RaiseNoneNotIterableError": 1, "__Pyx_IterFinish": 1, "__Pyx_IternextUnpackEndCheck": 1, "*retval": 1, "shape": 1, "strides": 1, "suboffsets": 1, "__Pyx_Buf_DimInfo": 2, "refcount": 1, "pybuffer": 1, "__Pyx_Buffer": 2, "*rcbuffer": 1, "diminfo": 1, "__Pyx_LocalBuf_ND": 1, "__Pyx_GetBuffer": 2, "*view": 2, "__Pyx_ReleaseBuffer": 2, "PyObject_GetBuffer": 1, "PyBuffer_Release": 1, "__Pyx_zeros": 1, "__Pyx_minusones": 1, "*__Pyx_Import": 1, "*from_list": 1, "__Pyx_RaiseImportError": 1, "__Pyx_Print": 1, "__pyx_print": 1, "__pyx_print_kwargs": 1, "__Pyx_PrintOne": 1, "__Pyx_CREAL": 4, ".real": 3, "__Pyx_CIMAG": 4, ".imag": 3, "__real__": 1, "__imag__": 1, "__Pyx_SET_CREAL": 2, "__Pyx_SET_CIMAG": 2, "__pyx_t_float_complex_from_parts": 1, "__Pyx_c_eqf": 2, "__Pyx_c_sumf": 2, "__Pyx_c_difff": 2, "__Pyx_c_prodf": 2, "__Pyx_c_quotf": 2, "__Pyx_c_negf": 2, "__Pyx_c_is_zerof": 3, "__Pyx_c_conjf": 3, "conj": 3, "__Pyx_c_absf": 3, "__Pyx_c_powf": 3, "pow": 2, "conjf": 1, "cabsf": 1, "cpowf": 1, "__pyx_t_double_complex_from_parts": 1, "__Pyx_c_eq": 2, "__Pyx_c_sum": 2, "__Pyx_c_diff": 2, "__Pyx_c_prod": 2, "__Pyx_c_quot": 2, "__Pyx_c_neg": 2, "__Pyx_c_is_zero": 3, "__Pyx_c_conj": 3, "__Pyx_c_abs": 3, "__Pyx_c_pow": 3, "cabs": 1, "cpow": 1, "__Pyx_PyInt_AsUnsignedChar": 1, "__Pyx_PyInt_AsUnsignedShort": 1, "__Pyx_PyInt_AsUnsignedInt": 1, "__Pyx_PyInt_AsChar": 1, "__Pyx_PyInt_AsShort": 1, "__Pyx_PyInt_AsSignedChar": 1, "__Pyx_PyInt_AsSignedShort": 1, "__Pyx_PyInt_AsSignedInt": 1, "__Pyx_PyInt_AsLongDouble": 1, "__Pyx_PyInt_AsUnsignedLong": 1, "__Pyx_PyInt_AsUnsignedLongLong": 1, "__Pyx_PyInt_AsLong": 1, "__Pyx_PyInt_AsLongLong": 1, "__Pyx_PyInt_AsSignedLong": 1, "__Pyx_PyInt_AsSignedLongLong": 1, "__Pyx_WriteUnraisable": 4, "clineno": 1, "lineno": 1, "*filename": 2, "__Pyx_check_binary_version": 1, "__Pyx_SetVtable": 1, "*vtable": 1, "__Pyx_PyIdentifier_FromString": 3, "*__Pyx_ImportModule": 1, "*__Pyx_ImportType": 1, "*module_name": 1, "*class_name": 1, "__Pyx_GetVtable": 1, "code_line": 4, "PyCodeObject*": 2, "code_object": 2, "__Pyx_CodeObjectCacheEntry": 1, "__Pyx_CodeObjectCache": 2, "max_count": 1, "__Pyx_CodeObjectCacheEntry*": 2, "entries": 2, "__pyx_code_cache": 1, "__pyx_bisect_code_objects": 1, "PyCodeObject": 1, "*__pyx_find_code_object": 1, "__pyx_insert_code_object": 1, "__Pyx_AddTraceback": 7, "*funcname": 1, "c_line": 1, "py_line": 1, "__Pyx_InitStrings": 1, "*__pyx_ptype_7cpython_4type_type": 1, "*__pyx_ptype_5numpy_dtype": 1, "*__pyx_ptype_5numpy_flatiter": 1, "*__pyx_ptype_5numpy_broadcast": 1, "*__pyx_ptype_5numpy_ndarray": 1, "*__pyx_ptype_5numpy_ufunc": 1, "*__pyx_f_5numpy__util_dtypestring": 1, "PyArray_Descr": 1, "*__pyx_ptype_7sklearn_5utils_13weight_vector_WeightVector": 1, "*__pyx_ptype_7sklearn_5utils_11seq_dataset_SequentialDataset": 1, "*__pyx_ptype_7sklearn_5utils_11seq_dataset_ArrayDataset": 1, "*__pyx_ptype_7sklearn_5utils_11seq_dataset_CSRDataset": 1, "*__pyx_ptype_7sklearn_12linear_model_8sgd_fast_LossFunction": 1, "*__pyx_ptype_7sklearn_12linear_model_8sgd_fast_Regression": 1, "*__pyx_ptype_7sklearn_12linear_model_8sgd_fast_Classification": 1, "*__pyx_ptype_7sklearn_12linear_model_8sgd_fast_ModifiedHuber": 1, "*__pyx_ptype_7sklearn_12linear_model_8sgd_fast_Hinge": 1, "*__pyx_ptype_7sklearn_12linear_model_8sgd_fast_SquaredHinge": 1, "*__pyx_ptype_7sklearn_12linear_model_8sgd_fast_Log": 1, "*__pyx_ptype_7sklearn_12linear_model_8sgd_fast_SquaredLoss": 1, "*__pyx_ptype_7sklearn_12linear_model_8sgd_fast_Huber": 1, "*__pyx_ptype_7sklearn_12linear_model_8sgd_fast_EpsilonInsensitive": 1, "*__pyx_ptype_7sklearn_12linear_model_8sgd_fast_SquaredEpsilonInsensitive": 1, "__pyx_f_7sklearn_12linear_model_8sgd_fast_max": 1, "__pyx_f_7sklearn_12linear_model_8sgd_fast_min": 1, "__pyx_f_7sklearn_12linear_model_8sgd_fast_sqnorm": 1, "__pyx_f_7sklearn_12linear_model_8sgd_fast_l1penalty": 1, "__Pyx_TypeInfo_nn___pyx_t_7sklearn_12linear_model_8sgd_fast_DOUBLE": 1, "__Pyx_MODULE_NAME": 1, "__pyx_module_is_main_sklearn__linear_model__sgd_fast": 1, "*__pyx_builtin_NotImplementedError": 1, "*__pyx_builtin_range": 1, "*__pyx_builtin_ValueError": 1, "*__pyx_builtin_RuntimeError": 1, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_12LossFunction_loss": 2, "*__pyx_v_self": 52, "__pyx_v_p": 46, "__pyx_v_y": 46, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_12LossFunction_2dloss": 2, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_10Regression_loss": 2, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_10Regression_2dloss": 1, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_14Classification_loss": 1, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_14Classification_2dloss": 1, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_13ModifiedHuber_loss": 1, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_13ModifiedHuber_2dloss": 1, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_13ModifiedHuber_4__reduce__": 1, "__pyx_pf_7sklearn_12linear_model_8sgd_fast_5Hinge___init__": 1, "__pyx_v_threshold": 2, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_5Hinge_2loss": 1, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_5Hinge_4dloss": 1, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_5Hinge_6__reduce__": 1, "__pyx_pf_7sklearn_12linear_model_8sgd_fast_12SquaredHinge___init__": 1, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_12SquaredHinge_2loss": 1, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_12SquaredHinge_4dloss": 1, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_12SquaredHinge_6__reduce__": 1, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_3Log_loss": 1, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_3Log_2dloss": 1, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_3Log_4__reduce__": 1, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_11SquaredLoss_loss": 1, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_11SquaredLoss_2dloss": 1, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_11SquaredLoss_4__reduce__": 1, "__pyx_pf_7sklearn_12linear_model_8sgd_fast_5Huber___init__": 1, "__pyx_v_c": 1, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_5Huber_2loss": 1, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_5Huber_4dloss": 1, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_5Huber_6__reduce__": 1, "__pyx_pf_7sklearn_12linear_model_8sgd_fast_18EpsilonInsensitive___init__": 1, "__pyx_v_epsilon": 2, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_18EpsilonInsensitive_2loss": 1, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_18EpsilonInsensitive_4dloss": 1, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_18EpsilonInsensitive_6__reduce__": 1, "__pyx_pf_7sklearn_12linear_model_8sgd_fast_25SquaredEpsilonInsensitive___init__": 1, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_25SquaredEpsilonInsensitive_2loss": 1, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_25SquaredEpsilonInsensitive_4dloss": 1, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_25SquaredEpsilonInsensitive_6__reduce__": 1, "*__pyx_pf_7sklearn_12linear_model_8sgd_fast_plain_sgd": 1, "*__pyx_self": 1, "*__pyx_v_weights": 1, "__pyx_v_intercept": 1, "*__pyx_v_loss": 1, "__pyx_v_penalty_type": 1, "__pyx_v_alpha": 1, "__pyx_v_C": 1, "__pyx_v_rho": 1, "*__pyx_v_dataset": 1, "__pyx_v_n_iter": 1, "__pyx_v_fit_intercept": 1, "__pyx_v_verbose": 1, "__pyx_v_shuffle": 1, "*__pyx_v_seed": 1, "__pyx_v_weight_pos": 1, "__pyx_v_weight_neg": 1, "__pyx_v_learning_rate": 1, "__pyx_v_eta0": 1, "__pyx_v_power_t": 1, "__pyx_v_t": 1, "__pyx_v_intercept_decay": 1, "__pyx_pf_5numpy_7ndarray___getbuffer__": 1, "*__pyx_v_info": 2, "__pyx_v_flags": 1, "__pyx_pf_5numpy_7ndarray_2__releasebuffer__": 1, "__pyx_k_1": 1, "__pyx_k_2": 1, "__pyx_k_3": 1, "__pyx_k_4": 1, "__pyx_k_6": 1, "__pyx_k_8": 1, "__pyx_k_10": 1, "__pyx_k_12": 1, "__pyx_k_13": 1, "__pyx_k_16": 1, "__pyx_k_20": 1, "__pyx_k_21": 1, "__pyx_k__B": 1, "__pyx_k__C": 1, "__pyx_k__H": 1, "__pyx_k__I": 1, "__pyx_k__L": 1, "__pyx_k__O": 1, "__pyx_k__Q": 1, "__pyx_k__b": 1, "__pyx_k__c": 1, "__pyx_k__d": 1, "__pyx_k__f": 1, "__pyx_k__g": 1, "__pyx_k__h": 1, "__pyx_k__i": 1, "__pyx_k__l": 1, "__pyx_k__p": 1, "__pyx_k__q": 1, "__pyx_k__t": 1, "__pyx_k__u": 1, "__pyx_k__w": 1, "__pyx_k__y": 1, "__pyx_k__Zd": 1, "__pyx_k__Zf": 1, "__pyx_k__Zg": 1, "__pyx_k__np": 1, "__pyx_k__any": 1, "__pyx_k__eta": 1, "__pyx_k__rho": 1, "__pyx_k__sys": 1, "__pyx_k__eta0": 1, "__pyx_k__loss": 1, "__pyx_k__seed": 1, "__pyx_k__time": 1, "__pyx_k__xnnz": 1, "__pyx_k__alpha": 1, "__pyx_k__count": 1, "__pyx_k__dloss": 1, "__pyx_k__dtype": 1, "__pyx_k__epoch": 1, "__pyx_k__isinf": 1, "__pyx_k__isnan": 1, "__pyx_k__numpy": 1, "__pyx_k__order": 1, "__pyx_k__range": 1, "__pyx_k__shape": 1, "__pyx_k__zeros": 1, "__pyx_k__n_iter": 1, "__pyx_k__update": 1, "__pyx_k__dataset": 1, "__pyx_k__epsilon": 1, "__pyx_k__float64": 1, "__pyx_k__nonzero": 1, "__pyx_k__power_t": 1, "__pyx_k__shuffle": 1, "__pyx_k__sumloss": 1, "__pyx_k__t_start": 1, "__pyx_k__verbose": 1, "__pyx_k__weights": 1, "__pyx_k____main__": 1, "__pyx_k____test__": 1, "__pyx_k__is_hinge": 1, "__pyx_k__intercept": 1, "__pyx_k__n_samples": 1, "__pyx_k__plain_sgd": 1, "__pyx_k__threshold": 1, "__pyx_k__x_ind_ptr": 1, "__pyx_k__ValueError": 1, "__pyx_k__n_features": 1, "__pyx_k__q_data_ptr": 1, "__pyx_k__weight_neg": 1, "__pyx_k__weight_pos": 1, "__pyx_k__x_data_ptr": 1, "__pyx_k__RuntimeError": 1, "__pyx_k__class_weight": 1, "__pyx_k__penalty_type": 1, "__pyx_k__fit_intercept": 1, "__pyx_k__learning_rate": 1, "__pyx_k__sample_weight": 1, "__pyx_k__intercept_decay": 1, "__pyx_k__NotImplementedError": 1, "*__pyx_kp_s_1": 1, "*__pyx_kp_u_10": 1, "*__pyx_kp_u_12": 1, "*__pyx_kp_u_13": 1, "*__pyx_kp_u_16": 1, "*__pyx_kp_s_2": 1, "*__pyx_kp_s_20": 1, "*__pyx_n_s_21": 1, "*__pyx_kp_s_3": 1, "*__pyx_kp_s_4": 1, "*__pyx_kp_u_6": 1, "*__pyx_kp_u_8": 1, "*__pyx_n_s__C": 1, "*__pyx_n_s__NotImplementedError": 1, "*__pyx_n_s__RuntimeError": 1, "*__pyx_n_s__ValueError": 1, "*__pyx_n_s____main__": 1, "*__pyx_n_s____test__": 1, "*__pyx_n_s__alpha": 1, "*__pyx_n_s__any": 1, "*__pyx_n_s__c": 1, "*__pyx_n_s__class_weight": 1, "*__pyx_n_s__count": 1, "*__pyx_n_s__dataset": 1, "*__pyx_n_s__dloss": 1, "*__pyx_n_s__dtype": 1, "*__pyx_n_s__epoch": 1, "*__pyx_n_s__epsilon": 1, "*__pyx_n_s__eta": 1, "*__pyx_n_s__eta0": 1, "*__pyx_n_s__fit_intercept": 1, "*__pyx_n_s__float64": 1, "*__pyx_n_s__i": 1, "*__pyx_n_s__intercept": 1, "*__pyx_n_s__intercept_decay": 1, "*__pyx_n_s__is_hinge": 1, "*__pyx_n_s__isinf": 1, "*__pyx_n_s__isnan": 1, "*__pyx_n_s__learning_rate": 1, "*__pyx_n_s__loss": 1, "*__pyx_n_s__n_features": 1, "*__pyx_n_s__n_iter": 1, "*__pyx_n_s__n_samples": 1, "*__pyx_n_s__nonzero": 1, "*__pyx_n_s__np": 1, "*__pyx_n_s__numpy": 1, "*__pyx_n_s__order": 1, "*__pyx_n_s__p": 1, "*__pyx_n_s__penalty_type": 1, "*__pyx_n_s__plain_sgd": 1, "*__pyx_n_s__power_t": 1, "*__pyx_n_s__q": 1, "*__pyx_n_s__q_data_ptr": 1, "*__pyx_n_s__range": 1, "*__pyx_n_s__rho": 1, "*__pyx_n_s__sample_weight": 1, "*__pyx_n_s__seed": 1, "*__pyx_n_s__shape": 1, "*__pyx_n_s__shuffle": 1, "*__pyx_n_s__sumloss": 1, "*__pyx_n_s__sys": 1, "*__pyx_n_s__t": 1, "*__pyx_n_s__t_start": 1, "*__pyx_n_s__threshold": 1, "*__pyx_n_s__time": 1, "*__pyx_n_s__u": 1, "*__pyx_n_s__update": 1, "*__pyx_n_s__verbose": 1, "*__pyx_n_s__w": 1, "*__pyx_n_s__weight_neg": 1, "*__pyx_n_s__weight_pos": 1, "*__pyx_n_s__weights": 1, "*__pyx_n_s__x_data_ptr": 1, "*__pyx_n_s__x_ind_ptr": 1, "*__pyx_n_s__xnnz": 1, "*__pyx_n_s__y": 1, "*__pyx_n_s__zeros": 1, "*__pyx_int_15": 1, "*__pyx_k_tuple_5": 1, "*__pyx_k_tuple_7": 1, "*__pyx_k_tuple_9": 1, "*__pyx_k_tuple_11": 1, "*__pyx_k_tuple_14": 1, "*__pyx_k_tuple_15": 1, "*__pyx_k_tuple_17": 1, "*__pyx_k_tuple_18": 1, "*__pyx_k_codeobj_19": 1, "*__pyx_pw_7sklearn_12linear_model_8sgd_fast_12LossFunction_1loss": 3, "*__pyx_args": 9, "*__pyx_kwds": 9, "__pyx_f_7sklearn_12linear_model_8sgd_fast_12LossFunction_loss": 1, "__pyx_skip_dispatch": 6, "__pyx_r": 39, "*__pyx_t_1": 6, "*__pyx_t_2": 3, "*__pyx_t_3": 3, "*__pyx_t_4": 3, "__pyx_t_5": 12, "__pyx_v_self": 15, "tp_dictoffset": 3, "__pyx_t_1": 69, "PyObject_GetAttr": 3, "__pyx_n_s__loss": 2, "__pyx_filename": 51, "__pyx_f": 42, "__pyx_L1_error": 33, "PyCFunction_Check": 3, "PyCFunction_GET_FUNCTION": 3, "PyCFunction": 3, "__pyx_pw_7sklearn_12linear_model_8sgd_fast_12LossFunction_1loss": 1, "__pyx_t_2": 21, "PyFloat_FromDouble": 9, "__pyx_t_3": 39, "__pyx_t_4": 27, "PyTuple_New": 3, "PyTuple_SET_ITEM": 6, "PyObject_Call": 6, "PyErr_Occurred": 9, "__pyx_L0": 18, "__pyx_builtin_NotImplementedError": 3, "__pyx_empty_tuple": 3, "__pyx_doc_7sklearn_12linear_model_8sgd_fast_12LossFunction_loss": 1, "*__pyx_r": 6, "**__pyx_pyargnames": 3, "__pyx_n_s__p": 6, "__pyx_n_s__y": 6, "__pyx_kwds": 15, "kw_args": 15, "pos_args": 12, "__pyx_args": 21, "__pyx_L5_argtuple_error": 12, "PyDict_Size": 3, "PyDict_GetItem": 6, "__pyx_L3_error": 18, "__pyx_pyargnames": 3, "__pyx_L4_argument_unpacking_done": 6, "__pyx_pf_7sklearn_12linear_model_8sgd_fast_12LossFunction_loss": 1, "__pyx_vtab": 2, "loss": 1, "*__pyx_pw_7sklearn_12linear_model_8sgd_fast_12LossFunction_3dloss": 3, "__pyx_f_7sklearn_12linear_model_8sgd_fast_12LossFunction_dloss": 1, "__pyx_n_s__dloss": 1, "__pyx_pw_7sklearn_12linear_model_8sgd_fast_12LossFunction_3dloss": 1, "__pyx_doc_7sklearn_12linear_model_8sgd_fast_12LossFunction_2dloss": 1, "__pyx_pf_7sklearn_12linear_model_8sgd_fast_12LossFunction_2dloss": 1, "dloss": 1, "*__pyx_pw_7sklearn_12linear_model_8sgd_fast_10Regression_1loss": 3, "__pyx_f_7sklearn_12linear_model_8sgd_fast_10Regression_loss": 1, "__pyx_pw_7sklearn_12linear_model_8sgd_fast_10Regression_1loss": 1, "__pyx_pf_7sklearn_12linear_model_8sgd_fast_10Regression_loss": 1, "__pyx_base.__pyx_vtab": 1, "__pyx_base.loss": 1, "syscalldef": 1, "syscalldefs": 1, "SYSCALL_OR_NUM": 3, "SYS_restart_syscall": 1, "MAKE_UINT16": 3, "SYS_exit": 1, "SYS_fork": 1, "": 1, "syscall_t": 1, "syscall_table": 1, "sys_exit": 1, "sys_read": 1, "sys_write": 1, "sys_getpid": 1, "sys_brk": 1, "sys_getppid": 1, "sys_mmap": 1, "sys_munmap": 1, "sys_test": 1, "sys_get_hostname": 1, "sys_set_hostname": 1, "sys_uname": 1, "sys_open": 1, "sys_execve": 1, "sys_seek": 1, "sys_opendir": 1, "sys_readdir": 1, "sys_kill": 1, "sys_getexecdata": 1, "sys_chdir": 1, "sys_getcwd": 1, "sys_fork": 1, "syscall_name_table": 1, "VFS_SEEK_SET": 1, "VFS_SEEK_CUR": 1, "VFS_SEEK_END": 1, "mount_path": 2, "mountpoint": 2, "vfs_file_t": 1, "vfs_dir_t": 1, "vfs_read_callback_t": 2, "vfs_read_dir_callback_t": 2, "vfs_last_read_attempt": 1, "vfs_file_t*": 4, "vfs_get_from_id": 1, "vfs_dir_t*": 3, "vfs_get_dir_from_id": 1, "vfs_read": 1, "vfs_dir_read": 1, "dir": 1, "vfs_seek": 1, "vfs_open": 1, "vfs_dir_open": 1, "vfs_mount": 1, "read_callback": 1, "read_dir_callback": 1, "vmem_page": 9, "VMEM_SECTION_STACK": 1, "VMEM_SECTION_CODE": 1, "VMEM_SECTION_DATA": 1, "VMEM_SECTION_HEAP": 1, "VMEM_SECTION_MMAP": 1, "VMEM_SECTION_KERNEL": 1, "VMEM_SECTION_UNMAPPED": 1, "cow": 1, "*cow_src_addr": 1, "*virt_addr": 3, "*phys_addr": 3, "*vmem_new": 1, "*vmem_new_page": 1, "vmem_add_page": 1, "*pg": 2, "*vmem_get_page_phys": 1, "*vmem_get_page_virt": 1, "*vmem_get_page": 1, "*vmem_rm_page_phys": 1, "*vmem_rm_page_virt": 1, "vmem_iterate": 1, "vmem_iterator_t": 1, "vmem_count_pages": 1, "vmem_dump_page": 1, "vmem_dump": 1, "vmem_handle_fault": 1, "*addr": 1, "*instruction": 1, "vmem_set_cache": 1, "*cache": 1, "*vmem_get_cache": 1, "__i386__": 1, "PAGE_SIZE": 3, "VMEM_ALIGN": 2, "typeof": 2, "intptr_t": 3, "VMEM_ALIGN_DOWN": 1, "__wglew_h__": 2, "__WGLEW_H__": 1, "__wglext_h_": 2, "wglext.h": 1, "wglew.h": 1, "WINAPI": 119, "": 1, "GLEW_STATIC": 1, "WGL_3DFX_multisample": 2, "WGL_SAMPLE_BUFFERS_3DFX": 1, "WGL_SAMPLES_3DFX": 1, "WGLEW_3DFX_multisample": 1, "WGLEW_GET_VAR": 49, "__WGLEW_3DFX_multisample": 2, "WGL_3DL_stereo_control": 2, "WGL_STEREO_EMITTER_ENABLE_3DL": 1, "WGL_STEREO_EMITTER_DISABLE_3DL": 1, "WGL_STEREO_POLARITY_NORMAL_3DL": 1, "WGL_STEREO_POLARITY_INVERT_3DL": 1, "BOOL": 84, "PFNWGLSETSTEREOEMITTERSTATE3DLPROC": 2, "HDC": 65, "hDC": 33, "UINT": 30, "uState": 1, "wglSetStereoEmitterState3DL": 1, "WGLEW_GET_FUN": 120, "__wglewSetStereoEmitterState3DL": 2, "WGLEW_3DL_stereo_control": 1, "__WGLEW_3DL_stereo_control": 2, "WGL_AMD_gpu_association": 2, "WGL_GPU_VENDOR_AMD": 1, "WGL_GPU_RENDERER_STRING_AMD": 1, "WGL_GPU_OPENGL_VERSION_STRING_AMD": 1, "WGL_GPU_FASTEST_TARGET_GPUS_AMD": 1, "WGL_GPU_RAM_AMD": 1, "WGL_GPU_CLOCK_AMD": 1, "WGL_GPU_NUM_PIPES_AMD": 1, "WGL_GPU_NUM_SIMD_AMD": 1, "WGL_GPU_NUM_RB_AMD": 1, "WGL_GPU_NUM_SPI_AMD": 1, "VOID": 6, "PFNWGLBLITCONTEXTFRAMEBUFFERAMDPROC": 2, "HGLRC": 14, "dstCtx": 1, "GLint": 18, "srcX0": 1, "srcY0": 1, "srcX1": 1, "srcY1": 1, "dstX0": 1, "dstY0": 1, "dstX1": 1, "dstY1": 1, "GLbitfield": 1, "mask": 1, "GLenum": 8, "PFNWGLCREATEASSOCIATEDCONTEXTAMDPROC": 2, "PFNWGLCREATEASSOCIATEDCONTEXTATTRIBSAMDPROC": 2, "hShareContext": 2, "attribList": 2, "PFNWGLDELETEASSOCIATEDCONTEXTAMDPROC": 2, "hglrc": 5, "PFNWGLGETCONTEXTGPUIDAMDPROC": 2, "PFNWGLGETCURRENTASSOCIATEDCONTEXTAMDPROC": 2, "PFNWGLGETGPUIDSAMDPROC": 2, "maxCount": 1, "UINT*": 6, "ids": 1, "INT": 3, "PFNWGLGETGPUINFOAMDPROC": 2, "property": 1, "dataType": 1, "PFNWGLMAKEASSOCIATEDCONTEXTCURRENTAMDPROC": 2, "wglBlitContextFramebufferAMD": 1, "__wglewBlitContextFramebufferAMD": 2, "wglCreateAssociatedContextAMD": 1, "__wglewCreateAssociatedContextAMD": 2, "wglCreateAssociatedContextAttribsAMD": 1, "__wglewCreateAssociatedContextAttribsAMD": 2, "wglDeleteAssociatedContextAMD": 1, "__wglewDeleteAssociatedContextAMD": 2, "wglGetContextGPUIDAMD": 1, "__wglewGetContextGPUIDAMD": 2, "wglGetCurrentAssociatedContextAMD": 1, "__wglewGetCurrentAssociatedContextAMD": 2, "wglGetGPUIDsAMD": 1, "__wglewGetGPUIDsAMD": 2, "wglGetGPUInfoAMD": 1, "__wglewGetGPUInfoAMD": 2, "wglMakeAssociatedContextCurrentAMD": 1, "__wglewMakeAssociatedContextCurrentAMD": 2, "WGLEW_AMD_gpu_association": 1, "__WGLEW_AMD_gpu_association": 2, "WGL_ARB_buffer_region": 2, "WGL_FRONT_COLOR_BUFFER_BIT_ARB": 1, "WGL_BACK_COLOR_BUFFER_BIT_ARB": 1, "WGL_DEPTH_BUFFER_BIT_ARB": 1, "WGL_STENCIL_BUFFER_BIT_ARB": 1, "HANDLE": 14, "PFNWGLCREATEBUFFERREGIONARBPROC": 2, "iLayerPlane": 5, "uType": 1, "PFNWGLDELETEBUFFERREGIONARBPROC": 2, "hRegion": 3, "PFNWGLRESTOREBUFFERREGIONARBPROC": 2, "xSrc": 1, "ySrc": 1, "PFNWGLSAVEBUFFERREGIONARBPROC": 2, "wglCreateBufferRegionARB": 1, "__wglewCreateBufferRegionARB": 2, "wglDeleteBufferRegionARB": 1, "__wglewDeleteBufferRegionARB": 2, "wglRestoreBufferRegionARB": 1, "__wglewRestoreBufferRegionARB": 2, "wglSaveBufferRegionARB": 1, "__wglewSaveBufferRegionARB": 2, "WGLEW_ARB_buffer_region": 1, "__WGLEW_ARB_buffer_region": 2, "WGL_ARB_create_context": 2, "WGL_CONTEXT_DEBUG_BIT_ARB": 1, "WGL_CONTEXT_FORWARD_COMPATIBLE_BIT_ARB": 1, "WGL_CONTEXT_MAJOR_VERSION_ARB": 1, "WGL_CONTEXT_MINOR_VERSION_ARB": 1, "WGL_CONTEXT_LAYER_PLANE_ARB": 1, "WGL_CONTEXT_FLAGS_ARB": 1, "ERROR_INVALID_VERSION_ARB": 1, "ERROR_INVALID_PROFILE_ARB": 1, "PFNWGLCREATECONTEXTATTRIBSARBPROC": 2, "wglCreateContextAttribsARB": 1, "__wglewCreateContextAttribsARB": 2, "WGLEW_ARB_create_context": 1, "__WGLEW_ARB_create_context": 2, "WGL_ARB_create_context_profile": 2, "WGL_CONTEXT_CORE_PROFILE_BIT_ARB": 1, "WGL_CONTEXT_COMPATIBILITY_PROFILE_BIT_ARB": 1, "WGL_CONTEXT_PROFILE_MASK_ARB": 1, "WGLEW_ARB_create_context_profile": 1, "__WGLEW_ARB_create_context_profile": 2, "WGL_ARB_create_context_robustness": 2, "WGL_CONTEXT_ROBUST_ACCESS_BIT_ARB": 1, "WGL_LOSE_CONTEXT_ON_RESET_ARB": 1, "WGL_CONTEXT_RESET_NOTIFICATION_STRATEGY_ARB": 1, "WGL_NO_RESET_NOTIFICATION_ARB": 1, "WGLEW_ARB_create_context_robustness": 1, "__WGLEW_ARB_create_context_robustness": 2, "WGL_ARB_extensions_string": 2, "PFNWGLGETEXTENSIONSSTRINGARBPROC": 2, "hdc": 16, "wglGetExtensionsStringARB": 1, "__wglewGetExtensionsStringARB": 2, "WGLEW_ARB_extensions_string": 1, "__WGLEW_ARB_extensions_string": 2, "WGL_ARB_framebuffer_sRGB": 2, "WGL_FRAMEBUFFER_SRGB_CAPABLE_ARB": 1, "WGLEW_ARB_framebuffer_sRGB": 1, "__WGLEW_ARB_framebuffer_sRGB": 2, "WGL_ARB_make_current_read": 2, "ERROR_INVALID_PIXEL_TYPE_ARB": 1, "ERROR_INCOMPATIBLE_DEVICE_CONTEXTS_ARB": 1, "PFNWGLGETCURRENTREADDCARBPROC": 2, "PFNWGLMAKECONTEXTCURRENTARBPROC": 2, "hDrawDC": 2, "hReadDC": 2, "wglGetCurrentReadDCARB": 1, "__wglewGetCurrentReadDCARB": 2, "wglMakeContextCurrentARB": 1, "__wglewMakeContextCurrentARB": 2, "WGLEW_ARB_make_current_read": 1, "__WGLEW_ARB_make_current_read": 2, "WGL_ARB_multisample": 2, "WGL_SAMPLE_BUFFERS_ARB": 1, "WGL_SAMPLES_ARB": 1, "WGLEW_ARB_multisample": 1, "__WGLEW_ARB_multisample": 2, "WGL_ARB_pbuffer": 2, "WGL_DRAW_TO_PBUFFER_ARB": 1, "WGL_MAX_PBUFFER_PIXELS_ARB": 1, "WGL_MAX_PBUFFER_WIDTH_ARB": 1, "WGL_MAX_PBUFFER_HEIGHT_ARB": 1, "WGL_PBUFFER_LARGEST_ARB": 1, "WGL_PBUFFER_WIDTH_ARB": 1, "WGL_PBUFFER_HEIGHT_ARB": 1, "WGL_PBUFFER_LOST_ARB": 1, "DECLARE_HANDLE": 6, "HPBUFFERARB": 12, "PFNWGLCREATEPBUFFERARBPROC": 2, "iPixelFormat": 6, "iWidth": 2, "iHeight": 2, "piAttribList": 4, "PFNWGLDESTROYPBUFFERARBPROC": 2, "hPbuffer": 14, "PFNWGLGETPBUFFERDCARBPROC": 2, "PFNWGLQUERYPBUFFERARBPROC": 2, "iAttribute": 8, "piValue": 8, "PFNWGLRELEASEPBUFFERDCARBPROC": 2, "wglCreatePbufferARB": 1, "__wglewCreatePbufferARB": 2, "wglDestroyPbufferARB": 1, "__wglewDestroyPbufferARB": 2, "wglGetPbufferDCARB": 1, "__wglewGetPbufferDCARB": 2, "wglQueryPbufferARB": 1, "__wglewQueryPbufferARB": 2, "wglReleasePbufferDCARB": 1, "__wglewReleasePbufferDCARB": 2, "WGLEW_ARB_pbuffer": 1, "__WGLEW_ARB_pbuffer": 2, "WGL_ARB_pixel_format": 2, "WGL_NUMBER_PIXEL_FORMATS_ARB": 1, "WGL_DRAW_TO_WINDOW_ARB": 1, "WGL_DRAW_TO_BITMAP_ARB": 1, "WGL_ACCELERATION_ARB": 1, "WGL_NEED_PALETTE_ARB": 1, "WGL_NEED_SYSTEM_PALETTE_ARB": 1, "WGL_SWAP_LAYER_BUFFERS_ARB": 1, "WGL_SWAP_METHOD_ARB": 1, "WGL_NUMBER_OVERLAYS_ARB": 1, "WGL_NUMBER_UNDERLAYS_ARB": 1, "WGL_TRANSPARENT_ARB": 1, "WGL_SHARE_DEPTH_ARB": 1, "WGL_SHARE_STENCIL_ARB": 1, "WGL_SHARE_ACCUM_ARB": 1, "WGL_SUPPORT_GDI_ARB": 1, "WGL_SUPPORT_OPENGL_ARB": 1, "WGL_DOUBLE_BUFFER_ARB": 1, "WGL_STEREO_ARB": 1, "WGL_PIXEL_TYPE_ARB": 1, "WGL_COLOR_BITS_ARB": 1, "WGL_RED_BITS_ARB": 1, "WGL_RED_SHIFT_ARB": 1, "WGL_GREEN_BITS_ARB": 1, "WGL_GREEN_SHIFT_ARB": 1, "WGL_BLUE_BITS_ARB": 1, "WGL_BLUE_SHIFT_ARB": 1, "WGL_ALPHA_BITS_ARB": 1, "WGL_ALPHA_SHIFT_ARB": 1, "WGL_ACCUM_BITS_ARB": 1, "WGL_ACCUM_RED_BITS_ARB": 1, "WGL_ACCUM_GREEN_BITS_ARB": 1, "WGL_ACCUM_BLUE_BITS_ARB": 1, "WGL_ACCUM_ALPHA_BITS_ARB": 1, "WGL_DEPTH_BITS_ARB": 1, "WGL_STENCIL_BITS_ARB": 1, "WGL_AUX_BUFFERS_ARB": 1, "WGL_NO_ACCELERATION_ARB": 1, "WGL_GENERIC_ACCELERATION_ARB": 1, "WGL_FULL_ACCELERATION_ARB": 1, "WGL_SWAP_EXCHANGE_ARB": 1, "WGL_SWAP_COPY_ARB": 1, "WGL_SWAP_UNDEFINED_ARB": 1, "WGL_TYPE_RGBA_ARB": 1, "WGL_TYPE_COLORINDEX_ARB": 1, "WGL_TRANSPARENT_RED_VALUE_ARB": 1, "WGL_TRANSPARENT_GREEN_VALUE_ARB": 1, "WGL_TRANSPARENT_BLUE_VALUE_ARB": 1, "WGL_TRANSPARENT_ALPHA_VALUE_ARB": 1, "WGL_TRANSPARENT_INDEX_VALUE_ARB": 1, "PFNWGLCHOOSEPIXELFORMATARBPROC": 2, "piAttribIList": 2, "FLOAT": 4, "*pfAttribFList": 2, "nMaxFormats": 2, "*piFormats": 2, "*nNumFormats": 2, "PFNWGLGETPIXELFORMATATTRIBFVARBPROC": 2, "nAttributes": 4, "piAttributes": 4, "*pfValues": 2, "PFNWGLGETPIXELFORMATATTRIBIVARBPROC": 2, "*piValues": 2, "wglChoosePixelFormatARB": 1, "__wglewChoosePixelFormatARB": 2, "wglGetPixelFormatAttribfvARB": 1, "__wglewGetPixelFormatAttribfvARB": 2, "wglGetPixelFormatAttribivARB": 1, "__wglewGetPixelFormatAttribivARB": 2, "WGLEW_ARB_pixel_format": 1, "__WGLEW_ARB_pixel_format": 2, "WGL_ARB_pixel_format_float": 2, "WGL_TYPE_RGBA_FLOAT_ARB": 1, "WGLEW_ARB_pixel_format_float": 1, "__WGLEW_ARB_pixel_format_float": 2, "WGL_ARB_render_texture": 2, "WGL_BIND_TO_TEXTURE_RGB_ARB": 1, "WGL_BIND_TO_TEXTURE_RGBA_ARB": 1, "WGL_TEXTURE_FORMAT_ARB": 1, "WGL_TEXTURE_TARGET_ARB": 1, "WGL_MIPMAP_TEXTURE_ARB": 1, "WGL_TEXTURE_RGB_ARB": 1, "WGL_TEXTURE_RGBA_ARB": 1, "WGL_NO_TEXTURE_ARB": 2, "WGL_TEXTURE_CUBE_MAP_ARB": 1, "WGL_TEXTURE_1D_ARB": 1, "WGL_TEXTURE_2D_ARB": 1, "WGL_MIPMAP_LEVEL_ARB": 1, "WGL_CUBE_MAP_FACE_ARB": 1, "WGL_TEXTURE_CUBE_MAP_POSITIVE_X_ARB": 1, "WGL_TEXTURE_CUBE_MAP_NEGATIVE_X_ARB": 1, "WGL_TEXTURE_CUBE_MAP_POSITIVE_Y_ARB": 1, "WGL_TEXTURE_CUBE_MAP_NEGATIVE_Y_ARB": 1, "WGL_TEXTURE_CUBE_MAP_POSITIVE_Z_ARB": 1, "WGL_TEXTURE_CUBE_MAP_NEGATIVE_Z_ARB": 1, "WGL_FRONT_LEFT_ARB": 1, "WGL_FRONT_RIGHT_ARB": 1, "WGL_BACK_LEFT_ARB": 1, "WGL_BACK_RIGHT_ARB": 1, "WGL_AUX0_ARB": 1, "WGL_AUX1_ARB": 1, "WGL_AUX2_ARB": 1, "WGL_AUX3_ARB": 1, "WGL_AUX4_ARB": 1, "WGL_AUX5_ARB": 1, "WGL_AUX6_ARB": 1, "WGL_AUX7_ARB": 1, "WGL_AUX8_ARB": 1, "WGL_AUX9_ARB": 1, "PFNWGLBINDTEXIMAGEARBPROC": 2, "iBuffer": 2, "PFNWGLRELEASETEXIMAGEARBPROC": 2, "PFNWGLSETPBUFFERATTRIBARBPROC": 2, "wglBindTexImageARB": 1, "__wglewBindTexImageARB": 2, "wglReleaseTexImageARB": 1, "__wglewReleaseTexImageARB": 2, "wglSetPbufferAttribARB": 1, "__wglewSetPbufferAttribARB": 2, "WGLEW_ARB_render_texture": 1, "__WGLEW_ARB_render_texture": 2, "WGL_ATI_pixel_format_float": 2, "WGL_TYPE_RGBA_FLOAT_ATI": 1, "GL_RGBA_FLOAT_MODE_ATI": 1, "GL_COLOR_CLEAR_UNCLAMPED_VALUE_ATI": 1, "WGLEW_ATI_pixel_format_float": 1, "__WGLEW_ATI_pixel_format_float": 2, "WGL_ATI_render_texture_rectangle": 2, "WGL_TEXTURE_RECTANGLE_ATI": 1, "WGLEW_ATI_render_texture_rectangle": 1, "__WGLEW_ATI_render_texture_rectangle": 2, "WGL_EXT_create_context_es2_profile": 2, "WGL_CONTEXT_ES2_PROFILE_BIT_EXT": 1, "WGLEW_EXT_create_context_es2_profile": 1, "__WGLEW_EXT_create_context_es2_profile": 2, "WGL_EXT_depth_float": 2, "WGL_DEPTH_FLOAT_EXT": 1, "WGLEW_EXT_depth_float": 1, "__WGLEW_EXT_depth_float": 2, "WGL_EXT_display_color_table": 2, "GLboolean": 53, "PFNWGLBINDDISPLAYCOLORTABLEEXTPROC": 2, "GLushort": 3, "PFNWGLCREATEDISPLAYCOLORTABLEEXTPROC": 2, "PFNWGLDESTROYDISPLAYCOLORTABLEEXTPROC": 2, "PFNWGLLOADDISPLAYCOLORTABLEEXTPROC": 2, "GLushort*": 1, "GLuint": 9, "wglBindDisplayColorTableEXT": 1, "__wglewBindDisplayColorTableEXT": 2, "wglCreateDisplayColorTableEXT": 1, "__wglewCreateDisplayColorTableEXT": 2, "wglDestroyDisplayColorTableEXT": 1, "__wglewDestroyDisplayColorTableEXT": 2, "wglLoadDisplayColorTableEXT": 1, "__wglewLoadDisplayColorTableEXT": 2, "WGLEW_EXT_display_color_table": 1, "__WGLEW_EXT_display_color_table": 2, "WGL_EXT_extensions_string": 2, "PFNWGLGETEXTENSIONSSTRINGEXTPROC": 2, "wglGetExtensionsStringEXT": 1, "__wglewGetExtensionsStringEXT": 2, "WGLEW_EXT_extensions_string": 1, "__WGLEW_EXT_extensions_string": 2, "WGL_EXT_framebuffer_sRGB": 2, "WGL_FRAMEBUFFER_SRGB_CAPABLE_EXT": 1, "WGLEW_EXT_framebuffer_sRGB": 1, "__WGLEW_EXT_framebuffer_sRGB": 2, "WGL_EXT_make_current_read": 2, "ERROR_INVALID_PIXEL_TYPE_EXT": 1, "PFNWGLGETCURRENTREADDCEXTPROC": 2, "PFNWGLMAKECONTEXTCURRENTEXTPROC": 2, "wglGetCurrentReadDCEXT": 1, "__wglewGetCurrentReadDCEXT": 2, "wglMakeContextCurrentEXT": 1, "__wglewMakeContextCurrentEXT": 2, "WGLEW_EXT_make_current_read": 1, "__WGLEW_EXT_make_current_read": 2, "WGL_EXT_multisample": 2, "WGL_SAMPLE_BUFFERS_EXT": 1, "WGL_SAMPLES_EXT": 1, "WGLEW_EXT_multisample": 1, "__WGLEW_EXT_multisample": 2, "WGL_EXT_pbuffer": 2, "WGL_DRAW_TO_PBUFFER_EXT": 1, "WGL_MAX_PBUFFER_PIXELS_EXT": 1, "WGL_MAX_PBUFFER_WIDTH_EXT": 1, "WGL_MAX_PBUFFER_HEIGHT_EXT": 1, "WGL_OPTIMAL_PBUFFER_WIDTH_EXT": 1, "WGL_OPTIMAL_PBUFFER_HEIGHT_EXT": 1, "WGL_PBUFFER_LARGEST_EXT": 1, "WGL_PBUFFER_WIDTH_EXT": 1, "WGL_PBUFFER_HEIGHT_EXT": 1, "HPBUFFEREXT": 6, "PFNWGLCREATEPBUFFEREXTPROC": 2, "PFNWGLDESTROYPBUFFEREXTPROC": 2, "PFNWGLGETPBUFFERDCEXTPROC": 2, "PFNWGLQUERYPBUFFEREXTPROC": 2, "PFNWGLRELEASEPBUFFERDCEXTPROC": 2, "wglCreatePbufferEXT": 1, "__wglewCreatePbufferEXT": 2, "wglDestroyPbufferEXT": 1, "__wglewDestroyPbufferEXT": 2, "wglGetPbufferDCEXT": 1, "__wglewGetPbufferDCEXT": 2, "wglQueryPbufferEXT": 1, "__wglewQueryPbufferEXT": 2, "wglReleasePbufferDCEXT": 1, "__wglewReleasePbufferDCEXT": 2, "WGLEW_EXT_pbuffer": 1, "__WGLEW_EXT_pbuffer": 2, "WGL_EXT_pixel_format": 2, "WGL_NUMBER_PIXEL_FORMATS_EXT": 1, "WGL_DRAW_TO_WINDOW_EXT": 1, "WGL_DRAW_TO_BITMAP_EXT": 1, "WGL_ACCELERATION_EXT": 1, "WGL_NEED_PALETTE_EXT": 1, "WGL_NEED_SYSTEM_PALETTE_EXT": 1, "WGL_SWAP_LAYER_BUFFERS_EXT": 1, "WGL_SWAP_METHOD_EXT": 1, "WGL_NUMBER_OVERLAYS_EXT": 1, "WGL_NUMBER_UNDERLAYS_EXT": 1, "WGL_TRANSPARENT_EXT": 1, "WGL_TRANSPARENT_VALUE_EXT": 1, "WGL_SHARE_DEPTH_EXT": 1, "WGL_SHARE_STENCIL_EXT": 1, "WGL_SHARE_ACCUM_EXT": 1, "WGL_SUPPORT_GDI_EXT": 1, "WGL_SUPPORT_OPENGL_EXT": 1, "WGL_DOUBLE_BUFFER_EXT": 1, "WGL_STEREO_EXT": 1, "WGL_PIXEL_TYPE_EXT": 1, "WGL_COLOR_BITS_EXT": 1, "WGL_RED_BITS_EXT": 1, "WGL_RED_SHIFT_EXT": 1, "WGL_GREEN_BITS_EXT": 1, "WGL_GREEN_SHIFT_EXT": 1, "WGL_BLUE_BITS_EXT": 1, "WGL_BLUE_SHIFT_EXT": 1, "WGL_ALPHA_BITS_EXT": 1, "WGL_ALPHA_SHIFT_EXT": 1, "WGL_ACCUM_BITS_EXT": 1, "WGL_ACCUM_RED_BITS_EXT": 1, "WGL_ACCUM_GREEN_BITS_EXT": 1, "WGL_ACCUM_BLUE_BITS_EXT": 1, "WGL_ACCUM_ALPHA_BITS_EXT": 1, "WGL_DEPTH_BITS_EXT": 1, "WGL_STENCIL_BITS_EXT": 1, "WGL_AUX_BUFFERS_EXT": 1, "WGL_NO_ACCELERATION_EXT": 1, "WGL_GENERIC_ACCELERATION_EXT": 1, "WGL_FULL_ACCELERATION_EXT": 1, "WGL_SWAP_EXCHANGE_EXT": 1, "WGL_SWAP_COPY_EXT": 1, "WGL_SWAP_UNDEFINED_EXT": 1, "WGL_TYPE_RGBA_EXT": 1, "WGL_TYPE_COLORINDEX_EXT": 1, "PFNWGLCHOOSEPIXELFORMATEXTPROC": 2, "PFNWGLGETPIXELFORMATATTRIBFVEXTPROC": 2, "PFNWGLGETPIXELFORMATATTRIBIVEXTPROC": 2, "wglChoosePixelFormatEXT": 1, "__wglewChoosePixelFormatEXT": 2, "wglGetPixelFormatAttribfvEXT": 1, "__wglewGetPixelFormatAttribfvEXT": 2, "wglGetPixelFormatAttribivEXT": 1, "__wglewGetPixelFormatAttribivEXT": 2, "WGLEW_EXT_pixel_format": 1, "__WGLEW_EXT_pixel_format": 2, "WGL_EXT_pixel_format_packed_float": 2, "WGL_TYPE_RGBA_UNSIGNED_FLOAT_EXT": 1, "WGLEW_EXT_pixel_format_packed_float": 1, "__WGLEW_EXT_pixel_format_packed_float": 2, "WGL_EXT_swap_control": 2, "PFNWGLGETSWAPINTERVALEXTPROC": 2, "PFNWGLSWAPINTERVALEXTPROC": 2, "interval": 1, "wglGetSwapIntervalEXT": 1, "__wglewGetSwapIntervalEXT": 2, "wglSwapIntervalEXT": 1, "__wglewSwapIntervalEXT": 2, "WGLEW_EXT_swap_control": 1, "__WGLEW_EXT_swap_control": 2, "WGL_I3D_digital_video_control": 2, "WGL_DIGITAL_VIDEO_CURSOR_ALPHA_FRAMEBUFFER_I3D": 1, "WGL_DIGITAL_VIDEO_CURSOR_ALPHA_VALUE_I3D": 1, "WGL_DIGITAL_VIDEO_CURSOR_INCLUDED_I3D": 1, "WGL_DIGITAL_VIDEO_GAMMA_CORRECTED_I3D": 1, "PFNWGLGETDIGITALVIDEOPARAMETERSI3DPROC": 2, "PFNWGLSETDIGITALVIDEOPARAMETERSI3DPROC": 2, "wglGetDigitalVideoParametersI3D": 1, "__wglewGetDigitalVideoParametersI3D": 2, "wglSetDigitalVideoParametersI3D": 1, "__wglewSetDigitalVideoParametersI3D": 2, "WGLEW_I3D_digital_video_control": 1, "__WGLEW_I3D_digital_video_control": 2, "WGL_I3D_gamma": 2, "WGL_GAMMA_TABLE_SIZE_I3D": 1, "WGL_GAMMA_EXCLUDE_DESKTOP_I3D": 1, "PFNWGLGETGAMMATABLEI3DPROC": 2, "iEntries": 2, "USHORT*": 2, "puRed": 2, "USHORT": 4, "*puGreen": 2, "*puBlue": 2, "PFNWGLGETGAMMATABLEPARAMETERSI3DPROC": 2, "PFNWGLSETGAMMATABLEI3DPROC": 2, "PFNWGLSETGAMMATABLEPARAMETERSI3DPROC": 2, "wglGetGammaTableI3D": 1, "__wglewGetGammaTableI3D": 2, "wglGetGammaTableParametersI3D": 1, "__wglewGetGammaTableParametersI3D": 2, "wglSetGammaTableI3D": 1, "__wglewSetGammaTableI3D": 2, "wglSetGammaTableParametersI3D": 1, "__wglewSetGammaTableParametersI3D": 2, "WGLEW_I3D_gamma": 1, "__WGLEW_I3D_gamma": 2, "WGL_I3D_genlock": 2, "WGL_GENLOCK_SOURCE_MULTIVIEW_I3D": 1, "WGL_GENLOCK_SOURCE_EXTERNAL_SYNC_I3D": 1, "WGL_GENLOCK_SOURCE_EXTERNAL_FIELD_I3D": 1, "WGL_GENLOCK_SOURCE_EXTERNAL_TTL_I3D": 1, "WGL_GENLOCK_SOURCE_DIGITAL_SYNC_I3D": 1, "WGL_GENLOCK_SOURCE_DIGITAL_FIELD_I3D": 1, "WGL_GENLOCK_SOURCE_EDGE_FALLING_I3D": 1, "WGL_GENLOCK_SOURCE_EDGE_RISING_I3D": 1, "WGL_GENLOCK_SOURCE_EDGE_BOTH_I3D": 1, "PFNWGLDISABLEGENLOCKI3DPROC": 2, "PFNWGLENABLEGENLOCKI3DPROC": 2, "PFNWGLGENLOCKSAMPLERATEI3DPROC": 2, "uRate": 2, "PFNWGLGENLOCKSOURCEDELAYI3DPROC": 2, "uDelay": 2, "PFNWGLGENLOCKSOURCEEDGEI3DPROC": 2, "uEdge": 2, "PFNWGLGENLOCKSOURCEI3DPROC": 2, "uSource": 2, "PFNWGLGETGENLOCKSAMPLERATEI3DPROC": 2, "PFNWGLGETGENLOCKSOURCEDELAYI3DPROC": 2, "PFNWGLGETGENLOCKSOURCEEDGEI3DPROC": 2, "PFNWGLGETGENLOCKSOURCEI3DPROC": 2, "PFNWGLISENABLEDGENLOCKI3DPROC": 2, "BOOL*": 3, "pFlag": 3, "PFNWGLQUERYGENLOCKMAXSOURCEDELAYI3DPROC": 2, "uMaxLineDelay": 1, "*uMaxPixelDelay": 1, "wglDisableGenlockI3D": 1, "__wglewDisableGenlockI3D": 2, "wglEnableGenlockI3D": 1, "__wglewEnableGenlockI3D": 2, "wglGenlockSampleRateI3D": 1, "__wglewGenlockSampleRateI3D": 2, "wglGenlockSourceDelayI3D": 1, "__wglewGenlockSourceDelayI3D": 2, "wglGenlockSourceEdgeI3D": 1, "__wglewGenlockSourceEdgeI3D": 2, "wglGenlockSourceI3D": 1, "__wglewGenlockSourceI3D": 2, "wglGetGenlockSampleRateI3D": 1, "__wglewGetGenlockSampleRateI3D": 2, "wglGetGenlockSourceDelayI3D": 1, "__wglewGetGenlockSourceDelayI3D": 2, "wglGetGenlockSourceEdgeI3D": 1, "__wglewGetGenlockSourceEdgeI3D": 2, "wglGetGenlockSourceI3D": 1, "__wglewGetGenlockSourceI3D": 2, "wglIsEnabledGenlockI3D": 1, "__wglewIsEnabledGenlockI3D": 2, "wglQueryGenlockMaxSourceDelayI3D": 1, "__wglewQueryGenlockMaxSourceDelayI3D": 2, "WGLEW_I3D_genlock": 1, "__WGLEW_I3D_genlock": 2, "WGL_I3D_image_buffer": 2, "WGL_IMAGE_BUFFER_MIN_ACCESS_I3D": 1, "WGL_IMAGE_BUFFER_LOCK_I3D": 1, "PFNWGLASSOCIATEIMAGEBUFFEREVENTSI3DPROC": 2, "HANDLE*": 3, "pEvent": 1, "LPVOID": 3, "*pAddress": 1, "DWORD": 5, "*pSize": 1, "PFNWGLCREATEIMAGEBUFFERI3DPROC": 2, "dwSize": 1, "uFlags": 1, "PFNWGLDESTROYIMAGEBUFFERI3DPROC": 2, "pAddress": 2, "PFNWGLRELEASEIMAGEBUFFEREVENTSI3DPROC": 2, "LPVOID*": 1, "wglAssociateImageBufferEventsI3D": 1, "__wglewAssociateImageBufferEventsI3D": 2, "wglCreateImageBufferI3D": 1, "__wglewCreateImageBufferI3D": 2, "wglDestroyImageBufferI3D": 1, "__wglewDestroyImageBufferI3D": 2, "wglReleaseImageBufferEventsI3D": 1, "__wglewReleaseImageBufferEventsI3D": 2, "WGLEW_I3D_image_buffer": 1, "__WGLEW_I3D_image_buffer": 2, "WGL_I3D_swap_frame_lock": 2, "PFNWGLDISABLEFRAMELOCKI3DPROC": 2, "PFNWGLENABLEFRAMELOCKI3DPROC": 2, "PFNWGLISENABLEDFRAMELOCKI3DPROC": 2, "PFNWGLQUERYFRAMELOCKMASTERI3DPROC": 2, "wglDisableFrameLockI3D": 1, "__wglewDisableFrameLockI3D": 2, "wglEnableFrameLockI3D": 1, "__wglewEnableFrameLockI3D": 2, "wglIsEnabledFrameLockI3D": 1, "__wglewIsEnabledFrameLockI3D": 2, "wglQueryFrameLockMasterI3D": 1, "__wglewQueryFrameLockMasterI3D": 2, "WGLEW_I3D_swap_frame_lock": 1, "__WGLEW_I3D_swap_frame_lock": 2, "WGL_I3D_swap_frame_usage": 2, "PFNWGLBEGINFRAMETRACKINGI3DPROC": 2, "PFNWGLENDFRAMETRACKINGI3DPROC": 2, "PFNWGLGETFRAMEUSAGEI3DPROC": 2, "float*": 1, "pUsage": 1, "PFNWGLQUERYFRAMETRACKINGI3DPROC": 2, "DWORD*": 1, "pFrameCount": 1, "*pMissedFrames": 1, "*pLastMissedUsage": 1, "wglBeginFrameTrackingI3D": 1, "__wglewBeginFrameTrackingI3D": 2, "wglEndFrameTrackingI3D": 1, "__wglewEndFrameTrackingI3D": 2, "wglGetFrameUsageI3D": 1, "__wglewGetFrameUsageI3D": 2, "wglQueryFrameTrackingI3D": 1, "__wglewQueryFrameTrackingI3D": 2, "WGLEW_I3D_swap_frame_usage": 1, "__WGLEW_I3D_swap_frame_usage": 2, "WGL_NV_DX_interop": 2, "WGL_ACCESS_READ_ONLY_NV": 1, "WGL_ACCESS_READ_WRITE_NV": 1, "WGL_ACCESS_WRITE_DISCARD_NV": 1, "PFNWGLDXCLOSEDEVICENVPROC": 2, "hDevice": 9, "PFNWGLDXLOCKOBJECTSNVPROC": 2, "hObjects": 2, "PFNWGLDXOBJECTACCESSNVPROC": 2, "hObject": 2, "access": 2, "PFNWGLDXOPENDEVICENVPROC": 2, "dxDevice": 1, "PFNWGLDXREGISTEROBJECTNVPROC": 2, "dxObject": 2, "PFNWGLDXSETRESOURCESHAREHANDLENVPROC": 2, "shareHandle": 1, "PFNWGLDXUNLOCKOBJECTSNVPROC": 2, "PFNWGLDXUNREGISTEROBJECTNVPROC": 2, "wglDXCloseDeviceNV": 1, "__wglewDXCloseDeviceNV": 2, "wglDXLockObjectsNV": 1, "__wglewDXLockObjectsNV": 2, "wglDXObjectAccessNV": 1, "__wglewDXObjectAccessNV": 2, "wglDXOpenDeviceNV": 1, "__wglewDXOpenDeviceNV": 2, "wglDXRegisterObjectNV": 1, "__wglewDXRegisterObjectNV": 2, "wglDXSetResourceShareHandleNV": 1, "__wglewDXSetResourceShareHandleNV": 2, "wglDXUnlockObjectsNV": 1, "__wglewDXUnlockObjectsNV": 2, "wglDXUnregisterObjectNV": 1, "__wglewDXUnregisterObjectNV": 2, "WGLEW_NV_DX_interop": 1, "__WGLEW_NV_DX_interop": 2, "WGL_NV_copy_image": 2, "PFNWGLCOPYIMAGESUBDATANVPROC": 2, "hSrcRC": 1, "srcName": 1, "srcTarget": 1, "srcLevel": 1, "srcX": 1, "srcY": 1, "srcZ": 1, "hDstRC": 1, "dstName": 1, "dstTarget": 1, "dstLevel": 1, "dstX": 1, "dstY": 1, "dstZ": 1, "GLsizei": 4, "wglCopyImageSubDataNV": 1, "__wglewCopyImageSubDataNV": 2, "WGLEW_NV_copy_image": 1, "__WGLEW_NV_copy_image": 2, "WGL_NV_float_buffer": 2, "WGL_FLOAT_COMPONENTS_NV": 1, "WGL_BIND_TO_TEXTURE_RECTANGLE_FLOAT_R_NV": 1, "WGL_BIND_TO_TEXTURE_RECTANGLE_FLOAT_RG_NV": 1, "WGL_BIND_TO_TEXTURE_RECTANGLE_FLOAT_RGB_NV": 1, "WGL_BIND_TO_TEXTURE_RECTANGLE_FLOAT_RGBA_NV": 1, "WGL_TEXTURE_FLOAT_R_NV": 1, "WGL_TEXTURE_FLOAT_RG_NV": 1, "WGL_TEXTURE_FLOAT_RGB_NV": 1, "WGL_TEXTURE_FLOAT_RGBA_NV": 1, "WGLEW_NV_float_buffer": 1, "__WGLEW_NV_float_buffer": 2, "WGL_NV_gpu_affinity": 2, "WGL_ERROR_INCOMPATIBLE_AFFINITY_MASKS_NV": 1, "WGL_ERROR_MISSING_AFFINITY_MASK_NV": 1, "HGPUNV": 5, "_GPU_DEVICE": 1, "cb": 1, "CHAR": 2, "DeviceName": 1, "DeviceString": 1, "Flags": 1, "RECT": 1, "rcVirtualScreen": 1, "GPU_DEVICE": 1, "*PGPU_DEVICE": 1, "PFNWGLCREATEAFFINITYDCNVPROC": 2, "*phGpuList": 1, "PFNWGLDELETEDCNVPROC": 2, "PFNWGLENUMGPUDEVICESNVPROC": 2, "hGpu": 1, "iDeviceIndex": 1, "PGPU_DEVICE": 1, "lpGpuDevice": 1, "PFNWGLENUMGPUSFROMAFFINITYDCNVPROC": 2, "hAffinityDC": 1, "iGpuIndex": 2, "*hGpu": 1, "PFNWGLENUMGPUSNVPROC": 2, "*phGpu": 1, "wglCreateAffinityDCNV": 1, "__wglewCreateAffinityDCNV": 2, "wglDeleteDCNV": 1, "__wglewDeleteDCNV": 2, "wglEnumGpuDevicesNV": 1, "__wglewEnumGpuDevicesNV": 2, "wglEnumGpusFromAffinityDCNV": 1, "__wglewEnumGpusFromAffinityDCNV": 2, "wglEnumGpusNV": 1, "__wglewEnumGpusNV": 2, "WGLEW_NV_gpu_affinity": 1, "__WGLEW_NV_gpu_affinity": 2, "WGL_NV_multisample_coverage": 2, "WGL_COVERAGE_SAMPLES_NV": 1, "WGL_COLOR_SAMPLES_NV": 1, "WGLEW_NV_multisample_coverage": 1, "__WGLEW_NV_multisample_coverage": 2, "WGL_NV_present_video": 2, "WGL_NUM_VIDEO_SLOTS_NV": 1, "HVIDEOOUTPUTDEVICENV": 2, "PFNWGLBINDVIDEODEVICENVPROC": 2, "hDc": 6, "uVideoSlot": 2, "hVideoDevice": 4, "PFNWGLENUMERATEVIDEODEVICESNVPROC": 2, "HVIDEOOUTPUTDEVICENV*": 1, "phDeviceList": 2, "PFNWGLQUERYCURRENTCONTEXTNVPROC": 2, "wglBindVideoDeviceNV": 1, "__wglewBindVideoDeviceNV": 2, "wglEnumerateVideoDevicesNV": 1, "__wglewEnumerateVideoDevicesNV": 2, "wglQueryCurrentContextNV": 1, "__wglewQueryCurrentContextNV": 2, "WGLEW_NV_present_video": 1, "__WGLEW_NV_present_video": 2, "WGL_NV_render_depth_texture": 2, "WGL_BIND_TO_TEXTURE_DEPTH_NV": 1, "WGL_BIND_TO_TEXTURE_RECTANGLE_DEPTH_NV": 1, "WGL_DEPTH_TEXTURE_FORMAT_NV": 1, "WGL_TEXTURE_DEPTH_COMPONENT_NV": 1, "WGL_DEPTH_COMPONENT_NV": 1, "WGLEW_NV_render_depth_texture": 1, "__WGLEW_NV_render_depth_texture": 2, "WGL_NV_render_texture_rectangle": 2, "WGL_BIND_TO_TEXTURE_RECTANGLE_RGB_NV": 1, "WGL_BIND_TO_TEXTURE_RECTANGLE_RGBA_NV": 1, "WGL_TEXTURE_RECTANGLE_NV": 1, "WGLEW_NV_render_texture_rectangle": 1, "__WGLEW_NV_render_texture_rectangle": 2, "WGL_NV_swap_group": 2, "PFNWGLBINDSWAPBARRIERNVPROC": 2, "group": 3, "barrier": 1, "PFNWGLJOINSWAPGROUPNVPROC": 2, "PFNWGLQUERYFRAMECOUNTNVPROC": 2, "GLuint*": 3, "PFNWGLQUERYMAXSWAPGROUPSNVPROC": 2, "maxGroups": 1, "*maxBarriers": 1, "PFNWGLQUERYSWAPGROUPNVPROC": 2, "*barrier": 1, "PFNWGLRESETFRAMECOUNTNVPROC": 2, "wglBindSwapBarrierNV": 1, "__wglewBindSwapBarrierNV": 2, "wglJoinSwapGroupNV": 1, "__wglewJoinSwapGroupNV": 2, "wglQueryFrameCountNV": 1, "__wglewQueryFrameCountNV": 2, "wglQueryMaxSwapGroupsNV": 1, "__wglewQueryMaxSwapGroupsNV": 2, "wglQuerySwapGroupNV": 1, "__wglewQuerySwapGroupNV": 2, "wglResetFrameCountNV": 1, "__wglewResetFrameCountNV": 2, "WGLEW_NV_swap_group": 1, "__WGLEW_NV_swap_group": 2, "WGL_NV_vertex_array_range": 2, "PFNWGLALLOCATEMEMORYNVPROC": 2, "GLfloat": 3, "readFrequency": 1, "writeFrequency": 1, "priority": 1, "PFNWGLFREEMEMORYNVPROC": 2, "*pointer": 1, "wglAllocateMemoryNV": 1, "__wglewAllocateMemoryNV": 2, "wglFreeMemoryNV": 1, "__wglewFreeMemoryNV": 2, "WGLEW_NV_vertex_array_range": 1, "__WGLEW_NV_vertex_array_range": 2, "WGL_NV_video_capture": 2, "WGL_UNIQUE_ID_NV": 1, "WGL_NUM_VIDEO_CAPTURE_SLOTS_NV": 1, "HVIDEOINPUTDEVICENV": 5, "PFNWGLBINDVIDEOCAPTUREDEVICENVPROC": 2, "PFNWGLENUMERATEVIDEOCAPTUREDEVICESNVPROC": 2, "HVIDEOINPUTDEVICENV*": 1, "PFNWGLLOCKVIDEOCAPTUREDEVICENVPROC": 2, "PFNWGLQUERYVIDEOCAPTUREDEVICENVPROC": 2, "PFNWGLRELEASEVIDEOCAPTUREDEVICENVPROC": 2, "wglBindVideoCaptureDeviceNV": 1, "__wglewBindVideoCaptureDeviceNV": 2, "wglEnumerateVideoCaptureDevicesNV": 1, "__wglewEnumerateVideoCaptureDevicesNV": 2, "wglLockVideoCaptureDeviceNV": 1, "__wglewLockVideoCaptureDeviceNV": 2, "wglQueryVideoCaptureDeviceNV": 1, "__wglewQueryVideoCaptureDeviceNV": 2, "wglReleaseVideoCaptureDeviceNV": 1, "__wglewReleaseVideoCaptureDeviceNV": 2, "WGLEW_NV_video_capture": 1, "__WGLEW_NV_video_capture": 2, "WGL_NV_video_output": 2, "WGL_BIND_TO_VIDEO_RGB_NV": 1, "WGL_BIND_TO_VIDEO_RGBA_NV": 1, "WGL_BIND_TO_VIDEO_RGB_AND_DEPTH_NV": 1, "WGL_VIDEO_OUT_COLOR_NV": 1, "WGL_VIDEO_OUT_ALPHA_NV": 1, "WGL_VIDEO_OUT_DEPTH_NV": 1, "WGL_VIDEO_OUT_COLOR_AND_ALPHA_NV": 1, "WGL_VIDEO_OUT_COLOR_AND_DEPTH_NV": 1, "WGL_VIDEO_OUT_FRAME": 1, "WGL_VIDEO_OUT_FIELD_1": 1, "WGL_VIDEO_OUT_FIELD_2": 1, "WGL_VIDEO_OUT_STACKED_FIELDS_1_2": 1, "WGL_VIDEO_OUT_STACKED_FIELDS_2_1": 1, "HPVIDEODEV": 4, "PFNWGLBINDVIDEOIMAGENVPROC": 2, "iVideoBuffer": 2, "PFNWGLGETVIDEODEVICENVPROC": 2, "numDevices": 1, "HPVIDEODEV*": 1, "PFNWGLGETVIDEOINFONVPROC": 2, "hpVideoDevice": 1, "long*": 2, "pulCounterOutputPbuffer": 1, "*pulCounterOutputVideo": 1, "PFNWGLRELEASEVIDEODEVICENVPROC": 2, "PFNWGLRELEASEVIDEOIMAGENVPROC": 2, "PFNWGLSENDPBUFFERTOVIDEONVPROC": 2, "iBufferType": 1, "pulCounterPbuffer": 1, "bBlock": 1, "wglBindVideoImageNV": 1, "__wglewBindVideoImageNV": 2, "wglGetVideoDeviceNV": 1, "__wglewGetVideoDeviceNV": 2, "wglGetVideoInfoNV": 1, "__wglewGetVideoInfoNV": 2, "wglReleaseVideoDeviceNV": 1, "__wglewReleaseVideoDeviceNV": 2, "wglReleaseVideoImageNV": 1, "__wglewReleaseVideoImageNV": 2, "wglSendPbufferToVideoNV": 1, "__wglewSendPbufferToVideoNV": 2, "WGLEW_NV_video_output": 1, "__WGLEW_NV_video_output": 2, "WGL_OML_sync_control": 2, "PFNWGLGETMSCRATEOMLPROC": 2, "INT32*": 1, "numerator": 1, "INT32": 1, "*denominator": 1, "PFNWGLGETSYNCVALUESOMLPROC": 2, "INT64*": 3, "INT64": 18, "*msc": 3, "*sbc": 3, "PFNWGLSWAPBUFFERSMSCOMLPROC": 2, "target_msc": 3, "divisor": 3, "remainder": 3, "PFNWGLSWAPLAYERBUFFERSMSCOMLPROC": 2, "fuPlanes": 1, "PFNWGLWAITFORMSCOMLPROC": 2, "PFNWGLWAITFORSBCOMLPROC": 2, "target_sbc": 1, "wglGetMscRateOML": 1, "__wglewGetMscRateOML": 2, "wglGetSyncValuesOML": 1, "__wglewGetSyncValuesOML": 2, "wglSwapBuffersMscOML": 1, "__wglewSwapBuffersMscOML": 2, "wglSwapLayerBuffersMscOML": 1, "__wglewSwapLayerBuffersMscOML": 2, "wglWaitForMscOML": 1, "__wglewWaitForMscOML": 2, "wglWaitForSbcOML": 1, "__wglewWaitForSbcOML": 2, "WGLEW_OML_sync_control": 1, "__WGLEW_OML_sync_control": 2, "GLEW_MX": 4, "WGLEW_EXPORT": 167, "GLEWAPI": 6, "WGLEWContextStruct": 2, "WGLEWContext": 1, "wglewContextInit": 2, "WGLEWContext*": 2, "wglewContextIsSupported": 2, "wglewInit": 1, "wglewGetContext": 4, "wglewIsSupported": 2, "wglewGetExtension": 1, "yajl_status_to_string": 1, "yajl_status": 4, "statStr": 6, "yajl_status_ok": 1, "yajl_status_client_canceled": 1, "yajl_status_insufficient_data": 1, "yajl_status_error": 1, "yajl_handle": 10, "yajl_alloc": 1, "yajl_callbacks": 1, "yajl_parser_config": 1, "config": 4, "yajl_alloc_funcs": 3, "afs": 8, "allowComments": 4, "validateUTF8": 3, "hand": 28, "afsBuffer": 3, "yajl_set_default_alloc_funcs": 1, "YA_MALLOC": 1, "yajl_handle_t": 1, "checkUTF8": 1, "lexer": 4, "yajl_lex_alloc": 1, "bytesConsumed": 2, "decodeBuf": 2, "yajl_buf_alloc": 1, "yajl_bs_init": 1, "stateStack": 3, "yajl_bs_push": 1, "yajl_state_start": 1, "yajl_reset_parser": 1, "yajl_lex_realloc": 1, "yajl_free": 1, "yajl_bs_free": 1, "yajl_buf_free": 1, "yajl_lex_free": 1, "YA_FREE": 2, "yajl_parse": 2, "jsonText": 4, "jsonTextLen": 4, "yajl_do_parse": 1, "yajl_parse_complete": 1, "yajl_get_error": 1, "verbose": 2, "yajl_render_error_string": 1, "yajl_get_bytes_consumed": 1, "yajl_free_error": 1 }, "C#": { "using": 12, "System.Reflection": 1, ";": 102, "System.Runtime.CompilerServices": 1, "[": 14, "assembly": 11, "AssemblyTitle": 1, "(": 139, ")": 139, "]": 14, "AssemblyDescription": 1, "AssemblyConfiguration": 1, "AssemblyCompany": 1, "AssemblyProduct": 1, "AssemblyCopyright": 1, "AssemblyTrademark": 1, "AssemblyCulture": 1, "AssemblyVersion": 1, "//": 2, "AssemblyDelaySign": 1, "false": 1, "AssemblyKeyFile": 1, "System": 2, "namespace": 3, "MongoDB.Serialization.Descriptors": 1, "{": 38, "internal": 2, "class": 3, "BsonPropertyValue": 2, "public": 4, "bool": 2, "IsDictionary": 2, "get": 4, "private": 3, "set": 3, "}": 38, "Type": 4, "object": 2, "Value": 2, "type": 2, "value": 2, "isDictionary": 2, "///////////////////////////////////////////////////////////////////////////////": 12, "var": 20, "target": 2, "Argument": 2, "": 2, "configuration": 4, "solutions": 3, "GetFiles": 1, "solutionPaths": 2, "solutions.Select": 1, "solution": 7, "solution.GetDirectory": 1, "Setup": 1, "Information": 5, "Teardown": 1, "Task": 4, ".Does": 3, "foreach": 3, "path": 4, "in": 3, "CleanDirectories": 2, "+": 8, "NuGetRestore": 1, ".IsDependentOn": 3, "MSBuild": 1, "settings": 1, "settings.SetPlatformTarget": 1, "PlatformTarget.MSIL": 1, ".WithProperty": 1, ".WithTarget": 1, ".SetConfiguration": 1, "RunTarget": 1, "@": 1, "ViewBag.Title": 1, "@section": 1, "featured": 1, "
": 1, "class=": 7, "
": 1, "
": 1, "

": 1, "@ViewBag.Title.": 1, "

": 1, "

": 1, "@ViewBag.Message": 1, "

": 1, "
": 1, "

": 1, "To": 1, "learn": 1, "more": 4, "about": 2, "ASP.NET": 5, "MVC": 4, "visit": 2, "": 5, "href=": 5, "title=": 2, "http": 1, "//asp.net/mvc": 1, "": 5, ".": 2, "The": 1, "page": 1, "features": 3, "": 1, "videos": 1, "tutorials": 1, "and": 6, "samples": 1, "": 1, "to": 4, "help": 1, "you": 4, "the": 5, "most": 1, "from": 4, "MVC.": 1, "If": 1, "have": 1, "any": 1, "questions": 1, "our": 1, "forums": 1, "

": 1, "
": 1, "
": 1, "

": 1, "We": 1, "suggest": 1, "following": 1, "

": 1, "
    ": 1, "
  1. ": 3, "
    ": 3, "Getting": 1, "Started": 1, "
    ": 3, "gives": 2, "a": 3, "powerful": 1, "patterns": 1, "-": 3, "based": 1, "way": 1, "build": 1, "dynamic": 1, "websites": 1, "that": 5, "enables": 1, "clean": 1, "separation": 1, "of": 2, "concerns": 1, "full": 1, "control": 1, "over": 1, "markup": 1, "for": 6, "enjoyable": 1, "agile": 1, "development.": 1, "includes": 1, "many": 1, "enable": 1, "fast": 1, "TDD": 1, "friendly": 1, "development": 1, "creating": 1, "sophisticated": 1, "applications": 1, "use": 1, "latest": 1, "web": 2, "standards.": 1, "Learn": 3, "
  2. ": 3, "Add": 1, "NuGet": 2, "packages": 1, "jump": 1, "start": 1, "your": 2, "coding": 1, "makes": 1, "it": 2, "easy": 1, "install": 1, "update": 1, "free": 1, "libraries": 1, "tools.": 1, "Find": 1, "Web": 1, "Hosting": 1, "You": 1, "can": 1, "easily": 1, "find": 1, "hosting": 1, "company": 1, "offers": 1, "right": 1, "mix": 1, "price": 1, "applications.": 1, "
": 1, "System.Collections.Generic": 2, "System.Collections.ObjectModel": 1, "System.Linq": 2, "System.Linq.Expressions": 1, "MongoDB.Linq.Expressions": 1, "MongoExpressionVisitor": 1, "ExpressionVisitor": 1, "protected": 12, "override": 1, "Expression": 14, "Visit": 13, "exp": 13, "if": 15, "null": 12, "return": 29, "switch": 2, "MongoExpressionType": 2, "exp.NodeType": 1, "case": 8, "MongoExpressionType.Collection": 1, "VisitCollection": 2, "CollectionExpression": 2, "MongoExpressionType.Field": 1, "VisitField": 2, "FieldExpression": 3, "MongoExpressionType.Projection": 1, "VisitProjection": 2, "ProjectionExpression": 3, "MongoExpressionType.Select": 1, "VisitSelect": 2, "SelectExpression": 6, "MongoExpressionType.Aggregate": 1, "VisitAggregate": 2, "AggregateExpression": 3, "MongoExpressionType.AggregateSubquery": 1, "VisitAggregateSubquery": 2, "AggregateSubqueryExpression": 3, "MongoExpressionType.Scalar": 2, "VisitScalar": 3, "ScalarExpression": 6, "default": 1, "base.Visit": 1, "virtual": 10, "aggregate": 2, "aggregate.Argument": 2, "new": 8, "aggregate.Type": 1, "aggregate.AggregateType": 1, "aggregate.Distinct": 1, "aggregateSubquery": 2, "e": 11, "aggregateSubquery.AggregateAsSubquery": 2, "subquery": 6, "aggregateSubquery.GroupByAlias": 1, "aggregateSubquery.AggregateInGroupSelect": 1, "collection": 2, "field": 3, "field.Expression": 2, "field.Alias": 1, "field.Name": 1, "projection": 2, "source": 5, "projection.Source": 2, "projector": 3, "projection.Projector": 2, "||": 7, "projection.Aggregator": 1, "ReadOnlyCollection": 4, "": 3, "VisitOrderBy": 2, "orderBys": 4, "List": 2, "alternate": 10, "int": 2, "i": 10, "n": 4, "orderBys.Count": 1, "<": 2, "OrderExpression": 2, "expr": 1, "this.Visit": 1, "expr.Expression": 2, "&&": 2, "orderBys.Take": 1, ".ToList": 2, "alternate.Add": 2, "expr.OrderType": 1, "alternate.AsReadOnly": 2, "scalar": 2, "select": 5, "scalar.Select": 2, "scalar.Type": 1, "VisitSource": 2, "select.From": 2, "where": 3, "select.Where": 2, "groupBy": 3, "select.GroupBy": 2, "orderBy": 3, "select.OrderBy": 2, "skip": 3, "select.Skip": 2, "take": 3, "select.Take": 2, "fields": 8, "VisitFieldDeclarationList": 2, "select.Fields": 2, "select.Alias": 1, "select.IsDistinct": 1, "VisitSubquery": 1, "SubqueryExpression": 1, "subquery.NodeType": 1, "": 3, "fields.Count": 1, "f": 1, "f.Expression": 2, "fields.Take": 1, "FieldDeclaration": 1, "f.Name": 1, "System.Text": 1, "System.Threading.Tasks": 1, "LittleSampleApp": 1, "///": 4, "": 1, "Just": 1, "what": 1, "says": 1, "on": 1, "tin.": 1, "A": 1, "little": 1, "sample": 1, "application": 1, "Linguist": 1, "try": 1, "out.": 1, "": 1, "Program": 1, "static": 1, "void": 1, "Main": 1, "string": 1, "args": 1, "Console.WriteLine": 2 }, "C++": { "enum": 6, "PIC16F88Instruction": 2, "{": 1037, "ADDWF": 1, "ANDWF": 1, "CLRF": 1, "CLRW": 1, "COMF": 1, "DECF": 1, "DECFSZ": 1, "INCF": 1, "INCFSZ": 1, "IORWF": 1, "MOVF": 1, "MOVWF": 1, "NOP": 1, "RLF": 1, "RRF": 1, "SUBWF": 1, "SWAPF": 1, "XORWF": 1, "BCF": 1, "BSF": 1, "BTFSC": 1, "BTFSS": 1, "ADDLW": 1, "ANDLW": 1, "CALL": 1, "CLRWDT": 1, "GOTO": 1, "IORLW": 1, "MOVLW": 1, "RETFIE": 1, "RETLW": 1, "RETURN": 1, "SLEEP": 1, "SUBLW": 1, "XORLW": 1, "}": 1043, ";": 4266, "class": 36, "PIC16F88": 2, "public": 37, "(": 5262, "ROM": 2, "*ProgramMemory": 1, ")": 5268, "void": 219, "Step": 1, "private": 18, "uint8_t": 17, "q": 1, "bool": 155, "nextIsNop": 1, "trapped": 1, "Memory": 2, "*memory": 1, "*program": 1, "Stack": 1, "": 1, "8": 1, "*CallStack": 1, "Register": 2, "": 1, "*PC": 1, "<": 84, "*WREG": 1, "*PCL": 1, "*STATUS": 1, "*PCLATCH": 1, "inst": 1, "uint16_t": 2, "instrWord": 1, "DecodeInstruction": 1, "ProcessInstruction": 1, "GetBank": 1, "GetMemoryContents": 1, "partialAddress": 4, "SetMemoryContents": 1, "newVal": 1, "CheckZero": 1, "value": 39, "StoreValue": 1, "updateZero": 1, "SetCarry": 1, "val": 4, "GetPCHFinalBits": 1, "Bar": 3, "protected": 6, "char": 150, "*name": 7, "hello": 3, "//": 163, "-": 905, "ClasspathVMSystem/Properties.cpp": 1, "GNU": 1, "classpath": 1, "gnu/classpath/VMSystemProperties": 1, "#include": 192, "": 1, "using": 10, "namespace": 48, "j3": 1, "extern": 5, "JNIEXPORT": 1, "JNICALL": 1, "Java_gnu_classpath_VMSystemProperties_preInit": 1, "#ifdef": 19, "NATIVE_JNI": 1, "JNIEnv": 1, "*env": 2, "jclass": 1, "clazz": 1, "#endif": 112, "JavaObject*": 2, "prop": 6, "llvm_gcroot": 2, "BEGIN_NATIVE_EXCEPTION": 2, "setProperties": 1, "END_NATIVE_EXCEPTION": 2, "Java_gnu_classpath_VMSystemProperties_postInit__Ljava_util_Properties_2": 1, "setCommandLineProperties": 1, "": 1, "": 1, "": 6, "": 10, "WIN32": 3, "": 1, "CCrypter": 6, "SetKeyFromPassphrase": 1, "const": 197, "SecureString": 1, "&": 363, "strKeyData": 2, "std": 126, "vector": 37, "": 28, "chSalt": 2, "unsigned": 27, "int": 276, "nRounds": 3, "nDerivationMethod": 2, "if": 472, "||": 43, "chSalt.size": 1, "WALLET_CRYPTO_SALT_SIZE": 1, "return": 345, "false": 76, "i": 131, "EVP_BytesToKey": 1, "EVP_aes_256_cbc": 3, "EVP_sha512": 1, "[": 268, "]": 270, "*": 196, "strKeyData.size": 1, "chKey": 7, "chIV": 13, "WALLET_CRYPTO_KEY_SIZE": 7, "OPENSSL_cleanse": 2, "sizeof": 21, "fKeySet": 4, "true": 74, "SetKey": 1, "CKeyingMaterial": 8, "chNewKey": 2, "chNewIV": 2, "chNewKey.size": 1, "chNewIV.size": 1, "memcpy": 6, "Encrypt": 1, "vchPlaintext": 10, "vchCiphertext": 10, "nLen": 6, "vchPlaintext.size": 1, "nCLen": 5, "+": 151, "AES_BLOCK_SIZE": 1, "nFLen": 6, "EVP_CIPHER_CTX": 2, "ctx": 38, "fOk": 19, "EVP_CIPHER_CTX_init": 2, "EVP_EncryptInit_ex": 1, "NULL": 129, "EVP_EncryptUpdate": 1, "EVP_EncryptFinal_ex": 1, "EVP_CIPHER_CTX_cleanup": 2, "vchCiphertext.resize": 1, "Decrypt": 1, "vchCiphertext.size": 1, "nPLen": 5, "EVP_DecryptInit_ex": 1, "EVP_DecryptUpdate": 1, "EVP_DecryptFinal_ex": 1, "vchPlaintext.resize": 1, "EncryptSecret": 1, "vMasterKey": 4, "uint256": 12, "nIV": 4, "cKeyCrypter": 2, "cKeyCrypter.SetKey": 2, "cKeyCrypter.Encrypt": 1, "DecryptSecret": 1, "cKeyCrypter.Decrypt": 1, "CKeyingMaterial*": 1, "#pragma": 6, "once": 3, "": 2, "#define": 203, "DEFAULT_DELIMITER": 1, "CsvStreamer": 5, "ofstream": 1, "file": 28, "File": 1, "output": 19, "stream": 9, "row_buffer": 1, "Buffer": 3, "which": 6, "stores": 3, "a": 79, "row": 12, "s": 19, "data": 8, "before": 2, "being": 5, "flushed/written": 1, "fields": 4, "Number": 2, "of": 36, "columns": 2, "long": 16, "rows": 3, "records": 2, "including": 2, "header": 4, "delimiter": 2, "Delimiter": 1, "character": 4, "comma": 2, "by": 5, "default": 8, "string": 80, "sanitize": 1, "Returns": 1, "ready": 1, "for": 43, "into": 2, "the": 75, "Empty": 2, "CSV": 4, "streamer...": 1, "be": 4, "sure": 5, "to": 27, "open": 5, "writing": 1, "Same": 1, "as": 7, "...": 1, "Opens": 3, "an": 7, "given": 4, "path/name": 3, "Ensures": 1, "is": 14, "closed": 1, "and": 12, "saved": 1, "delimiting": 1, "add_field": 1, "If": 1, "still": 1, "on": 2, "first": 1, "line": 5, "adds": 1, "new": 73, "field": 5, "save_fields": 1, "Call": 1, "this": 42, "save": 2, "all": 4, "writes": 2, "should": 2, "through": 3, "append": 8, "Appends": 5, "current": 17, "with": 12, "next": 4, "quoted": 1, "only": 2, "needed": 2, "leading/trailing": 1, "spaces": 3, "are": 2, "trimmed": 1, "Like": 1, "but": 3, "can": 3, "specify": 1, "whether": 2, "trim": 2, "at": 8, "either": 2, "end": 12, "keep": 1, "float": 80, "number": 8, "double": 26, "writeln": 1, "Flushes": 1, "what": 1, "was": 4, "in": 23, "buffer": 22, "close": 6, "Saves": 1, "closes": 1, "field_count": 1, "Gets": 2, "row_count": 1, "NOT": 2, "#ifndef": 27, "ENTITY_H": 2, "///": 18, "@namespace": 1, "Whitedrop": 2, "Entity": 7, "mesh": 1, "id": 8, "Ogre": 7, "Vector3": 4, "dimensions": 1, "position": 2, "material": 1, "ref": 2, "operator": 11, "ent": 1, "virtual": 8, "type": 10, "setup": 1, "SceneManager*": 1, "sceneMgr": 1, "update": 2, "mMesh": 1, "mId": 1, "mMaterial": 1, "mDimensions": 1, "mPosition": 1, "Entity*": 1, "mEntity": 1, "SceneNode*": 1, "mNode": 1, "": 1, "": 1, "": 2, "static": 269, "Env": 13, "*env_instance": 1, "*Env": 1, "instance": 3, "env_instance": 3, "QObject": 2, "QCoreApplication": 1, "parse": 11, "**envp": 1, "**env": 1, "**": 2, "QString": 19, "envvar": 2, "name": 27, "indexOfEquals": 5, "env": 3, "envp": 4, "envvar.indexOf": 1, "continue": 5, "envvar.left": 1, "envvar.mid": 1, "m_map.insert": 1, "QVariantMap": 3, "asVariantMap": 2, "m_map": 2, "ENV_H": 3, "": 1, "Q_OBJECT": 1, "*instance": 1, "BOOST_ASIO_DETAIL_IMPL_EPOLL_REACTOR_IPP": 3, "#if": 68, "defined": 55, "_MSC_VER": 11, "&&": 47, "": 1, "BOOST_ASIO_HAS_EPOLL": 2, "": 1, "": 1, "": 1, "": 1, "": 1, "BOOST_ASIO_HAS_TIMERFD": 19, "": 1, "boost": 74, "asio": 14, "detail": 5, "epoll_reactor": 40, "io_service": 6, "service_base": 1, "": 1, "io_service_": 1, "use_service": 1, "": 1, "mutex_": 13, "interrupter_": 5, "epoll_fd_": 20, "do_epoll_create": 3, "timer_fd_": 21, "do_timerfd_create": 3, "shutdown_": 10, "epoll_event": 10, "ev": 21, "ev.events": 13, "EPOLLIN": 8, "|": 43, "EPOLLERR": 8, "EPOLLET": 5, "ev.data.ptr": 10, "epoll_ctl": 12, "EPOLL_CTL_ADD": 7, "interrupter_.read_descriptor": 3, "interrupter_.interrupt": 2, "shutdown_service": 1, "mutex": 16, "scoped_lock": 16, "lock": 5, "lock.unlock": 1, "op_queue": 6, "": 6, "ops": 10, "while": 31, "descriptor_state*": 6, "state": 26, "registered_descriptors_.first": 2, "max_ops": 6, "ops.push": 5, "op_queue_": 12, "registered_descriptors_.free": 2, "timer_queues_.get_all_timers": 1, "io_service_.abandon_operations": 1, "fork_service": 1, "fork_event": 1, "fork_ev": 2, "fork_child": 1, "interrupter_.recreate": 1, "update_timeout": 2, "descriptors_lock": 3, "registered_descriptors_mutex_": 3, "next_": 3, "registered_events_": 8, "result": 21, "descriptor_": 5, "system": 4, "error_code": 4, "ec": 6, "errno": 10, "error": 11, "get_system_category": 3, "throw_error": 2, "init_task": 1, "io_service_.init_task": 1, "register_descriptor": 1, "socket_type": 7, "descriptor": 15, "per_descriptor_data": 8, "descriptor_data": 60, "allocate_descriptor_state": 3, "descriptor_lock": 7, "reactor_": 7, "EPOLLHUP": 3, "EPOLLPRI": 3, "register_internal_descriptor": 1, "op_type": 8, "reactor_op*": 5, "op": 28, ".push": 2, "move_descriptor": 1, "target_descriptor_data": 2, "source_descriptor_data": 3, "start_op": 1, "is_continuation": 5, "allow_speculative": 2, "ec_": 4, "bad_descriptor": 1, "post_immediate_completion": 2, ".empty": 5, "read_op": 1, "except_op": 1, "perform": 2, "descriptor_lock.unlock": 4, "io_service_.post_immediate_completion": 2, "write_op": 2, "EPOLLOUT": 4, "EPOLL_CTL_MOD": 3, "else": 72, "io_service_.work_started": 2, "cancel_ops": 1, ".front": 3, "operation_aborted": 2, ".pop": 3, "io_service_.post_deferred_completions": 3, "deregister_descriptor": 1, "closing": 2, "EPOLL_CTL_DEL": 2, "free_descriptor_state": 3, "deregister_internal_descriptor": 1, "run": 1, "block": 5, "timeout": 4, "get_timeout": 5, "events": 8, "num_events": 2, "epoll_wait": 1, "check_timers": 6, "#else": 36, "void*": 59, "ptr": 6, ".data.ptr": 1, "static_cast": 24, "": 2, "set_ready_events": 1, ".events": 1, "common_lock": 1, "timer_queues_.get_ready_timers": 1, "itimerspec": 5, "new_timeout": 6, "old_timeout": 4, "flags": 4, "timerfd_settime": 2, "interrupt": 2, "EPOLL_CLOEXEC": 4, "fd": 15, "epoll_create1": 1, "EINVAL": 4, "ENOSYS": 1, "epoll_create": 1, "epoll_size": 1, "fcntl": 2, "F_SETFD": 2, "FD_CLOEXEC": 2, "timerfd_create": 2, "CLOCK_MONOTONIC": 2, "TFD_CLOEXEC": 1, "registered_descriptors_.alloc": 1, "do_add_timer_queue": 1, "timer_queue_base": 2, "queue": 6, "timer_queues_.insert": 1, "do_remove_timer_queue": 1, "timer_queues_.erase": 1, "timer_queues_.wait_duration_msec": 1, "ts": 1, "ts.it_interval.tv_sec": 1, "ts.it_interval.tv_nsec": 1, "usec": 5, "timer_queues_.wait_duration_usec": 1, "ts.it_value.tv_sec": 1, "/": 19, "ts.it_value.tv_nsec": 1, "%": 178, "TFD_TIMER_ABSTIME": 1, "struct": 13, "perform_io_cleanup_on_block_exit": 4, "explicit": 5, "epoll_reactor*": 2, "r": 69, "first_op_": 3, "ops_.empty": 1, "ops_": 2, "operation*": 4, "descriptor_state": 5, "operation": 2, "do_complete": 2, "perform_io": 2, "uint32_t": 12, "mutex_.lock": 1, "io_cleanup": 1, "adopt_lock": 1, "flag": 2, "j": 11, "io_cleanup.ops_.push": 1, "break": 62, "io_cleanup.first_op_": 2, "io_cleanup.ops_.front": 1, "io_cleanup.ops_.pop": 1, "io_service_impl*": 1, "owner": 3, "base": 4, "size_t": 7, "bytes_transferred": 2, "": 1, "complete": 1, "": 1, "Field": 2, "Free": 1, "Black": 1, "White": 1, "Illegal": 1, "typedef": 41, "Player": 1, "GDSDBREADER_H": 3, "": 1, "GDS_DIR": 1, "level": 1, "LEVEL_ONE": 1, "LEVEL_TWO": 1, "LEVEL_THREE": 1, "dbDataStructure": 2, "label": 1, "quint32": 3, "depth": 1, "userIndex": 1, "QByteArray": 1, "This": 5, "COMPRESSED": 1, "optimize": 1, "ram": 1, "disk": 2, "space": 1, "decompressed": 1, "quint64": 1, "uniqueID": 1, "QVector": 2, "": 1, "nextItems": 1, "": 1, "nextItemsIndices": 1, "dbDataStructure*": 1, "father": 1, "fatherIndex": 1, "noFatherRoot": 1, "Used": 2, "tell": 1, "node": 1, "root": 11, "so": 2, "hasn": 1, "t": 25, "argument": 1, "list": 3, "overload.": 1, "A": 4, "friend": 9, "<<": 29, "myclass.label": 2, "myclass.depth": 2, "myclass.userIndex": 2, "qCompress": 2, "myclass.data": 4, "myclass.uniqueID": 2, "myclass.nextItemsIndices": 2, "myclass.fatherIndex": 2, "myclass.noFatherRoot": 2, "myclass.fileName": 2, "myclass.firstLineData": 4, "myclass.linesNumbers": 2, "QDataStream": 2, "myclass": 1, "//Don": 1, "read": 1, "it": 31, "qUncompress": 2, "": 1, "currentR": 4, "currentG": 4, "currentB": 4, "currentA": 5, "currentScreen": 3, "GFX_BOTTOM": 2, "transX": 5, "transY": 5, "isPushed": 4, "u32": 5, "getCurrentColor": 1, "RGBA8": 1, "setColor": 2, "g": 6, "b": 59, "setScreen": 1, "screen": 2, "getCurrentScreen": 5, "screenShot": 1, "//for": 1, "showing": 1, "stuff": 1, "done": 1, "FILE": 2, "topScreen": 3, "fopen": 2, "fwrite": 2, "gfxGetFramebuffer": 2, "GFX_TOP": 1, "GFX_LEFT": 2, "fclose": 2, "bottomScreen": 3, "translateCoords": 1, "x": 86, "y": 20, "*x": 2, "*y": 1, "translate": 1, "dx": 2, "dy": 2, "sf2d_get_current_screen": 4, "push": 4, "pop": 1, "setScissor": 1, "width": 3, "height": 3, "GPU_SCISSORMODE": 1, "mode": 4, "GPU_SCISSOR_NORMAL": 1, "GPU_SCISSOR_DISABLE": 1, "sf2d_set_scissor_test": 1, "": 5, "main": 3, "cout": 5, "endl": 3, "HEADER_INCLUDES": 3, "#undef": 5, "SET_SYMBOL": 3, "ALL_STAGES": 2, "llvmo": 820, "APFloat_O": 14, "___set_static_ClassSymbol": 66, "LOOKUP_SYMBOL": 66, "static_packageName": 66, "static_className": 179, "APInt_O": 14, "Attribute_O": 14, "Builder_O": 14, "DebugLoc_O": 14, "EngineBuilder_O": 14, "ExecutionEngine_O": 14, "IRBuilderBase_O": 14, "InsertPoint_O": 14, "LLVMContext_O": 14, "Module_O": 14, "PassManagerBase_O": 14, "Pass_O": 14, "Type_O": 14, "Value_O": 14, "Argument_O": 14, "BasicBlock_O": 14, "CompositeType_O": 14, "FunctionPassManager_O": 14, "FunctionPass_O": 14, "FunctionType_O": 14, "IRBuilder_O": 14, "IntegerType_O": 14, "MDNode_O": 14, "MDString_O": 14, "ModulePass_O": 14, "User_O": 14, "Constant_O": 14, "ImmutablePass_O": 14, "Instruction_O": 14, "SequentialType_O": 14, "StructType_O": 14, "ArrayType_O": 14, "AtomicCmpXchgInst_O": 14, "AtomicRMWInst_O": 14, "CallInst_O": 14, "ConstantArray_O": 14, "ConstantDataSequential_O": 14, "ConstantExpr_O": 14, "ConstantFP_O": 14, "ConstantInt_O": 14, "ConstantPointerNull_O": 14, "DataLayout_O": 14, "FenceInst_O": 14, "GlobalValue_O": 14, "LandingPadInst_O": 14, "PHINode_O": 14, "PointerType_O": 14, "StoreInst_O": 14, "TerminatorInst_O": 14, "UnaryInstruction_O": 14, "UndefValue_O": 14, "VectorType_O": 14, "AllocaInst_O": 14, "BranchInst_O": 14, "ConstantDataArray_O": 14, "Function_O": 9, "GlobalVariable_O": 3, "IndirectBrInst_O": 3, "InvokeInst_O": 3, "LoadInst_O": 3, "ResumeInst_O": 3, "ReturnInst_O": 3, "SwitchInst_O": 3, "UnreachableInst_O": 3, "VAArgInst_O": 3, "CREATE_CLASS": 1, "core": 115, "MetaClass_sp": 1, "undefinedMetaClass": 114, "undefinedMetaClass.reset": 1, "LOG": 170, "BF": 170, "BuiltInClass_sp": 57, "classllvmo__APFloat_Oval": 8, "BuiltInClass_O": 57, "create": 57, "__setup_stage1_with_sharedPtr_lisp_sid": 57, "_lisp": 114, "static_classSymbol": 114, "___staticMetaClass": 57, "setf_findClass": 57, "AllocatorCallback": 57, "cb": 114, "new_Nil": 57, "": 2, "___set_static_newNil_callback": 57, "static_newNil_callback": 113, "setInstance_newNil_callback": 57, "shared_ptr": 56, "nil_for_class": 280, "__setWeakThis": 56, "_nil": 56, "setInstanceNil": 56, "setSupportsSlots": 56, "static_supportsSlots": 56, "classllvmo__APInt_Oval": 8, "": 2, "classllvmo__Attribute_Oval": 8, "": 2, "classllvmo__Builder_Oval": 8, "": 2, "classllvmo__DebugLoc_Oval": 8, "": 2, "classllvmo__EngineBuilder_Oval": 8, "": 2, "classllvmo__ExecutionEngine_Oval": 8, "": 2, "classllvmo__IRBuilderBase_Oval": 8, "": 2, "classllvmo__InsertPoint_Oval": 8, "": 2, "classllvmo__LLVMContext_Oval": 8, "": 2, "classllvmo__Module_Oval": 8, "": 2, "classllvmo__PassManagerBase_Oval": 8, "": 2, "classllvmo__Pass_Oval": 8, "": 2, "classllvmo__Type_Oval": 8, "": 2, "classllvmo__Value_Oval": 8, "": 2, "classllvmo__Argument_Oval": 8, "": 2, "classllvmo__BasicBlock_Oval": 8, "": 2, "classllvmo__CompositeType_Oval": 8, "": 2, "classllvmo__FunctionPassManager_Oval": 8, "": 2, "classllvmo__FunctionPass_Oval": 8, "": 2, "classllvmo__FunctionType_Oval": 8, "": 2, "classllvmo__IRBuilder_Oval": 8, "": 2, "classllvmo__IntegerType_Oval": 8, "": 2, "classllvmo__MDNode_Oval": 8, "": 2, "classllvmo__MDString_Oval": 8, "": 2, "classllvmo__ModulePass_Oval": 8, "": 2, "classllvmo__User_Oval": 8, "": 2, "classllvmo__Constant_Oval": 8, "": 2, "classllvmo__ImmutablePass_Oval": 8, "": 2, "classllvmo__Instruction_Oval": 8, "": 2, "classllvmo__SequentialType_Oval": 8, "": 2, "classllvmo__StructType_Oval": 8, "": 2, "classllvmo__ArrayType_Oval": 8, "": 2, "classllvmo__AtomicCmpXchgInst_Oval": 8, "": 2, "classllvmo__AtomicRMWInst_Oval": 8, "": 2, "classllvmo__CallInst_Oval": 8, "": 2, "classllvmo__ConstantArray_Oval": 8, "": 2, "classllvmo__ConstantDataSequential_Oval": 8, "": 2, "classllvmo__ConstantExpr_Oval": 8, "": 2, "classllvmo__ConstantFP_Oval": 8, "": 2, "classllvmo__ConstantInt_Oval": 8, "": 2, "classllvmo__ConstantPointerNull_Oval": 8, "": 2, "classllvmo__DataLayout_Oval": 8, "": 2, "classllvmo__FenceInst_Oval": 8, "": 2, "classllvmo__GlobalValue_Oval": 8, "": 2, "classllvmo__LandingPadInst_Oval": 8, "": 2, "classllvmo__PHINode_Oval": 8, "": 2, "classllvmo__PointerType_Oval": 8, "": 2, "classllvmo__StoreInst_Oval": 8, "": 2, "classllvmo__TerminatorInst_Oval": 8, "": 2, "classllvmo__UnaryInstruction_Oval": 8, "": 2, "classllvmo__UndefValue_Oval": 8, "": 2, "classllvmo__VectorType_Oval": 8, "": 2, "classllvmo__AllocaInst_Oval": 8, "": 2, "classllvmo__BranchInst_Oval": 8, "": 2, "classllvmo__ConstantDataArray_Oval": 8, "": 2, "classllvmo__Function_Oval": 6, "": 1, "warning": 5, "disable": 5, "template": 9, "QPBO": 6, "": 5, "": 3, "": 3, "inline": 44, "get_type_information": 3, "char*": 28, "type_name": 6, "type_format": 6, "": 1, "": 1, "": 2, "": 2, "": 1, "": 3, "": 2, "VC": 2, "about": 4, "strdup": 2, "deprecated.": 2, "Json": 6, "__QNXNTO__": 1, "sprintf": 2, "sscanf": 1, "Features": 10, "allowComments_": 1, "strictRoot_": 1, "strictMode": 1, "features": 4, "features.allowComments_": 1, "features.strictRoot_": 1, "Reader": 33, "Char": 17, "c": 98, "c1": 9, "c2": 9, "c3": 4, "c4": 4, "c5": 2, "containsNewLine": 3, "Location": 20, "begin": 10, "*begin": 3, "codePointToUTF8": 1, "cp": 15, "result.resize": 4, "": 12, "features_": 2, "document": 2, "Value": 30, "collectComments": 7, "document_": 1, "document_.c_str": 1, "*end": 1, "document_.length": 1, "istream": 3, "sin": 6, "//std": 2, "istream_iterator": 2, "doc": 3, "getline": 1, "EOF": 1, "*beginDoc": 1, "*endDoc": 1, "features_.allowComments_": 2, "begin_": 2, "beginDoc": 2, "end_": 7, "endDoc": 2, "collectComments_": 6, "current_": 20, "lastValueEnd_": 4, "lastValue_": 4, "commentsBefore_": 6, "errors_.clear": 1, "nodes_.empty": 1, "nodes_.pop": 1, "nodes_.push": 1, "successful": 12, "readValue": 2, "Token": 225, "token": 86, "skipCommentTokens": 3, "commentsBefore_.empty": 3, "root.setComment": 1, "commentAfter": 1, "features_.strictRoot_": 1, "root.isArray": 1, "root.isObject": 1, "token.type_": 18, "tokenError": 2, "token.start_": 2, "token.end_": 2, "addError": 3, "currentValue": 5, ".setComment": 1, "commentBefore": 2, "switch": 7, "case": 79, "tokenObjectBegin": 2, "readObject": 1, "tokenArrayBegin": 2, "readArray": 1, "tokenNumber": 2, "decodeNumber": 1, "tokenString": 2, "decodeString": 1, "tokenTrue": 2, "tokenFalse": 2, "tokenNull": 2, "do": 14, "readToken": 4, "tokenComment": 2, "expectToken": 1, "TokenType": 1, "*message": 1, "message": 3, "skipSpaces": 2, "getNextChar": 6, "ok": 14, "tokenObjectEnd": 1, "tokenArrayEnd": 1, "readString": 2, "readComment": 2, "readNumber": 2, "match": 4, "tokenArraySeparator": 1, "tokenMemberSeparator": 1, "tokenEndOfStream": 1, "*current_": 4, "pattern": 2, "patternLength": 4, "index": 9, "commentBegin": 4, "readCStyleComment": 2, "readCppStyleComment": 2, "CommentPlacement": 2, "placement": 6, "commentAfterOnSameLine": 2, "addComment": 2, "assert": 4, "setComment": 1, ".": 5, "e": 17, "E": 4, "escape": 5, "sequence": 4, "Bad": 3, "additional": 1, "six": 1, "characters": 1, "expected": 2, "unicode": 4, "surrogate": 2, "pair.": 1, "expecting": 1, "another": 1, "u": 7, "second": 1, "half": 1, "pair": 1, "four": 1, "digits": 7, "expected.": 2, "hexadecimal": 1, "digit": 1, "Line": 1, "d": 8, "Column": 1, "n": 49, "See": 1, "detail.": 1, "formattedMessage": 1, "reader": 1, "reader.parse": 1, "//JSON_ASSERT": 1, "throw": 5, "runtime_error": 3, "reader.getFormatedErrorMessages": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "isControlCharacter": 2, "ch": 16, "containsControlCharacter": 2, "str": 4, "*str": 1, "uintToString": 3, "valueToString": 4, "Int": 1, "*current": 2, "isNegative": 3, "UInt": 2, "__STDC_SECURE_LIB__": 1, "Use": 2, "secure": 1, "version": 5, "visual": 1, "studio": 1, "avoid": 3, "warning.": 1, "sprintf_s": 1, "strlen": 2, "nothing": 1, "truncate": 1, "time": 4, "*ch": 1, "last_nonzero": 2, "valueToQuotedString": 1, "*value": 3, "strpbrk": 1, "maxsize": 2, "*2": 1, "allescaped": 1, "quotes": 1, "result.reserve": 1, "lots": 1, "mallocs": 1, "*c": 1, "f": 85, "handle": 1, "unix": 1, "EOL": 1, "other": 8, "normalized": 2, "ostream": 2, "sout": 3, "StyledStreamWriter": 1, "writer": 1, "writer.write": 1, "": 2, "": 1, "": 1, "EC_KEY_regenerate_key": 1, "EC_KEY": 3, "*eckey": 2, "BIGNUM": 9, "*priv_key": 1, "BN_CTX": 2, "*ctx": 2, "EC_POINT": 4, "*pub_key": 1, "eckey": 7, "EC_GROUP": 2, "*group": 2, "EC_KEY_get0_group": 2, "BN_CTX_new": 2, "goto": 156, "err": 26, "pub_key": 6, "EC_POINT_new": 4, "group": 12, "EC_POINT_mul": 3, "priv_key": 2, "EC_KEY_set_private_key": 1, "EC_KEY_set_public_key": 2, "EC_POINT_free": 4, "BN_CTX_free": 2, "ECDSA_SIG_recover_key_GFp": 3, "ECDSA_SIG": 3, "*ecsig": 1, "*msg": 2, "msglen": 2, "recid": 3, "check": 3, "ret": 111, "*e": 1, "*order": 1, "*sor": 1, "*eor": 1, "*field": 1, "*R": 1, "*O": 1, "*Q": 1, "*rr": 1, "*zero": 1, "BN_CTX_start": 1, "order": 8, "BN_CTX_get": 8, "EC_GROUP_get_order": 1, "BN_copy": 1, "BN_mul_word": 1, "BN_add": 1, "ecsig": 3, "EC_GROUP_get_curve_GFp": 1, "BN_cmp": 1, "R": 6, "EC_POINT_set_compressed_coordinates_GFp": 1, "O": 5, "EC_POINT_is_at_infinity": 1, "Q": 5, "EC_GROUP_get_degree": 1, "BN_bin2bn": 3, "msg": 1, "*msglen": 1, "BN_rshift": 1, "zero": 5, "BN_zero": 1, "BN_mod_sub": 1, "rr": 8, "BN_mod_inverse": 1, "sor": 3, "BN_mod_mul": 2, "eor": 3, "BN_CTX_end": 1, "CKey": 26, "SetCompressedPubKey": 4, "EC_KEY_set_conv_form": 1, "pkey": 14, "POINT_CONVERSION_COMPRESSED": 1, "fCompressedPubKey": 5, "Reset": 5, "EC_KEY_new_by_curve_name": 2, "NID_secp256k1": 2, "key_error": 6, "fSet": 7, "EC_KEY_dup": 1, "b.pkey": 2, "b.fSet": 2, "EC_KEY_copy": 1, "hash": 20, "vchSig": 18, "nSize": 2, "vchSig.clear": 2, "vchSig.resize": 2, "Shrink": 1, "fit": 1, "actual": 1, "size": 13, "SignCompact": 2, "*sig": 2, "ECDSA_do_sign": 1, "sig": 11, "nBitsR": 3, "BN_num_bits": 2, "nBitsS": 3, "nRecId": 4, "<4;>": 1, "keyRec": 5, "1": 8, "GetPubKey": 5, "BN_bn2bin": 2, "/8": 2, "ECDSA_SIG_free": 2, "SetCompactSignature": 2, "vchSig.size": 2, "nV": 6, "<27>": 1, "ECDSA_SIG_new": 1, "EC_KEY_free": 1, "Verify": 2, "ECDSA_verify": 1, "VerifyCompact": 2, "key": 1, "key.SetCompactSignature": 1, "key.GetPubKey": 1, "IsValid": 4, "fCompr": 3, "CSecret": 4, "secret": 2, "GetSecret": 2, "key2": 1, "key2.SetSecret": 1, "key2.GetPubKey": 1, "BITCOIN_KEY_H": 2, "": 1, "definition": 2, "CKeyID": 5, "uint160": 8, "CScriptID": 3, "CPubKey": 11, "vchPubKey": 6, "vchPubKeyIn": 2, "a.vchPubKey": 3, "b.vchPubKey": 3, "IMPLEMENT_SERIALIZE": 1, "READWRITE": 1, "GetID": 1, "Hash160": 1, "GetHash": 1, "Hash": 1, "vchPubKey.begin": 1, "vchPubKey.end": 1, "vchPubKey.size": 3, "IsCompressed": 2, "Raw": 1, "secure_allocator": 2, "CPrivKey": 3, "EC_KEY*": 1, "IsNull": 1, "MakeNewKey": 1, "fCompressed": 3, "SetPrivKey": 1, "vchPrivKey": 1, "SetSecret": 1, "vchSecret": 1, "GetPrivKey": 1, "SetPubKey": 1, "Sign": 2, "LIBCANIH": 2, "": 3, "int64": 1, "//#define": 1, "DEBUG": 8, "dout": 2, "cerr": 1, "libcanister": 2, "//the": 8, "canmem": 22, "object": 3, "generic": 1, "memory": 6, "container": 2, "used": 3, "commonly": 1, "//throughout": 1, "canister": 14, "framework": 1, "hold": 1, "uncertain": 1, "//length": 1, "may": 2, "or": 5, "not": 9, "contain": 1, "null": 3, "bytes.": 1, "raw": 2, "absolute": 1, "length": 10, "//creates": 3, "unallocated": 1, "allocsize": 1, "allocated": 1, "blank": 1, "strdata": 1, "//automates": 1, "creation": 1, "limited": 2, "canmems": 1, "//cleans": 1, "up": 3, "zeromem": 1, "//overwrites": 2, "fragmem": 1, "fragment": 1, "notation": 1, "countlen": 1, "//counts": 1, "strings": 1, "//removes": 1, "any": 4, "nulls": 1, "from": 24, "//returns": 2, "singleton": 2, "//contains": 2, "information": 1, "caninfo": 2, "path": 8, "//physical": 1, "internalname": 1, "//a": 1, "numfiles": 1, "files": 6, "//necessary": 1, "use": 5, "canfile": 7, "//this": 1, "holds": 2, "within": 2, "//canister": 1, "canister*": 1, "parent": 1, "that": 7, "//internal": 1, "//use": 1, "their": 1, "own.": 1, "newline": 2, "delimited": 2, "container.": 1, "TOC": 1, "info": 2, "general": 1, "canfiles": 1, "recommended": 1, "programs": 1, "modify": 1, "//these": 1, "directly": 1, "enforced.": 1, "canfile*": 1, "readonly": 3, "//if": 1, "then": 3, "no": 1, "write": 1, "routines": 1, "will": 1, "anything": 1, "//maximum": 1, "have": 3, "//time": 1, "change": 1, "whatever": 1, "suits": 1, "your": 4, "application.": 1, "cachemax": 2, "cachecnt": 1, "//number": 1, "cache": 2, "modified": 1, "//both": 1, "initialize": 6, "physical": 1, "location": 5, "fspath": 3, "//destroys": 1, "after": 2, "flushing": 1, "modded": 1, "buffers": 2, "course": 1, "//open": 1, "//does": 1, "exist": 2, "//close": 1, "flush": 1, "clean": 2, "//deletes": 1, "inside": 1, "delFile": 1, "//pulls": 1, "contents": 2, "returns": 2, "getFile": 1, "does": 1, "otherwise": 1, "overwrites": 1, "succeeded": 2, "writeFile": 2, "//get": 1, "containing": 1, "//list": 1, "paths": 1, "getTOC": 1, "//brings": 1, "back": 1, "limit": 1, "//important": 1, "sCFID": 2, "safe": 1, "CFID": 2, "we": 9, "want": 2, "uncaching": 1, "//really": 1, "just": 2, "internally": 1, "harm.": 1, "cacheclean": 1, "dFlush": 1, "Q_OS_LINUX": 2, "": 1, "QT_VERSION": 1, "QT_VERSION_CHECK": 1, "#error": 9, "Something": 1, "wrong": 1, "setup.": 1, "Please": 3, "report": 4, "mailing": 1, "argc": 2, "char**": 2, "argv": 2, "google_breakpad": 1, "ExceptionHandler": 1, "eh": 1, "Utils": 4, "exceptionHandler": 2, "qInstallMsgHandler": 1, "messageHandler": 2, "QApplication": 1, "app": 5, "STATIC_BUILD": 1, "Q_INIT_RESOURCE": 2, "WebKit": 1, "InspectorBackendStub": 1, "app.setWindowIcon": 1, "QIcon": 1, "app.setApplicationName": 1, "app.setOrganizationName": 1, "app.setOrganizationDomain": 1, "app.setApplicationVersion": 1, "PHANTOMJS_VERSION_STRING": 1, "Phantom": 1, "phantom": 1, "phantom.execute": 1, "app.exec": 1, "phantom.returnValue": 1, "__OG_MATH_INL__": 2, "og": 1, "OG_INLINE": 41, "Math": 41, "Abs": 1, "MASK_SIGNED": 2, "Fabs": 1, "uInt": 1, "*pf": 1, "reinterpret_cast": 8, "": 1, "pf": 1, "fabsf": 1, "Round": 1, "floorf": 2, "Floor": 1, "Ceil": 1, "ceilf": 1, "Ftoi": 1, "@todo": 1, "needs": 1, "testing": 1, "note": 1, "sse": 1, "function": 3, "cvttss2si": 2, "OG_ASM_MSVC": 4, "OG_FTOI_USE_SSE": 2, "SysInfo": 2, "cpu.general.SSE": 2, "__asm": 8, "eax": 5, "mov": 6, "fld": 4, "fistp": 3, "//__asm": 3, "need": 3, "O_o": 3, "#elif": 7, "OG_ASM_GNU": 4, "__asm__": 4, "__volatile__": 4, "cast": 7, "instead": 3, "why": 3, "did": 3, "FtoiFast": 2, "Ftol": 1, "": 1, "Fmod": 1, "numerator": 2, "denominator": 2, "fmodf": 1, "Modf": 2, "modff": 2, "Sqrt": 2, "sqrtf": 2, "InvSqrt": 1, "OG_ASSERT": 4, "RSqrt": 1, "*reinterpret_cast": 3, "guess": 1, "Newtons": 1, "calculation": 1, "Log": 1, "logf": 3, "Log2": 1, "INV_LN_2": 1, "Log10": 1, "INV_LN_10": 1, "Pow": 1, "exp": 2, "powf": 1, "Exp": 1, "expf": 1, "IsPowerOfTwo": 4, "faster": 3, "two": 1, "known": 1, "methods": 1, "moved": 1, "beginning": 1, "HigherPowerOfTwo": 4, "LowerPowerOfTwo": 2, "FloorPowerOfTwo": 1, "CeilPowerOfTwo": 1, "ClosestPowerOfTwo": 1, "high": 4, "low": 3, "Digits": 1, "step": 3, "Sin": 2, "sinf": 1, "ASin": 1, "<=>": 3, "0f": 2, "HALF_PI": 2, "asinf": 1, "Cos": 2, "cosf": 1, "ACos": 1, "PI": 1, "acosf": 1, "Tan": 1, "tanf": 1, "ATan": 2, "atanf": 1, "f1": 2, "f2": 2, "atan2f": 1, "SinCos": 1, "sometimes": 1, "assembler": 1, "waaayy": 1, "_asm": 1, "fsincos": 1, "ecx": 2, "edx": 2, "fstp": 2, "dword": 2, "asm": 1, "than": 1, "calling": 1, "Deg2Rad": 1, "DEG_TO_RAD": 1, "Rad2Deg": 1, "RAD_TO_DEG": 1, "Square": 1, "v": 16, "Cube": 1, "Sec2Ms": 1, "sec": 2, "Ms2Sec": 1, "ms": 2, "Memory16F88": 2, "map": 2, "": 1, "MemoryLocation": 1, "memoryMap": 1, "Dereference": 1, "bank": 2, "*Reference": 1, "*operator": 1, "NINJA_METRICS_H_": 3, "For": 1, "int64_t.": 1, "The": 3, "Metrics": 2, "module": 1, "debug": 1, "dumps": 1, "timing": 2, "stats": 2, "various": 1, "actions.": 1, "To": 1, "see": 1, "METRIC_RECORD": 4, "below.": 1, "single": 1, "metrics": 2, "ve": 2, "hit": 1, "code": 2, "path.": 2, "count": 1, "Total": 1, "micros": 1, "spent": 1, "int64_t": 4, "sum": 1, "scoped": 1, "recording": 1, "metric": 2, "across": 1, "body": 1, "function.": 2, "macro.": 1, "ScopedMetric": 4, "Metric*": 4, "metric_": 1, "Timestamp": 1, "when": 1, "measurement": 1, "started.": 1, "platform": 1, "dependent.": 1, "start_": 1, "prints": 1, "report.": 1, "NewMetric": 2, "Print": 1, "summary": 2, "stdout.": 1, "Report": 1, "": 1, "metrics_": 1, "Get": 1, "relative": 1, "some": 1, "epoch.": 1, "Epoch": 1, "varies": 1, "between": 1, "platforms": 1, "useful": 1, "measuring": 1, "elapsed": 1, "time.": 1, "GetTimeMillis": 1, "simple": 1, "stopwatch": 1, "seconds": 1, "since": 2, "Restart": 3, "called.": 1, "Stopwatch": 2, "started_": 4, "Seconds": 1, "call.": 1, "Elapsed": 1, "Now": 3, "uint64_t": 4, "primary": 1, "interface": 1, "metrics.": 1, "top": 1, "get": 1, "recorded": 1, "each": 1, "call": 1, "metrics_h_metric": 2, "g_metrics": 3, "metrics_h_scoped": 1, "Metrics*": 1, "": 1, "": 2, "": 3, "": 1, "BPackageKit": 2, "BPackageInfo": 7, "ParseErrorListener": 2, "Parser": 7, "ParseErrorListener*": 1, "listener": 2, "fListener": 13, "fPos": 15, "status_t": 3, "Parse": 1, "BString": 3, "packageInfoString": 1, "BPackageInfo*": 1, "packageInfo": 3, "B_BAD_VALUE": 1, "packageInfoString.String": 2, "try": 3, "_Parse": 1, "catch": 6, "ParseError": 3, "column": 6, "inLineOffset": 5, "int32": 4, "offset": 8, "error.pos": 4, "newlinePos": 6, "packageInfoString.FindLast": 2, "OnError": 6, "error.message": 3, "B_BAD_DATA": 3, "bad_alloc": 3, "B_NO_MEMORY": 3, "B_OK": 3, "ParseVersion": 1, "versionString": 1, "revisionIsOptional": 2, "BPackageVersion": 1, "_version": 2, "versionString.String": 2, "TOKEN_STRING": 2, "versionString.Length": 1, "_ParseVersionValue": 1, "ParseResolvableExpression": 1, "expressionString": 1, "BPackageResolvableExpression": 1, "_expression": 2, "expressionString.String": 2, "expressionString.Length": 1, "_ParseResolvableExpression": 1, "_NextToken": 2, "Eat": 1, "whitespace": 1, "comments": 1, "escaped": 1, "lines.": 1, "Also": 1, "eat": 1, "they": 1, "same": 1, "newlines.": 1, "We": 2, "remember": 1, "last": 1, "encountered": 1, "afterwards.": 1, "itemSeparatorPos": 1, "inComment": 2, "*fPos": 4, "isspace": 1, "#": 1, "<':>": 1, "TOKEN_OPERATOR_LESS_EQUAL": 1, "tokenPos": 5, "2": 4, "TOKEN_OPERATOR_LESS": 1, "TOKEN_OPERATOR_EQUAL": 1, "TOKEN_OPERATOR_ASSIGN": 1, "TOKEN_OPERATOR_NOT_EQUAL": 1, "<=',>": 1, "approve_license": 1, "system_package": 1, "included": 1, "real": 3, "home": 1, "shell": 1, "groups": 1, "already": 1, "seen": 1, "invalid": 6, "package": 1, "contains": 1, "linebreaks": 1, "set": 2, "anywhere": 1, "url": 4, "pos": 22, "": 1, "": 1, "": 2, "": 1, "ll": 1, "mod": 1, "pb": 1, "push_back": 1, "r2": 5, "m": 7, "dfs": 5, "graph": 13, "//cout": 1, "point": 4, "cc": 4, "stack": 1, "": 1, "st": 2, "search": 2, "t.r": 4, "t.c": 4, "st.push": 4, "st.empty": 1, "st.top": 1, "st.pop": 1, "u.r": 1, "u.c": 1, "<(m-1)){>": 1, "r=": 1, "c=": 1, "ios": 1, "sync_with_stdio": 1, "ifdef": 1, "freopen": 1, "input": 7, "txt": 1, "stdin": 1, "endif": 1, "cin": 4, "temp": 5, "": 1, "graph.pb": 1, "r1": 5, "INTERNAL_SUPPRESS_PROTOBUF_FIELD_DEPRECATION": 1, "": 2, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "persons": 4, "google": 72, "protobuf": 72, "Descriptor*": 3, "Person_descriptor_": 6, "internal": 45, "GeneratedMessageReflection*": 1, "Person_reflection_": 4, "protobuf_AssignDesc_protocol_2dbuffer_2eproto": 4, "protobuf_AddDesc_protocol_2dbuffer_2eproto": 6, "FileDescriptor*": 1, "DescriptorPool": 3, "generated_pool": 2, "FindFileByName": 1, "GOOGLE_CHECK": 1, "message_type": 1, "Person_offsets_": 2, "GOOGLE_PROTOBUF_GENERATED_MESSAGE_FIELD_OFFSET": 3, "Person": 65, "name_": 30, "GeneratedMessageReflection": 1, "default_instance_": 8, "_has_bits_": 14, "_unknown_fields_": 5, "MessageFactory": 3, "generated_factory": 1, "GOOGLE_PROTOBUF_DECLARE_ONCE": 1, "protobuf_AssignDescriptors_once_": 2, "protobuf_AssignDescriptorsOnce": 4, "GoogleOnceInit": 1, "protobuf_RegisterTypes": 2, "InternalRegisterGeneratedMessage": 1, "default_instance": 3, "protobuf_ShutdownFile_protocol_2dbuffer_2eproto": 4, "delete": 6, "already_here": 3, "GOOGLE_PROTOBUF_VERIFY_VERSION": 1, "InternalAddGeneratedFile": 1, "InternalRegisterGeneratedFile": 1, "InitAsDefaultInstance": 3, "OnShutdown": 1, "StaticDescriptorInitializer_protocol_2dbuffer_2eproto": 2, "static_descriptor_initializer_protocol_2dbuffer_2eproto_": 1, "kNameFieldNumber": 2, "Message": 7, "SharedCtor": 4, "MergeFrom": 9, "_cached_size_": 7, "const_cast": 3, "string*": 11, "kEmptyString": 12, "memset": 2, "SharedDtor": 3, "SetCachedSize": 2, "GOOGLE_SAFE_CONCURRENT_WRITES_BEGIN": 2, "GOOGLE_SAFE_CONCURRENT_WRITES_END": 2, "*default_instance_": 1, "Person*": 7, "New": 4, "Clear": 5, "has_name": 6, "clear": 2, "mutable_unknown_fields": 4, "MergePartialFromCodedStream": 2, "io": 4, "CodedInputStream*": 2, "DO_": 4, "EXPRESSION": 2, "uint32": 2, "tag": 6, "ReadTag": 1, "WireFormatLite": 9, "GetTagFieldNumber": 1, "GetTagWireType": 2, "WIRETYPE_LENGTH_DELIMITED": 1, "ReadString": 1, "mutable_name": 3, "WireFormat": 10, "VerifyUTF8String": 3, ".data": 3, ".length": 3, "PARSE": 1, "handle_uninterpreted": 2, "ExpectAtEnd": 1, "WIRETYPE_END_GROUP": 1, "SkipField": 1, "SerializeWithCachedSizes": 2, "CodedOutputStream*": 2, "SERIALIZE": 2, "WriteString": 1, "unknown_fields": 7, "SerializeUnknownFields": 1, "uint8*": 4, "SerializeWithCachedSizesToArray": 2, "target": 6, "WriteStringToArray": 1, "SerializeUnknownFieldsToArray": 1, "ByteSize": 2, "total_size": 5, "StringSize": 1, "ComputeUnknownFieldsSize": 1, "GOOGLE_CHECK_NE": 2, "source": 9, "dynamic_cast_if_available": 1, "": 12, "ReflectionOps": 1, "Merge": 1, "from._has_bits_": 1, "from.has_name": 1, "set_name": 7, "from.name": 1, "from.unknown_fields": 1, "CopyFrom": 5, "IsInitialized": 3, "Swap": 2, "swap": 3, "_unknown_fields_.Swap": 1, "Metadata": 3, "GetMetadata": 2, "metadata": 2, "metadata.descriptor": 1, "metadata.reflection": 1, "PROTOBUF_protocol_2dbuffer_2eproto__INCLUDED": 3, "GOOGLE_PROTOBUF_VERSION": 1, "generated": 2, "newer": 2, "protoc": 2, "incompatible": 2, "Protocol": 2, "headers.": 3, "GOOGLE_PROTOBUF_MIN_PROTOC_VERSION": 1, "older": 1, "regenerate": 1, "protoc.": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "*this": 1, "UnknownFieldSet": 2, "UnknownFieldSet*": 1, "GetCachedSize": 1, "clear_name": 2, "release_name": 2, "set_allocated_name": 2, "set_has_name": 7, "clear_has_name": 5, "mutable": 1, "*name_": 1, "assign": 3, "SWIG": 2, "": 2, "Gui": 1, "rpc_init": 1, "rpc_server_loop": 1, "v8": 9, "Scanner": 16, "UnicodeCache*": 4, "unicode_cache": 3, "unicode_cache_": 10, "octal_pos_": 5, "harmony_scoping_": 4, "harmony_modules_": 4, "Initialize": 4, "Utf16CharacterStream*": 3, "source_": 7, "Init": 3, "has_line_terminator_before_next_": 9, "SkipWhiteSpace": 4, "Scan": 5, "uc32": 19, "ScanHexNumber": 2, "expected_length": 4, "ASSERT": 17, "prevent": 1, "overflow": 1, "c0_": 64, "HexValue": 2, "PushBack": 8, "Advance": 44, "STATIC_ASSERT": 5, "NUM_TOKENS": 1, "byte": 1, "one_char_tokens": 2, "ILLEGAL": 120, "LPAREN": 2, "RPAREN": 2, "COMMA": 2, "COLON": 2, "SEMICOLON": 2, "CONDITIONAL": 2, "LBRACK": 2, "RBRACK": 2, "LBRACE": 2, "RBRACE": 2, "BIT_NOT": 2, "Next": 3, "has_multiline_comment_before_next_": 5, "": 1, "source_pos": 10, "next_.token": 3, "next_.location.beg_pos": 3, "next_.location.end_pos": 4, "current_.token": 4, "IsByteOrderMark": 2, "start_position": 2, "IsWhiteSpace": 2, "IsLineTerminator": 6, "SkipSingleLineComment": 6, "undo": 4, "WHITESPACE": 6, "SkipMultiLineComment": 3, "ScanHtmlComment": 3, "LT": 2, "next_.literal_chars": 13, "ScanString": 3, "Select": 32, "LTE": 1, "ASSIGN_SHL": 1, "SHL": 1, "GTE": 1, "ASSIGN_SAR": 1, "ASSIGN_SHR": 1, "SHR": 1, "SAR": 1, "GT": 1, "EQ_STRICT": 1, "EQ": 1, "ASSIGN": 1, "NE_STRICT": 1, "NE": 1, "INC": 1, "ASSIGN_ADD": 1, "ADD": 1, "DEC": 1, "ASSIGN_SUB": 1, "SUB": 1, "ASSIGN_MUL": 1, "MUL": 1, "ASSIGN_MOD": 1, "MOD": 1, "ASSIGN_DIV": 1, "DIV": 1, "AND": 1, "ASSIGN_BIT_AND": 1, "BIT_AND": 1, "OR": 1, "ASSIGN_BIT_OR": 1, "BIT_OR": 1, "ASSIGN_BIT_XOR": 1, "BIT_XOR": 1, "IsDecimalDigit": 2, "ScanNumber": 3, "PERIOD": 1, "IsIdentifierStart": 2, "ScanIdentifierOrKeyword": 2, "EOS": 1, "SeekForward": 4, "current_pos": 4, "ASSERT_EQ": 1, "ScanEscape": 2, "IsCarriageReturn": 2, "IsLineFeed": 2, "fall": 2, "xx": 1, "xxx": 1, "immediately": 1, "because": 1, "octal": 1, "quote": 3, "consume": 2, "LiteralScope": 4, "literal": 2, "X": 2, "l": 1, "p": 5, "w": 1, "keyword": 1, "valid": 1, "has": 1, "Unescaped": 1, "character.": 1, "in_character_class": 2, "AddLiteralCharAdvance": 3, "literal.Complete": 2, "ScanLiteralUnicodeEscape": 3, "V8_SCANNER_H_": 3, "ParsingFlags": 1, "kNoParsingFlags": 1, "kLanguageModeMask": 4, "kAllowLazy": 1, "kAllowNativesSyntax": 1, "kAllowModules": 1, "CLASSIC_MODE": 2, "STRICT_MODE": 2, "EXTENDED_MODE": 2, "detect": 1, "x16": 1, "x36.": 1, "Utf16CharacterStream": 3, "pos_": 6, "buffer_cursor_": 5, "buffer_end_": 3, "ReadBlock": 2, "": 1, "kEndOfInput": 2, "code_unit_count": 7, "buffered_chars": 2, "SlowSeekForward": 2, "int32_t": 1, "code_unit": 6, "uc16*": 3, "UnicodeCache": 3, "unibrow": 11, "Utf8InputBuffer": 2, "<1024>": 2, "Utf8Decoder": 2, "StaticResource": 2, "": 2, "utf8_decoder": 1, "utf8_decoder_": 2, "uchar": 4, "kIsIdentifierStart.get": 1, "IsIdentifierPart": 1, "kIsIdentifierPart.get": 1, "kIsLineTerminator.get": 1, "kIsWhiteSpace.get": 1, "Predicate": 4, "": 1, "128": 4, "kIsIdentifierStart": 1, "": 1, "kIsIdentifierPart": 1, "": 1, "kIsLineTerminator": 1, "": 1, "kIsWhiteSpace": 1, "DISALLOW_COPY_AND_ASSIGN": 2, "LiteralBuffer": 6, "is_ascii_": 10, "position_": 17, "backing_store_": 7, "backing_store_.length": 4, "backing_store_.Dispose": 3, "INLINE": 2, "AddChar": 2, "ExpandBuffer": 2, "kMaxAsciiCharCodeU": 1, "": 6, "kASCIISize": 1, "ConvertToUtf16": 2, "": 2, "kUC16Size": 2, "is_ascii": 3, "Vector": 13, "uc16": 5, "utf16_literal": 3, "backing_store_.start": 5, "ascii_literal": 3, "kInitialCapacity": 2, "kGrowthFactory": 2, "kMinConversionSlack": 1, "kMaxGrowth": 2, "MB": 1, "NewCapacity": 3, "min_capacity": 2, "capacity": 3, "Max": 1, "new_capacity": 2, "Min": 1, "new_store": 6, "new_store.start": 3, "new_content_size": 4, "src": 2, "": 1, "dst": 2, "Scanner*": 2, "self": 5, "scanner_": 5, "complete_": 4, "StartLiteral": 2, "DropLiteral": 2, "Complete": 1, "TerminateLiteral": 2, "beg_pos": 5, "end_pos": 4, "kNoOctalLocation": 1, "scanner_contants": 1, "current_token": 1, "current_.location": 2, "literal_ascii_string": 1, "ASSERT_NOT_NULL": 9, "current_.literal_chars": 11, "literal_utf16_string": 1, "is_literal_ascii": 1, "literal_length": 1, "literal_contains_escapes": 1, "source_length": 3, "location.end_pos": 1, "location.beg_pos": 1, "STRING": 1, "peek": 1, "peek_location": 1, "next_.location": 1, "next_literal_ascii_string": 1, "next_literal_utf16_string": 1, "is_next_literal_ascii": 1, "next_literal_length": 1, "kCharacterLookaheadBufferSize": 3, "ScanOctalEscape": 1, "octal_position": 1, "clear_octal_position": 1, "HarmonyScoping": 1, "SetHarmonyScoping": 1, "scoping": 2, "HarmonyModules": 1, "SetHarmonyModules": 1, "modules": 2, "HasAnyLineTerminatorBeforeNext": 1, "ScanRegExpPattern": 1, "seen_equal": 1, "ScanRegExpFlags": 1, "IsIdentifier": 1, "CharacterStream*": 1, "TokenDesc": 3, "LiteralBuffer*": 2, "literal_chars": 1, "free_buffer": 3, "literal_buffer1_": 3, "literal_buffer2_": 2, "AddLiteralChar": 2, "tok": 2, "else_": 2, "ScanDecimalDigits": 1, "seen_period": 1, "ScanIdentifierSuffix": 1, "LiteralScope*": 1, "ScanIdentifierUnicodeEscape": 1, "desc": 2, "returned": 1, "one": 2, "look": 1, "ahead": 1, "": 1, "SRS_AUTO_INGEST": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "SRS_AUTO_INGESTER_SLEEP_US": 2, "*1000*1000LL": 1, "SrsIngesterFFMPEG": 16, "ffmpeg": 23, "srs_freep": 9, "SrsFFMPEG*": 4, "ff": 2, "ERROR_SUCCESS": 31, "vhost": 30, "starttime": 2, "srs_get_system_time_ms": 2, "uri": 4, "alive": 2, "equals": 4, "start": 5, "stop": 7, "cycle": 4, "fast_stop": 3, "SrsIngester": 20, "_srs_config": 20, "subscribe": 1, "pthread": 5, "SrsReusableThread": 1, "pprint": 4, "SrsPithyPrint": 1, "create_ingester": 1, "unsubscribe": 1, "clear_engines": 4, "srs_error": 6, "srs_trace": 14, "cid": 1, "_srs_context": 1, "get_id": 1, "parse_ingesters": 3, "SrsConfDirective*": 12, "": 3, "ingesters": 4, "get_ingesters": 1, "arg0": 16, "ingesters.size": 3, "ingest": 21, "parse_engines": 3, "get_ingest_enabled": 1, "ffmpeg_bin": 3, "get_ingest_ffmpeg": 1, "ffmpeg_bin.empty": 1, "ERROR_ENCODER_PARSE": 1, "engines": 2, "get_transcode_engines": 1, "engines.empty": 1, "SrsFFMPEG": 2, "initialize_ffmpeg": 3, "ERROR_ENCODER_LOOP": 2, "SrsIngesterFFMPEG*": 7, "ingester": 29, "ingesters.push_back": 2, "engines.size": 1, "engine": 10, ".c_str": 12, "dispose": 1, "": 5, "iterator": 5, "ingesters.begin": 5, "ingesters.end": 5, "*it": 5, "ingesters.empty": 1, "show_ingest_log_message": 2, "on_thread_stop": 1, "ingesters.clear": 1, "vhosts": 3, "get_vhosts": 1, "vhosts.size": 1, "port": 3, "": 1, "ip_ports": 2, "get_listens": 1, "srs_assert": 1, "ip_ports.size": 1, "ep": 2, "ip": 2, "srs_parse_endpoint": 1, "get_engine_output": 1, "srs_string_replace": 2, "output.empty": 1, "ERROR_ENCODER_NO_OUTPUT": 1, "npos": 4, "url.rfind": 2, "url.substr": 4, "app.rfind": 1, "app.substr": 1, "log_file": 13, "SRS_CONSTS_NULL_FILE": 1, "disabled": 1, "get_ffmpeg_log_enabled": 1, "get_ffmpeg_log_dir": 1, "input_type": 3, "get_ingest_input_type": 1, "input_type.empty": 1, "ERROR_ENCODER_NO_INPUT": 3, "srs_config_ingest_is_file": 1, "input_url": 4, "get_ingest_input_url": 2, "input_url.empty": 2, "set_iparams": 2, "srs_config_ingest_is_stream": 1, "ERROR_ENCODER_INPUT_TYPE": 1, "input_type.c_str": 1, "set_oformat": 1, "vcodec": 1, "get_engine_vcodec": 1, "acodec": 1, "get_engine_acodec": 1, "engine_disabled": 2, "get_engine_enabled": 1, "vcodec.empty": 1, "acodec.empty": 1, "initialize_copy": 1, "initialize_transcode": 1, "elapse": 1, "0": 1, "random": 2, "choose": 1, "rand": 1, "reportable": 1, "can_print": 1, "SRS_CONSTS_LOG_INGESTER": 1, "PRId64": 1, "age": 1, "on_reload_vhost_added": 1, "_vhost": 4, "get_vhost": 2, "vhost.c_str": 5, "on_reload_vhost_removed": 1, "ingesters.erase": 2, "on_reload_ingest_removed": 2, "ingest_id": 7, "on_reload_ingest_added": 2, "_ingester": 2, "get_ingest_by_id": 1, "ingest_id.c_str": 2, "on_reload_ingest_updated": 1, "__THREADED_QUEUE_H__": 2, "": 1, "": 1, "T": 2, "ThreadedQueue": 3, "": 2, "pthread_mutex_t": 1, "queueMutex": 8, "pthread_cond_t": 1, "queueCond": 5, "pthread_mutexattr_t": 1, "mutexAttrs": 5, "pthread_condattr_t": 1, "condAttrs": 5, "pthread_mutexattr_init": 1, "pthread_mutexattr_settype": 1, "PTHREAD_MUTEX_ERRORCHECK": 1, "pthread_mutex_init": 1, "pthread_mutexattr_destroy": 1, "pthread_condattr_init": 1, "pthread_condattr_setpshared": 1, "PTHREAD_PROCESS_PRIVATE": 1, "pthread_cond_init": 1, "pthread_condattr_destroy": 1, "pthread_cond_destroy": 1, "pthread_mutex_destroy": 1, "waitItems": 1, "pthread_mutex_lock": 2, "pthread_cond_wait": 1, "pthread_mutex_unlock": 2, "signalItems": 2, "pthread_cond_broadcast": 1, "item": 2, "smallPrime_t": 1, "UTILS_H": 3, "": 1, "": 1, "": 1, "QTemporaryFile": 1, "showUsage": 1, "QtMsgType": 1, "dump_path": 1, "minidump_id": 1, "context": 8, "QVariant": 1, "coffee2js": 1, "script": 1, "injectJsInFrame": 2, "jsFilePath": 5, "libraryPath": 5, "QWebFrame": 4, "*targetFrame": 4, "startingScript": 2, "Encoding": 3, "jsFileEnc": 2, "readResourceFileUtf8": 1, "resourceFilePath": 1, "loadJSForDebug": 2, "autorun": 2, "cleanupFromDebug": 1, "findScript": 1, "jsFromScriptFile": 1, "scriptPath": 1, "enc": 1, "shouldn": 1, "instantiated": 1, "QTemporaryFile*": 2, "m_tempHarness": 1, "make": 1, "ourselves": 1, "m_tempWrapper": 1, "V8_DECLARE_ONCE": 1, "init_once": 2, "V8": 21, "is_running_": 6, "has_been_set_up_": 4, "has_been_disposed_": 6, "has_fatal_error_": 5, "use_crankshaft_": 6, "List": 3, "": 3, "call_completed_callbacks_": 16, "LazyMutex": 1, "entropy_mutex": 1, "LAZY_MUTEX_INITIALIZER": 1, "EntropySource": 3, "entropy_source": 4, "Deserializer*": 2, "des": 3, "FlagList": 1, "EnforceFlagImplications": 1, "InitializeOncePerProcess": 4, "Isolate": 9, "CurrentPerIsolateThreadData": 4, "EnterDefaultIsolate": 1, "thread_id": 1, ".Equals": 1, "ThreadId": 1, "Current": 5, "isolate": 15, "IsDead": 2, "Isolate*": 6, "SetFatalError": 2, "TearDown": 5, "IsDefaultIsolate": 1, "ElementsAccessor": 2, "LOperand": 2, "TearDownCaches": 1, "RegisteredExtension": 1, "UnregisterAll": 1, "OS": 3, "seed_random": 2, "uint32_t*": 2, "FLAG_random_seed": 2, "ScopedLock": 1, "entropy_mutex.Pointer": 1, "random_base": 3, "SetEntropySource": 2, "SetReturnAddressLocationResolver": 3, "ReturnAddressLocationResolver": 2, "resolver": 3, "StackFrame": 1, "Random": 3, "Context*": 4, "IsGlobalContext": 1, "ByteArray*": 1, "seed": 2, "random_seed": 1, "": 1, "GetDataStartAddress": 1, "RandomPrivate": 2, "private_random_seed": 1, "IdleNotification": 3, "hint": 3, "FLAG_use_idle_notification": 1, "HEAP": 1, "AddCallCompletedCallback": 2, "CallCompletedCallback": 4, "callback": 7, "Lazy": 1, "init.": 1, "Add": 1, "RemoveCallCompletedCallback": 2, "Remove": 1, "FireCallCompletedCallback": 2, "HandleScopeImplementer*": 1, "handle_scope_implementer": 5, "CallDepthIsZero": 1, "IncrementCallDepth": 1, "DecrementCallDepth": 1, "union": 1, "double_value": 1, "uint64_t_value": 1, "double_int_union": 2, "Object*": 4, "FillHeapNumberWithRandom": 2, "heap_number": 4, "random_bits": 2, "binary_million": 3, "r.double_value": 3, "r.uint64_t_value": 1, "HeapNumber": 1, "set_value": 1, "InitializeOncePerProcessImpl": 3, "SetUp": 4, "FLAG_crankshaft": 1, "Serializer": 1, "enabled": 1, "CPU": 2, "SupportsCrankshaft": 1, "PostSetUp": 1, "RuntimeProfiler": 1, "GlobalSetUp": 1, "FLAG_stress_compaction": 1, "FLAG_force_marking_deque_overflows": 1, "FLAG_gc_global": 1, "FLAG_max_new_space_size": 1, "kPageSizeBits": 1, "SetUpCaches": 1, "SetUpJSCallerSavedCodeData": 1, "SamplerRegistry": 1, "ExternalReference": 1, "CallOnce": 1, "V8_V8_H_": 3, "GOOGLE3": 2, "NDEBUG": 4, "both": 1, "Deserializer": 1, "AllStatic": 1, "IsRunning": 1, "UseCrankshaft": 1, "FatalProcessOutOfMemory": 1, "take_snapshot": 1, "NilValue": 1, "kNullValue": 1, "kUndefinedValue": 1, "EqualityKind": 1, "kStrictEquality": 1, "kNonStrictEquality": 1, "PY_SSIZE_T_CLEAN": 1, "Py_PYTHON_H": 1, "Python": 1, "headers": 1, "compile": 1, "C": 1, "extensions": 1, "please": 1, "install": 1, "development": 1, "Python.": 1, "": 1, "offsetof": 2, "member": 2, "type*": 1, "MS_WINDOWS": 2, "__stdcall": 2, "__cdecl": 2, "__fastcall": 2, "DL_IMPORT": 2, "DL_EXPORT": 2, "PY_LONG_LONG": 5, "LONG_LONG": 1, "PY_VERSION_HEX": 9, "METH_COEXIST": 1, "PyDict_CheckExact": 1, "Py_TYPE": 4, "PyDict_Type": 1, "PyDict_Contains": 1, "o": 20, "PySequence_Contains": 1, "Py_ssize_t": 17, "PY_SSIZE_T_MAX": 1, "INT_MAX": 1, "PY_SSIZE_T_MIN": 1, "INT_MIN": 1, "PY_FORMAT_SIZE_T": 1, "PyInt_FromSsize_t": 2, "z": 46, "PyInt_FromLong": 13, "PyInt_AsSsize_t": 2, "PyInt_AsLong": 2, "PyNumber_Index": 1, "PyNumber_Int": 1, "PyIndex_Check": 1, "PyNumber_Check": 1, "PyErr_WarnEx": 1, "category": 2, "stacklevel": 1, "PyErr_Warn": 1, "Py_REFCNT": 1, "ob": 6, "PyObject*": 16, "ob_refcnt": 1, "ob_type": 7, "Py_SIZE": 1, "PyVarObject*": 1, "ob_size": 1, "PyVarObject_HEAD_INIT": 1, "PyObject_HEAD_INIT": 1, "PyType_Modified": 1, "*buf": 1, "PyObject": 221, "*obj": 2, "len": 1, "itemsize": 2, "ndim": 2, "*format": 1, "*shape": 1, "*strides": 1, "*suboffsets": 1, "*internal": 1, "Py_buffer": 5, "PyBUF_SIMPLE": 1, "PyBUF_WRITABLE": 1, "PyBUF_FORMAT": 1, "PyBUF_ND": 2, "PyBUF_STRIDES": 5, "PyBUF_C_CONTIGUOUS": 3, "PyBUF_F_CONTIGUOUS": 3, "PyBUF_ANY_CONTIGUOUS": 1, "PyBUF_INDIRECT": 1, "PY_MAJOR_VERSION": 10, "__Pyx_BUILTIN_MODULE_NAME": 2, "Py_TPFLAGS_CHECKTYPES": 1, "Py_TPFLAGS_HAVE_INDEX": 1, "Py_TPFLAGS_HAVE_NEWBUFFER": 1, "PyBaseString_Type": 1, "PyUnicode_Type": 2, "PyStringObject": 2, "PyUnicodeObject": 1, "PyString_Type": 2, "PyString_Check": 2, "PyUnicode_Check": 1, "PyString_CheckExact": 2, "PyUnicode_CheckExact": 1, "PyBytesObject": 1, "PyBytes_Type": 1, "PyBytes_Check": 1, "PyBytes_CheckExact": 1, "PyBytes_FromString": 2, "PyString_FromString": 1, "PyBytes_FromStringAndSize": 1, "PyString_FromStringAndSize": 1, "PyBytes_FromFormat": 1, "PyString_FromFormat": 1, "PyBytes_DecodeEscape": 1, "PyString_DecodeEscape": 1, "PyBytes_AsString": 2, "PyString_AsString": 1, "PyBytes_AsStringAndSize": 1, "PyString_AsStringAndSize": 1, "PyBytes_Size": 1, "PyString_Size": 1, "PyBytes_AS_STRING": 1, "PyString_AS_STRING": 1, "PyBytes_GET_SIZE": 1, "PyString_GET_SIZE": 1, "PyBytes_Repr": 1, "PyString_Repr": 1, "PyBytes_Concat": 1, "PyString_Concat": 1, "PyBytes_ConcatAndDel": 1, "PyString_ConcatAndDel": 1, "PySet_Check": 1, "obj": 42, "PyObject_TypeCheck": 3, "PySet_Type": 2, "PyFrozenSet_Check": 1, "PyFrozenSet_Type": 1, "PySet_CheckExact": 2, "__Pyx_TypeCheck": 1, "PyTypeObject": 2, "PyIntObject": 1, "PyLongObject": 2, "PyInt_Type": 1, "PyLong_Type": 1, "PyInt_Check": 1, "PyLong_Check": 1, "PyInt_CheckExact": 1, "PyLong_CheckExact": 1, "PyInt_FromString": 1, "PyLong_FromString": 1, "PyInt_FromUnicode": 1, "PyLong_FromUnicode": 1, "PyLong_FromLong": 1, "PyInt_FromSize_t": 1, "PyLong_FromSize_t": 1, "PyLong_FromSsize_t": 1, "PyLong_AsLong": 1, "PyInt_AS_LONG": 1, "PyLong_AS_LONG": 1, "PyLong_AsSsize_t": 1, "PyInt_AsUnsignedLongMask": 1, "PyLong_AsUnsignedLongMask": 1, "PyInt_AsUnsignedLongLongMask": 1, "PyLong_AsUnsignedLongLongMask": 1, "PyBoolObject": 1, "__Pyx_PyNumber_Divide": 2, "PyNumber_TrueDivide": 1, "__Pyx_PyNumber_InPlaceDivide": 2, "PyNumber_InPlaceTrueDivide": 1, "PyNumber_Divide": 1, "PyNumber_InPlaceDivide": 1, "__Pyx_PySequence_GetSlice": 2, "PySequence_GetSlice": 2, "__Pyx_PySequence_SetSlice": 2, "PySequence_SetSlice": 2, "__Pyx_PySequence_DelSlice": 2, "PySequence_DelSlice": 2, "unlikely": 69, "PyErr_SetString": 4, "PyExc_SystemError": 3, "likely": 15, "tp_as_mapping": 3, "PyErr_Format": 4, "PyExc_TypeError": 5, "tp_name": 4, "PyMethod_New": 2, "func": 3, "klass": 1, "PyInstanceMethod_New": 1, "__Pyx_GetAttrString": 2, "PyObject_GetAttrString": 3, "__Pyx_SetAttrString": 2, "PyObject_SetAttrString": 2, "__Pyx_DelAttrString": 2, "PyObject_DelAttrString": 2, "__Pyx_NAMESTR": 3, "__Pyx_DOCSTR": 3, "__cplusplus": 10, "__PYX_EXTERN_C": 2, "_USE_MATH_DEFINES": 1, "": 1, "__PYX_HAVE_API__wrapper_inner": 1, "PYREX_WITHOUT_ASSERTIONS": 1, "CYTHON_WITHOUT_ASSERTIONS": 1, "CYTHON_INLINE": 68, "__GNUC__": 5, "__inline__": 1, "__inline": 1, "__STDC_VERSION__": 2, "CYTHON_UNUSED": 7, "**p": 1, "*s": 1, "encoding": 1, "is_unicode": 1, "is_str": 1, "intern": 1, "__Pyx_StringTabEntry": 1, "__Pyx_PyBytes_FromUString": 1, "__Pyx_PyBytes_AsUString": 1, "__Pyx_PyBool_FromLong": 1, "Py_INCREF": 3, "Py_True": 2, "Py_False": 2, "__Pyx_PyObject_IsTrue": 8, "__Pyx_PyNumber_Int": 1, "__Pyx_PyIndex_AsSsize_t": 1, "__Pyx_PyInt_FromSize_t": 1, "__Pyx_PyInt_AsSize_t": 1, "__pyx_PyFloat_AsDouble": 3, "PyFloat_CheckExact": 1, "PyFloat_AS_DOUBLE": 1, "PyFloat_AsDouble": 1, "__GNUC_MINOR__": 1, "__builtin_expect": 2, "*__pyx_m": 1, "*__pyx_b": 1, "*__pyx_empty_tuple": 1, "*__pyx_empty_bytes": 1, "__pyx_lineno": 80, "__pyx_clineno": 80, "__pyx_cfilenm": 1, "__FILE__": 2, "*__pyx_filename": 1, "CYTHON_CCOMPLEX": 12, "_Complex_I": 3, "": 1, "": 1, "__sun__": 1, "*__pyx_f": 1, "npy_int8": 1, "__pyx_t_5numpy_int8_t": 1, "npy_int16": 1, "__pyx_t_5numpy_int16_t": 1, "npy_int32": 1, "__pyx_t_5numpy_int32_t": 1, "npy_int64": 1, "__pyx_t_5numpy_int64_t": 1, "npy_uint8": 1, "__pyx_t_5numpy_uint8_t": 1, "npy_uint16": 1, "__pyx_t_5numpy_uint16_t": 1, "npy_uint32": 1, "__pyx_t_5numpy_uint32_t": 1, "npy_uint64": 1, "__pyx_t_5numpy_uint64_t": 1, "npy_float32": 1, "__pyx_t_5numpy_float32_t": 1, "npy_float64": 1, "__pyx_t_5numpy_float64_t": 1, "npy_long": 1, "__pyx_t_5numpy_int_t": 1, "npy_longlong": 1, "__pyx_t_5numpy_long_t": 1, "npy_intp": 10, "__pyx_t_5numpy_intp_t": 1, "npy_uintp": 1, "__pyx_t_5numpy_uintp_t": 1, "npy_ulong": 1, "__pyx_t_5numpy_uint_t": 1, "npy_ulonglong": 1, "__pyx_t_5numpy_ulong_t": 1, "npy_double": 2, "__pyx_t_5numpy_float_t": 1, "__pyx_t_5numpy_double_t": 1, "npy_longdouble": 1, "__pyx_t_5numpy_longdouble_t": 1, "complex": 2, "__pyx_t_float_complex": 27, "_Complex": 2, "imag": 2, "__pyx_t_double_complex": 27, "npy_cfloat": 1, "__pyx_t_5numpy_cfloat_t": 1, "npy_cdouble": 2, "__pyx_t_5numpy_cdouble_t": 1, "npy_clongdouble": 1, "__pyx_t_5numpy_clongdouble_t": 1, "__pyx_t_5numpy_complex_t": 1, "CYTHON_REFNANNY": 3, "__Pyx_RefNannyAPIStruct": 4, "*__Pyx_RefNanny": 1, "__Pyx_RefNannyImportAPI": 1, "*modname": 1, "*m": 1, "*p": 1, "*r": 1, "PyImport_ImportModule": 1, "modname": 1, "PyLong_AsVoidPtr": 1, "Py_XDECREF": 3, "__Pyx_RefNannySetupContext": 13, "*__pyx_refnanny": 1, "__Pyx_RefNanny": 6, "SetupContext": 1, "__LINE__": 84, "__Pyx_RefNannyFinishContext": 12, "FinishContext": 1, "__pyx_refnanny": 5, "__Pyx_INCREF": 36, "INCREF": 1, "__Pyx_DECREF": 66, "DECREF": 1, "__Pyx_GOTREF": 60, "GOTREF": 1, "__Pyx_GIVEREF": 10, "GIVEREF": 1, "__Pyx_XDECREF": 26, "Py_DECREF": 1, "__Pyx_XGIVEREF": 7, "__Pyx_XGOTREF": 1, "__Pyx_TypeTest": 4, "*type": 3, "*__Pyx_GetName": 1, "*dict": 1, "__Pyx_ErrRestore": 1, "*tb": 2, "__Pyx_ErrFetch": 1, "**type": 1, "**value": 1, "**tb": 1, "__Pyx_Raise": 8, "__Pyx_RaiseNoneNotIterableError": 1, "__Pyx_RaiseNeedMoreValuesError": 1, "__Pyx_RaiseTooManyValuesError": 1, "__Pyx_UnpackTupleError": 2, "*__Pyx_Import": 1, "*from_list": 1, "__Pyx_Print": 1, "__pyx_print": 1, "__pyx_print_kwargs": 1, "__Pyx_PrintOne": 4, "*o": 1, "*__Pyx_PyInt_to_py_Py_intptr_t": 1, "Py_intptr_t": 1, "__Pyx_CREAL": 4, ".real": 3, "__Pyx_CIMAG": 4, ".imag": 3, "__real__": 1, "__imag__": 1, "_WIN32": 1, "__Pyx_SET_CREAL": 2, "__Pyx_SET_CIMAG": 2, "__pyx_t_float_complex_from_parts": 1, "__Pyx_c_eqf": 2, "__Pyx_c_sumf": 2, "__Pyx_c_difff": 2, "__Pyx_c_prodf": 2, "__Pyx_c_quotf": 2, "__Pyx_c_negf": 2, "__Pyx_c_is_zerof": 3, "__Pyx_c_conjf": 3, "conj": 3, "__Pyx_c_absf": 3, "abs": 2, "__Pyx_c_powf": 3, "pow": 2, "conjf": 1, "cabsf": 1, "cpowf": 1, "__pyx_t_double_complex_from_parts": 1, "__Pyx_c_eq": 2, "__Pyx_c_sum": 2, "__Pyx_c_diff": 2, "__Pyx_c_prod": 2, "__Pyx_c_quot": 2, "__Pyx_c_neg": 2, "__Pyx_c_is_zero": 3, "__Pyx_c_conj": 3, "__Pyx_c_abs": 3, "__Pyx_c_pow": 3, "cabs": 1, "cpow": 1, "__Pyx_PyInt_AsUnsignedChar": 1, "short": 3, "__Pyx_PyInt_AsUnsignedShort": 1, "__Pyx_PyInt_AsUnsignedInt": 1, "__Pyx_PyInt_AsChar": 1, "__Pyx_PyInt_AsShort": 1, "__Pyx_PyInt_AsInt": 1, "signed": 5, "__Pyx_PyInt_AsSignedChar": 1, "__Pyx_PyInt_AsSignedShort": 1, "__Pyx_PyInt_AsSignedInt": 1, "__Pyx_PyInt_AsLongDouble": 1, "__Pyx_PyInt_AsUnsignedLong": 1, "__Pyx_PyInt_AsUnsignedLongLong": 1, "__Pyx_PyInt_AsLong": 1, "__Pyx_PyInt_AsLongLong": 1, "__Pyx_PyInt_AsSignedLong": 1, "__Pyx_PyInt_AsSignedLongLong": 1, "__Pyx_WriteUnraisable": 3, "__Pyx_ExportFunction": 1, "*__pyx_f_5numpy_PyArray_MultiIterNew2": 2, "*__pyx_f_5numpy_PyArray_MultiIterNew3": 2, "*__pyx_f_5numpy_PyArray_MultiIterNew4": 2, "*__pyx_f_5numpy_PyArray_MultiIterNew5": 2, "*__pyx_f_5numpy__util_dtypestring": 2, "PyArray_Descr": 6, "__pyx_f_5numpy_set_array_base": 1, "PyArrayObject": 19, "*__pyx_f_5numpy_get_array_base": 1, "inner_work_1d": 2, "inner_work_2d": 2, "__Pyx_MODULE_NAME": 1, "__pyx_module_is_main_wrapper_inner": 1, "*__pyx_builtin_ValueError": 1, "*__pyx_builtin_range": 1, "*__pyx_builtin_RuntimeError": 1, "__pyx_k_1": 1, "__pyx_k_2": 1, "__pyx_k_3": 1, "__pyx_k_5": 1, "__pyx_k_7": 1, "__pyx_k_9": 1, "__pyx_k_11": 1, "__pyx_k_12": 1, "__pyx_k_15": 1, "__pyx_k__B": 2, "__pyx_k__H": 2, "__pyx_k__I": 2, "__pyx_k__L": 2, "__pyx_k__O": 2, "__pyx_k__Q": 2, "__pyx_k__b": 2, "__pyx_k__d": 2, "__pyx_k__f": 2, "__pyx_k__g": 2, "__pyx_k__h": 2, "__pyx_k__i": 2, "__pyx_k__l": 2, "__pyx_k__q": 2, "__pyx_k__Zd": 2, "__pyx_k__Zf": 2, "__pyx_k__Zg": 2, "__pyx_k__np": 1, "__pyx_k__buf": 1, "__pyx_k__obj": 1, "__pyx_k__base": 1, "__pyx_k__ndim": 1, "__pyx_k__ones": 1, "__pyx_k__descr": 1, "__pyx_k__names": 1, "__pyx_k__numpy": 1, "__pyx_k__range": 1, "__pyx_k__shape": 1, "__pyx_k__fields": 1, "__pyx_k__format": 1, "__pyx_k__strides": 1, "__pyx_k____main__": 1, "__pyx_k____test__": 1, "__pyx_k__itemsize": 1, "__pyx_k__readonly": 1, "__pyx_k__type_num": 1, "__pyx_k__byteorder": 1, "__pyx_k__ValueError": 1, "__pyx_k__suboffsets": 1, "__pyx_k__work_module": 1, "__pyx_k__RuntimeError": 1, "__pyx_k__pure_py_test": 1, "__pyx_k__wrapper_inner": 1, "__pyx_k__do_awesome_work": 1, "*__pyx_kp_s_1": 1, "*__pyx_kp_u_11": 1, "*__pyx_kp_u_12": 1, "*__pyx_kp_u_15": 1, "*__pyx_kp_s_2": 1, "*__pyx_kp_s_3": 1, "*__pyx_kp_u_5": 1, "*__pyx_kp_u_7": 1, "*__pyx_kp_u_9": 1, "*__pyx_n_s__RuntimeError": 1, "*__pyx_n_s__ValueError": 1, "*__pyx_n_s____main__": 1, "*__pyx_n_s____test__": 1, "*__pyx_n_s__base": 1, "*__pyx_n_s__buf": 1, "*__pyx_n_s__byteorder": 1, "*__pyx_n_s__descr": 1, "*__pyx_n_s__do_awesome_work": 1, "*__pyx_n_s__fields": 1, "*__pyx_n_s__format": 1, "*__pyx_n_s__itemsize": 1, "*__pyx_n_s__names": 1, "*__pyx_n_s__ndim": 1, "*__pyx_n_s__np": 1, "*__pyx_n_s__numpy": 1, "*__pyx_n_s__obj": 1, "*__pyx_n_s__ones": 1, "*__pyx_n_s__pure_py_test": 1, "*__pyx_n_s__range": 1, "*__pyx_n_s__readonly": 1, "*__pyx_n_s__shape": 1, "*__pyx_n_s__strides": 1, "*__pyx_n_s__suboffsets": 1, "*__pyx_n_s__type_num": 1, "*__pyx_n_s__work_module": 1, "*__pyx_n_s__wrapper_inner": 1, "*__pyx_int_5": 1, "*__pyx_int_15": 1, "*__pyx_k_tuple_4": 1, "*__pyx_k_tuple_6": 1, "*__pyx_k_tuple_8": 1, "*__pyx_k_tuple_10": 1, "*__pyx_k_tuple_13": 1, "*__pyx_k_tuple_14": 1, "*__pyx_k_tuple_16": 1, "__pyx_v_num_x": 4, "*__pyx_v_data_ptr": 2, "*__pyx_v_answer_ptr": 2, "__pyx_v_nd": 6, "*__pyx_v_dims": 2, "__pyx_v_typenum": 6, "*__pyx_v_data_np": 2, "__pyx_v_sum": 6, "__pyx_t_1": 154, "*__pyx_t_2": 4, "*__pyx_t_3": 4, "*__pyx_t_4": 3, "__pyx_t_5": 75, "__pyx_kp_s_1": 1, "__pyx_filename": 79, "__pyx_f": 79, "__pyx_L1_error": 88, "__pyx_v_dims": 4, "NPY_DOUBLE": 3, "__pyx_t_2": 120, "PyArray_SimpleNewFromData": 2, "__pyx_v_data_ptr": 2, "Py_None": 38, "__pyx_ptype_5numpy_ndarray": 2, "__pyx_v_data_np": 10, "__Pyx_GetName": 4, "__pyx_m": 4, "__pyx_n_s__work_module": 3, "__pyx_t_3": 113, "PyObject_GetAttr": 4, "__pyx_n_s__do_awesome_work": 3, "PyTuple_New": 4, "PyTuple_SET_ITEM": 4, "__pyx_t_4": 35, "PyObject_Call": 11, "PyErr_Occurred": 2, "__pyx_v_answer_ptr": 2, "__pyx_L0": 24, "__pyx_v_num_y": 2, "__pyx_kp_s_2": 1, "*__pyx_pf_13wrapper_inner_pure_py_test": 2, "*__pyx_self": 2, "*unused": 2, "PyMethodDef": 1, "__pyx_mdef_13wrapper_inner_pure_py_test": 1, "PyCFunction": 1, "__pyx_pf_13wrapper_inner_pure_py_test": 1, "METH_NOARGS": 1, "*__pyx_v_data": 1, "*__pyx_r": 7, "*__pyx_t_1": 8, "__pyx_self": 2, "__pyx_v_data": 7, "__pyx_kp_s_3": 1, "__pyx_n_s__np": 1, "__pyx_n_s__ones": 1, "__pyx_k_tuple_4": 1, "__pyx_r": 39, "__Pyx_AddTraceback": 7, "__pyx_pf_5numpy_7ndarray___getbuffer__": 2, "*__pyx_v_self": 4, "*__pyx_v_info": 4, "__pyx_v_flags": 4, "__pyx_v_copy_shape": 5, "__pyx_v_i": 6, "__pyx_v_ndim": 6, "__pyx_v_endian_detector": 6, "__pyx_v_little_endian": 8, "__pyx_v_t": 29, "*__pyx_v_f": 2, "*__pyx_v_descr": 2, "__pyx_v_offset": 9, "__pyx_v_hasfields": 4, "__pyx_t_6": 40, "__pyx_t_7": 9, "*__pyx_t_8": 1, "*__pyx_t_9": 1, "__pyx_v_info": 33, "__pyx_v_self": 16, "PyArray_NDIM": 1, "__pyx_L5": 6, "PyArray_CHKFLAGS": 2, "NPY_C_CONTIGUOUS": 1, "__pyx_builtin_ValueError": 5, "__pyx_k_tuple_6": 1, "__pyx_L6": 6, "NPY_F_CONTIGUOUS": 1, "__pyx_k_tuple_8": 1, "__pyx_L7": 2, "buf": 1, "PyArray_DATA": 1, "strides": 5, "malloc": 2, "shape": 3, "PyArray_STRIDES": 2, "PyArray_DIMS": 2, "__pyx_L8": 2, "suboffsets": 1, "PyArray_ITEMSIZE": 1, "PyArray_ISWRITEABLE": 1, "__pyx_v_f": 31, "descr": 2, "__pyx_v_descr": 10, "PyDataType_HASFIELDS": 2, "__pyx_L11": 7, "type_num": 2, "byteorder": 4, "__pyx_k_tuple_10": 1, "__pyx_L13": 2, "NPY_BYTE": 2, "__pyx_L14": 18, "NPY_UBYTE": 2, "NPY_SHORT": 2, "NPY_USHORT": 2, "NPY_INT": 2, "NPY_UINT": 2, "NPY_LONG": 1, "NPY_ULONG": 1, "NPY_LONGLONG": 1, "NPY_ULONGLONG": 1, "NPY_FLOAT": 1, "NPY_LONGDOUBLE": 1, "NPY_CFLOAT": 1, "NPY_CDOUBLE": 1, "NPY_CLONGDOUBLE": 1, "NPY_OBJECT": 1, "__pyx_t_8": 16, "PyNumber_Remainder": 1, "__pyx_kp_u_11": 1, "format": 6, "__pyx_L12": 2, "__pyx_t_9": 7, "__pyx_f_5numpy__util_dtypestring": 1, "__pyx_L2": 2, "__pyx_pf_5numpy_7ndarray_1__releasebuffer__": 2, "PyArray_HASFIELDS": 1, "free": 2, "*__pyx_f_5numpy_PyArray_MultiIterNew1": 1, "*__pyx_v_a": 5, "PyArray_MultiIterNew": 5, "__pyx_v_a": 5, "*__pyx_v_b": 4, "__pyx_v_b": 4, "*__pyx_v_c": 3, "__pyx_v_c": 3, "*__pyx_v_d": 2, "__pyx_v_d": 2, "*__pyx_v_e": 1, "__pyx_v_e": 1, "*__pyx_v_end": 1, "*__pyx_v_offset": 1, "*__pyx_v_child": 1, "*__pyx_v_fields": 1, "*__pyx_v_childname": 1, "*__pyx_v_new_offset": 1, "*__pyx_v_t": 1, "*__pyx_t_5": 1, "__pyx_t_10": 7, "*__pyx_t_11": 1, "__pyx_v_child": 8, "__pyx_v_fields": 7, "__pyx_v_childname": 4, "__pyx_v_new_offset": 5, "names": 2, "PyTuple_GET_SIZE": 2, "PyTuple_GET_ITEM": 3, "PyObject_GetItem": 1, "PyTuple_CheckExact": 1, "tuple": 3, "__pyx_ptype_5numpy_dtype": 1, "__pyx_v_end": 2, "PyNumber_Subtract": 2, "PyObject_RichCompare": 8, "__pyx_int_15": 1, "Py_LT": 2, "__pyx_builtin_RuntimeError": 2, "__pyx_k_tuple_13": 1, "__pyx_k_tuple_14": 1, "elsize": 1, "__pyx_k_tuple_16": 1, "__pyx_L10": 2, "Py_EQ": 6 }, "CLIPS": { ";": 135, "***************************": 2, "*": 2, "DEFFACTS": 2, "KNOWLEDGE": 1, "BASE": 1, "(": 626, "deffacts": 3, "MAIN": 1, "knowledge": 1, "-": 70, "base": 1, "welcome": 1, "message": 1, "WelcomeMessage": 1, ")": 624, "goal": 1, "variable": 44, "type.animal": 45, "legalanswers": 1, "values": 4, "yes": 43, "no": 44, "displayanswers": 1, "rule": 83, "if": 83, "backbone": 6, "is": 249, "then": 83, "superphylum": 6, "jellyback": 3, "question": 42, "query": 42, "backbone.query": 1, "and": 85, "warm.blooded": 3, "phylum": 12, "warm": 3, "cold": 3, "warm.blooded.query": 1, "live.prime.in.soil": 3, "soil": 3, "elsewhere": 3, "live.prime.in.soil.query": 1, "has.breasts": 3, "class": 15, "breasts": 3, "bird": 1, "has.breasts.query": 1, "always.in.water": 3, "water": 6, "dry": 6, "always.in.water.query": 1, "flat.bodied": 3, "flatworm": 1, "worm.leech": 1, "flat.bodied.query": 1, "body.in.segments": 3, "segments": 3, "unified": 3, "body.in.segments.query": 1, "can.eat.meat": 3, "order": 21, "meat": 3, "vegy": 3, "can.eat.meat.query": 1, "boney": 3, "fish": 1, "shark.ray": 1, "boney.query": 1, "scaly": 3, "scales": 3, "soft": 3, "scaly.query": 1, "shell": 6, "centipede.millipede.insect": 1, "shell.query": 1, "digest.cells": 3, "cells": 3, "stomach": 3, "digest.cells.query": 1, "fly": 3, "bat": 1, "family": 18, "nowings": 3, "fly.query": 1, "hooves": 6, "feet": 3, "hooves.query": 1, "rounded.shell": 3, "turtle": 1, "noshell": 6, "rounded.shell.query": 1, "jump": 3, "frog": 1, "salamander": 1, "jump.query": 1, "tail": 3, "lobster": 1, "crab": 1, "tail.query": 1, "stationary": 6, "jellyfish": 1, "stationary.query": 1, "multicelled": 6, "protozoa": 1, "multicelled.query": 1, "opposing.thumb": 3, "genus": 21, "thumb": 3, "nothumb": 3, "opposing.thumb.query": 1, "two.toes": 3, "twotoes": 3, "onetoe": 3, "two.toes.query": 1, "live.in.water": 3, "live.in.water.query": 1, "limbs": 3, "crocodile.alligator": 1, "snake": 1, "limbs.query": 1, "spikes": 3, "sea.anemone": 1, "coral.sponge": 1, "spikes.query": 1, "spiral.shell": 3, "snail": 1, "spiral.shell.query": 1, "prehensile.tail": 3, "monkey": 1, "species": 22, "notail": 3, "prehensile.tail.query": 1, "over.400": 3, "under400": 3, "over.400.query": 1, "horns": 6, "nohorns": 4, "horns.query": 1, "plating": 3, "rhinoceros": 1, "horse.zebra": 1, "plating.query": 1, "hunted": 3, "whale": 1, "dolphin.porpoise": 1, "hunted.query": 1, "front.teeth": 3, "teeth": 3, "noteeth": 3, "front.teeth.query": 1, "bivalve": 3, "clam.oyster": 1, "squid.octopus": 1, "bivalve.query": 1, "nearly.hairless": 3, "man": 1, "subspecies": 3, "hair": 3, "nearly.hairless.query": 1, "land.based": 3, "bear.tiger.lion": 1, "walrus": 1, "land.based.query": 1, "thintail": 3, "cat": 1, "coyote.wolf.fox.dog": 1, "thintail.query": 1, "lives.in.desert": 4, "camel": 1, "semi.aquatic": 3, "giraffe": 1, "hippopotamus": 1, "lives.in.desert.query": 1, "semi.aquatic.query": 1, "large.ears": 3, "rabbit": 1, "rat.mouse.squirrel.beaver.porcupine": 1, "large.ears.query": 1, "pouch": 3, "kangaroo.koala.bear": 1, "mole.shrew.elephant": 1, "pouch.query": 1, "long.powerful.arms": 3, "orangutan.gorilla.chimpanzee": 1, "baboon": 1, "long.powerful.arms.query": 1, "fleece": 3, "sheep.goat": 1, "subsubspecies": 3, "nofleece": 3, "fleece.query": 1, "domesticated": 3, "cow": 1, "deer.moose.antelope": 1, "domesticated.query": 1, "answer": 1, "prefix": 1, "postfix": 1, "http": 6, "//www.angusj.com/sudoku/hints": 1, "//www.scanraid.com/BasicStrategies.htm": 1, "//www.sudokuoftheday.com/pages/techniques": 1, "overview": 1, "//www.sudokuonline.us/sudoku_solving_techniques": 1, "//www.sadmansoftware.com/sudoku/techniques.htm": 1, "//www.krazydad.com/blog/2005/09/29/an": 1, "index": 1, "of": 1, "sudoku": 1, "strategies/": 1, "#######################": 2, "DEFTEMPLATES": 1, "&": 14, "deftemplate": 5, "possible": 10, "slot": 15, "row": 7, "column": 7, "value": 69, "group": 4, "id": 10, "impossible": 4, "priority": 19, "reason": 2, "technique": 7, "employed": 1, "name": 1, "startup": 1, "phase": 14, "grid": 1, "size": 60, "###########": 4, "SETUP": 1, "RULES": 2, "***********": 4, "stress": 3, "test": 3, "defrule": 9, "declare": 9, "salience": 9, "match": 8, "last": 11, "not": 18, "p": 12, "next": 12, "<": 7, "assert": 10, "*****************": 6, "enable": 2, "techniques": 2, "any": 12, "**********": 2, "expand": 7, "f": 11, "r": 6, "c": 6, "g": 3, "id2": 2, "s": 4, "as": 4, "v": 6, "v2": 3, "position": 4, "expanded": 2, "<=>": 1, "retract": 5, "PHASE": 1, "***************": 2, "done": 2, "<->": 4, "initial": 2, "output": 5, "print": 2, "begin": 6, "elimination": 3, "*************": 2, "************": 2, "final": 1 }, "CMake": { "cmake_minimum_required": 4, "(": 118, "VERSION": 5, ")": 118, "project": 3, "Foo": 1, "set": 6, "CMAKE_SKIP_RPATH": 1, "TRUE": 1, "CMAKE_INSTALL_PREFIX": 1, "add_subdirectory": 1, "bar": 1, "add_executable": 4, "foo": 5, "foo.c": 2, "target_link_libraries": 4, "pthread": 1, "install": 1, "TARGETS": 1, "DESTINATION": 1, "bin": 1, "enable_testing": 1, "CMAKE_BUILD_TYPE": 1, "debug": 1, "include_directories": 2, "find_library": 1, "ssl_LIBRARY": 2, "NAMES": 1, "ssl": 1, "PATHS": 1, "add_custom_command": 1, "OUTPUT": 2, "COMMAND": 3, "./ver.sh": 1, "bar.c": 1, "baz.c": 1, "ver.c": 1, "{": 37, "}": 37, "FATAL_ERROR": 3, "PCLVisualizer": 4, "PCL_LIBRARIES": 1, "#it": 1, "seems": 1, "it": 1, "s": 1, "needed": 1, "only": 1, "on": 1, "OS": 1, "X": 1, "find_package": 4, "GLEW": 1, "REQUIRED": 4, "CMAKE_CXX_FLAGS": 1, "PCL": 1, "PCL_INCLUDE_DIRS": 1, "link_directories": 2, "PCL_LIBRARY_DIRS": 1, "add_definitions": 2, "PCL_DEFINITIONS": 1, "PCL_BUILD_TYPE": 1, "Release": 1, "file": 3, "GLOB": 1, "PCL_openni_viewer_SRC": 2, "#add": 2, "this": 1, "line": 1, "to": 1, "solve": 1, "probem": 1, "in": 1, "mac": 1, "os": 1, "x": 1, "PCL_COMMON_LIBRARIES": 1, "PCL_IO_LIBRARIES": 1, "PCL_VISUALIZATION_LIBRARIES": 1, "PCL_FEATURES_LIBRARIES": 1, "#": 3, "CMAKE_MINIMUM_REQUIRED": 1, "FIND_FILE": 1, "SPHINX": 1, "sphinx": 1, "-": 5, "build.exe": 1, "IF": 13, "WIN32": 3, "SET": 17, "SPHINX_MAKE": 4, "make.bat": 1, "ELSE": 5, "make": 1, "ENDIF": 13, "ADD_CUSTOM_TARGET": 2, "doc_usr": 1, "html": 2, "WORKING_DIRECTORY": 2, "CMAKE_CURRENT_SOURCE_DIR": 2, "/usr": 1, "doc_dev": 1, "/dev": 1, "CMAKE_RUNTIME_OUTPUT_DIRECTORY": 1, "list": 1, "APPEND": 3, "CMAKE_MODULE_PATH": 1, "CMAKE_SOURCE_DIR": 1, "/cmake/vala": 1, "Vala": 1, "include": 2, "ValaPrecompile": 1, "ValaVersion": 1, "ensure_vala_version": 1, "MINIMUM": 1, "template": 1, "C": 1, "PkgConfig": 1, "pkg_check_modules": 1, "GOBJECT": 1, "gobject": 1, "GOBJECT_CFLAGS": 1, "GOBJECT_CFLAGS_OTHER": 1, "link_libraries": 1, "GOBJECT_LIBRARIES": 1, "GOBJECT_LIBRARY_DIRS": 1, "vala_precompile": 1, "VALA_C": 2, "src/template.vala": 1, "PACKAGES": 1, "OPTIONS": 1, "thread": 1, "CUSTOM_VAPIS": 1, "GENERATE_VAPI": 1, "GENERATE_HEADER": 1, "DIRECTORY": 1, "gen": 1, "MACRO": 1, "CHECK_STDCALL_FUNCTION_EXISTS": 2, "FUNCTION_DECLARATION": 3, "VARIABLE": 7, "MATCHES": 2, "#get": 1, "includes": 2, "CHECK_STDCALL_FUNCTION_PREMAIN": 7, "FOREACH": 2, "def": 2, "CMAKE_EXTRA_INCLUDE_FILES": 1, "ENDFOREACH": 2, "some": 1, "default": 1, "HAVE_WINDOWS_H": 2, "HAVE_UNISTD_H": 2, "HAVE_DIRECT_H": 2, "HAVE_IO_H": 2, "HAVE_SYS_TIMEB_H": 2, "STRING": 3, "REGEX": 2, "REPLACE": 2, "CHECK_STDCALL_FUNCTION_EXISTS_FUNCTION": 1, "MACRO_CHECK_STDCALL_FUNCTION_DEFINITIONS": 2, "MESSAGE": 7, "STATUS": 5, "CMAKE_REQUIRED_LIBRARIES": 3, "CHECK_STDCALL_FUNCTION_EXISTS_ADD_LIBRARIES": 2, "CMAKE_REQUIRED_INCLUDES": 3, "CHECK_STDCALL_FUNCTION_EXISTS_ADD_INCLUDES": 2, "CHECK_STDCALL_FUNCTION_DECLARATION": 1, "CONFIGURE_FILE": 1, "IMMEDIATE": 1, "@ONLY": 1, "FILE": 4, "READ": 2, "CHECK_STDCALL_FUNCTION_CONTENT": 1, "TRY_COMPILE": 1, "CMAKE_BINARY_DIR": 3, "COMPILE_DEFINITIONS": 1, "CMAKE_REQUIRED_DEFINITIONS": 1, "CMAKE_FLAGS": 1, "DCOMPILE_DEFINITIONS": 1, "OUTPUT_VARIABLE": 2, "CACHE": 2, "INTERNAL": 2, "CMAKE_FILES_DIRECTORY": 2, "/CMakeOutput.log": 1, "/CMakeError.log": 1, "ENDMACRO": 1, "NOT": 4, "EXISTS": 5, "files": 3, "EXEC_PROGRAM": 1, "ARGS": 1, "rm_out": 1, "RETURN_VALUE": 1, "rm_retval": 1, "STREQUAL": 2 }, "COBOL": { "program": 1, "-": 19, "id.": 1, "hello.": 3, "procedure": 1, "division.": 1, "display": 1, ".": 3, "stop": 1, "run.": 1, "IDENTIFICATION": 2, "DIVISION.": 4, "PROGRAM": 2, "ID.": 2, "PROCEDURE": 2, "DISPLAY": 2, "STOP": 2, "RUN.": 2, "COBOL": 7, "TEST": 2, "RECORD.": 1, "USAGES.": 1, "COMP": 5, "PIC": 5, "S9": 4, "(": 5, ")": 5, "COMP.": 3, "COMP2": 2 }, "CSON": { "directoryIcons": 1, "Atom": 1, "icon": 11, "match": 20, "/": 16, ".atom": 1, "colour": 6, "Bower": 1, "bower": 1, "[": 17, "-": 3, "_": 1, "]": 17, "components": 1, "Dropbox": 2, "(": 3, "|": 3, ".dropbox": 1, ".cache": 1, ")": 3, "Git": 1, ".git": 1, "GitHub": 1, ".github": 1, "Meteor": 1, ".meteor": 1, "NodeJS": 1, "node_modules": 1, "Package": 1, ".bundle": 1, "/i": 2, "TextMate": 1, "fileIcons": 1, "ABAP": 1, "scope": 2, "ActionScript": 1, "#": 2, "Or": 1, "Flash": 1, "related": 1, ".": 2, "flex": 1, "config": 1, "actionscript": 1, "d": 1, "+": 1, "alias": 1, "/ActionScript": 1, "s": 2, "as3/i": 1, "name": 27, "scopeName": 1, "fileTypes": 1, "firstLineMatch": 1, "patterns": 7, "include": 16, "repository": 1, "main": 1, "{": 18, "}": 18, "punctuation": 1, "private": 1, "begin": 4, "end": 4, "beginCaptures": 4, "endCaptures": 4, "image": 1, "contentName": 1, "pickleData": 1, "sections": 1, "control": 1, "captures": 2, "encoding": 1, "Don": 1, "referring": 1, "to": 1, "a": 1, "memory": 1, "register": 1, "or": 1, "something.": 1, "address": 1, "property": 1 }, "CSS": { ".clearfix": 8, "{": 1661, "*zoom": 48, ";": 4219, "}": 1705, "before": 48, "after": 96, "display": 135, "table": 44, "content": 66, "line": 97, "-": 8839, "height": 141, "clear": 32, "both": 30, ".hide": 12, "text": 129, "font": 142, "/0": 2, "a": 268, "color": 711, "transparent": 148, "shadow": 254, "none": 128, "background": 770, "border": 912, ".input": 216, "block": 133, "level": 2, "width": 215, "%": 366, "min": 14, "px": 2535, "webkit": 364, "box": 264, "sizing": 27, "moz": 316, "article": 2, "aside": 2, "details": 2, "figcaption": 2, "figure": 2, "footer": 2, "header": 12, "hgroup": 2, "nav": 2, "section": 2, "audio": 4, "canvas": 2, "video": 4, "inline": 116, "*display": 20, "not": 6, "(": 748, "[": 384, "controls": 2, "]": 384, ")": 748, "html": 4, "size": 104, "adjust": 6, "ms": 13, "focus": 232, "outline": 30, "thin": 8, "dotted": 10, "#333": 6, "auto": 50, "ring": 6, "offset": 6, "hover": 144, "active": 46, "sub": 4, "sup": 4, "position": 342, "relative": 18, "vertical": 56, "align": 72, "baseline": 4, "top": 376, "em": 6, "bottom": 309, "img": 14, "max": 18, "middle": 20, "interpolation": 2, "mode": 2, "bicubic": 2, "#map_canvas": 2, ".google": 2, "maps": 2, "button": 18, "input": 336, "select": 90, "textarea": 76, "margin": 424, "*overflow": 3, "visible": 8, "normal": 18, "inner": 37, "padding": 174, "type": 174, "appearance": 6, "cursor": 30, "pointer": 12, "label": 20, "textfield": 2, "search": 66, "decoration": 33, "cancel": 2, "overflow": 21, "@media": 2, "print": 4, "*": 2, "important": 18, "#000": 2, "visited": 2, "underline": 6, "href": 28, "attr": 4, "abbr": 6, "title": 10, ".ir": 2, "pre": 16, "blockquote": 14, "solid": 93, "#999": 6, "page": 6, "break": 12, "inside": 4, "avoid": 6, "thead": 38, "group": 120, "tr": 92, "@page": 2, "cm": 2, "p": 14, "h2": 14, "h3": 14, "orphans": 2, "widows": 2, "body": 3, "family": 10, "Helvetica": 6, "Arial": 6, "sans": 6, "serif": 6, "#333333": 26, "#ffffff": 136, "#0088cc": 24, "#005580": 8, ".img": 6, "rounded": 2, "radius": 534, "polaroid": 2, "#fff": 10, "#ccc": 13, "rgba": 409, "circle": 18, ".row": 126, "left": 489, "class*": 100, "float": 84, ".container": 32, ".navbar": 332, "static": 14, "fixed": 36, ".span12": 4, ".span11": 4, ".span10": 4, ".span9": 4, ".span8": 4, ".span7": 4, ".span6": 4, ".span5": 4, ".span4": 4, ".span3": 4, ".span2": 4, ".span1": 4, ".offset12": 6, ".offset11": 6, ".offset10": 6, ".offset9": 6, ".offset8": 6, ".offset7": 6, ".offset6": 6, ".offset5": 6, ".offset4": 6, ".offset3": 6, ".offset2": 6, ".offset1": 6, "fluid": 126, "*margin": 70, "first": 179, "child": 301, ".controls": 28, "row": 20, "+": 105, "*width": 26, ".pull": 16, "right": 258, ".lead": 2, "weight": 28, "small": 66, "strong": 2, "bold": 14, "style": 21, "italic": 4, "cite": 2, ".muted": 2, "#999999": 50, "a.muted": 4, "#808080": 2, ".text": 14, "warning": 33, "#c09853": 14, "a.text": 16, "#a47e3c": 4, "error": 10, "#b94a48": 20, "#953b39": 6, "info": 37, "#3a87ad": 18, "#2d6987": 6, "success": 35, "#468847": 18, "#356635": 6, "center": 17, "h1": 11, "h4": 20, "h5": 6, "h6": 6, "inherit": 8, "rendering": 2, "optimizelegibility": 2, ".page": 2, "#eeeeee": 31, "ul": 84, "ol": 10, "li": 205, "ul.unstyled": 2, "ol.unstyled": 2, "list": 44, "ul.inline": 4, "ol.inline": 4, "dl": 2, "dt": 6, "dd": 6, ".dl": 12, "horizontal": 60, "hidden": 9, "ellipsis": 2, "white": 25, "space": 23, "nowrap": 14, "hr": 2, "data": 2, "original": 2, "help": 2, "abbr.initialism": 2, "transform": 4, "uppercase": 4, "blockquote.pull": 10, "q": 4, "address": 2, "code": 6, "Monaco": 2, "Menlo": 2, "Consolas": 2, "monospace": 2, "#d14": 2, "#f7f7f9": 2, "#e1e1e8": 2, "word": 6, "all": 10, "wrap": 6, "#f5f5f5": 26, "pre.prettyprint": 2, ".pre": 2, "scrollable": 2, "y": 2, "scroll": 2, ".label": 30, ".badge": 30, "empty": 7, "a.label": 4, "a.badge": 4, "#f89406": 27, "#c67605": 4, "inverse": 110, "#1a1a1a": 2, ".btn": 506, "mini": 34, "collapse": 12, "spacing": 3, ".table": 180, "th": 70, "td": 66, "#dddddd": 16, "caption": 18, "colgroup": 18, "tbody": 68, "condensed": 4, "bordered": 76, "separate": 4, "*border": 8, "topleft": 16, "last": 118, "topright": 16, "tfoot": 12, "bottomleft": 16, "bottomright": 16, "striped": 13, "nth": 4, "odd": 4, "#f9f9f9": 12, "cell": 2, "td.span1": 2, "th.span1": 2, "td.span2": 2, "th.span2": 2, "td.span3": 2, "th.span3": 2, "td.span4": 2, "th.span4": 2, "td.span5": 2, "th.span5": 2, "td.span6": 2, "th.span6": 2, "td.span7": 2, "th.span7": 2, "td.span8": 2, "th.span8": 2, "td.span9": 2, "th.span9": 2, "td.span10": 2, "th.span10": 2, "td.span11": 2, "th.span11": 2, "td.span12": 2, "th.span12": 2, "tr.success": 4, "#dff0d8": 6, "tr.error": 4, "#f2dede": 6, "tr.warning": 4, "#fcf8e3": 6, "tr.info": 4, "#d9edf7": 6, "#d0e9c6": 2, "#ebcccc": 2, "#faf2cc": 2, "#c4e3f3": 2, "form": 38, "fieldset": 2, "legend": 6, "#e5e5e5": 28, ".uneditable": 80, "#555555": 18, "#cccccc": 18, "inset": 132, "transition": 36, "linear": 204, ".2s": 16, "o": 48, ".075": 12, ".6": 6, "multiple": 2, "#fcfcfc": 2, "allowed": 4, "placeholder": 18, ".radio": 26, ".checkbox": 26, ".radio.inline": 6, ".checkbox.inline": 6, "medium": 2, "large": 40, "xlarge": 2, "xxlarge": 2, "append": 120, "prepend": 82, "input.span12": 4, "textarea.span12": 2, "input.span11": 4, "textarea.span11": 2, "input.span10": 4, "textarea.span10": 2, "input.span9": 4, "textarea.span9": 2, "input.span8": 4, "textarea.span8": 2, "input.span7": 4, "textarea.span7": 2, "input.span6": 4, "textarea.span6": 2, "input.span5": 4, "textarea.span5": 2, "input.span4": 4, "textarea.span4": 2, "input.span3": 4, "textarea.span3": 2, "input.span2": 4, "textarea.span2": 2, "input.span1": 4, "textarea.span1": 2, "disabled": 36, "readonly": 10, ".control": 150, "group.warning": 32, ".help": 44, "#dbc59e": 6, ".add": 36, "on": 36, "group.error": 32, "#d59392": 6, "group.success": 32, "#7aba7b": 6, "group.info": 32, "#7ab5d3": 6, "invalid": 12, "#ee5f5b": 18, "#e9322d": 2, "#f8b9b7": 6, ".form": 132, "actions": 10, "#595959": 2, ".dropdown": 126, "menu": 42, ".popover": 14, "z": 12, "index": 14, "toggle": 84, ".active": 86, "#a9dba9": 2, "#46a546": 2, "prepend.input": 22, "input.search": 2, "query": 22, ".search": 22, "*padding": 36, "image": 187, "gradient": 175, "#e6e6e6": 20, "from": 40, "to": 75, "repeat": 66, "x": 30, "filter": 57, "progid": 48, "DXImageTransform.Microsoft.gradient": 48, "startColorstr": 30, "endColorstr": 30, "GradientType": 30, "#bfbfbf": 4, "*background": 36, "enabled": 18, "false": 18, "#b3b3b3": 2, ".3em": 6, ".2": 12, ".05": 24, ".btn.active": 8, ".btn.disabled": 4, "#d9d9d9": 4, "s": 25, ".15": 24, "default": 12, "opacity": 15, "alpha": 7, "class": 26, "primary.active": 6, "warning.active": 6, "danger.active": 6, "success.active": 6, "info.active": 6, "inverse.active": 6, "primary": 14, "#006dcc": 2, "#0044cc": 20, "#002a80": 2, "primary.disabled": 2, "#003bb3": 2, "#003399": 2, "#faa732": 3, "#fbb450": 16, "#ad6704": 2, "warning.disabled": 2, "#df8505": 2, "danger": 21, "#da4f49": 2, "#bd362f": 20, "#802420": 2, "danger.disabled": 2, "#a9302a": 2, "#942a25": 2, "#5bb75b": 2, "#62c462": 16, "#51a351": 20, "#387038": 2, "success.disabled": 2, "#499249": 2, "#408140": 2, "#49afcd": 2, "#5bc0de": 16, "#2f96b4": 20, "#1f6377": 2, "info.disabled": 2, "#2a85a0": 2, "#24748c": 2, "#363636": 2, "#444444": 10, "#222222": 32, "#000000": 14, "inverse.disabled": 2, "#151515": 12, "#080808": 2, "button.btn": 4, "button.btn.btn": 6, ".btn.btn": 6, "link": 28, "url": 4, "no": 2, ".icon": 288, ".nav": 308, "pills": 28, "submenu": 8, "glass": 2, "music": 2, "envelope": 2, "heart": 2, "star": 4, "user": 2, "film": 2, "ok": 6, "remove": 6, "zoom": 5, "in": 10, "out": 10, "off": 4, "signal": 2, "cog": 2, "trash": 2, "home": 2, "file": 2, "time": 2, "road": 2, "download": 4, "alt": 6, "upload": 2, "inbox": 2, "play": 4, "refresh": 2, "lock": 2, "flag": 2, "headphones": 2, "volume": 6, "down": 12, "up": 12, "qrcode": 2, "barcode": 2, "tag": 2, "tags": 2, "book": 2, "bookmark": 2, "camera": 2, "justify": 2, "indent": 4, "facetime": 2, "picture": 2, "pencil": 2, "map": 2, "marker": 2, "tint": 2, "edit": 2, "share": 4, "check": 2, "move": 2, "step": 4, "backward": 6, "fast": 4, "pause": 2, "stop": 32, "forward": 6, "eject": 2, "chevron": 8, "plus": 4, "sign": 16, "minus": 4, "question": 2, "screenshot": 2, "ban": 2, "arrow": 21, "resize": 8, "full": 2, "asterisk": 2, "exclamation": 2, "gift": 2, "leaf": 2, "fire": 2, "eye": 4, "open": 4, "close": 4, "plane": 2, "calendar": 2, "random": 2, "comment": 2, "magnet": 2, "retweet": 2, "shopping": 2, "cart": 2, "folder": 4, "hdd": 2, "bullhorn": 2, "bell": 2, "certificate": 2, "thumbs": 4, "hand": 8, "globe": 2, "wrench": 2, "tasks": 2, "briefcase": 2, "fullscreen": 2, "toolbar": 8, ".btn.large": 4, ".large.dropdown": 2, "group.open": 18, ".125": 6, ".btn.dropdown": 2, "primary.dropdown": 2, "warning.dropdown": 2, "danger.dropdown": 2, "success.dropdown": 2, "info.dropdown": 2, "inverse.dropdown": 2, ".caret": 70, ".dropup": 2, ".divider": 8, "tabs": 94, "#ddd": 38, "stacked": 24, "tabs.nav": 12, "pills.nav": 4, ".dropdown.active": 4, ".open": 8, "li.dropdown.open.active": 14, "li.dropdown.open": 14, ".tabs": 62, ".tabbable": 8, ".tab": 8, "below": 18, "pane": 4, ".pill": 6, ".disabled": 22, "*position": 2, "*z": 2, "#fafafa": 2, "#f2f2f2": 22, "#d4d4d4": 2, "collapse.collapse": 2, ".brand": 14, "#777777": 12, ".1": 24, ".nav.pull": 2, "navbar": 28, "#ededed": 2, "navbar.active": 8, "navbar.disabled": 4, "bar": 21, "absolute": 8, "li.dropdown": 12, "li.dropdown.active": 8, "menu.pull": 8, "#1b1b1b": 2, "#111111": 18, "#252525": 2, "#515151": 2, "query.focused": 2, "#0e0e0e": 2, "#040404": 18, ".breadcrumb": 8, ".pagination": 78, "span": 38, "centered": 2, ".pager": 34, ".next": 4, ".previous": 4, ".thumbnails": 12, ".thumbnail": 6, "ease": 12, "a.thumbnail": 4, ".caption": 2, ".alert": 34, "#fbeed5": 2, ".close": 2, "#d6e9c6": 2, "#eed3d7": 2, "#bce8f1": 2, "@": 8, "keyframes": 8, "progress": 15, "stripes": 15, "@keyframes": 2, ".progress": 22, "#f7f7f7": 3, ".bar": 22, "#0e90d2": 2, "#149bdf": 11, "#0480be": 10, "deg": 20, ".progress.active": 1, "animation": 5, "infinite": 5, "#dd514c": 1, "#c43c35": 5, "danger.progress": 1, "#5eb95e": 1, "#57a957": 5, "success.progress": 1, "#4bb1cf": 1, "#339bb9": 5, "info.progress": 1, "warning.progress": 1, ".hero": 3, "unit": 3, "letter": 1, ".media": 11, "object": 1, "heading": 1, ".tooltip": 7, "visibility": 1, ".tooltip.in": 1, ".tooltip.top": 2, ".tooltip.right": 2, ".tooltip.bottom": 2, ".tooltip.left": 2, "clip": 3, ".popover.top": 3, ".popover.right": 3, ".popover.bottom": 3, ".popover.left": 3, "#ebebeb": 1, ".arrow": 12, ".modal": 5, "backdrop": 2, "backdrop.fade": 1, "backdrop.fade.in": 1 }, "CSV": { "Year": 1, "Make": 1, "Model": 1, "Length": 1, "Ford": 1, "E350": 1, "Mercury": 1, "Cougar": 1 }, "CartoCSS": { "@marina": 3, "-": 2547, "text": 835, "#576ddf": 1, ";": 1091, "//": 1, "also": 1, "swimming_pool": 1, "@wetland": 2, "darken": 43, "(": 177, "#017fff": 1, "%": 43, ")": 177, "@mud": 2, "#aea397": 1, "@shop": 6, "icon": 9, "#ac39ac": 1, "@transportation": 6, "#0092da": 1, "#0066ff": 6, "@airtransport": 5, "#8461C4": 1, "@landcover": 312, "font": 135, "size": 446, "big": 90, "bigger": 90, "wrap": 340, "width": 353, "face": 127, "name": 214, "@oblique": 8, "fonts": 45, "@standard": 36, ".points": 1, "{": 430, "[": 784, "feature": 223, "]": 784, "zoom": 237, "point": 126, "file": 92, "url": 92, "placement": 167, "interior": 166, "}": 430, "marker": 97, "fill": 145, "#0a0a0a": 1, "#969494": 1, "line": 6, "clip": 15, "false": 15, "access": 6, "opacity": 1, "religion": 8, "denomination": 1, "aeroway": 4, "<": 3, "man_made": 3, "natural": 6, "#d08f55": 2, "#d40000": 1, "ignore": 1, "true": 1, "#239c45": 1, "color": 1, "#8ef2ab": 1, "power": 2, "power_source": 1, ".amenity": 1, "low": 2, "priority": 1, "railway": 2, "highway": 2, "barrier": 6, "#3f3f3f": 1, "#7d7c7c": 1, ".text": 2, "way_pixels": 224, "#000": 1, "halo": 127, "radius": 85, "#734a08": 7, "dy": 43, "@bold": 5, "@book": 32, "#66ccaf": 1, "#000033": 2, "is_building": 66, "@wood": 1, "rgba": 42, "brown": 7, "ele/text": 30, "way_area": 10, "@water": 1, "@stadium": 1, "@track": 1, "@pitch": 1, "@park": 3, "@quarry": 1, "@vineyard": 1, "@cemetery": 1, "@residential": 1, "@garages": 1, "@field": 1, "@grass": 1, "@allotments": 1, "@forest": 1, "@farmyard": 1, "@farmland": 1, "@retail": 1, "@industrial": 1, "@commercial": 1, "@construction": 1, "#6699cc": 6, "black": 1, "@campsite": 1, "@theme_park": 1, "#660033": 1, "@school": 3, "#da0092": 2, "#939": 2, "@danger_area": 1, "@military": 1, "#aa66cc": 1, "@barracks": 1, "@zoo": 1, "@power": 1, "@desert": 1, "@sand": 1, "@heath": 1, "@grassland": 1, "@scrub": 1, "@apron": 1, "@beach": 1, "@rest_area": 1, "@glacier": 1 }, "Ceylon": { "by": 1, "(": 5, ")": 5, "shared": 5, "void": 1, "test": 1, "{": 3, "print": 1, ";": 4, "}": 3, "class": 1, "Test": 2, "name": 3, "satisfies": 1, "Comparable": 1, "": 1, "String": 2, "actual": 2, "string": 1, "Comparison": 1, "compare": 1, "other": 1, "return": 1, "<=>": 1, "other.name": 1 }, "Chapel": { "//": 168, "use": 5, "BlockDist": 2, "CyclicDist": 1, "BlockCycDist": 1, "ReplicatedDist": 2, ";": 526, "DimensionalDist2D": 2, "ReplicatedDim": 2, "BlockCycDim": 1, "config": 10, "const": 61, "n": 16, "Space": 12, "{": 131, "}": 129, "BlockSpace": 2, "dmapped": 8, "Block": 4, "(": 645, "boundingBox": 2, ")": 642, "var": 72, "BA": 5, "[": 931, "]": 931, "int": 21, "forall": 43, "ba": 4, "in": 84, "do": 66, "here.id": 7, "if": 106, "BA.hasSingleLocalSubdomain": 1, "then": 88, "halt": 11, "for": 44, "L": 6, "Locales": 9, "on": 10, "indices": 6, "BA.localSubdomain": 1, "i": 263, "L.id": 2, "writeln": 52, "MyLocaleView": 5, "#numLocales": 1, "MyLocales": 6, "locale": 1, "reshape": 2, "BlockSpace2": 2, "targetLocales": 1, "BA2": 3, "ML": 2, "zip": 2, "BA2.targetLocales": 1, "CyclicSpace": 2, "Cyclic": 1, "startIdx": 2, "Space.low": 5, "CA": 4, "ca": 2, "CA.localSubdomain": 1, "BlkCycSpace": 2, "BlockCyclic": 1, "blocksize": 1, "BCA": 4, "bca": 2, "BCA.hasSingleLocalSubdomain": 1, "proc": 46, "verifyID": 3, "Data": 2, "Data.localSubdomains": 1, "ReplicatedSpace": 2, "RA": 11, "ra": 4, "RA.numElements": 1, "A": 13, "j": 25, "i*100": 1, "+": 323, "here": 2, "LocaleSpace.high": 3, "nl1": 2, "nl2": 2, "numLocales": 5, "else": 18, "numLocales/2": 1, "#nl1": 2, "#nl2": 1, "#nl1*nl2": 1, "DimReplicatedBlockcyclicSpace": 2, "new": 7, "BlockCyclicDim": 1, "lowIdx": 1, "blockSize": 1, "DRBA": 3, "locId1": 2, "drba": 2, "Helper": 2, "print": 5, "to": 9, "the": 10, "console": 1, "Time": 2, "get": 3, "timing": 6, "routines": 1, "benchmarking": 1, "block": 1, "-": 308, "distributed": 1, "arrays": 6, "luleshInit": 1, "initialization": 1, "code": 1, "data": 1, "set": 4, "param": 17, "useBlockDist": 5, "CHPL_COMM": 1, "use3DRepresentation": 6, "false": 4, "useSparseMaterials": 3, "true": 5, "printWarnings": 3, "&&": 9, "luleshInit.filename": 1, "initialEnergy": 2, "initial": 1, "energy": 5, "value": 1, "showProgress": 3, "time": 9, "and": 4, "dt": 14, "values": 1, "each": 1, "step": 1, "debug": 8, "various": 1, "info": 1, "doTiming": 4, "main": 3, "timestep": 1, "loop": 2, "printCoords": 2, "final": 1, "computed": 1, "coordinates": 2, "XI_M": 2, "XI_M_SYMM": 4, "XI_M_FREE": 3, "XI_P": 2, "XI_P_SYMM": 3, "XI_P_FREE": 3, "ETA_M": 2, "ETA_M_SYMM": 4, "ETA_M_FREE": 3, "ETA_P": 2, "ETA_P_SYMM": 3, "ETA_P_FREE": 3, "ZETA_M": 2, "ZETA_M_SYMM": 4, "ZETA_M_FREE": 3, "ZETA_P": 2, "ZETA_P_SYMM": 3, "ZETA_P_FREE": 3, "numElems": 2, "numNodes": 1, "initProblemSize": 1, "ElemSpace": 4, "#elemsPerEdge": 3, "#numElems": 1, "NodeSpace": 4, "#nodesPerEdge": 3, "#numNodes": 1, "Elems": 45, "Nodes": 16, "x": 113, "y": 109, "z": 109, "real": 63, "nodesPerElem": 6, "elemToNode": 7, "nodesPerElem*index": 1, "lxim": 3, "lxip": 3, "letam": 3, "letap": 3, "lzetam": 3, "lzetap": 3, "index": 4, "XSym": 4, "YSym": 4, "ZSym": 4, "sparse": 3, "subdomain": 3, "u_cut": 5, "hgcoef": 1, "qstop": 2, "monoq_max_slope": 7, "monoq_limiter_mult": 7, "e_cut": 3, "p_cut": 6, "ss4o3": 1, "/3.0": 2, "q_cut": 2, "v_cut": 2, "qlc_monoq": 2, "qqc_monoq": 2, "qqc": 1, "qqc2": 1, "*": 260, "qqc**2": 1, "eosvmax": 14, "eosvmin": 9, "pmin": 7, "emin": 7, "dvovmax": 1, "refdens": 3, "deltatimemultlb": 1, "deltatimemultub": 1, "dtmax": 1, "stoptime": 3, "maxcycles": 3, "max": 2, "dtfixed": 2, "MatElems": 9, "MatElemsType": 2, "enumerateMatElems": 2, "type": 1, "return": 15, "Elems.type": 1, "iter": 3, "yield": 3, "elemBC": 16, "e": 35, "p": 10, "pressure": 1, "q": 13, "ql": 3, "linear": 1, "term": 2, "qq": 3, "quadratic": 1, "v": 9, "//relative": 1, "volume": 21, "vnew": 9, "volo": 5, "reference": 1, "delv": 3, "m_vnew": 1, "m_v": 1, "vdov": 4, "derivative": 1, "over": 2, "arealg": 2, "elem": 3, "characteristic": 2, "length": 2, "ss": 2, "elemMass": 4, "mass": 12, "xd": 8, "yd": 8, "zd": 8, "velocities": 2, "xdd": 3, "ydd": 3, "zdd": 3, "acceleration": 1, "fx": 9, "fy": 9, "fz": 9, "atomic": 5, "forces": 1, "nodalMass": 3, "current": 1, "deltatime": 3, "variable": 1, "increment": 1, "dtcourant": 1, "e20": 2, "courant": 1, "constraint": 2, "dthydro": 1, "change": 2, "cycle": 5, "iteration": 1, "count": 1, "simulation": 1, "initLulesh": 2, "st": 4, "getCurrentTime": 4, "while": 4, "<": 42, "iterTime": 2, "TimeIncrement": 2, "LagrangeLeapFrog": 1, "deprintatomic": 2, "deprint": 3, "writef": 5, "et": 3, "/cycle": 1, "outfile": 1, "open": 1, "iomode.cw": 1, "writer": 1, "outfile.writer": 1, "fmtstr": 2, "writer.writef": 1, "writer.close": 1, "outfile.close": 1, "initCoordinates": 1, "initElemToNodeMapping": 1, "initGreekVars": 1, "initXSyms": 1, "initYSyms": 1, "initZSyms": 1, "//calculated": 1, "fly": 1, "using": 1, "elemToNodes": 3, "initMasses": 2, "octantCorner": 2, "initBoundaryConditions": 2, "massAccum": 3, "eli": 18, "x_local": 11, "y_local": 11, "z_local": 11, "*real": 40, "localizeNeighborNodes": 6, "CalcElemVolume": 3, "neighbor": 2, ".add": 1, ".read": 1, "/": 26, "surfaceNode": 8, "mask": 16, "<<": 2, "&": 18, "|": 14, "check": 3, "loc": 4, "maxloc": 1, "reduce": 2, "freeSurface": 3, "initFreeSurface": 1, "b": 4, "inline": 5, "ref": 19, "noi": 4, "TripleProduct": 4, "x1": 1, "y1": 1, "z1": 1, "x2": 1, "y2": 1, "z2": 1, "x3": 1, "y3": 1, "z3": 1, "x1*": 1, "y2*z3": 1, "z2*y3": 1, "x2*": 1, "z1*y3": 1, "y1*z3": 1, "x3*": 1, "y1*z2": 1, "z1*y2": 1, "dx61": 2, "dy61": 2, "dz61": 2, "dx70": 2, "dy70": 2, "dz70": 2, "dx63": 2, "dy63": 2, "dz63": 2, "dx20": 2, "dy20": 2, "dz20": 2, "dx50": 2, "dy50": 2, "dz50": 2, "dx64": 2, "dy64": 2, "dz64": 2, "dx31": 2, "dy31": 2, "dz31": 2, "dx72": 2, "dy72": 2, "dz72": 2, "dx43": 2, "dy43": 2, "dz43": 2, "dx57": 2, "dy57": 2, "dz57": 2, "dx14": 2, "dy14": 2, "dz14": 2, "dx25": 2, "dy25": 2, "dz25": 2, "InitStressTermsForElems": 1, "sigxx": 2, "sigyy": 2, "sigzz": 2, "D": 11, "CalcElemShapeFunctionDerivatives": 2, "b_x": 18, "b_y": 18, "b_z": 18, "fjxxi": 5, ".125": 9, "fjxet": 6, "fjxze": 5, "fjyxi": 5, "fjyet": 6, "fjyze": 5, "fjzxi": 5, "fjzet": 6, "fjzze": 5, "cjxxi": 5, "cjxet": 6, "cjxze": 5, "cjyxi": 5, "cjyet": 6, "cjyze": 5, "cjzxi": 5, "cjzet": 6, "cjzze": 5, "CalcElemNodeNormals": 1, "pfx": 15, "pfy": 15, "pfz": 15, "ElemFaceNormal": 7, "n1": 23, "n2": 23, "n3": 23, "n4": 23, "bisectX0": 3, "bisectY0": 3, "bisectZ0": 3, "bisectX1": 3, "bisectY1": 3, "bisectZ1": 3, "areaX": 5, "areaY": 5, "areaZ": 5, "rx": 6, "ry": 6, "rz": 6, "//results": 1, "SumElemStressesToNodeForces": 1, "stress_xx": 2, "stress_yy": 2, "stress_zz": 2, "CalcElemVolumeDerivative": 1, "VoluDer": 9, "n0": 13, "n5": 13, "ox": 1, "oy": 1, "oz": 1, "ox/12.0": 1, "oy/12.0": 1, "oz/12.0": 1, "dvdx": 10, "dvdy": 10, "dvdz": 10, "CalcElemFBHourglassForce": 1, "hourgam": 7, "coefficient": 4, "hgfx": 2, "hgfy": 2, "hgfz": 2, "hx": 3, "hy": 3, "hz": 3, "shx": 3, "shy": 3, "shz": 3, "CalcElemCharacteristicLength": 2, "AreaFace": 7, "p0": 7, "p1": 7, "p2": 7, "p3": 7, "gx": 5, "gy": 5, "gz": 5, "area": 2, "charLength": 2, "sqrt": 10, "CalcElemVelocityGradient": 2, "xvel": 25, "yvel": 25, "zvel": 25, "detJ": 5, "d": 12, "inv_detJ": 10, "dyddx": 2, "dxddy": 2, "dzddx": 2, "dxddz": 2, "dzddy": 2, "dyddz": 2, "CalcPressureForElems": 4, "p_new": 17, "bvc": 15, "pbvc": 14, "e_old": 7, "compression": 10, "vnewc": 22, "c1s": 3, "abs": 8, "//impossible": 1, "targetdt": 1, "//don": 1, "t": 3, "have": 2, "negative": 2, "determ": 1, "can": 2, "we": 1, "be": 2, "able": 1, "write": 1, "these": 1, "as": 1, "follows": 1, "CalcVelocityForNodes": 1, "local": 8, "xdtmp": 4, "ydtmp": 4, "zdtmp": 4, "CalcPositionForNodes": 1, "ijk": 7, "CalcLagrangeElements": 1, "dxx": 6, "dyy": 6, "dzz": 6, "CalcKinematicsForElems": 2, "k": 20, "vdovthird": 4, "<=>": 7, "0": 5, "all": 1, "elements": 3, "8": 4, "6": 1, "nodal": 2, "from": 2, "global": 3, "copy": 2, "into": 3, "xd_local": 4, "yd_local": 4, "zd_local": 4, "dt2": 4, "5": 1, "wish": 1, "this": 2, "was": 1, "too": 1, "calculations": 1, "relativeVolume": 3, "1": 2, "put": 1, "velocity": 3, "gradient": 3, "quantities": 1, "their": 1, "2": 1, "3": 1, "sungeun": 1, "Temporary": 1, "array": 4, "reused": 1, "throughout": 1, "delv_xi": 12, "delv_eta": 12, "delv_zeta": 12, "position": 1, "delx_xi": 7, "delx_eta": 7, "delx_zeta": 7, "CalcQForElems": 1, "MONOTONIC": 1, "Q": 1, "option": 1, "Calculate": 1, "gradients": 2, "CalcMonotonicQGradientsForElems": 2, "Transfer": 2, "veloctiy": 1, "first": 1, "order": 1, "problem": 1, "commElements": 1, "CommElements": 1, "monoQ": 1, "*/": 1, "CalcMonotonicQForElems": 2, "ApplyMaterialPropertiesForElems": 1, "c": 6, "matelm": 2, "vc": 6, "exit": 1, "EvalEOSForElems": 2, "UpdateVolumesForElems": 1, "tmpV": 4, "ptiny": 9, "xl": 26, "yl": 26, "zl": 26, "xvl": 26, "yvl": 26, "zvl": 26, "vol": 5, "norm": 20, "ax": 7, "ay": 7, "az": 7, "dxv": 4, "dyv": 4, "dzv": 4, "dxj": 1, "dyj": 1, "dzj": 1, "dxi": 1, "dyi": 1, "dzi": 1, "dxk": 1, "dyk": 1, "dzk": 1, "dyi*dzj": 1, "dzi*dyj": 1, "dzi*dxj": 1, "dxi*dzj": 1, "dxi*dyj": 1, "dyi*dxj": 1, "ax*ax": 3, "ay*ay": 3, "az*az": 3, "ax*dxv": 3, "ay*dyv": 3, "az*dzv": 3, "dyj*dzk": 1, "dzj*dyk": 1, "dzj*dxk": 1, "dxj*dzk": 1, "dxj*dyk": 1, "dyj*dxk": 1, "dyk*dzi": 1, "dzk*dyi": 1, "dzk*dxi": 1, "dxk*dzi": 1, "dxk*dyi": 1, "dyk*dxi": 1, "//got": 1, "rid": 1, "of": 3, "call": 1, "through": 1, "bcMask": 7, "delvm": 27, "delvp": 27, "select": 6, "when": 18, "phixi": 10, "phieta": 10, "phizeta": 10, "qlin": 4, "qquad": 4, "delvxxi": 4, "delvxeta": 4, "delvxzeta": 4, "rho": 3, "delvxxi**2": 1, "phixi**2": 1, "delvxeta**2": 1, "phieta**2": 1, "delvxzeta**2": 1, "phizeta**2": 1, "rho0": 8, "delvc": 11, "p_old": 8, "q_old": 7, "compHalfStep": 8, "qq_old": 7, "ql_old": 7, "work": 5, "e_new": 25, "q_new": 11, "vchalf": 2, "CalcEnergyForElems": 2, "CalcSoundSpeedForElems": 2, "sixth": 2, "pHalfStep": 5, "vhalf": 1, "ssc": 18, "vhalf**2": 1, "q_tilde": 4, "**2": 6, "enewc": 2, "pnewc": 2, "ssTmp": 4, "elemToNodesTuple": 1, "title": 4, "string": 2, "idx3DTo1D": 2, "D.dim": 2, ".size": 2, ".peek": 3, "pi": 1, "solarMass": 7, "pi**2": 1, "daysPerYear": 13, "record": 1, "body": 6, "pos": 5, "does": 1, "not": 1, "after": 1, "it": 1, "is": 1, "up": 1, "bodies": 8, "numbodies": 5, "bodies.numElements": 1, "initSun": 2, "advance": 2, "b.v": 2, "b.mass": 1, ".v": 1, "updateVelocities": 2, "b1": 2, "b2": 2, "dpos": 4, "b1.pos": 2, "b2.pos": 2, "mag": 3, "sumOfSquares": 4, "**3": 1, "b1.v": 2, "b2.mass": 2, "b2.v": 1, "b1.mass": 3, "b.pos": 1, "Random": 1, "random": 1, "number": 1, "generation": 1, "Timer": 2, "class": 1, "timer": 2, "sort": 1, "**15": 1, "size": 1, "sorted": 1, "thresh": 6, "recursive": 1, "depth": 1, "serialize": 1, "verbose": 7, "out": 1, "many": 1, "bool": 1, "disable": 1, "numbers": 1, "fillRandom": 1, "timer.start": 1, "pqsort": 4, "timer.stop": 1, "timer.elapsed": 1, "arr": 32, "low": 12, "arr.domain.low": 1, "high": 14, "arr.domain.high": 1, "where": 2, "arr.rank": 2, "bubbleSort": 2, "pivotVal": 9, "findPivot": 2, "pivotLoc": 3, "partition": 2, "serial": 1, "cobegin": 1, "mid": 7, "ilo": 9, "ihi": 6, "low..high": 2 }, "Charity": { "%": 2, "data": 1, "LA": 1, "(": 1, "A": 2, ")": 1, "-": 3, "D": 2, "ss": 1, "|": 1, "ff": 1, "D.": 1 }, "Cirru": { "print": 38, "array": 14, "int": 36, "string": 7, "set": 12, "f": 3, "block": 1, "(": 20, "a": 22, "b": 7, "c": 9, ")": 20, "call": 1, "bool": 6, "true": 1, "false": 1, "yes": 1, "no": 1, "map": 8, "m": 3, "float": 1, "require": 1, "./stdio.cr": 1, "self": 2, "child": 1, "under": 2, "parent": 1, "get": 4, "x": 2, "just": 4, "-": 4, "code": 4, "eval": 2, "nothing": 1, "container": 3 }, "Clarion": { "Member": 2, "(": 135, ")": 136, "Include": 5, "ONCE": 6, "Map": 2, "MODULE": 1, "General": 1, "functions": 2, "GetLastError": 6, "DWORD": 2, "PASCAL": 4, "Console": 1, "GetStdHandle": 3, "HANDLE": 1, "PROC": 10, "RAW": 3, "WriteConsole": 2, "Handle": 4, "Long": 5, "Dword": 2, "long": 4, "bool": 2, "Raw": 4, "Pascal": 4, "name": 4, "ReadConsole": 2, "SetConsoleTitle": 1, "Bool": 2, "GetConsoleTitle": 1, "dword": 1, "SetConsoleMode": 2, "dWord": 1, "BOOL": 2, "GetConsoleMode": 1, "End": 8, "ConsoleSupport.Construct": 1, "PROCEDURE": 26, "CODE": 27, "ConsoleSupport.Destruct": 1, "ConsoleSupport.Init": 1, "BYTE": 7, "VIRTUAL": 4, "SELF.OutputHandle": 3, "STD_OUTPUT_HANDLE": 1, "If": 3, "INVALID_HANDLE_VALUE": 4, "Halt": 5, "&": 24, "RETURN": 27, "SELF.InputHandle": 4, "STD_INPUT_HANDLE": 1, "if": 6, "ENABLE_PROCESSED_INPUT": 1, "INVALID_OTHER": 1, "FALSE": 6, "ConsoleSupport.WriteLine": 1, "STRING": 13, "pText": 2, "SELF.TextBuffer": 3, "SELF.Prefix": 1, "ADDRESS": 2, "LEN": 1, "SELF.BytesWritten": 1, "NULL": 2, "-": 81, "Consolesupport.ReadKey": 1, "SELF.WriteLine": 1, "Clear": 1, "SELF.InBuffer": 3, "Loop": 1, "IF": 10, "Address": 2, "SELF.BytesRead": 2, "THEN": 1, "Break": 1, "Until": 1, "omit": 1, "_VER_C55": 1, "_ABCDllMode_": 1, "EQUATE": 2, "_ABCLinkMode_": 1, "***": 2, "map": 1, "CStringClass.Construct": 1, "Declare": 18, "Procedure": 18, "SELF.bufferSize": 5, "DEFAULT_CS_BUFFER_SIZE": 1, "SELF.CS": 16, "New": 4, "CSTRING": 6, "CStringClass.Destruct": 1, "Dispose": 4, "SELF.cs": 1, "CStringClass.Cat": 1, "pStr": 10, "*CSTRING": 7, "newLen": 7, "LONG": 8, "AUTO": 2, "oldCS": 5, "Len": 7, "+": 17, "SELF.strLength": 9, "SELF.newStrSize": 6, "Only": 2, "grow": 1, "the": 28, "internal": 2, "string": 12, "result": 1, "of": 7, "cat": 1, "will": 1, "be": 4, "larger": 1, "than": 1, "currently": 1, "is.": 1, "The": 1, "reason": 1, "for": 3, "is": 13, "because": 1, "this": 6, "used": 2, "in": 3, "slicing": 1, "outside": 1, "IF.": 1, "Without": 1, "matching": 1, "there": 1, "potential": 1, "an": 1, "out": 1, "bounds": 1, "slice": 1, "which": 1, "would": 1, "bad": 1, "Save": 1, "a": 7, "temporary": 1, "copy": 2, "old": 2, "so": 2, "we": 4, "can": 1, "us": 1, "it": 6, "concatination": 1, "after": 1, "have": 1, "grown": 1, "END": 11, "Append": 1, "new": 2, "directly": 1, "to": 6, "end": 2, "one.": 1, "[": 2, "]": 2, "And": 1, "terminate": 1, "manually": 1, "This": 4, "same": 1, "as": 1, "doing": 1, "but": 2, "_really_": 1, "slow": 1, "on": 2, "large": 2, "strings.": 1, "much": 1, "faster": 1, "what": 1, "SELF.Str": 19, "s": 1, "It": 1, "nice": 1, "and": 3, "neat": 1, "solution": 1, "performance": 2, "especially": 1, "strings": 1, "was": 1, "terrible": 1, "CStringClass.Str": 2, "Dispose/New": 1, "one": 1, "requires": 1, "it.": 1, "might": 1, "slightly": 1, "innefficient": 1, "terms": 1, "memory": 1, "usage": 1, "when": 2, "gets": 2, "smaller": 1, "But": 1, "_vasty_": 1, "better": 1, "added": 1, "lot.": 1, "CStringClass.Len": 1, "CStringClass.Replace": 1, "pFind": 6, "pReplace": 3, "FindString": 1, "ReplaceWith": 1, "locate": 6, "lastLocate": 3, "LOOP": 1, "InString": 5, "Upper": 3, "BREAK": 1, "So": 1, "dont": 1, "up": 1, "having": 1, "recursive": 1, "replacement.": 1, "Sub": 3, "|": 3, "SELF.Len": 1, "CStringClass.Contains": 1, "pCaseSensitive": 6, "TRUE": 10, "Returns": 4, "value": 1, "indicating": 1, "whether": 1, "specified": 1, "String": 1, "occurs": 1, "within": 3, "string.": 1, "Second": 1, "parameter": 3, "defaults": 1, "case": 1, "sensitive": 1, "search.": 1, "ELSE": 4, "Lower": 3, "SELF.Lower": 3, "CStringClass.Lower": 1, "version": 1, "self.cs": 2, "doesnt": 1, "change": 1, "CStringClass.SubString": 1, "pPosition": 2, "pLength": 2, "CStringClass.ToLower": 1, "Converts": 2, "lowercase": 1, "returns": 2, "converted": 2, "CStringClass.ToUpper": 1, "uppercase": 1, "SELF.Upper": 1, "CStringClass.Trim": 1, "Left": 1, "Clip": 1, "CStringClass.Upper": 1, "CStringClass.IndexOf": 1, "pLookIn": 7, "index": 1, "first": 2, "found": 3, "zero": 1, "not": 1, "CStringClass.FoundIn": 1, "no": 1, "SELF.IndexOf": 1, "CStringClass.SetBuffer": 1, "pNewBuffer": 2, "CStringClass.EscapeXml": 1, "": 1, "CS": 2, "CStringClass": 1, "Omitted": 1, "CS.Str": 2, "Make": 1, "don": 1, "amp": 1, ";": 3, "<',>": 1, "lt": 1, "Replace": 1, "gt": 1, "quot": 1, "MEMBER": 1, "INCLUDE": 1, "MAP": 2, "HelloClass.Construct": 1, "HelloClass.Destruct": 1, "HelloClass.SayHello": 1, "MESSAGE": 2, "PROGRAM": 1 }, "Clean": { "module": 9, "fsieve": 1, "import": 10, "StdClass": 2, ";": 1, "//": 4, "RWS": 1, "StdInt": 2, "StdReal": 1, "NrOfPrimes": 3, "The": 1, "sieve": 1, "algorithm": 1, "generate": 1, "an": 1, "infinite": 1, "list": 3, "of": 3, "all": 1, "primes.": 1, "Primes": 3, "[": 93, "Int": 33, "]": 92, "pr": 6, "where": 12, "Sieve": 8, "-": 66, "g": 10, "i": 14, "prs": 6, "|": 48, "IsPrime": 4, "(": 132, "toInt": 1, "sqrt": 1, "toReal": 1, ")": 134, "+": 14, "Bool": 1, "f": 26, "r": 2, "bd": 3, "True": 1, "rem": 2, "False": 1, "Select": 2, "is": 1, "used": 1, "to": 2, "get": 1, "the": 3, "th": 1, "prime": 1, "from": 1, "primes": 1, "generated": 1, "by": 1, "Primes.": 1, "*/": 1, "Start": 3, "definition": 4, "GenHylo": 2, "StdGeneric": 4, "GenMap": 4, "Fix": 9, "In": 9, ".": 6, "Out": 1, "u": 6, "v": 12, "a": 55, "w": 4, "<=>": 1, "hylo": 1, "b": 7, ".b": 4, ".a": 11, ".f": 1, "gMap": 19, "{": 17, "*": 13, "}": 17, "cata": 4, "ana": 1, "generic": 2, "derive": 4, "c": 2, "UNIT": 2, "PAIR": 4, "EITHER": 3, "CONS": 4, "FIELD": 4, "OBJECT": 4, "implementation": 3, "StdArray": 1, "StdFunc": 1, "_Array": 1, "x": 36, "fx": 2, "fy": 2, "y": 11, "fl": 3, "fr": 3, "LEFT": 2, "RIGHT": 2, "xs": 4, "mapArray": 2, "monadicSemantics": 1, "StdEnv": 4, "Op": 6, "Plus": 2, "Minus": 2, "Times": 2, "Rem": 3, "Equal": 2, "LessThan": 3, "Var": 9, "String": 1, "ExpP": 3, "Exp": 5, "StmP": 3, "Assign": 3, "If": 3, "While": 3, "Seq": 3, "Cont": 4, "Stm": 2, "Env": 3, "Sem": 11, "empty": 2, "rtn": 4, "e.": 4, "e": 16, "infixl": 4, "e2": 2, ".y": 1, "_.": 1, "read": 4, "write": 3, "w.": 1, "if": 5, "class": 1, "sem": 9, "operator": 8, "<": 3, "instance": 14, "phi": 12, "n": 8, "op": 5, "v1.": 1, "return": 1, "o": 6, "v1": 1, "s1": 4, "s2": 4, "stm": 2, "s": 49, "Here": 1, "*finally*": 1, "pays": 1, "off": 1, "D": 1, "int": 2, "var": 6, "o2": 7, "assign": 4, "ifte": 1, "while": 2, "seq": 3, "cont": 1, "pEuclides": 2, "fst": 1, "program": 2, "start": 4, "_": 5, "infixr": 1, "stack": 2, "Stack": 28, "newStack": 3, "push": 3, "pushes": 3, "pop": 4, "popn": 3, "top": 4, "topn": 3, "elements": 3, "count": 3, "abort": 2, "drop": 1, "take": 1, "length": 1, "streams": 2, "zero": 4, "Real": 28, "one": 5, "/": 3, "X": 3, "invert": 5, "pow": 5, "shuffle": 6, "//Infinite": 1, "row": 1, "zeroes": 1, "represented": 1, "as": 1, "ease": 1, "computation": 1, "t": 23, "/s": 2, "s*t": 1 }, "Click": { "rates": 2, "AvailableRates": 1, "elementclass": 2, "sr2": 2, "{": 2, "sr2_ip": 10, "sr2_nm": 3, "wireless_mac": 7, "gateway": 2, "probes": 2, "|": 2, "arp": 6, "ARPTable": 1, "(": 54, ")": 54, ";": 79, "lt": 7, "LinkTable": 1, "IP": 7, "gw": 7, "SR2GatewaySelector": 1, "ETHTYPE": 5, "ETH": 6, "LT": 6, "ARP": 7, "PERIOD": 2, "GW": 1, "-": 124, "SR2SetChecksum": 4, "[": 71, "]": 71, "output": 8, "set_gw": 3, "SR2SetGateway": 1, "SEL": 1, "es": 3, "SR2ETTStat": 1, "TAU": 1, "PROBES": 1, "ETT": 1, "metric": 2, "RT": 1, "SR2ETTMetric": 1, "forwarder": 5, "SR2Forwarder": 1, "querier": 5, "SR2Querier": 1, "SR": 1, "ROUTE_DAMPENING": 1, "true": 3, "TIME_BEFORE_SWITCH": 1, "DEBUG": 3, "query_forwarder": 5, "SR2MetricFlood": 1, "false": 2, "query_responder": 4, "SR2QueryResponder": 1, "SR2Print": 1, "forwarding": 1, "data_ck": 3, "input": 3, "host_cl": 2, "IPClassifier": 9, "dst": 11, "net": 6, "mask": 2, "dt": 2, "DecIPTTL": 1, "Print": 1, "ttl": 1, "error": 1, "ICMPError": 1, "timeexceeded": 1, "SetTimestamp": 1, "//ip": 1, "packets": 2, "to": 4, "me": 1, "SR2StripHeader": 1, "CheckIPHeader": 4, "from_gw_cl": 2, "src": 3, "ncl": 6, "Classifier": 2, "/0643": 1, "//sr2_forwarder": 1, "/0644": 1, "//sr2": 1, "/0645": 1, "//replies": 1, "/0641": 1, "//sr2_es": 1, "/062c": 1, "//sr2_gw": 1, "SR2CheckHeader": 4, "PrintSR": 1, "query": 1, "}": 2, "Idle": 2, "s": 5, "Discard": 5, "//": 14, "AddressInfo": 1, "eth0": 18, "in": 8, "/24": 1, "d": 4, "c": 2, "e9": 2, "ex": 9, "addr": 3, "c2": 1, "SniffGatewayDevice": 2, "device": 9, "from": 2, "FromDevice": 1, "t1": 2, "Tee": 2, "q": 1, "Queue": 1, "t2": 2, "PullTee": 1, "ToDevice": 1, "ToHostSniffers": 2, "ScheduleInfo": 1, ".1": 1, "arpq_in": 3, "ARPQuerier": 1, "ip_to_extern": 3, "GetIPAddress": 2, "EtherEncap": 2, "ip_to_host": 8, "ToHost": 2, "ip_to_intern": 4, "arp_class": 5, "/0806": 2, "/0001": 1, "requests": 1, "/0002": 1, "replies": 1, "host": 5, "/0800": 1, "ARPResponder": 1, "arp_t": 3, "Strip": 1, "ipclass": 4, "iprw": 1, "IPRewriterPatterns": 1, "NAT": 2, "rw": 6, "IPRewriter": 1, "pattern": 1, "pass": 1, "irw": 6, "ICMPPingRewriter": 1, "icmp_me_or_intern": 5, "ierw": 4, "ICMPRewriter": 1, "established_class": 3, "firewall": 9, "tcp": 4, "port": 7, "ssh": 2, "smtp": 2, "domain": 4, "udp": 2, "icmp": 5, "type": 2, "echo": 2, "reply": 2, "proto": 1, "t": 2, "u": 1, "other": 1, "probably": 1, "for": 2, "connection": 2, "don": 1, "allow": 1, "incoming": 1, "<=>": 1, "4095": 1, "established": 1, "1": 1, "inter_class": 3, "ip_udp_class": 3, "or": 1 }, "Clojure": { ";": 355, "from": 2, "https": 1, "//github.com/boot": 1, "-": 76, "clj/boot#configure": 1, "task": 1, "options": 1, "(": 264, "set": 1, "env": 1, "source": 1, "paths": 1, "#": 15, "{": 20, "}": 21, "dependencies": 1, "my": 1, "project": 1, "version": 1, "jar": 2, "manifest": 1, ")": 265, "deftask": 1, "build": 1, "[": 68, "]": 68, "comp": 2, "pom": 1, "install": 1, "defn": 14, "prime": 2, "n": 9, "not": 9, "any": 3, "zero": 2, "map": 3, "rem": 2, "%": 6, "range": 3, "while": 3, "stops": 1, "at": 2, "the": 5, "first": 2, "collection": 1, "element": 1, "that": 1, "evaluates": 1, "to": 2, "false": 6, "like": 1, "take": 1, "for": 4, "x": 8, "html": 2, "head": 2, "meta": 3, "charset": 2, "link": 2, "rel": 2, "href": 6, "script": 1, "src": 1, "body": 2, "div.nav": 1, "p": 4, "Copyright": 1, "c": 1, "Alan": 1, "Dipert": 1, "and": 8, "Micha": 1, "Niskin.": 1, "All": 1, "rights": 1, "reserved.": 1, "The": 1, "use": 3, "distribution": 1, "terms": 2, "this": 6, "software": 2, "are": 2, "covered": 1, "by": 4, "Eclipse": 1, "Public": 1, "License": 1, "http": 2, "//opensource.org/licenses/eclipse": 1, "php": 1, "which": 2, "can": 1, "be": 2, "found": 1, "in": 4, "file": 1, "epl": 1, "v10.html": 1, "root": 1, "of": 2, "distribution.": 1, "By": 1, "using": 1, "fashion": 1, "you": 1, "agreeing": 1, "bound": 1, "license.": 1, "You": 1, "must": 1, "remove": 3, "notice": 1, "or": 2, "other": 1, "software.": 1, "page": 2, "refer": 4, "clojure": 1, "exclude": 1, "nth": 2, "require": 2, "tailrecursion.hoplon.reload": 1, "reload": 2, "all": 5, "tailrecursion.hoplon.util": 1, "name": 1, "pluralize": 2, "tailrecursion.hoplon.storage": 1, "atom": 1, "local": 3, "storage": 2, "utility": 1, "functions": 2, "declare": 1, "route": 11, "state": 15, "editing": 13, "def": 4, "mapvi": 2, "vec": 2, "indexed": 1, "dissocv": 2, "v": 15, "i": 20, "let": 3, "z": 4, "dec": 1, "count": 5, "cond": 2, "neg": 1, "pop": 1, "pos": 1, "into": 3, "subvec": 2, "inc": 2, "decorate": 2, "todo": 10, "done": 12, "completed": 12, "text": 14, "assoc": 4, "visible": 2, "empty": 8, "persisted": 1, "cell": 12, "AKA": 1, "stem": 1, "store": 1, "cells": 2, "defc": 6, "loaded": 1, "nil": 3, "formula": 1, "computed": 1, "filter": 2, "active": 5, "plural": 1, "item": 1, "todos": 2, "list": 1, "transition": 1, "t": 5, "destroy": 3, "swap": 6, "clear": 2, "&": 1, "_": 4, "new": 5, "when": 3, "conj": 1, "mapv": 1, "fn": 3, "reset": 1, "if": 3, "lang": 1, "equiv": 1, "content": 1, "title": 1, "noscript": 1, "div": 3, "id": 20, "section": 2, "header": 1, "h1": 1, "form": 2, "on": 11, "submit": 2, "do": 15, "val": 4, "value": 3, "input": 4, "type": 8, "autofocus": 1, "true": 5, "placeholder": 1, "blur": 2, "toggle": 4, "attr": 2, "checked": 2, "click": 4, "label": 2, "ul": 2, "loop": 2, "tpl": 1, "reverse": 1, "bind": 1, "ids": 1, "done#": 3, "edit#": 3, "bindings": 1, "edit": 3, "show": 2, "li": 4, "class": 8, "dblclick": 1, "@i": 6, "button": 2, "focus": 1, "@edit": 2, "change": 1, "footer": 2, "span": 2, "strong": 1, "a": 7, "selected": 3, "array": 3, "aseq": 8, "make": 1, "seq": 1, "<": 1, "aset": 1, "recur": 1, "next": 1, "defprotocol": 1, "ISound": 4, "sound": 5, "deftype": 2, "Cat": 1, "Dog": 1, "extend": 1, "default": 1, "rand": 2, "scm*": 1, "random": 1, "real": 1, "clj": 1, "ns": 2, "c2.svg": 2, "c2.core": 2, "only": 4, "unify": 2, "c2.maths": 2, "Pi": 2, "Tau": 2, "radians": 2, "per": 2, "degree": 2, "sin": 2, "cos": 2, "mean": 2, "cljs": 3, "c2.dom": 1, "as": 1, "dom": 1, "Stub": 1, "float": 2, "does": 1, "exist": 1, "runtime": 1, "identity": 1, "xy": 1, "coordinates": 7, "vector": 1, "y": 1, "deftest": 1, "function": 1, "tests": 1, "is": 7, "contains": 1, "foo": 6, "bar": 4, "select": 1, "keys": 2, "baz": 4, "vals": 1 }, "CoffeeScript": { "CoffeeScript": 1, "require": 24, "CoffeeScript.require": 1, "CoffeeScript.eval": 1, "(": 208, "code": 22, "options": 16, "{": 34, "}": 37, ")": 211, "-": 119, "options.bare": 2, "on": 3, "eval": 2, "CoffeeScript.compile": 2, "CoffeeScript.run": 3, "Function": 1, "return": 29, "unless": 19, "window": 1, "CoffeeScript.load": 2, "url": 2, "callback": 37, "xhr": 2, "new": 12, "window.ActiveXObject": 1, "or": 22, "XMLHttpRequest": 1, "xhr.open": 1, "true": 8, "xhr.overrideMimeType": 1, "if": 104, "of": 7, "xhr.onreadystatechange": 1, "xhr.readyState": 1, "is": 37, "xhr.status": 1, "in": 32, "[": 137, "]": 137, "xhr.responseText": 1, "else": 53, "throw": 3, "Error": 1, "xhr.send": 1, "null": 15, "runScripts": 3, "scripts": 2, "document.getElementsByTagName": 1, "coffees": 2, "s": 10, "for": 14, "when": 16, "s.type": 1, "index": 4, "length": 4, "coffees.length": 1, "do": 2, "execute": 3, "script": 7, "+": 31, ".type": 1, "script.src": 2, "script.innerHTML": 1, "window.addEventListener": 1, "addEventListener": 1, "no": 3, "attachEvent": 1, "fs": 3, "print": 3, "spawn": 2, "build": 2, "coffee": 1, "coffee.stderr.on": 1, "data": 2, "process.stderr.write": 1, "data.toString": 2, "coffee.stdout.on": 1, "coffee.on": 1, "task": 1, "class": 11, "Animal": 3, "constructor": 6, "@name": 2, "move": 3, "meters": 2, "alert": 4, "Snake": 2, "extends": 6, "super": 4, "Horse": 2, "sam": 1, "tom": 1, "sam.move": 1, "tom.move": 1, "#": 35, "path": 3, "Lexer": 3, "RESERVED": 3, "parser": 1, "vm": 1, "require.extensions": 3, "module": 1, "filename": 6, "content": 4, "compile": 5, "fs.readFileSync": 1, "module._compile": 1, "require.registerExtension": 2, "exports.VERSION": 1, "exports.RESERVED": 1, "exports.helpers": 2, "exports.compile": 1, "merge": 1, "try": 3, "js": 5, "parser.parse": 3, "lexer.tokenize": 3, ".compile": 1, "options.header": 1, "catch": 2, "err": 20, "err.message": 2, "options.filename": 5, "header": 1, "exports.tokens": 1, "exports.nodes": 1, "source": 5, "typeof": 2, "exports.run": 1, "mainModule": 1, "require.main": 1, "mainModule.filename": 4, "process.argv": 1, "then": 24, "fs.realpathSync": 2, "mainModule.moduleCache": 1, "and": 20, "mainModule.paths": 1, "._nodeModulePaths": 1, "path.dirname": 2, "path.extname": 1, "isnt": 7, "mainModule._compile": 2, "exports.eval": 1, "code.trim": 1, "Script": 2, "vm.Script": 1, "options.sandbox": 4, "instanceof": 2, "Script.createContext": 2, ".constructor": 1, "sandbox": 8, "k": 4, "v": 4, "own": 2, "sandbox.global": 1, "sandbox.root": 1, "sandbox.GLOBAL": 1, "global": 3, "sandbox.__filename": 3, "||": 3, "sandbox.__dirname": 1, "sandbox.module": 2, "sandbox.require": 2, "Module": 2, "_module": 3, "options.modulename": 1, "_require": 2, "Module._load": 1, "_module.filename": 1, "r": 4, "Object.getOwnPropertyNames": 1, "_require.paths": 1, "_module.paths": 1, "Module._nodeModulePaths": 1, "process.cwd": 1, "_require.resolve": 1, "request": 2, "Module._resolveFilename": 1, "o": 4, "o.bare": 1, "ensure": 1, "value": 25, "vm.runInThisContext": 1, "vm.runInContext": 1, "lexer": 1, "parser.lexer": 1, "lex": 1, "tag": 33, "@yytext": 1, "@yylineno": 1, "@tokens": 7, "@pos": 2, "setInput": 1, "upcomingInput": 1, "parser.yy": 1, "###*": 1, "@cjsx": 1, "React.DOM": 1, "###": 4, "define": 1, "React": 1, "ExampleStore": 3, "ExampleActions": 1, "ReactExampleTable": 1, "ReactExampleComponent": 1, "React.createClass": 1, "mixins": 1, "ListenMixin": 1, "getInitialState": 1, "rows": 3, "ExampleStore.getRows": 2, "meta": 3, "ExampleStore.getMeta": 2, "componentWillMount": 1, "@listenTo": 1, "componentDidMount": 1, "ExampleActions.getExampleData": 1, "onStoreChange": 1, "this.isMounted": 1, "@setState": 1, "componentWillUnmount": 1, "@stopListening": 1, "render": 1, "
": 1, "className=": 1, "
": 2, "": 1, "@state.title": 1, "": 1, "": 1, "rows=": 1, "meta=": 1, "
": 1, "console.log": 1, "number": 13, "opposite": 2, "square": 4, "x": 6, "*": 21, "list": 2, "math": 1, "root": 1, "Math.sqrt": 1, "cube": 1, "race": 1, "winner": 2, "runners...": 1, "runners": 1, "elvis": 1, "cubes": 1, "math.cube": 1, "num": 2, "Rewriter": 2, "INVERSES": 2, "count": 5, "starts": 1, "compact": 1, "last": 3, "exports.Lexer": 1, "tokenize": 1, "opts": 1, "WHITESPACE.test": 1, "code.replace": 1, "/": 44, "r/g": 1, ".replace": 3, "TRAILING_SPACES": 2, "@code": 1, "The": 7, "remainder": 1, "the": 4, "code.": 1, "@line": 4, "opts.line": 1, "current": 5, "line.": 1, "@indent": 3, "indentation": 3, "level.": 3, "@indebt": 1, "over": 1, "at": 2, "@outdebt": 1, "under": 1, "outdentation": 1, "@indents": 1, "stack": 4, "all": 1, "levels.": 1, "@ends": 1, "pairing": 1, "up": 1, "tokens.": 1, "Stream": 1, "parsed": 1, "tokens": 5, "form": 1, "line": 6, ".": 13, "i": 8, "while": 4, "@chunk": 9, "i..": 1, "@identifierToken": 1, "@commentToken": 1, "@whitespaceToken": 1, "@lineToken": 1, "@heredocToken": 1, "@stringToken": 1, "@numberToken": 1, "@regexToken": 1, "@jsToken": 1, "@literalToken": 1, "@closeIndentation": 1, "@error": 10, "@ends.pop": 1, "opts.rewrite": 1, "off": 1, ".rewrite": 1, "identifierToken": 1, "match": 23, "IDENTIFIER.exec": 1, "input": 1, "id": 16, "colon": 3, "@tag": 3, "@token": 12, "id.length": 1, "forcedIdentifier": 4, "prev": 17, "not": 4, "prev.spaced": 3, "JS_KEYWORDS": 1, "COFFEE_KEYWORDS": 1, "id.toUpperCase": 1, "LINE_BREAK": 2, "@seenFor": 4, "yes": 5, "UNARY": 4, "RELATION": 3, "@value": 1, "@tokens.pop": 1, "JS_FORBIDDEN": 1, "String": 1, "id.reserved": 1, "COFFEE_ALIAS_MAP": 1, "COFFEE_ALIASES": 1, "switch": 7, "input.length": 1, "numberToken": 1, "NUMBER.exec": 1, "BOX": 1, "/.test": 4, "/E/.test": 1, "x/.test": 1, "d*": 1, "d": 2, "lexedLength": 2, "number.length": 1, "octalLiteral": 2, "/.exec": 2, "parseInt": 5, ".toString": 3, "binaryLiteral": 2, "b": 1, "stringToken": 1, "@chunk.charAt": 3, "SIMPLESTR.exec": 1, "string": 9, "MULTILINER": 2, "@balancedString": 1, "<": 6, "string.indexOf": 1, "@interpolateString": 2, "@escapeLines": 1, "octalEsc": 1, "|": 21, "string.length": 1, "heredocToken": 1, "HEREDOC.exec": 1, "heredoc": 4, "quote": 5, "heredoc.charAt": 1, "doc": 11, "@sanitizeHeredoc": 2, "indent": 7, "<=>": 1, "indexOf": 1, "interpolateString": 1, "token": 1, "STRING": 2, "makeString": 1, "n": 16, "Matches": 1, "consumes": 1, "comments": 1, "commentToken": 1, "@chunk.match": 1, "COMMENT": 2, "comment": 2, "here": 3, "herecomment": 4, "Array": 1, ".join": 2, "comment.length": 1, "jsToken": 1, "JSTOKEN.exec": 1, "script.length": 1, "regexToken": 1, "HEREGEX.exec": 1, "@heregexToken": 1, "NOT_REGEX": 2, "NOT_SPACED_REGEX": 2, "REGEX.exec": 1, "regex": 5, "flags": 2, "..1": 1, "match.length": 1, "heregexToken": 1, "heregex": 1, "body": 2, "body.indexOf": 1, "re": 1, "body.replace": 1, "HEREGEX_OMIT": 3, "//g": 1, "re.match": 1, "*/": 2, "heregex.length": 1, "@tokens.push": 1, "tokens.push": 1, "value...": 1, "continue": 3, "value.replace": 2, "/g": 3, "spaced": 1, "reserved": 1, "word": 1, "value.length": 2, "MATH": 3, "COMPARE": 3, "COMPOUND_ASSIGN": 2, "SHIFT": 3, "LOGIC": 3, ".spaced": 1, "CALLABLE": 2, "INDEXABLE": 2, "@ends.push": 1, "@pair": 1, "sanitizeHeredoc": 1, "HEREDOC_ILLEGAL.test": 1, "doc.indexOf": 1, "HEREDOC_INDENT.exec": 1, "attempt": 2, "attempt.length": 1, "indent.length": 1, "doc.replace": 2, "///": 12, "///g": 1, "n/": 1, "tagParameters": 1, "this": 6, "tokens.length": 1, "tok": 5, "stack.push": 1, "stack.length": 1, "stack.pop": 2, "closeIndentation": 1, "@outdentToken": 1, "balancedString": 1, "str": 1, "end": 2, "continueCount": 3, "str.length": 1, "letter": 1, "str.charAt": 1, "missing": 1, "starting": 1, "Hello": 1, "name.capitalize": 1, "OUTDENT": 1, "THROW": 1, "EXTENDS": 1, "&": 4, "false": 4, "delete": 1, "break": 1, "debugger": 1, "finally": 2, "undefined": 1, "until": 1, "loop": 1, "by": 1, "&&": 1, "case": 1, "default": 1, "function": 2, "var": 1, "void": 1, "with": 1, "const": 1, "let": 2, "enum": 1, "export": 1, "import": 1, "native": 1, "__hasProp": 1, "__extends": 1, "__slice": 1, "__bind": 1, "__indexOf": 1, "implements": 1, "interface": 1, "package": 1, "private": 1, "protected": 1, "public": 1, "static": 1, "yield": 1, "arguments": 1, "S": 10, "OPERATOR": 1, "%": 1, "compound": 1, "assign": 1, "compare": 1, "zero": 1, "fill": 1, "right": 1, "shift": 2, "doubles": 1, "logic": 1, "soak": 1, "access": 1, "range": 1, "splat": 1, "WHITESPACE": 1, "s*#": 1, "##": 1, ".*": 1, "CODE": 1, "MULTI_DENT": 1, "SIMPLESTR": 1, "JSTOKEN": 1, "REGEX": 1, "disallow": 1, "leading": 1, "whitespace": 1, "equals": 1, "signs": 1, "every": 1, "other": 1, "thing": 1, "anything": 1, "escaped": 1, "character": 1, "imgy": 2, "w": 2, "HEREGEX": 1, "#.*": 1, "n/g": 1, "HEREDOC_INDENT": 1, "HEREDOC_ILLEGAL": 1, "//": 1, "LINE_CONTINUER": 1, "s*": 1, "BOOL": 1, "NOT_REGEX.concat": 1, "CALLABLE.concat": 1, "async": 1, "nack": 1, "bufferLines": 3, "pause": 2, "sourceScriptEnv": 3, "join": 8, "exists": 5, "basename": 2, "resolve": 2, "module.exports": 1, "RackApplication": 1, "@configuration": 1, "@root": 8, "@firstHost": 1, "@logger": 1, "@configuration.getLogger": 1, "@readyCallbacks": 3, "@quitCallbacks": 3, "@statCallbacks": 3, "ready": 1, "@state": 11, "@readyCallbacks.push": 1, "@initialize": 2, "quit": 1, "@quitCallbacks.push": 1, "@terminate": 2, "queryRestartFile": 1, "fs.stat": 1, "stats": 1, "@mtime": 5, "lastMtime": 2, "stats.mtime.getTime": 1, "setPoolRunOnceFlag": 1, "@statCallbacks.length": 1, "alwaysRestart": 2, "@pool.runOnce": 1, "statCallback": 2, "@statCallbacks.push": 1, "loadScriptEnvironment": 1, "env": 18, "async.reduce": 1, "scriptExists": 2, "loadRvmEnvironment": 1, "rvmrcExists": 2, "rvm": 1, "@configuration.rvmPath": 1, "rvmExists": 2, "libexecPath": 1, "before": 2, ".trim": 1, "loadEnvironment": 1, "@queryRestartFile": 2, "@loadScriptEnvironment": 1, "@configuration.env": 1, "@loadRvmEnvironment": 1, "initialize": 1, "@quit": 3, "@loadEnvironment": 1, "@logger.error": 3, "@pool": 2, "nack.createPool": 1, "size": 1, ".POW_WORKERS": 1, "@configuration.workers": 1, "idle": 1, ".POW_TIMEOUT": 1, "@configuration.timeout": 1, "@pool.stdout": 1, "@logger.info": 1, "@pool.stderr": 1, "@logger.warning": 1, "@pool.on": 2, "process": 2, "@logger.debug": 2, "readyCallback": 2, "terminate": 1, "@ready": 3, "@pool.quit": 1, "quitCallback": 2, "handle": 1, "req": 4, "res": 3, "next": 3, "resume": 2, "@setPoolRunOnceFlag": 1, "@restartIfNecessary": 1, "req.proxyMetaVariables": 1, "SERVER_PORT": 1, "@configuration.dstPort.toString": 1, "@pool.proxy": 1, "restart": 1, "restartIfNecessary": 1, "mtimeChanged": 2, "@restart": 1, "writeRvmBoilerplate": 1, "powrc": 3, "boilerplate": 2, "@constructor.rvmBoilerplate": 1, "fs.readFile": 1, "contents": 2, "contents.indexOf": 1, "fs.writeFile": 1, "@rvmBoilerplate": 1, "dnsserver": 1, "exports.Server": 1, "Server": 2, "dnsserver.Server": 1, "NS_T_A": 3, "NS_T_NS": 2, "NS_T_CNAME": 1, "NS_T_SOA": 2, "NS_C_IN": 5, "NS_RCODE_NXDOMAIN": 2, "domain": 6, "@rootAddress": 2, "@domain": 3, "domain.toLowerCase": 1, "@soa": 2, "createSOA": 2, "@on": 1, "@handleRequest": 1, "handleRequest": 1, "question": 5, "req.question": 1, "subdomain": 10, "@extractSubdomain": 1, "question.name": 3, "isARequest": 2, "res.addRR": 2, "subdomain.getAddress": 1, ".isEmpty": 1, "isNSRequest": 2, "res.header.rcode": 1, "res.send": 1, "extractSubdomain": 1, "name": 5, "Subdomain.extract": 1, "question.type": 2, "question.class": 2, "mname": 2, "rname": 2, "serial": 2, "Date": 1, ".getTime": 1, "refresh": 2, "retry": 2, "expire": 2, "minimum": 2, "dnsserver.createSOA": 1, "exports.createServer": 1, "address": 4, "exports.Subdomain": 1, "Subdomain": 4, "@extract": 1, "name.toLowerCase": 1, "offset": 4, "name.length": 1, "domain.length": 1, "name.slice": 2, "@for": 2, "IPAddressSubdomain.pattern.test": 1, "IPAddressSubdomain": 2, "EncodedSubdomain.pattern.test": 1, "EncodedSubdomain": 2, "@subdomain": 1, "@address": 2, "@labels": 2, ".split": 1, "@length": 3, "@labels.length": 1, "isEmpty": 1, "getAddress": 3, "@pattern": 2, "@labels.slice": 1, "a": 2, "z0": 2, "decode": 2, "exports.encode": 1, "encode": 1, "ip": 2, "byte": 2, "ip.split": 1, "<<": 1, "PATTERN": 1, "exports.decode": 1, "PATTERN.test": 1, "ip.push": 1, "ip.join": 1 }, "ColdFusion": { "-": 12, "": 1, "": 1, "": 1, "Date": 1, "Functions": 1, "": 1, "": 1, "": 1, "": 15, "RightNow": 7, "Now": 1, "": 3, "#RightNow#": 1, "
": 8, "#DateFormat": 2, "(": 8, ")": 8, "#": 8, "#TimeFormat": 2, "#IsDate": 3, "#DaysInMonth": 1, "
": 3, "x=": 1, "y=": 1, "z=": 1, "group=": 1, "#x#": 1, "#y#": 1, "#z#": 1, "": 1, "": 1, "person": 2, "Paul": 1, "greeting": 2, "Hello": 2, "world": 1, "a": 7, "5": 1, "b": 7, "10": 1, "c": 6, "MOD": 1, "comment": 1 }, "ColdFusion CFC": { "component": 1, "extends": 1, "singleton": 1, "{": 22, "//": 16, "DI": 1, "property": 10, "name": 10, "inject": 10, ";": 55, "ContentService": 1, "function": 12, "init": 2, "(": 58, "entityName": 2, ")": 58, "it": 1, "super.init": 1, "arguments.entityName": 1, "useQueryCaching": 1, "true": 12, "Test": 1, "scope": 1, "coloring": 1, "in": 1, "pygments": 1, "this.colorTestVar": 1, "cookie.colorTestVar": 1, "client.colorTestVar": 1, "session.colorTestVar": 1, "application.colorTestVar": 1, "return": 11, "this": 10, "}": 22, "clearAllCaches": 1, "boolean": 6, "async": 7, "false": 7, "var": 15, "settings": 6, "settingService.getAllSettings": 6, "asStruct": 6, "Get": 6, "appropriate": 6, "cache": 12, "provider": 6, "cacheBox.getCache": 6, "settings.cb_content_cacheName": 6, "cache.clearByKeySnippet": 3, "keySnippet": 3, "arguments.async": 3, "clearAllPageWrapperCaches": 1, "clearPageWrapperCaches": 1, "required": 5, "any": 5, "slug": 2, "clearPageWrapper": 1, "cache.clear": 3, "searchContent": 1, "searchTerm": 1, "numeric": 2, "max": 2, "offset": 2, "asQuery": 2, "sortOrder": 2, "isPublished": 1, "searchActiveContent": 1, "results": 2, "c": 1, "newCriteria": 1, "only": 1, "published": 1, "content": 2, "if": 4, "isBoolean": 1, "arguments.isPublished": 3, "Published": 2, "bit": 1, "c.isEq": 1, "javaCast": 1, "eq": 1, "evaluate": 1, "other": 1, "params": 1, "c.isLt": 1, "now": 2, ".": 1, "or": 3, "c.restrictions.isNull": 1, "c.restrictions.isGT": 1, ".isEq": 1, "Search": 1, "Criteria": 1, "len": 1, "arguments.searchTerm": 1, "like": 1, "disjunctions": 1, "c.createAlias": 1, "Do": 1, "we": 1, "search": 1, "title": 2, "and": 2, "active": 1, "just": 1, "arguments.searchActiveContent": 1, "c.": 1, "c.restrictions.like": 2, "else": 1, "c.like": 1, "run": 1, "criteria": 1, "query": 1, "projections": 1, "count": 1, "results.count": 1, "c.count": 1, "results.content": 1, "c.resultTransformer": 1, "c.DISTINCT_ROOT_ENTITY": 1, ".list": 1, "arguments.offset": 1, "arguments.max": 1, "arguments.sortOrder": 1, "arguments.asQuery": 1, "private": 4, "syncUpdateHits": 1, "contentID": 1, "q": 1, "new": 1, "Query": 1, "sql": 1, ".execute": 1, "closureTest": 1, "methodCall": 1, "param1": 2, "arg1": 4, "arg2": 2, "StructliteralTest": 1, "foo": 3, "bar": 1, "brad": 3, "func": 1, "array": 1, "[": 2, "wood": 2, "null": 2, "]": 2, "last": 1, "arrayliteralTest": 1, "": 1, "": 2, "name=": 4, "access=": 2, "returntype=": 2, "": 2, "type=": 2, "required=": 2, "": 2, "myVariable": 1, "arguments": 2, "": 1, "": 2, "": 1, "structKeyExists": 1, "writeoutput": 1, "Argument": 1, "exists": 1, "": 1, "": 1 }, "Common Lisp": { ";": 404, "-": 608, "*": 7, "Mode": 1, "Lisp": 1, "Package": 1, "LISP": 1, "This": 1, "file": 1, "is": 7, "part": 1, "of": 4, "xyzzy.": 1, "(": 1936, "provide": 1, ")": 1953, "in": 26, "package": 5, "export": 5, "t": 36, "null": 6, "type": 26, "character": 4, "base": 1, "standard": 1, "char": 4, "extended": 1, "test": 74, "#": 57, "setq": 58, "car": 52, "si": 5, "canonicalize": 1, "cond": 19, "or": 10, "eq": 17, "member": 16, "defun": 110, "check": 3, "array": 35, "initialize": 3, "option": 3, "ies": 6, "p": 32, "ics": 9, "displaced": 13, "to": 14, "let": 34, "x": 131, "and": 24, "incf": 9, "when": 19, "error": 10, "make": 19, "vector": 15, "length": 28, "&": 74, "key": 91, "element": 24, "initial": 14, "nil": 72, "contents": 5, "fill": 7, "pointer": 4, "adjustable": 5, "index": 6, "offset": 4, "upgraded": 2, "*make": 2, "*copy": 1, "into": 3, "seq": 50, "dimensions": 6, "rest": 48, "integerp": 2, "apply": 8, "dims": 8, "list": 72, "rank": 6, "stack": 7, "dolist": 13, "push": 21, "elt": 12, "dotimes": 7, "i": 33, "total": 2, "size": 8, "setf": 27, "row": 1, "major": 1, "aref": 4, "do": 17, "cdr": 32, "j": 8, "pop": 14, "<": 7, "dimension": 1, "r": 17, "nth": 5, "return": 9, "copy": 5, "partially": 2, "old": 5, "new": 9, "*replace": 1, "src": 14, "dst": 1, "let*": 10, "mapcar": 7, "s": 18, "minusp": 3, "common.l": 1, "commonLisp": 1, "features": 1, "for": 6, "eus": 1, "Copyright": 2, "c": 4, "Toshihiro": 1, "MATSUI": 1, "Electrotechnical": 1, "Laboratory": 1, "Aug": 1, "Feb": 1, "Jun": 2, "defclass": 3, "macroexpand": 5, "prog1": 4, "loop": 4, "unless": 15, "until": 2, "pushnew": 3, "inc": 11, "dec": 1, "decf": 2, "find": 14, "if": 72, "not": 56, "position": 7, "count": 26, "pairlis": 3, "sequence": 2, "replace": 3, "transpose": 2, "remove": 10, "delete": 11, "substitute": 7, "nsubstitute": 7, "unique": 7, "duplicates": 3, "extream": 2, "send": 14, "super": 8, "lexpr": 2, "all": 6, "resend": 1, "super*": 2, "send*": 3, "instance": 4, "instance*": 2, "defclassmethod": 2, "method": 5, "class": 9, "defstruct": 2, "readtablep": 1, "readtable": 1, "set": 5, "syntax": 1, "from": 12, "collect": 3, "instances": 1, "zerop": 5, "plusp": 2, "oddp": 2, "evenp": 2, "/": 5, "logandc1": 2, "logandc2": 2, "ecase": 2, "every": 3, "some": 3, "reduce": 1, "merge": 3, "expt": 2, "signum": 2, "defsetf": 2, "define": 3, "multiple": 5, "value": 13, "bind": 2, "rad2deg": 2, "deg2rad": 2, "version": 6, "lisp": 8, "implementation": 6, "format": 4, "cdddr": 5, "*OS": 1, "VERSION*": 1, "cadr": 16, "caddr": 8, "euserror": 1, "basic": 1, "macros": 4, "eval": 15, "load": 6, "form": 13, "macroexpand2": 2, "while": 10, "listp": 9, "macro": 8, "function": 7, "defmacro": 40, "fname": 3, "fdef": 1, "progn": 11, "lambda": 14, "args": 9, "first": 8, "gensym": 15, ".": 28, "forms": 11, "tag": 6, "block": 4, "tagbody": 4, "@forms": 3, "go": 2, "pred": 20, "condition": 2, "item": 36, "place": 19, "cons": 28, "var": 66, "optional": 12, "h": 12, "+": 44, "defvar": 6, "init": 6, "doc": 6, "symbolp": 8, "eql": 3, "vtype": 1, "boundp": 1, "global": 4, "special": 2, "defconstant": 3, "sym": 2, "val": 7, "declare": 6, "decl": 7, "vars": 22, "lists": 3, "symbols": 4, "v": 35, "pkg": 2, "*package*": 1, "pkgv": 3, "svec": 4, "symvector": 1, "apackage": 3, "packages": 1, "psetq": 2, "varvals": 4, "vals": 4, "gvars": 5, "nreverse": 12, "endtest": 3, "body": 17, "consp": 6, "@body": 7, "mapcan": 2, "cddr": 11, "prog": 1, "prog*": 1, "case": 2, "casebody": 1, "otherwise": 1, "quote": 6, "head": 5, "case1": 2, "keyvar": 6, "clauses": 5, "atom": 8, "classcasehead": 1, "memq": 3, "derivedp": 2, "classcase1": 1, "symbol": 5, "alias": 5, "caaar": 1, "caar": 3, "caadr": 1, "cadar": 1, "cdar": 3, "cdaar": 1, "cdadr": 1, "cddar": 1, "fourth": 1, "fifth": 1, "sixth": 1, "seventh": 1, "cddddr": 3, "eighth": 1, "cadddr": 3, "|": 16, "caaddr": 1, "cdaddr": 1, "caddddr": 1, "flatten": 4, "l": 20, "accumulator": 4, "insert": 1, "pos": 5, "nconc": 3, "tail": 2, "nthcdr": 7, "rplacd": 2, "lst": 6, "n": 22, "adjoin": 1, "identity": 20, "union": 1, "list1": 9, "list2": 9, "result": 21, "funcall": 13, "reverse": 2, "intersection": 1, "difference": 1, "l1": 15, "exclusive": 1, "result1": 3, "result2": 3, "l2": 11, "rotate": 1, "append": 3, "last": 1, "tree": 12, "subst": 4, "nreconc": 1, "y": 16, "rassoc": 2, "alist": 9, "a": 14, "equal": 5, "acons": 1, "datum": 2, "supermember": 1, "assoc": 3, "superassoc": 1, "subsetp": 1, "sub": 1, "system": 15, "raw": 11, "start": 31, "end": 34, "klass": 4, "dlist": 2, "dest": 12, "start1": 6, "end1": 3, "start2": 7, "end2": 3, "min": 1, "aset": 1, "universal": 2, "newitem": 8, "olditem": 4, "message": 5, "self": 1, "selector": 2, "msgs": 4, "metaclass": 6, "target": 1, "obj": 7, "mesg": 1, "cls": 6, "instantiate": 6, "@message": 2, "inst": 3, "setslot": 1, "string": 4, "classname": 2, "methods": 5, "defmethod": 1, "name": 18, "classobj": 8, "methodname": 2, "metaklass": 3, "variables": 17, "coerce": 8, "types": 6, "forwards": 6, "varlist": 1, "forward": 1, "etype": 1, "assq": 1, "putprop": 4, "documentation": 5, "slot": 1, "access": 15, "functions": 1, "accessor": 2, "intern": 1, "concatenate": 1, "slots": 4, "functionp": 2, "numberp": 1, "logbitp": 2, "n1": 2, "n2": 2, "logand": 2, "lognot": 2, "arg": 5, "more": 3, "aux": 6, "seq1": 5, "seq2": 5, "i1": 6, "i2": 6, "e1": 4, "e2": 4, "e": 6, "arithmetics": 1, "b": 14, "ix": 8, "integer": 1, "ash": 1, "exp": 2, "log": 1, "abs": 1, "rad": 2, "pi": 2, "deg": 2, "C": 1, "Taiichi": 1, "Yuasa": 1, "Masami": 1, "Hagiya": 1, "All": 1, "rights": 1, "reserved.": 1, "routines": 1, "Modified": 1, "by": 1, "T.Matsui": 1, "be": 3, "run": 1, "on": 2, "euslisp": 1, "DEFSETF": 1, "macro.": 2, "fn": 15, "endp": 2, "stringp": 1, "DEFINE": 1, "SETF": 1, "METHOD": 1, "@rest": 1, "The": 3, "expansion": 3, "SETF.": 1, "expand": 3, "newvalue": 2, "g": 4, "update": 1, "@": 1, "get": 7, "structure": 1, "d": 4, "MULTI": 1, "VALUE": 2, "simulation": 1, "vlist": 4, "inits": 3, "vilist": 3, "tempvar": 1, "second": 4, "values": 1, "vec": 5, "quick": 2, "sort": 2, "rplaca": 1, "vectorp": 1, "exe_name": 1, "hello": 2, "link_order": 1, "world": 1, "DEFUN": 1, "HELLO": 2, "PRINT": 1, "@file": 1, "advanced.cl": 1, "@breif": 1, "Advanced": 1, "practices": 1, "defining": 1, "your": 1, "own": 1, "Macro": 1, "definition": 1, "skeleton": 1, "parameter*": 1, "form*": 1, "Note": 2, "that": 5, "backquote": 1, "expression": 2, "most": 2, "often": 1, "used": 2, "the": 35, "primep": 4, "number": 2, "prime": 12, "mod": 1, "sqrt": 1, "next": 11, "bigger": 1, "than": 1, "specified": 2, "recommended": 1, "procedures": 1, "writting": 1, "are": 2, "as": 1, "follows": 1, "Write": 2, "sample": 2, "call": 2, "code": 2, "it": 2, "should": 1, "primes": 3, "Expected": 1, "expanded": 1, "codes": 1, "generate": 1, "hardwritten": 1, "arguments": 1, "range": 4, "third": 2, "More": 1, "concise": 1, "implementations": 1, "with": 7, "synonym": 1, "also": 1, "emits": 1, "friendly": 1, "messages": 1, "incorrent": 1, "input.": 1, "Test": 1, "gensyms": 4, "Define": 1, "note": 1, "how": 1, "comma": 1, "interpolate": 1, "names": 2, "ESCUELA": 1, "POLITECNICA": 1, "SUPERIOR": 1, "UNIVERSIDAD": 1, "AUTONOMA": 1, "DE": 1, "MADRID": 1, "INTELIGENCIA": 1, "ARTIFICIAL": 1, "Motor": 1, "de": 2, "inferencia": 1, "Basado": 1, "en": 2, "parte": 1, "Peter": 1, "Norvig": 1, "Global": 1, "*hypothesis": 1, "list*": 7, "*rule": 4, "*fact": 2, "Constants": 1, "fail": 10, "no": 6, "bindings": 45, "man": 3, "luis": 1, "pedro": 1, "woman": 2, "mart": 1, "daniel": 1, "laura": 1, "facts": 1, "unify": 12, "hypothesis": 10, "____________________________________________________________________________": 5, "FUNCTION": 3, "FIND": 1, "RULES": 2, "COMMENTS": 3, "Returns": 2, "rules": 5, "whose": 1, "THENs": 1, "term": 1, "given": 3, "": 2, "satisfy": 1, "this": 1, "requirement": 1, "renamed.": 1, "EXAMPLES": 2, "renamed": 3, "rule": 17, "rename": 1, "then": 7, "FROM": 1, "solutions": 1, "found": 5, "using": 1, "": 1, "single": 1, "can": 4, "have": 1, "solutions.": 1, "R1": 2, "pertenece": 3, "E": 4, "_": 8, "R2": 2, "Xs": 2, "Then": 1, "EVAL": 2, "RULE": 2, "PERTENECE": 6, "E.42": 2, "returns": 4, "NIL": 3, "That": 2, "query": 4, "proven": 2, "binding": 17, "necessary": 2, "fact": 4, "has": 1, "On": 1, "other": 1, "hand": 1, "E.49": 2, "XS.50": 2, "R2.": 1, "ifs": 1, "NOT": 2, "question": 1, "T": 1, "equality": 2, "UNIFY": 1, "Finds": 1, "general": 1, "unifier": 1, "two": 2, "input": 2, "expressions": 2, "taking": 1, "account": 1, "": 1, "In": 1, "unification.": 1, "Otherwise": 1, "which": 1, "constant": 1, "anonymous": 4, "variable": 6, "Auxiliary": 1, "Functions": 1, "lookup": 5, "occurs": 5, "extend": 2, "anywhere": 6, "predicate": 8, "so": 4, "far": 4, "gentemp": 2, "s/reuse": 1, "cons/cons": 1, "expresion": 2, "EOF": 1, "TURTLE": 1, "@PREFIX": 5, "TRIPLES": 10, "URIREF": 30, "PREDICATE": 44, "OBJECT": 44, "LIST": 44, "#1": 1, "OBJECTS": 44, "QNAME": 48, "STRING": 20, "#1#": 9, "foo": 4, "Header": 2, "comment.": 8, "*foo*": 2, "execute": 2, "compile": 2, "toplevel": 4, "add": 2, "z": 4, "ignore": 2, "Inline": 2, "Multi": 2, "line": 4, "After": 2 }, "Component Pascal": { "MODULE": 2, "ObxControls": 1, ";": 123, "IMPORT": 2, "Dialog": 1, "Ports": 1, "Properties": 1, "Views": 1, "CONST": 1, "beginner": 5, "advanced": 3, "expert": 1, "guru": 2, "TYPE": 1, "View": 6, "POINTER": 2, "TO": 2, "RECORD": 2, "(": 91, "Views.View": 2, ")": 94, "size": 1, "INTEGER": 10, "END": 31, "VAR": 9, "data*": 1, "class*": 1, "list*": 1, "Dialog.List": 1, "width*": 1, "predef": 12, "ARRAY": 2, "OF": 2, "PROCEDURE": 12, "SetList": 4, "BEGIN": 13, "IF": 11, "data.class": 5, "THEN": 12, "data.list.SetLen": 3, "data.list.SetItem": 11, "ELSIF": 1, "ELSE": 3, "v": 6, "CopyFromSimpleView": 2, "source": 2, "v.size": 10, ".size": 1, "Restore": 2, "f": 1, "Views.Frame": 1, "l": 1, "t": 1, "r": 7, "b": 1, "[": 13, "]": 13, "f.DrawRect": 1, "Ports.fill": 1, "Ports.red": 1, "HandlePropMsg": 2, "msg": 2, "Views.PropMessage": 1, "WITH": 1, "Properties.SizePref": 1, "DO": 4, "msg.w": 1, "msg.h": 1, "ClassNotify*": 1, "op": 4, "from": 2, "to": 5, "Dialog.changed": 2, "OR": 4, "&": 8, "data.list.index": 3, "data.width": 4, "Dialog.Update": 2, "data": 2, "Dialog.UpdateList": 1, "data.list": 1, "ClassNotify": 1, "ListNotify*": 1, "ListNotify": 1, "ListGuard*": 1, "par": 2, "Dialog.Par": 2, "par.disabled": 1, "ListGuard": 1, "WidthGuard*": 1, "par.readOnly": 1, "#": 3, "WidthGuard": 1, "Open*": 1, "NEW": 2, "*": 1, "Ports.mm": 1, "Views.OpenAux": 1, "Open": 1, "ObxControls.": 1, "ObxFact": 1, "Stores": 1, "Models": 1, "TextModels": 1, "TextControllers": 1, "Integers": 1, "Read": 3, "TextModels.Reader": 2, "x": 15, "Integers.Integer": 3, "i": 17, "len": 5, "beg": 11, "ch": 14, "CHAR": 3, "buf": 5, "r.ReadChar": 5, "WHILE": 3, "r.eot": 4, "<=>": 1, "ReadChar": 1, "ASSERT": 1, "eot": 1, "<": 8, "r.Pos": 2, "-": 1, "REPEAT": 3, "INC": 4, "UNTIL": 3, "+": 1, "r.SetPos": 2, "X": 1, "Integers.ConvertFromString": 1, "Write": 3, "w": 4, "TextModels.Writer": 2, "Integers.Sign": 2, "w.WriteChar": 3, "Integers.Digits10Of": 1, "DEC": 1, "Integers.ThisDigit10": 1, "Compute*": 1, "end": 6, "n": 3, "s": 3, "Stores.Operation": 1, "attr": 3, "TextModels.Attributes": 1, "c": 3, "TextControllers.Controller": 1, "TextControllers.Focus": 1, "NIL": 3, "c.HasSelection": 1, "c.GetSelection": 1, "c.text.NewReader": 1, "r.ReadPrev": 2, "r.attr": 1, "Integers.Compare": 1, "Integers.Long": 3, "MAX": 1, "LONGINT": 1, "SHORT": 1, "Integers.Short": 1, "Integers.Product": 1, "Models.BeginScript": 1, "c.text": 2, "c.text.Delete": 1, "c.text.NewWriter": 1, "w.SetPos": 1, "w.SetAttr": 1, "Models.EndScript": 1, "Compute": 1, "ObxFact.": 1 }, "Cool": { "class": 7, "List": 8, "{": 27, "isNil": 2, "(": 30, ")": 30, "Bool": 5, "true": 2, "}": 27, ";": 40, "head": 2, "Int": 15, "abort": 2, "tail": 2, "self": 3, "cons": 1, "i": 7, "new": 3, "Cons": 2, ".init": 1, "inherits": 4, "car": 3, "-": 13, "The": 2, "element": 1, "in": 3, "this": 1, "list": 2, "cell": 1, "cdr": 3, "rest": 3, "of": 2, "the": 1, "false": 3, "init": 1, "<": 9, "Sample": 5, "testCondition": 1, "x": 3, "if": 3, "then": 3, "else": 3, "+": 1, "*": 3, "fi": 2, "testLoop": 1, "y": 7, "while": 1, "loop": 1, "not": 1, "condition": 1, "/": 2, "pool": 1, "testAssign": 1, "z": 2, "testCase": 1, "var": 2, "SELF_TYPE": 2, "io": 1, "IO": 3, "<->": 1, "case": 1, "a": 4, "A": 3, "io.out_string": 4, "b": 3, "B": 2, "s": 1, "o": 1, "Object": 1, "esac": 1, "testLet": 1, "let": 2, "c": 2, "C": 1, "main": 2, ".testLet": 1, "Main": 1, "out_string": 1 }, "Coq": { "Require": 33, "Import": 24, "Coq.NArith.NArith.": 1, "ListString.All.": 3, "Local": 2, "Open": 3, "Scope": 2, "type.": 3, "Module": 19, "Command.": 2, "Inductive": 51, "t": 135, "|": 1551, "AskCard": 2, "AskPIN": 2, "CheckPIN": 2, "(": 1290, "pin": 5, "N": 9, ")": 1288, "AskAmount": 2, "CheckAmount": 2, "amount": 5, "GiveCard": 2, "GiveAmount": 2, "ShowError": 2, "message": 5, "LString.t": 2, ".": 494, "Definition": 73, "answer": 9, "command": 20, "Type": 151, "match": 62, "with": 103, "bool": 133, "option": 63, "_": 1469, "unit": 1, "end.": 47, "End": 19, "C.": 5, "Ret": 5, "Call": 9, "forall": 263, "Command.t": 11, "Command.answer": 9, "-": 2296, "t.": 6, "Arguments": 13, "Ret.": 2, "_.": 1, "Notations.": 2, "ret": 4, "apply": 251, "{": 28, "A": 44, "B": 33, "}": 28, "f": 39, "x": 209, "x.": 7, "Notation": 56, "fun": 17, "X": 203, "at": 30, "level": 28, "ident": 13, "Y": 44, "Export": 12, "SfLib.": 2, "AExp.": 2, "aexp": 30, "ANum": 18, "nat": 51, "APlus": 14, "AMinus": 9, "AMult": 9, "aexp.": 1, "bexp": 22, "BTrue": 10, "BFalse": 11, "BEq": 9, "BLe": 9, "BNot": 9, "BAnd": 10, "bexp.": 1, "Fixpoint": 26, "aeval": 46, "e": 53, "n": 171, "a1": 44, "a2": 43, "+": 114, "*": 57, "Example": 21, "test_aeval1": 1, "Proof.": 172, "reflexivity.": 133, "Qed.": 138, "beval": 16, "true": 37, "false": 23, "beq_nat": 19, "ble_nat": 4, "b1": 26, "negb": 6, "b2": 12, "andb": 5, "optimize_0plus": 15, "a": 87, "e2": 54, "e1": 62, "test_optimize_0plus": 1, "Theorem": 73, "optimize_0plus_sound": 4, "e.": 16, "intros": 144, "induction": 43, "Case": 34, "destruct": 151, "e1.": 1, "SCase": 24, "n.": 18, "SSCase": 3, "simpl.": 27, "IHe2.": 10, "rewrite": 115, "simpl": 80, "in": 259, "IHe1.": 11, "aexp_cases": 3, ";": 309, "try": 25, "IHe1": 6, "IHe2": 6, "reflexivity": 10, "optimize_0plus_all": 2, "b": 68, "Tactic": 28, "tactic": 9, "first": 18, "c": 83, "[": 202, "Case_aux": 38, "]": 196, "optimize_0plus_all_sound": 1, "bexp_cases": 4, "optimize_and": 5, "optimize_and_sound": 1, "IHe": 2, "aevalR_first_try.": 2, "aevalR": 18, "Prop": 32, "E_Anum": 1, "E_APlus": 2, "n1": 48, "n2": 44, "E_AMinus": 2, "E_AMult": 2, "Reserved": 4, "E_ANum": 1, "where": 6, "bevalR": 11, "E_BTrue": 1, "E_BFalse": 1, "E_BEq": 1, "E_BLe": 1, "E_BNot": 1, "E_BAnd": 1, "aeval_iff_aevalR": 9, "<->": 15, "split.": 14, "H": 67, "subst": 31, "generalize": 6, "dependent": 8, "constructor": 2, "IHa1": 1, "IHa2": 1, "beval_iff_bevalR": 1, "b.": 14, "H.": 92, "*.": 97, "H0.": 21, "subst.": 70, "IHbevalR": 1, "IHbevalR1": 1, "IHbevalR2": 1, "a.": 8, "constructor.": 11, "<": 39, "remember": 12, "as": 93, "assert": 39, "a0": 6, "IHa.": 1, "IHa1.": 1, "IHa2.": 1, "silly_presburger_formula": 1, "m": 63, "o": 682, "p": 39, "<=>": 6, "3": 2, "Proof": 7, "omega": 5, "Qed": 9, "Id": 7, "id": 7, "id.": 1, "beq_id": 14, "id1": 2, "id2": 2, "beq_id_refl": 1, "i": 11, "i.": 2, "intros.": 7, "beq_nat_refl.": 1, "beq_id_eq": 4, "i1": 14, "i2": 9, "i2.": 8, "i1.": 3, "unfold": 33, "beq_nat_eq": 2, "beq_id_false_not_eq": 1, "n0": 2, "beq_false_not_eq": 1, "inversion": 101, "not_eq_beq_id_false": 1, "false.": 5, "not_eq_beq_false.": 1, "beq_nat_sym": 2, "S": 483, "AId": 4, "com_cases": 1, "SKIP": 5, "IFB": 4, "WHILE": 5, "l": 200, "c1": 14, "c2": 9, "e3": 1, "cl": 1, "st": 113, "/": 123, "E_IfTrue": 2, "THEN": 3, "ELSE": 3, "FI": 3, "E_WhileEnd": 2, "DO": 4, "END": 4, "E_WhileLoop": 2, "ceval_cases": 1, "E_Skip": 1, "E_Ass": 1, "E_Seq": 1, "E_IfFalse": 1, "assignment": 1, "if": 10, "st1": 2, "o.": 38, "IHi1": 3, "Heqst1": 1, "Hceval.": 4, "Hceval": 2, "assumption.": 39, "bval": 2, "ceval_step": 3, "Some": 239, "ceval_step_more": 7, "x1.": 4, "omega.": 5, "H1": 12, "x2.": 2, "IHHce.": 2, "exists": 108, "%": 3, "nat.": 3, "IHHce1.": 1, "IHHce2.": 1, "x0": 18, "plus2": 1, "nx": 3, "ny": 2, "XtimesYinZ": 1, "Z": 15, "ny.": 1, "loop": 2, "contra.": 19, "loopdef.": 1, "Heqloopdef.": 8, "contra1.": 1, "IHcontra2.": 1, "no_whiles": 15, "com": 5, "ct": 3, "cf": 2, "no_Whiles": 10, "noWhilesSKIP": 1, "noWhilesAss": 1, "noWhilesSeq": 1, "noWhilesIf": 1, "no_whiles_eqv": 1, "c.": 3, "noWhilesSKIP.": 1, "noWhilesAss.": 1, "noWhilesSeq.": 1, "IHc1.": 2, "auto.": 15, "eauto": 6, "andb_true_elim1": 4, "IHc2.": 2, "andb_true_elim2": 4, "noWhilesIf.": 1, "andb_true_intro.": 2, "H1.": 28, "no_whiles_terminate": 1, "state": 20, "st.": 7, "update": 2, "IHc1": 2, "H3.": 4, "IHc2": 2, "H2.": 18, "H5.": 1, "x1": 13, "r": 13, "r.": 3, "symmetry": 1, "Heqr.": 1, "H4.": 2, "s": 32, "Heqr": 3, "H4": 3, "H8.": 1, "H10": 1, "assumption": 6, "H0": 10, "H2": 3, "H3": 1, "beval_short_circuit": 5, "end": 18, "beval_short_circuit_eqv": 1, "sinstr": 8, "SPush": 8, "SLoad": 6, "SPlus": 10, "SMinus": 11, "SMult": 11, "sinstr.": 1, "s_execute": 21, "stack": 7, "list": 248, "prog": 18, "cons": 26, "nil": 53, "al": 3, "bl": 3, "s_execute1": 1, "empty_state": 2, "s_execute2": 1, "s_compile": 36, "v": 122, "s_compile1": 1, "execute_theorem": 1, "s1": 19, "other": 20, "other.": 4, "app_ass.": 6, "plus_comm": 1, "mult_comm": 1, "s_compile_correct": 1, "app_nil_end.": 1, "execute_theorem.": 1, "Set": 5, "Implicit": 88, "Arguments.": 4, "Shared.": 3, "LibFix": 2, "LibList.": 2, "JsSyntax": 3, "JsSyntaxAux": 2, "JsCommon": 1, "JsCommonAux": 1, "JsPreliminary.": 2, "JsInterpreterMonads": 2, "JsInterpreter": 2, "JsPrettyInterm": 1, "JsPrettyRules.": 1, "Ltac": 8, "tryfalse_nothing": 1, "goal": 3, "nothing": 3, "tryfalse.": 29, "bool.": 4, "number.": 21, "k": 18, "int.": 13, "string.": 3, "literal.": 2, "object_loc.": 2, "w": 12, "prim.": 2, "value.": 3, "ref.": 2, "ty": 9, "rt": 5, "restype.": 2, "rv": 47, "resvalue.": 2, "lab": 5, "label.": 2, "labs": 18, "label_set.": 2, "R": 194, "res.": 3, "out.": 2, "codetype.": 1, "prop_name.": 2, "str": 24, "strictness_flag.": 2, "mutability.": 2, "Ad": 6, "attributes_data.": 2, "Aa": 11, "attributes_accessor.": 2, "attributes.": 2, "Desc": 11, "descriptor.": 2, "D": 2, "full_descriptor.": 2, "L": 7, "env_loc.": 2, "E": 56, "env_record.": 2, "Ed": 2, "decl_env_record.": 2, "lexical_env.": 2, "O": 63, "object.": 2, "state.": 2, "C": 181, "execution_ctx.": 2, "P": 39, "object_properties_type.": 2, "W": 60, "result.": 1, "expr.": 2, "prog.": 2, "stat.": 2, "T": 48, "Type.": 1, "Record": 1, "runs_type_correct": 26, "runs": 106, "make_runs_type_correct": 1, "runs_type_correct_expr": 1, "runs_type_expr": 1, "red_expr": 44, "expr_basic": 4, "runs_type_correct_stat": 1, "runs_type_stat": 1, "red_stat": 4, "stat_basic": 4, "runs_type_correct_prog": 1, "runs_type_prog": 1, "red_prog": 1, "prog_basic": 4, "runs_type_correct_call": 1, "vs": 7, "runs_type_call": 1, "spec_call": 3, "runs_type_correct_call_prealloc": 1, "args": 33, "runs_type_call_prealloc": 1, "result_some": 34, "specret_out": 16, "spec_call_prealloc": 3, "runs_type_correct_construct": 1, "co": 5, "runs_type_construct": 1, "spec_construct_1": 3, "runs_type_correct_function_has_instance": 2, "lo": 7, "lv": 13, "object_loc": 305, "runs_type_function_has_instance": 1, "spec_function_has_instance_2": 4, "runs_type_correct_get_args_for_apply": 1, "array": 3, "index": 6, "int": 105, "y": 261, "runs_type_get_args_for_apply": 1, "red_spec": 16, "spec_function_proto_apply_get_args": 3, "runs_type_correct_object_has_instance": 1, "runs_type_object_has_instance": 1, "spec_object_has_instance_1": 4, "runs_type_correct_stat_while": 1, "ls": 6, "runs_type_stat_while": 1, "stat_while_1": 3, "runs_type_correct_stat_do_while": 1, "runs_type_stat_do_while": 1, "stat_do_while_1": 3, "runs_type_correct_stat_for_loop": 1, "eo2": 7, "eo3": 7, "runs_type_stat_for_loop": 1, "stat_for_2": 3, "runs_type_correct_object_delete": 1, "runs_type_object_delete": 1, "spec_object_delete": 3, "runs_type_correct_object_get_own_prop": 1, "sp": 6, "runs_type_object_get_own_prop": 1, "spec_object_get_own_prop": 4, "runs_type_correct_object_get_prop": 1, "runs_type_object_get_prop": 1, "spec_object_get_prop": 4, "runs_type_correct_object_get": 1, "runs_type_object_get": 1, "spec_object_get": 4, "runs_type_correct_object_proto_is_prototype_of": 1, "lthis": 4, "runs_type_object_proto_is_prototype_of": 1, "spec_call_object_proto_is_prototype_of_2_3": 3, "runs_type_correct_object_put": 1, "runs_type_object_put": 1, "spec_object_put": 3, "runs_type_correct_equal": 1, "v1": 22, "v2": 17, "runs_type_equal": 1, "spec_equal": 1, "runs_type_correct_to_integer": 1, "runs_type_to_integer": 1, "spec_to_integer": 4, "runs_type_correct_to_string": 1, "runs_type_to_string": 1, "spec_to_string": 6, "runs_type_correct_array_element_list": 1, "oes": 8, "runs_type_array_element_list": 1, "expr_array_3": 3, "runs_type_correct_object_define_own_prop_array_loop": 1, "newLen": 6, "oldLen": 6, "newLenDesc": 9, "newWritable": 8, "throw": 6, "def": 6, "prop_name": 111, "descriptor": 76, "strictness_flag": 35, "specres": 4, "def_correct": 2, "res_out": 17, "spec_object_define_own_prop_1": 4, "builtin_define_own_prop_default": 2, "runs_type_object_define_own_prop_array_loop": 1, "spec_object_define_own_prop_array_3l": 4, "runs_type_correct_array_join_elements": 1, "length": 11, "sep": 3, "runs_type_array_join_elements": 1, "spec_call_array_proto_join_elements": 3, "absurd_neg": 2, "let": 9, "fresh": 9, "introv": 71, "inverts": 29, "Hint": 15, "Constructors": 11, "abort.": 4, "Lemma": 80, "arguments_from_spec_1": 1, "arguments_from": 11, "get_arg": 9, "v.": 11, "arguments_from.": 1, "undef.": 1, "splits*.": 7, "res_overwrite_value_if_empty_empty": 1, "res_overwrite_value_if_empty": 5, "resvalue_empty": 2, "R.": 6, "introv.": 7, "unfolds.": 18, "cases_if": 10, "simpls": 11, "res_type_res_overwrite_value_if_empty": 1, "res_type": 31, "res_overwrite_value_if_empty.": 3, "res_label_res_overwrite_value_if_empty": 1, "res_label": 6, "res_overwrite_value_if_empty_resvalue": 1, "rv1": 3, "rv2": 3, "rv3": 4, "res_normal": 2, "unfolds": 64, "cases_if*.": 4, "get_arg_correct": 1, "num": 4, "LibList.nth": 1, "vs.": 1, "A.": 3, "I.": 6, "lets": 11, "I": 1, "destruct*": 6, "num.": 2, "nth_succ.": 2, "IHA.": 2, "repeat": 11, "nth_def_nil.": 1, "length_cons": 2, "nat_math.": 2, "nth_def_succ.": 1, "get_arg_correct_0": 1, "do": 4, "constructors.": 3, "get_arg_correct_1": 1, "get_arg_correct_2": 1, "get_arg_first_and_rest_correct": 1, "get_arg_first_and_rest": 2, "arguments_first_and_rest": 4, "splits": 18, "Hyp": 5, "Hyp.": 5, "and_impl_left": 3, "P1": 9, "P2": 9, "P3": 2, "P3.": 1, "auto*.": 8, "applys_and_base": 5, "applys": 44, "constr": 30, "A1": 6, "A2": 4, "A3": 2, "constructors_and": 1, "eapply": 10, "intro": 3, "constructors": 1, "exact": 2, "run_callable_correct": 2, "run_callable": 1, "callable": 1, "co.": 1, "E.": 53, "sets_eq": 4, "pick_option": 1, "object_binds": 1, "tryfalse": 5, "o0": 2, "forwards": 22, "pick_option_correct": 6, "EQB": 1, "Monadic": 1, "Lemmas": 1, "Shared": 1, "defs": 1, "eqabort": 10, "o1": 75, "that": 6, "and": 2, "are": 1, "equal": 1, "satisfy": 1, "the": 5, "abort": 10, "predicate": 1, "prove_abort": 2, "solve": 5, "isout": 16, "Pred": 4, "asserts": 9, "is": 4, "fact": 1, "an": 1, "outcome": 1, "satisfies": 1, "out": 213, "o1.": 14, "Unfold": 2, "isout.": 1, "eqabort.": 1, "if_empty_label_out": 2, "K": 97, "if_empty_label": 1, "label_empty": 4, "tt": 4, "eexists": 2, "if_some_out": 1, "oa": 9, "if_some": 1, "if_result_some_out": 2, "resultof": 1, "if_result_some": 1, "if_some_or_default_out": 1, "d": 6, "if_some_or_default": 1, "None": 278, "if_ter_post": 2, "result": 20, "out_div": 6, "out_ter": 35, "if_ter_out": 6, "if_ter": 2, "tryfalse_nothing.": 3, "inverts*": 9, "jauto.": 3, "if_success_state_post": 2, "rv0": 3, "restype_throw": 11, "restype_normal": 3, "ifb": 1, "then": 10, "else": 10, "if_success_state_out": 1, "if_success_state": 1, "&": 120, "WE": 13, "rm": 27, "W.": 2, "eexists.": 4, "inversion_clear": 13, "branch": 10, "substs.": 8, "rl": 1, "simpls.": 10, "if_void_post": 2, "out_void": 1, "if_void_out": 1, "if_void": 1, "if_success_out": 2, "split": 18, "P.": 14, "left*": 10, "right": 15, "S.": 4, "Admitted.": 27, "if_not_throw_post": 2, "Extern": 1, "restype": 1, "congruence.": 5, "if_not_throw_out": 1, "if_not_throw": 1, "substs": 3, "right.": 8, "left": 5, "discriminate": 1, "if_any_or_throw_post": 2, "K1": 10, "K2": 10, "value": 301, "res_value": 3, "if_any_or_throw_out": 1, "if_any_or_throw": 1, "simple*.": 5, "split*.": 1, "forwards*": 5, "if_empty_label_out.": 3, "if_success_or_return_post": 2, "resvalue": 45, "restype_return": 3, "if_success_or_return_out": 1, "if_success_or_return": 1, "if_break_post": 2, "restype_break": 6, "if_break_out": 1, "if_break": 1, "if_value_post": 2, "res_val": 7, "if_value_out": 6, "if_value": 1, "exists___*.": 9, "if_bool_post": 2, "z": 17, "prim_bool": 2, "if_bool_out": 1, "if_bool": 1, "if_object_post": 2, "value_object": 3, "if_object_out": 1, "if_object": 2, "if_string_post": 2, "prim_string": 1, "if_string_out": 1, "if_string": 1, "if_number_post": 2, "prim_number": 1, "if_number_out": 1, "if_number": 1, "if_prim_post": 2, "value_prim": 4, "if_prim_out": 1, "if_prim": 1, "if_abort_out": 2, "if_abort": 1, "if_spec_post": 3, "specret": 92, "specret_val": 8, "if_spec_out": 1, "if_spec": 1, "y.": 18, "s.": 5, "if_ter_spec_post": 2, "res": 22, "if_ter_spec": 2, "if_success_spec_post": 2, "if_success_spec": 1, "if_success": 1, "rename": 9, "into": 9, "Proj": 5, "IH": 25, "Er": 2, "Red": 17, "run_step": 1, "Red.": 1, "run": 64, "auto": 8, "Lem": 5, "run_step_using": 1, "Lem.": 1, "using": 26, "run_simpl.": 5, "or": 5, "run_pre_core": 1, "R1": 5, "K.": 2, "run_pre_lemma": 1, "run_apply": 1, "__my_red_lemma__": 1, "R1.": 4, "run_post.": 5, "run_inv.": 28, "type_of_prim_not_object": 1, "type_of": 1, "type_object.": 1, "Resolve": 2, "type_of_prim_not_object.": 1, "is_lazy_op_correct": 1, "op": 24, "is_lazy_op": 1, "regular_binary_op": 1, "lazy_op": 1, "lazy_op.": 1, "regular_binary_op.": 1, "run_object_method_correct": 10, "run_object_method": 2, "object_method": 1, "z.": 6, "B.": 5, "Bi": 1, "LibOption.map_on_inv": 1, "@pick_option_correct": 3, "Bi.": 1, "exists*": 1, "O.": 6, "run_object_heap_set_extensible_correct": 1, "object_heap_set_extensible": 1, "cases_if.": 5, "red_spec_build_error": 1, "EQX.": 1, "red_spec_build_error_1_no_msg.": 1, "run_error_correct": 6, "run_error_correct_2": 2, "ne": 9, "native_error": 5, "run_error": 5, "spec_error": 3, "apply*": 6, "run_error_correct.": 2, "run_error_correct_2.": 1, "run_simpl_run_error": 1, "run_error_not_some_out_res": 1, "native_error_type": 1, "@specret_out": 1, "set": 1, "execution_ctx_intro": 1, "red_spec_error_or_void_false.": 1, "out_error_or_cst_correct": 4, "red_spec_error_or_cst_false.": 2, "out_error_or_cst": 1, "spec_error_or_cst": 3, "HR.": 79, "case_if.": 20, "applys*": 118, "red_spec_error_or_cst_true.": 1, "run_select_proj_extra_error": 1, "HT": 5, "object_has_prop_correct": 2, "object_has_prop": 1, "spec_object_has_prop": 3, "run_hyp": 6, "M.": 8, "red_spec_object_has_prop": 1, "x0.": 5, "red_spec_object_has_prop_1_default": 1, "runs_type_correct_object_get_prop.": 1, "red_spec_object_has_prop_2.": 1, "decide_def.": 3, "run_object_get_prop_correct": 1, "run_object_get_prop": 1, "run.": 26, "red_spec_object_get_prop.": 1, "run_object_method_correct.": 6, "clear": 24, "red_spec_object_get_prop_1_default.": 1, "red_spec_object_get_prop_2_undef.": 1, "red_spec_object_get_prop_3_null.": 1, "red_spec_object_get_prop_3_not_null.": 1, "run_hyp*.": 2, "red_spec_object_get_prop_2_not_undef.": 1, "object_get_builtin_correct": 1, "vthis": 10, "object_get_builtin": 1, "spec_object_get_1": 5, "let_name": 6, "Mdefault.": 1, "Mdefault_correct": 1, "Mdefault": 1, "builtin_get_default": 1, "HR": 15, "red_spec_object_get_1_default.": 1, "red_spec_object_get_2_undef.": 1, "red_spec_object_get_2_data.": 1, "red_spec_object_get_2_accessor.": 1, "attributes_accessor_get": 1, "red_spec_object_get_3_accessor_undef.": 1, "red_spec_object_get_3_accessor_object.": 1, "EQMdefault.": 1, "Mfunction.": 1, "Mfunction_correct": 1, "Mfunction": 1, "builtin_get_function": 1, "run*": 9, "red_spec_object_get_1_function.": 1, "red_spec_function_get_1_error.": 1, "red_spec_function_get_1_normal.": 1, "EQMfunction.": 1, "Mdefault_correct.": 1, "Mfunction_correct.": 1, "obpm": 2, "red_spec_object_get_args_obj.": 1, "red_spec_object_get_args_obj_1_undef.": 1, "run_hyp.": 1, "red_spec_object_get_args_obj_1_attrs.": 1, "run_object_get_correct": 2, "run_object_get": 1, "red_spec_object_get.": 1, "object_get_builtin_correct.": 2, "object_can_put_correct": 1, "object_can_put": 1, "spec_object_can_put": 3, "CP.": 2, "red_spec_object_can_put": 1, "red_spec_object_can_put_1_default.": 1, "red_spec_object_can_put_2_undef": 1, "lproto": 2, "red_spec_object_can_put_4_null.": 1, "red_spec_object_can_put_4_not_null": 1, "run_object_get_prop_correct.": 2, "red_spec_object_can_put_5_undef.": 1, "red_spec_object_can_put_5_data": 1, "red_spec_object_can_put_6_extens_true.": 1, "red_spec_object_can_put_6_extens_false.": 1, "red_spec_object_can_put_5_accessor.": 1, "red_spec_object_can_put_2_data.": 1, "red_spec_object_can_put_2_accessor.": 1, "object_default_value_correct": 1, "pref": 3, "object_default_value": 1, "spec_object_default_value": 3, "red_spec_object_default_value": 1, "M_correct": 2, "F": 10, "M": 5, "spec_object_default_value_sub_1": 3, "clears": 4, "HK.": 1, "red_spec_object_default_value_sub_1": 1, "run_object_get_correct.": 3, "red_spec_object_default_value_sub_2_callable.": 1, "red_spec_object_default_value_sub_3_prim.": 1, "red_spec_object_default_value_sub_3_object.": 1, "red_spec_object_default_value_sub_2_not_callable.": 1, "EQM.": 1, "let_name.": 15, "red_spec_object_default_value_1_default.": 1, "red_spec_object_default_value_2.": 1, "M_correct.": 2, "red_spec_object_default_value_3.": 1, "red_spec_object_default_value_4.": 1, "to_primitive_correct": 2, "prefo": 3, "to_primitive": 2, "spec_to_primitive": 4, "red_spec_to_primitive_pref_prim.": 1, "red_spec_to_primitive_pref_object.": 1, "object_default_value_correct.": 1, "run_pre.": 4, "run_post": 2, "to_number_correct": 2, "to_number": 2, "spec_to_number": 5, "red_spec_to_number_prim.": 2, "red_spec_to_number_object": 1, "to_primitive_correct.": 2, "red_spec_to_number_1.": 1, "to_string_correct": 2, "to_string": 3, "red_spec_to_string_prim.": 1, "red_spec_to_string_object": 1, "red_spec_to_string_1.": 1, "to_integer_correct": 1, "to_integer": 1, "red_spec_to_integer": 1, "to_number_correct.": 3, "red_spec_to_integer_1.": 1, "to_int32_correct": 2, "to_int32": 3, "spec_to_int32": 3, "red_spec_to_int32": 1, "red_spec_to_int32_1.": 1, "to_uint32_correct": 2, "to_uint32": 4, "spec_to_uint32": 3, "red_spec_to_uint32": 1, "red_spec_to_uint32_1.": 2, "run_select_proj_extra_conversions": 1, "run_object_define_own_prop_array_loop_correct": 1, "run_object_define_own_prop_array_loop": 1, "IH.": 1, "run_object_define_own_prop_array_loop.": 1, "red_spec_object_define_own_prop_array_3l_condition_true.": 1, "EQoldLen": 1, "case_if": 4, "HC1.": 1, "red_spec_object_define_own_prop_5_b.": 1, "red_spec_object_define_own_prop_6b_false_reject.": 1, "red_spec_object_define_own_prop_6b_false_accept.": 1, "red_spec_object_define_own_prop_5_c.": 1, "red_spec_object_define_own_prop_6c_1.": 1, "red_spec_object_define_own_prop_6c_2.": 1, "EQdef.": 1, "red_spec_object_define_own_prop.": 1, "Def.": 1, "red_spec_object_define_own_prop_array_1.": 1, "oldLen.": 1, "red_spec_object_define_own_prop_array_2.": 1, "attributes_data_value": 1, "descValueOpt.": 1, "red_spec_object_define_own_prop_array_2_1.": 1, "red_spec_to_uint32.": 1, "EQoldLen.": 1, "red_spec_object_define_own_prop_array_branch_3_4_3.": 1, "descriptor_value": 3, "EQv": 2, "red_spec_object_define_own_prop_array_3_3c": 1, "newLen.": 1, "red_spec_object_define_own_prop_array_3c": 1, "newLenN.": 2, "case_if*.": 6, "red_spec_object_define_own_prop_array_3d.": 1, "red_spec_object_define_own_prop_array_3e.": 1, "red_spec_object_define_own_prop_array_3f.": 1, "red_spec_object_define_own_prop_array_3g.": 1, "red_spec_object_define_own_prop_array_3g_to_h.": 1, "EQnewLenDesc.": 1, "replace": 1, "by": 2, "red_spec_object_define_own_prop_array_3j.": 1, "case_if*": 6, "n1.": 1, "red_spec_object_define_own_prop_array_to_3l.": 1, "run_object_define_own_prop_array_loop_correct.": 1, "red_spec_object_define_own_prop_array_3k.": 1, "red_spec_object_define_own_prop_array_3h.": 1, "descriptor_writable": 1, "EQnewWritable.": 1, "red_spec_prim_new_object_bool.": 1, "red_spec_prim_new_object_number.": 1, "red_spec_prim_new_object_string.": 1, "to_object_correct": 2, "to_object": 2, "spec_to_object": 4, "hint": 1, "prim_new_object_correct.": 1, "w.": 1, "red_spec_to_object_undef_or_null.": 2, "red_spec_to_object_prim.": 3, "rew_logic*.": 3, "red_spec_to_object_object.": 1, "run_object_prim_value_correct": 1, "run_object_prim_value": 1, "object_prim_value": 1, "runs.": 1, "prim_value_get_correct": 1, "prim_value_get": 1, "spec_prim_value_get": 3, "red_spec_prim_value_get": 1, "to_object_correct.": 5, "red_spec_prim_value_get_1.": 1, "object_put_complete_correct": 1, "object_put_complete": 1, "spec_object_put_1": 3, "red_spec_object_put_1_default": 1, "object_can_put_correct.": 1, "red_spec_object_put_2_true.": 1, "follows_correct": 2, "full_descriptor_undef": 1, "attributes_accessor_of": 1, "follow": 3, "S0": 4, "spec_object_put_3": 3, "S2": 1, "red_spec_object_put_3_not_data": 1, "N.": 2, "tests": 1, "Acc": 2, "attributes_accessor_set": 1, "la": 1, "discriminate.": 28, "red_spec_object_put_5_return.": 3, "red_spec_object_put_4_not_accessor_prim": 1, "let_simpl.": 3, "red_spec_object_put_4_not_accessor_object": 1, "object_define_own_prop_correct.": 2, "arbitrary": 3, "attributes_accessor": 2, "EQfollow": 2, "follows_correct.": 2, "wthis": 1, "red_spec_object_put_3_data_prim.": 1, "out_error_or_void_correct.": 2, "red_spec_object_put_3_data_object": 1, "red_spec_object_put_2_false.": 1, "prim_value_put_correct": 1, "prim_value_put": 1, "spec_prim_value_put": 3, "red_spec_prim_value_put": 1, "red_spec_prim_value_put_1.": 1, "object_put_complete_correct.": 1, "env_record_get_binding_value_correct": 1, "rn": 3, "rs": 3, "env_record_get_binding_value": 1, "spec_env_record_get_binding_value": 3, "red_spec_env_record_get_binding_value": 1, "Heap": 2, "binds_equiv_read_option": 1, "mu": 1, "red_spec_env_record_get_binding_value_1_decl_uninitialized": 1, "red_spec_env_record_get_binding_value_1_decl_initialized": 1, "run_inv": 4, "red_spec_returns": 1, "red_spec_env_record_get_binding_value_1_object": 1, "red_spec_env_record_get_binding_value_obj_2_true": 1, "red_spec_env_record_get_binding_value_obj_2_false": 1, "throw_result_run_error_correct": 1, "throw_result": 1, "spec_error_spec": 3, "throw_result.": 1, "y1": 11, "E2": 1, "Ab": 3, "red_spec_env_record_initialize_immutable_binding": 1, "convert_value_to_boolean": 2, "y2": 9, "spec_expr_get_value_conv": 4, "spec_to_boolean": 3, "if_spec_ter_post_bool": 1, "y2.": 5, "HP.": 2, "y1.": 2, "splits.": 3, "red_spec_expr_get_value_conv.": 5, "left.": 5, "S1": 2, "red_spec_expr_get_value_conv_1.": 3, "red_spec_to_boolean.": 2, "red_spec_expr_get_value_conv_2.": 2, "__.": 1, "if_spec_ter_post_object": 2, "if_spec_post_to_object": 1, "spec_expr_get_value": 3, "lets*": 1, "lift2": 4, "x2": 4, "convert_twice_primitive_correct": 1, "convert_twice_primitive": 1, "spec_convert_twice": 5, "spec_to_primitive_auto": 3, "red_spec_convert_twice.": 3, "red_spec_convert_twice_1.": 3, "lift2.": 3, "red_spec_convert_twice_2.": 3, "convert_twice_number_correct": 1, "convert_twice_number": 1, "convert_twice_string_correct": 1, "convert_twice_string": 1, "get_puremath_op_correct": 1, "get_puremath_op": 1, "puremath_op": 1, "F.": 3, "puremath_op.": 1, "get_inequality_op_correct": 1, "get_inequality_op": 1, "inequality_op": 1, "b2.": 1, "inequality_op.": 1, "get_shift_op_correct": 1, "get_shift_op": 1, "shift_op": 1, "shift_op.": 1, "get_bitwise_op_correct": 1, "get_bitwise_op": 1, "bitwise_op": 1, "bitwise_op.": 1, "run_object_get_own_prop_correct": 1, "run_object_get_own_prop": 1, "red_spec_object_get_own_prop.": 1, "spec_object_get_own_prop_1": 3, "builtin_get_own_prop_default": 1, "Ao": 2, "read_option": 1, "red_spec_object_get_own_prop_1_default": 1, "EQAo": 1, "red_spec_object_get_own_prop_2_some_data": 1, "red_spec_object_get_own_prop_2_none": 1, "EQM": 1, "default": 1, "argument": 1, "object": 1, "red_spec_object_get_own_prop_args_obj": 1, "LTAC": 1, "ARTHUR": 1, "this": 4, "has": 1, "been": 1, "defined": 1, "tactics": 1, "red_spec_object_get_own_prop_args_obj_1_undef": 1, "red_spec_object_get_own_prop_args_obj_1_attrs": 1, "Follow": 1, "spec_args_obj_get_own_prop_4": 3, "RES.": 3, "red_spec_object_get_own_prop_args_obj_4.": 1, "EQfollow.": 1, "red_spec_object_get_own_prop_args_obj_2_undef.": 1, "red_spec_object_get_own_prop_args_obj_2_attrs": 1, "red_spec_object_get_own_prop_args_obj_3.": 1, "red_spec_object_get_own_prop_string.": 1, "red_spec_object_get_own_prop_string_1_undef": 1, "to_int32_correct.": 1, "red_spec_object_get_own_prop_string_2.": 1, "red_spec_object_get_own_prop_string_3_different.": 1, "EQo": 1, "Opv": 1, "run_object_prim_value_correct.": 1, "EQo.": 1, "red_spec_object_get_own_prop_string_3_same": 1, "Opv.": 1, "red_spec_object_get_own_prop_string_4.": 1, "red_spec_object_get_own_prop_string_5.": 1, "red_spec_object_get_own_prop_string_6_outofbounds.": 1, "math.": 2, "red_spec_object_get_own_prop_string_6_inbounds.": 1, "red_spec_object_get_own_prop_string_1_attrs.": 1, "run_function_has_instance_correct": 1, "run_function_has_instance": 1, "red_spec_function_has_instance_2": 1, "red_spec_function_has_instance_3_null.": 1, "red_spec_function_has_instance_3_eq.": 1, "red_spec_function_has_instance_3_neq.": 1, "run_object_has_instance_correct": 1, "run_object_has_instance": 1, "red_spec_object_has_instance_1_function_prim.": 1, "red_spec_object_has_instance_1_function_object": 1, "red_spec_function_has_instance_1_prim.": 1, "red_spec_function_has_instance_1_object.": 1, "runs_type_correct_function_has_instance.": 1, "E1": 1, "red_spec_object_has_instance_after_bind.": 1, "red_spec_function_has_instance_after_bind_1.": 1, "eassumption.": 3, "red_spec_function_has_instance_after_bind_2_some.": 1, "runs_type_correct_object_has_instance.": 1, "red_spec_function_has_instance_after_bind_2_none.": 1, "run_binary_op_correct": 1, "binary_op": 1, "run_binary_op": 1, "expr_binary_op_3": 1, "red_expr_binary_op_add": 1, "convert_twice_primitive_correct.": 2, "w1": 2, "w2": 2, "red_expr_binary_op_add_1_string": 1, "convert_twice_string_correct.": 1, "s2": 1, "red_expr_binary_op_add_string_1.": 1, "red_expr_binary_op_add_1_number": 1, "convert_twice_number_correct.": 2, "red_expr_puremath_op_1.": 2, "red_expr_puremath_op": 1, "get_puremath_op_correct.": 1, "red_expr_shift_op": 1, "get_shift_op_correct.": 2, "red_expr_shift_op_1.": 2, "red_expr_shift_op_2.": 2, "red_expr_bitwise_op.": 1, "get_bitwise_op_correct.": 1, "red_expr_bitwise_op_1.": 1, "red_expr_bitwise_op_2.": 1, "red_expr_inequality_op.": 1, "get_inequality_op_correct.": 1, "red_expr_inequality_op_1": 1, "wa": 2, "wb": 2, "wr": 1, "inequality_test_primitive": 1, "applys_eq*": 1, "red_expr_inequality_op_2": 1, "EQp": 1, "EQwr": 1, "fequals.": 1, "v2.": 2, "red_expr_binary_op_instanceof_non_object.": 1, "red_expr_binary_op_instanceof_normal.": 1, "red_spec_object_has_instance.": 1, "run_object_has_instance_correct.": 1, "red_expr_binary_op_instanceof_non_instance.": 1, "red_expr_binary_op_in_non_object.": 1, "red_expr_binary_op_in_object.": 1, "red_expr_binary_op_in_1.": 1, "object_has_prop_correct.": 1, "red_expr_binary_op_equal.": 1, "runs_type_correct_equal.": 1, "red_expr_binary_op_disequal.": 1, "red_expr_binary_op_disequal_1.": 1, "red_expr_binary_op_strict_equal.": 1, "red_expr_binary_op_strict_disequal.": 1, "red_expr_binary_op_coma.": 1, "array_args_map_loop_no_abort": 2, "array_args_map_loop": 1, "res_empty.": 1, "inductions": 1, "IHoes": 1, "array_args_map_loop_correct": 1, "spec_call_array_new_3": 3, "red_spec_call_object_new_1_null_or_undef.": 2, "red_spec_call_object_new_1_prim.": 3, "red_spec_call_object_new_1_object.": 1, "red_spec_construct_bool.": 1, "get_arg_correct_0.": 2, "arg_len.": 1, "args.": 2, "red_spec_call_array_new_no_args.": 1, "red_spec_call_array_new_1": 1, "red_spec_call_array_new_2.": 1, "red_spec_call_array_new_3_empty.": 1, "get_arg.": 1, "nth_def.": 1, "red_spec_call_array_new_single_arg.": 1, "red_spec_call_array_new_single_allocate": 1, "eassumption": 1, "v0": 1, "E0": 1, "red_spec_call_array_new_single_not_prim_number": 1, "v1.": 1, "Heq_o": 1, "object_with_primitive_value": 1, "object_with_get_own_property": 1, "object_new": 1, "prealloc_string_proto": 1, "builtin_get_own_prop_string": 1, "red_spec_construct_string_2": 1, "red_spec_construct_string_non_empty.": 1, "jauto": 1, "red_spec_construct_string_1": 1, "to_string_correct.": 1, "context": 2, "object_alloc": 2, "JsInit.": 1, "LibTactics": 1, "LibLogic": 1, "LibReflect": 1, "LibList": 1, "LibOperation": 1, "LibStruct": 1, "LibNat": 1, "LibEpsilon": 1, "LibFunc": 1, "LibHeap.": 1, "Flocq.Appli.Fappli_IEEE": 2, "Flocq.Appli.Fappli_IEEE_bits.": 2, "Extraction": 9, "Language": 1, "Ocaml.": 1, "ExtrOcamlBasic.": 1, "ExtrOcamlNatInt.": 1, "ExtrOcamlString.": 1, "Inline": 5, "FixFun3": 1, "FixFun3Mod": 1, "FixFun4": 1, "FixFun4Mod": 1, "FixFunMod": 1, "curry3": 1, "uncurry3": 1, "curry4": 1, "uncurry4.": 1, "epsilon": 1, "epsilon_def": 1, "classicT": 1, "indefinite_description": 1, "Inhab_witness": 1, "Fix": 1, "isTrue.": 1, "Extract": 78, "positive": 1, "float": 4, "Constant": 74, "Z.add": 1, "Z.succ": 1, "Z.pred": 1, "Z.sub": 1, "Z.mul": 1, "Z.opp": 1, "Z.abs": 1, "Z.min": 1, "Z.max": 1, "Z.compare": 1, "Pos.add": 1, "Pos.succ": 1, "Pos.pred": 1, "Pos.sub": 1, "Pos.mul": 1, "Pos.min": 1, "Pos.max": 1, "Pos.compare": 1, "Pos.compare_cont": 1, "N.add": 1, "N.succ": 1, "N.pred": 1, "N.sub": 1, "N.mul": 1, "N.min": 1, "N.max": 1, "N.div": 1, "N.modulo": 1, "N.compare": 1, "Fappli_IEEE.binary_float": 1, "JsNumber.of_int": 1, "JsNumber.nan": 1, "JsNumber.zero": 1, "JsNumber.neg_zero": 1, "JsNumber.one": 1, "JsNumber.infinity": 1, "JsNumber.neg_infinity": 1, "JsNumber.max_value": 1, "JsNumber.min_value": 1, "JsNumber.pi": 1, "JsNumber.e": 1, "JsNumber.ln2": 1, "JsNumber.floor": 1, "JsNumber.absolute": 1, "JsNumber.from_string": 1, "JsNumber.to_string": 1, "JsNumber.add": 1, "JsNumber.sub": 1, "JsNumber.mult": 1, "JsNumber.div": 1, "JsNumber.fmod": 1, "JsNumber.neg": 1, "JsNumber.sign": 1, "JsNumber.number_comparable": 1, "JsNumber.lt_bool": 1, "JsNumber.to_int32": 1, "JsNumber.to_uint32": 1, "JsNumber.modulo_32": 1, "JsNumber.int32_bitwise_not": 1, "JsNumber.int32_bitwise_and": 1, "JsNumber.int32_bitwise_or": 1, "JsNumber.int32_bitwise_xor": 1, "JsNumber.int32_left_shift": 1, "JsNumber.int32_right_shift": 1, "JsNumber.uint32_right_shift": 1, "int_of_char": 1, "ascii_comparable": 1, "lt_int_decidable": 1, "le_int_decidable": 1, "ge_nat_decidable": 1, "prop_eq_decidable": 1, "env_loc_global_env_record": 1, "Fappli_IEEE.Bplus": 1, "Fappli_IEEE.binary_normalize": 2, "Fappli_IEEE_bits.b64_plus.": 1, "Fappli_IEEE.Bmult": 1, "Fappli_IEEE.Bmult_FF": 1, "Fappli_IEEE_bits.b64_mult.": 1, "Fappli_IEEE.Bdiv": 1, "Fappli_IEEE_bits.b64_div.": 1, "AccessOpaque.": 1, "object_prealloc_global_proto": 1, "object_prealloc_global_class": 1, "parse_pickable": 1, "print_endline": 3, "__LOC__": 3, "Not": 1, "implemented": 1, "because": 2, "Prheap.string_of_char_list": 3, "Coq_result_not_yet_implemented": 1, "Stuck": 2, "Coq_result_impossible": 2, "nState": 1, "Prheap.prstate": 1, "nMessage": 1, "Blacklist": 1, "string": 74, "Separate": 1, "run_javascript.": 1, "": 1, "html": 1, "": 1, "lang=": 1, "class=": 500, "": 1, "prefix=": 1, "": 51, "charset=": 3, "": 20, "crossorigin=": 6, "href=": 87, "media=": 3, "rel=": 31, "http": 3, "equiv=": 3, "content=": 49, "name=": 45, "": 1, "jscert/JsNumber.v": 1, "master": 3, "jscert/jscert": 1, "GitHub": 4, "": 1, "type=": 20, "title=": 9, "sizes=": 9, "property=": 7, "data": 185, "pjax": 8, "transient": 3, "value=": 3, "transient=": 1, "color=": 1, "": 1, "": 1, "
": 54, "id=": 226, "
": 54, "": 67, "tabindex=": 2, "Skip": 1, "to": 8, "content": 1, "": 67, "
": 1, "role=": 10, "aria": 53, "label=": 24, "ga": 18, "click=": 18, "": 25, "hidden=": 25, "height=": 36, "version=": 25, "viewBox=": 25, "width=": 36, "": 25, "d=": 25, "": 25, "": 25, "": 10, "": 3, "Sign": 2, "up": 1, "Pricing": 1, "Blog": 2, "Support": 1, "Search": 1, "": 2, "": 4, "
": 2, "accept": 2, "action=": 2, "scoped": 2, "search": 2, "url=": 2, "unscoped": 2, "method=": 2, "style=": 5, "": 5, "": 1, "
": 1, "itemscope": 5, "itemtype=": 5, "container": 1, "
    ": 5, "
  • ": 22, "Watch": 1, "
  • ": 22, "Star": 1, "Fork": 1, "
": 5, "

": 1, "": 137, "itemprop=": 15, "jscert": 3, "": 137, "": 3, "pjax=": 8, "": 3, "

": 1, "selected=": 1, "Code": 1, "Issues": 1, "Pull": 1, "requests": 1, "Projects": 1, "Pulse": 1, "Graphs": 1, "Permalink": 1, "haspopup=": 1, "": 1, "Branch": 1, "": 1, "Switch": 1, "branches/tags": 1, "tab": 7, "filter=": 4, "filter": 5, "Branches": 1, "Tags": 1, "filterable": 4, "for=": 2, "skip": 5, "wellformedness": 1, "Nothing": 2, "show": 2, "popl14": 3, "results": 1, "release": 1, "camera": 1, "ready": 1, "Find": 1, "file": 2, "copied": 1, "hint=": 1, "Copy": 1, "path": 1, "coq": 1, "JsNumber.v": 1, "da30e0c": 1, "": 1, "datetime=": 1, "Jul": 1, "": 1, "": 11, "alt=": 11, "src=": 14, "edgemaster": 2, "Add": 1, "Math.LN2": 1, "facebox=": 2, "contributors": 1, "

": 1, "facebox": 3, "Users": 1, "who": 1, "have": 1, "contributed": 1, "

": 1, "charguer": 1, "brabalan": 1, "Mbodin": 1, "PetarMax": 1, "Raw": 1, "Blame": 1, "History": 1, "lines": 1, "sloc": 1, "KB": 1, "": 1, "size=": 1, "": 107, "": 214, "": 107, "**************************************************************": 8, "**": 16, "for": 2, "number": 27, "IEEE": 1, "floats": 1, "Fappli_IEEE_bits.binary64.": 1, "Particular": 1, "values": 1, "of": 6, "numbers": 4, "LATER": 5, "find": 3, "definitions": 3, "Flocq": 2, "Parameter": 31, "nan": 2, "zero": 2, "neg_zero": 1, "one": 1, "eq_refl": 2, "Fappli_IEEE.mode_NE": 1, "infinity": 1, "neg_infinity": 1, "max_value": 1, "min_value": 1, "pi": 1, "ln2": 1, "Conversions": 2, "on": 3, "implement": 1, "from_string": 1, "gt": 36, "Unary": 1, "operations": 2, "neg": 1, "floor": 1, "absolute": 1, "sign": 1, "returns": 1, "when": 1, "lt_bool": 1, "Binary": 1, "add": 1, "Fappli_IEEE_bits.b64_plus": 1, "Fappli_IEEE.mode_NE.": 3, "sub": 1, "todo": 2, "bind": 2, "fmod": 1, "mult": 1, "Fappli_IEEE_bits.b64_mult": 1, "div": 1, "Fappli_IEEE_bits.b64_div": 1, "Todo": 1, "comparison": 1, "operator": 1, "Global": 1, "Instance": 1, "number_comparable": 1, "Comparable": 1, "Int32": 3, "of_int": 1, "quite": 1, "complex.": 1, "Should": 1, "we": 1, "make": 1, "it": 1, "precise": 1, "Remark": 1, "extracted": 1, "code": 1, "could": 1, "efficiency": 1, "reasons": 1, "use": 1, "Ocaml": 1, "to_int16": 1, "currently": 1, "not": 3, "used": 1, "Check": 1, "OCaml": 1, "extraction": 1, "correct.": 1, "Implements": 2, "operation": 2, "masks": 1, "all": 1, "but": 1, "least": 1, "significant": 1, "bits": 1, "non": 1, "negative": 1, "obtained": 1, "modulo_32": 1, "int32": 1, "int32_bitwise_not": 1, "int32_bitwise_and": 1, "int32_bitwise_or": 1, "int32_bitwise_xor": 1, "int32_left_shift": 1, "int32_right_shift": 1, "uint32_right_shift": 1, "related": 1, "conversion": 1, "
": 214, "line": 108, "number=": 107, "
": 1, "Jump": 1, "Line": 1, "js": 1, "jump": 1, "form": 1, "autofocus": 1, "Go": 1, "Contact": 1, "API": 1, "Training": 1, "Shop": 1, "About": 1, "copy": 1, "Inc.": 1, "Terms": 1, "Privacy": 1, "Security": 1, "Status": 1, "Help": 1, "You": 3, "can": 1, "perform": 1, "action": 1, "time.": 1, "": 3, "async=": 1, "signed": 2, "another": 2, "window.": 2, "Reload": 2, "refresh": 2, "your": 2, "session.": 2, "labelledby=": 1, "describedby=": 1, "": 1, "": 1, "ext_expr": 425, "expr": 58, "expr_identifier_1": 2, "ref": 6, "expr_object_0": 2, "propdefs": 8, "expr_object_1": 2, "expr_object_2": 2, "propbody": 1, "expr_object_3_val": 2, "expr_object_3_get": 2, "expr_object_3_set": 2, "expr_object_4": 2, "expr_object_5": 2, "expr_array_0": 2, "expr_array_1": 2, "expr_array_2": 2, "expr_array_3_1": 2, "expr_array_3_2": 2, "expr_array_3_3": 2, "expr_array_3_4": 2, "expr_array_3_5": 2, "expr_array_add_length": 2, "expr_array_add_length_0": 2, "expr_array_add_length_1": 2, "expr_array_add_length_2": 2, "expr_array_add_length_3": 2, "expr_array_add_length_4": 2, "expr_function_1": 2, "funcbody": 9, "env_loc": 47, "lexical_env": 18, "expr_function_2": 2, "expr_function_3": 2, "expr_access_1": 2, "expr_access_2": 2, "expr_access_3": 2, "expr_access_4": 2, "expr_new_1": 2, "expr_new_2": 2, "expr_call_1": 2, "expr_call_2": 2, "expr_call_3": 2, "expr_call_4": 2, "expr_call_5": 2, "spec_eval": 2, "expr_unary_op_1": 2, "unary_op": 5, "expr_unary_op_2": 2, "expr_delete_1": 2, "expr_delete_2": 2, "expr_delete_3": 2, "expr_delete_4": 2, "expr_typeof_1": 2, "expr_typeof_2": 2, "expr_prepost_1": 2, "expr_prepost_2": 2, "expr_prepost_3": 2, "expr_prepost_4": 2, "expr_unary_op_neg_1": 2, "expr_unary_op_bitwise_not_1": 2, "expr_unary_op_not_1": 2, "expr_conditional_1": 4, "expr_assign_4": 2, "expr_assign_5": 2, "preftype": 6, "spec_to_number_1": 2, "spec_to_integer_1": 2, "spec_to_string_1": 2, "spec_check_object_coercible": 2, "spec_eq": 2, "spec_eq0": 2, "spec_eq1": 2, "spec_eq2": 2, "builtin_get": 1, "spec_object_get_2": 2, "full_descriptor": 37, "spec_object_get_3": 2, "spec_object_can_put_1": 2, "builtin_can_put": 1, "spec_object_can_put_2": 2, "spec_object_can_put_4": 2, "spec_object_can_put_5": 2, "spec_object_can_put_6": 2, "attributes_data": 2, "builtin_put": 1, "spec_object_put_2": 2, "spec_object_put_4": 2, "spec_object_put_5": 2, "spec_object_has_prop_1": 2, "builtin_has_prop": 1, "spec_object_has_prop_2": 2, "spec_object_delete_1": 2, "builtin_delete": 1, "spec_object_delete_2": 2, "spec_object_delete_3": 2, "spec_object_default_value_1": 2, "builtin_default_value": 1, "spec_object_default_value_2": 2, "spec_object_default_value_3": 2, "spec_object_default_value_4": 2, "spec_object_default_value_sub_2": 2, "spec_object_default_value_sub_3": 2, "spec_object_define_own_prop": 2, "builtin_define_own_prop": 1, "spec_object_define_own_prop_2": 2, "spec_object_define_own_prop_3": 2, "spec_object_define_own_prop_4": 2, "attributes": 17, "spec_object_define_own_prop_5": 2, "spec_object_define_own_prop_6a": 2, "spec_object_define_own_prop_6b": 2, "spec_object_define_own_prop_6c": 2, "spec_object_define_own_prop_reject": 2, "spec_object_define_own_prop_write": 2, "spec_prim_value_get_1": 2, "spec_prim_value_put_1": 2, "prim": 2, "spec_object_define_own_prop_array_2": 2, "spec_object_define_own_prop_array_2_1": 2, "spec_object_define_own_prop_array_branch_3_4": 2, "spec_object_define_own_prop_array_branch_4_5": 2, "spec_object_define_own_prop_array_branch_4_5_a": 2, "spec_object_define_own_prop_array_branch_4_5_b": 2, "spec_object_define_own_prop_array_4a": 2, "spec_object_define_own_prop_array_4b": 2, "spec_object_define_own_prop_array_4c": 2, "spec_object_define_own_prop_array_5": 2, "spec_object_define_own_prop_array_3": 2, "spec_object_define_own_prop_array_3c": 2, "spec_object_define_own_prop_array_3d_e": 2, "spec_object_define_own_prop_array_3f_g": 2, "spec_object_define_own_prop_array_3h_i": 2, "spec_object_define_own_prop_array_3j": 2, "spec_object_define_own_prop_array_3k_l": 2, "spec_object_define_own_prop_array_3l_ii": 2, "spec_object_define_own_prop_array_3l_ii_1": 2, "spec_object_define_own_prop_array_3l_ii_2": 2, "spec_object_define_own_prop_array_3l_iii_1": 2, "spec_object_define_own_prop_array_3l_iii_2": 2, "spec_object_define_own_prop_array_3l_iii_3": 2, "spec_object_define_own_prop_array_3l_iii_4": 2, "spec_object_define_own_prop_array_3m_n": 2, "spec_put_value": 2, "spec_env_record_has_binding": 2, "spec_env_record_has_binding_1": 2, "env_record": 6, "spec_env_record_get_binding_value_1": 2, "spec_env_record_get_binding_value_2": 2, "spec_env_record_create_immutable_binding": 2, "spec_env_record_initialize_immutable_binding": 2, "spec_env_record_create_mutable_binding": 2, "spec_env_record_create_mutable_binding_1": 2, "spec_env_record_create_mutable_binding_2": 2, "spec_env_record_create_mutable_binding_3": 2, "spec_env_record_set_mutable_binding": 2, "spec_env_record_set_mutable_binding_1": 2, "spec_env_record_delete_binding": 2, "spec_env_record_delete_binding_1": 2, "spec_env_record_create_set_mutable_binding": 2, "spec_env_record_create_set_mutable_binding_1": 2, "spec_env_record_implicit_this_value": 2, "spec_env_record_implicit_this_value_1": 2, "spec_from_descriptor": 2, "spec_from_descriptor_1": 2, "spec_from_descriptor_2": 2, "spec_from_descriptor_3": 2, "spec_from_descriptor_4": 2, "spec_from_descriptor_5": 2, "spec_from_descriptor_6": 2, "spec_entering_eval_code": 2, "spec_entering_eval_code_1": 2, "spec_entering_eval_code_2": 2, "spec_call_global_eval": 2, "spec_call_global_eval_1": 2, "spec_call_global_eval_2": 2, "spec_call_global_eval_3": 3, "spec_entering_func_code": 2, "spec_entering_func_code_1": 2, "spec_entering_func_code_2": 2, "spec_entering_func_code_3": 2, "spec_entering_func_code_4": 2, "spec_binding_inst_formal_params": 2, "spec_binding_inst_formal_params_1": 2, "spec_binding_inst_formal_params_2": 2, "spec_binding_inst_formal_params_3": 2, "spec_binding_inst_formal_params_4": 2, "spec_binding_inst_function_decls": 2, "funcdecl": 14, "spec_binding_inst_function_decls_1": 2, "spec_binding_inst_function_decls_2": 2, "spec_binding_inst_function_decls_3": 2, "spec_binding_inst_function_decls_3a": 2, "spec_binding_inst_function_decls_4": 2, "spec_binding_inst_function_decls_5": 2, "spec_binding_inst_function_decls_6": 2, "spec_binding_inst_arg_obj": 2, "spec_binding_inst_arg_obj_1": 2, "spec_binding_inst_arg_obj_2": 2, "spec_binding_inst_var_decls": 2, "spec_binding_inst_var_decls_1": 2, "spec_binding_inst_var_decls_2": 2, "spec_binding_inst": 2, "codetype": 7, "spec_binding_inst_1": 2, "spec_binding_inst_2": 2, "spec_binding_inst_3": 2, "spec_binding_inst_4": 2, "spec_binding_inst_5": 2, "spec_binding_inst_6": 2, "spec_binding_inst_7": 2, "spec_binding_inst_8": 2, "spec_make_arg_getter": 2, "spec_make_arg_setter": 2, "spec_args_obj_get_1": 2, "spec_args_obj_define_own_prop_1": 2, "spec_args_obj_define_own_prop_2": 2, "spec_args_obj_define_own_prop_3": 2, "spec_args_obj_define_own_prop_4": 2, "spec_args_obj_define_own_prop_5": 2, "spec_args_obj_define_own_prop_6": 2, "spec_args_obj_delete_1": 2, "spec_args_obj_delete_2": 2, "spec_args_obj_delete_3": 2, "spec_args_obj_delete_4": 2, "spec_arguments_object_map": 2, "spec_arguments_object_map_1": 2, "spec_arguments_object_map_2": 2, "spec_arguments_object_map_3": 2, "spec_arguments_object_map_4": 2, "spec_arguments_object_map_5": 2, "spec_arguments_object_map_6": 2, "spec_arguments_object_map_7": 2, "spec_arguments_object_map_8": 2, "spec_create_arguments_object": 2, "spec_create_arguments_object_1": 2, "spec_create_arguments_object_2": 2, "spec_create_arguments_object_3": 2, "spec_create_arguments_object_4": 2, "spec_object_has_instance": 2, "builtin_has_instance": 1, "spec_function_has_instance_1": 2, "spec_function_has_instance_3": 2, "spec_function_has_instance_after_bind_1": 2, "spec_function_has_instance_after_bind_2": 2, "spec_function_get_1": 2, "spec_function_proto_apply": 2, "spec_function_proto_apply_1": 2, "spec_function_proto_apply_2": 2, "spec_function_proto_apply_3": 2, "spec_function_proto_bind_1": 2, "spec_function_proto_bind_2": 2, "spec_function_proto_bind_3": 2, "spec_function_proto_bind_4": 2, "spec_function_proto_bind_5": 2, "spec_function_proto_bind_6": 2, "spec_function_proto_bind_7": 2, "spec_error_1": 2, "spec_error_or_void": 2, "spec_init_throw_type_error": 2, "spec_init_throw_type_error_1": 2, "spec_build_error": 2, "spec_build_error_1": 2, "spec_build_error_2": 2, "spec_new_object": 2, "spec_new_object_1": 2, "spec_prim_new_object": 2, "spec_creating_function_object_proto": 2, "spec_creating_function_object_proto_1": 2, "spec_creating_function_object_proto_2": 2, "spec_creating_function_object": 2, "spec_creating_function_object_1": 2, "spec_creating_function_object_2": 2, "spec_creating_function_object_3": 2, "spec_creating_function_object_4": 2, "spec_create_new_function_in": 2, "execution_ctx": 2, "spec_call_1": 2, "call": 8, "prealloc": 3, "spec_call_default": 2, "spec_call_default_1": 2, "spec_call_default_2": 2, "spec_call_default_3": 3, "spec_construct": 2, "construct": 1, "spec_construct_prealloc": 2, "spec_construct_default": 2, "spec_construct_default_1": 2, "spec_construct_default_2": 2, "spec_construct_1_after_bind": 2, "spec_call_global_is_nan_1": 2, "spec_call_global_is_finite_1": 2, "spec_call_object_call_1": 2, "spec_call_object_new_1": 2, "spec_call_object_get_proto_of_1": 2, "spec_call_object_is_extensible_1": 2, "spec_call_object_create_1": 2, "spec_call_object_create_2": 2, "spec_call_object_create_3": 2, "spec_call_object_define_props_1": 2, "spec_call_object_define_props_2": 2, "spec_call_object_define_props_3": 2, "spec_call_object_define_props_4": 2, "spec_call_object_define_props_5": 2, "spec_call_object_define_props_6": 2, "spec_call_object_define_props_7": 2, "spec_call_object_seal_1": 2, "spec_call_object_seal_2": 2, "spec_call_object_seal_3": 2, "spec_call_object_seal_4": 2, "spec_call_object_is_sealed_1": 2, "spec_call_object_is_sealed_2": 2, "spec_call_object_is_sealed_3": 2, "spec_call_object_freeze_1": 2, "spec_call_object_freeze_2": 2, "spec_call_object_freeze_3": 2, "spec_call_object_freeze_4": 2, "spec_call_object_freeze_5": 2, "spec_call_object_is_frozen_1": 2, "spec_call_object_is_frozen_2": 2, "spec_call_object_is_frozen_3": 2, "spec_call_object_is_frozen_4": 2, "spec_call_object_is_frozen_5": 2, "spec_call_object_prevent_extensions_1": 2, "spec_call_object_define_prop_1": 2, "spec_call_object_define_prop_2": 2, "spec_call_object_define_prop_3": 2, "spec_call_object_define_prop_4": 2, "spec_call_object_get_own_prop_descriptor_1": 2, "spec_call_object_get_own_prop_descriptor_2": 2, "spec_call_object_proto_to_string_1": 2, "spec_call_object_proto_to_string_2": 2, "spec_call_object_proto_has_own_prop_1": 2, "spec_call_object_proto_has_own_prop_2": 2, "spec_call_object_proto_has_own_prop_3": 2, "spec_call_object_proto_is_prototype_of_2_1": 2, "spec_call_object_proto_is_prototype_of_2_2": 2, "spec_call_object_proto_is_prototype_of_2_4": 2, "spec_call_object_proto_prop_is_enumerable_1": 2, "spec_call_object_proto_prop_is_enumerable_2": 2, "spec_call_object_proto_prop_is_enumerable_3": 2, "spec_call_object_proto_prop_is_enumerable_4": 2, "spec_call_array_new_1": 2, "spec_call_array_new_2": 2, "spec_call_array_new_single_1": 2, "spec_call_array_new_single_2": 2, "spec_call_array_new_single_3": 2, "spec_call_array_new_single_4": 2, "spec_call_array_is_array_1": 2, "spec_call_array_is_array_2_3": 2, "class_name": 1, "spec_call_array_proto_to_string": 2, "spec_call_array_proto_to_string_1": 2, "spec_call_array_proto_join": 2, "spec_call_array_proto_join_1": 2, "spec_call_array_proto_join_2": 2, "spec_call_array_proto_join_3": 2, "spec_call_array_proto_join_4": 2, "spec_call_array_proto_join_5": 2, "spec_call_array_proto_join_elements_1": 2, "spec_call_array_proto_join_elements_2": 2, "spec_call_array_proto_pop_1": 2, "spec_call_array_proto_pop_2": 2, "spec_call_array_proto_pop_3": 2, "spec_call_array_proto_pop_3_empty_1": 2, "spec_call_array_proto_pop_3_empty_2": 2, "spec_call_array_proto_pop_3_nonempty_1": 2, "spec_call_array_proto_pop_3_nonempty_2": 2, "spec_call_array_proto_pop_3_nonempty_3": 2, "spec_call_array_proto_pop_3_nonempty_4": 2, "spec_call_array_proto_pop_3_nonempty_5": 2, "spec_call_array_proto_push_1": 2, "spec_call_array_proto_push_2": 2, "spec_call_array_proto_push_3": 2, "spec_call_array_proto_push_4": 2, "spec_call_array_proto_push_4_nonempty_1": 2, "spec_call_array_proto_push_4_nonempty_2": 2, "spec_call_array_proto_push_4_nonempty_3": 2, "spec_call_array_proto_push_5": 2, "spec_call_array_proto_push_6": 2, "spec_call_string_non_empty": 2, "spec_construct_string_1": 2, "spec_construct_string_2": 2, "spec_construct_bool_1": 2, "spec_call_bool_proto_to_string_1": 2, "spec_call_bool_proto_value_of_1": 2, "spec_call_bool_proto_value_of_2": 2, "spec_call_number_proto_to_string_1": 2, "spec_call_number_proto_to_string_2": 2, "spec_construct_number_1": 2, "spec_call_number_proto_value_of_1": 2, "spec_call_error_proto_to_string_1": 2, "spec_call_error_proto_to_string_2": 2, "spec_call_error_proto_to_string_3": 2, "spec_call_error_proto_to_string_4": 2, "spec_call_error_proto_to_string_5": 2, "spec_call_error_proto_to_string_6": 2, "spec_returns": 2, "ext_stat": 67, "stat": 52, "stat_expr_1": 3, "stat_block_1": 2, "stat_block_2": 3, "stat_label_1": 3, "label": 1, "stat_var_decl_1": 2, "stat_var_decl_item": 2, "stat_var_decl_item_1": 2, "stat_var_decl_item_2": 2, "stat_var_decl_item_3": 2, "stat_if_1": 2, "label_set": 25, "stat_while_2": 2, "stat_while_3": 3, "stat_while_4": 2, "stat_while_5": 2, "stat_while_6": 2, "stat_do_while_2": 3, "stat_do_while_3": 2, "stat_do_while_4": 2, "stat_do_while_5": 2, "stat_do_while_6": 2, "stat_do_while_7": 2, "stat_for_1": 2, "stat_for_3": 2, "stat_for_4": 2, "stat_for_5": 2, "stat_for_6": 3, "stat_for_7": 3, "stat_for_8": 2, "stat_for_9": 2, "stat_for_var_1": 2, "stat_switch_1": 2, "switchbody": 1, "stat_switch_2": 3, "stat_switch_nodefault_1": 2, "switchclause": 26, "stat_switch_nodefault_2": 2, "stat_switch_nodefault_3": 2, "stat_switch_nodefault_4": 2, "stat_switch_nodefault_5": 2, "stat_switch_nodefault_6": 3, "stat_switch_default_1": 2, "stat_switch_default_A_1": 2, "stat_switch_default_A_2": 2, "stat_switch_default_A_3": 2, "stat_switch_default_A_4": 2, "stat_switch_default_A_5": 3, "stat_switch_default_B_1": 2, "stat_switch_default_B_2": 2, "stat_switch_default_B_3": 2, "stat_switch_default_B_4": 2, "stat_switch_default_5": 2, "stat_switch_default_6": 2, "stat_switch_default_7": 2, "stat_switch_default_8": 3, "stat_with_1": 2, "stat_throw_1": 2, "stat_return_1": 2, "stat_try_1": 3, "string*stat": 1, "stat_try_2": 2, "stat_try_3": 3, "stat_try_4": 2, "stat_try_5": 2, "ext_prog": 7, "javascript_1": 2, "prog_1": 2, "element": 1, "prog_2": 3, "ext_spec": 75, "spec_to_int32_1": 2, "spec_to_uint32_1": 2, "spec_expr_get_value_conv_1": 2, "spec_expr_get_value_conv_2": 2, "spec_convert_twice_1": 2, "spec_convert_twice_2": 2, "spec_list_expr": 2, "spec_list_expr_1": 2, "spec_list_expr_2": 2, "spec_to_descriptor": 2, "spec_to_descriptor_1a": 2, "spec_to_descriptor_1b": 2, "spec_to_descriptor_1c": 2, "spec_to_descriptor_2a": 2, "spec_to_descriptor_2b": 2, "spec_to_descriptor_2c": 2, "spec_to_descriptor_3a": 2, "spec_to_descriptor_3b": 2, "spec_to_descriptor_3c": 2, "spec_to_descriptor_4a": 2, "spec_to_descriptor_4b": 2, "spec_to_descriptor_4c": 2, "spec_to_descriptor_5a": 2, "spec_to_descriptor_5b": 2, "spec_to_descriptor_5c": 2, "spec_to_descriptor_6a": 2, "spec_to_descriptor_6b": 2, "spec_to_descriptor_6c": 2, "spec_to_descriptor_7": 2, "builtin_get_own_prop": 1, "spec_object_get_own_prop_2": 2, "spec_object_get_prop_1": 2, "builtin_get_prop": 1, "spec_object_get_prop_2": 2, "spec_object_get_prop_3": 2, "spec_get_value": 2, "spec_get_value_ref_b_1": 2, "spec_get_value_ref_c_1": 2, "spec_expr_get_value_1": 2, "spec_lexical_env_get_identifier_ref": 3, "spec_lexical_env_get_identifier_ref_1": 2, "spec_lexical_env_get_identifier_ref_2": 2, "spec_error_spec_1": 2, "spec_args_obj_get_own_prop_1": 2, "spec_args_obj_get_own_prop_2": 2, "spec_args_obj_get_own_prop_3": 2, "spec_string_get_own_prop_1": 2, "spec_string_get_own_prop_2": 2, "spec_string_get_own_prop_3": 2, "spec_string_get_own_prop_4": 2, "spec_string_get_own_prop_5": 2, "spec_string_get_own_prop_6": 2, "spec_function_proto_apply_get_args_1": 2, "spec_function_proto_apply_get_args_2": 2, "spec_function_proto_apply_get_args_3": 2, "spec_function_proto_bind_length": 2, "spec_function_proto_bind_length_1": 2, "spec_function_proto_bind_length_2": 2, "spec_function_proto_bind_length_3": 2, "spec_call_array_proto_join_vtsfj": 2, "spec_call_array_proto_join_vtsfj_1": 2, "spec_call_array_proto_join_vtsfj_2": 2, "spec_call_array_proto_join_vtsfj_3": 2, "Coercion": 3, "ext_expr.": 1, "ext_stat.": 1, "ext_prog.": 1, "None.": 3, "out_of_specret": 79, "out_of_ext_expr": 1, "out_of_ext_stat": 1, "out_of_ext_prog": 1, "out_of_ext_spec": 1, "es": 2, "res_is_normal": 1, "restype_normal.": 1, "abort_div": 1, "abort_not_normal": 1, "abrupt_res": 4, "abort_intercepted_prog": 2, "abort_intercepted_prog_block_2": 1, "abort_intercepted_stat": 13, "abort_intercepted_stat_block_2": 1, "abort_intercepted_stat_label_1": 1, "res_intro": 1, "abort_intercepted_do_while_2": 1, "t2": 50, "res_label_in": 3, "restype_continue": 2, "abort_intercepted_while_3": 1, "abort_intercepted_stat_try_1": 1, "cb": 2, "fo": 4, "abort_intercepted_stat_try_3": 1, "abort_intercepted_stat_switch_2": 1, "abort_intercepted_stat_switch_nodefault_6": 1, "scs": 6, "abort_intercepted_stat_switch_default_8": 1, "abort_intercepted_stat_switch_default_A_5": 1, "vi": 2, "ts1": 2, "scs2": 2, "abort_intercepted_stat_for_6": 1, "abort_intercepted_stat_for_7": 1, "abort_intercepted_expr": 3, "abort_intercepted_expr_call_default_2": 1, "abort_intercepted_expr_call_global_eval_3": 1, "abort_intercepted_spec": 1, "spec_identifier_resolution": 1, "lex": 2, "execution_ctx_lexical_env": 1, "strict": 1, "execution_ctx_strict": 1, "strict.": 1, "arguments_from_nil": 1, "Vs": 5, "arguments_from_undef": 1, "undef": 2, "arguments_from_cons": 1, "Vs1": 3, "Vs2": 3, "arguments_f_a_r_from_nil": 1, "arguments_f_a_r_from_cons": 1, "arguments_first_and_rest.": 1, "search_proto_chain": 6, "search_proto_chain_found": 1, "object_has_property": 2, "search_proto_chain_not_found": 1, "object_proto": 1, "prim_null": 1, "search_proto_chain_inductive": 1, "make_delete_event": 2, "event": 1, "make_delete_event_intro": 1, "ev": 2, "delete_event": 1, "ev.": 1, "implementation_prealloc": 1, "vret": 1, "dret": 1, "Basics.": 2, "NatList.": 2, "Playground1.": 3, "natprod": 5, "pair": 7, "natprod.": 1, "fst": 3, "snd": 3, "swap_pair": 1, "surjective_pairing": 1, "count": 7, "remove_one": 3, "test_remove_one1": 1, "remove_all": 2, "bag": 3, "app_ass": 1, "l1": 27, "l2": 21, "l3": 6, "natlist": 7, "l3.": 1, "remove_decreases_count": 1, "true.": 6, "ble_n_Sn.": 1, "IHs.": 2, "natoption": 5, "natoption.": 1, "option_elim": 2, "hd_opt": 8, "test_hd_opt1": 2, "test_hd_opt2": 2, "option_elim_hd": 1, "head": 1, "l.": 14, "beq_natlist": 5, "r1": 2, "r2": 2, "test_beq_natlist1": 1, "test_beq_natlist2": 1, "beq_natlist_refl": 1, "beq_nat_refl": 2, "IHl.": 5, "silly1": 1, "eq1": 6, "eq2.": 9, "eq2": 1, "silly2a": 1, "q": 4, "eq1.": 5, "silly_ex": 1, "evenb": 2, "oddb": 2, "silly3": 1, "symmetry.": 2, "rev_exercise": 1, "rev_involutive.": 1, "IHn": 3, "l1.": 2, "FunctionNinjas.All.": 2, "Computation.": 2, "C.Notations.": 1, "error": 8, "C.t": 13, "do_call": 1, "Command.ShowError": 1, "ret.": 1, "main": 1, "card_is_valid": 2, "Command.AskCard": 1, "Command.AskPIN": 1, "@@": 7, "LString.s": 7, "pin_is_valid": 2, "Command.CheckPIN": 1, "ask_amount": 2, "Command.AskAmount": 1, "amount_is_valid": 2, "Command.CheckAmount": 1, "card_is_given": 2, "Command.GiveCard": 1, "amount_is_given": 2, "Command.GiveAmount": 1, "Lists.": 1, "X.": 4, "h": 24, "app": 5, "snoc": 9, "rev": 5, "list123": 1, "associativity": 4, "nil.": 1, "..": 2, "test_repeat1": 1, "nil_app": 1, "rev_snoc": 1, "snoc_with_append": 1, "IHl1.": 1, "prod": 3, "Y.": 1, "type_scope.": 1, "combine": 3, "lx": 4, "ly": 4, "tx": 2, "tp": 2, "xs": 7, "plus3": 2, "plus": 8, "prod_curry": 3, "prod_uncurry": 3, "uncurry_uncurry": 1, "curry_uncurry": 1, "p.": 2, "test": 4, "countoddmembers": 1, "fmostlytrue": 5, "override": 5, "ftrue": 1, "override_example1": 1, "override_example2": 1, "override_example3": 1, "override_example4": 1, "override_example": 1, "constfun": 1, "unfold_example_bad": 1, "m.": 9, "plus3.": 1, "override_eq": 1, "f.": 1, "override.": 2, "override_neq": 1, "k1": 5, "k2": 4, "eq_add_S": 1, "eq.": 11, "silly4": 1, "silly5": 1, "sillyex1": 1, "j": 6, "j.": 1, "silly6": 1, "silly7": 1, "sillyex2": 1, "assertion": 3, "Hl.": 1, "IHm": 1, "eq": 4, "0": 2, "IHl": 1, "beq_nat_O_l": 1, "beq_nat_O_r": 1, "double_injective": 1, "double": 2, "fold_map": 2, "fold": 1, "total": 2, "fold_map_correct": 1, "map": 1, "fold_map.": 1, "forallb": 4, "existsb": 3, "orb": 1, "existsb2": 2, "existsb_correct": 1, "existsb2.": 1, "index_okx": 1, "mumble": 5, "mumble.": 1, "grumble": 3, "Logic.": 1, "relation": 16, "Prop.": 1, "partial_function": 6, "next_nat_partial_function": 1, "next_nat.": 1, "partial_function.": 5, "Q.": 2, "le_not_a_partial_function": 1, "le": 1, "not.": 3, "Nonsense.": 4, "le_n.": 6, "le_S.": 4, "total_relation_not_partial_function": 1, "total_relation": 1, "total_relation1.": 2, "empty_relation_not_partial_funcion": 1, "empty_relation.": 1, "reflexive": 5, "le_reflexive": 1, "le.": 4, "reflexive.": 1, "transitive": 8, "le_trans": 4, "Hnm": 3, "Hmo.": 4, "Hnm.": 3, "IHHmo.": 1, "lt_trans": 3, "lt.": 2, "transitive.": 1, "le_S": 1, "Hm": 1, "le_Sn_le": 1, "le_S_n": 2, "Sn_le_Sm__n_le_m.": 1, "le_Sn_n": 1, "TODO": 1, "lt": 2, "Hmo": 1, "symmetric": 2, "antisymmetric": 3, "le_antisymmetric": 1, "Sn_le_Sm__n_le_m": 2, "IHb": 1, "equivalence": 1, "order": 2, "preorder": 1, "le_order": 1, "order.": 1, "le_reflexive.": 1, "le_antisymmetric.": 1, "le_trans.": 1, "clos_refl_trans": 8, "rt_step": 1, "rt_refl": 1, "rt_trans": 3, "next_nat_closure_is_le": 1, "next_nat": 1, "rt_refl.": 2, "IHle.": 1, "rt_step.": 2, "nn.": 1, "IHclos_refl_trans1.": 2, "IHclos_refl_trans2.": 2, "refl_step_closure": 11, "rsc_refl": 1, "rsc_step": 4, "rsc_R": 2, "rsc_refl.": 4, "rsc_trans": 4, "IHrefl_step_closure": 1, "rtc_rsc_coincide": 1, "IHrefl_step_closure.": 1, "Imp.": 1, "Relations.": 1, "tm": 43, "tm_const": 45, "tm_plus": 30, "tm.": 3, "SimpleArith0.": 2, "eval": 8, "SimpleArith1.": 2, "E_Const": 2, "E_Plus": 2, "t1": 44, "test_step_1": 1, "ST_Plus1.": 2, "ST_PlusConstConst.": 3, "test_step_2": 1, "ST_Plus2.": 2, "step_deterministic": 1, "step.": 3, "Hy1": 2, "Hy2.": 2, "step_cases": 4, "Hy2": 3, "SCase.": 3, "Hy1.": 5, "IHHy1": 2, "SimpleArith2.": 1, "v_const": 4, "step": 9, "ST_PlusConstConst": 3, "ST_Plus1": 2, "strong_progress": 2, "value_not_same_as_normal_form": 2, "normal_form": 3, "normal_form.": 2, "v_funny.": 1, "Temp1.": 1, "Temp2.": 1, "ST_Funny": 1, "Temp3.": 1, "Temp4.": 2, "tm_true": 8, "tm_false": 5, "tm_if": 10, "v_true": 1, "v_false": 1, "tm_false.": 3, "ST_IfTrue": 1, "ST_IfFalse": 1, "ST_If": 1, "t3": 6, "bool_step_prop4": 1, "bool_step_prop4_holds": 1, "bool_step_prop4.": 2, "ST_ShortCut.": 1, "IHt1.": 1, "t2.": 4, "t3.": 2, "ST_If.": 2, "Temp5.": 1, "stepmany": 4, "normalizing": 1, "IHt2": 3, "H11": 2, "H12": 2, "H21": 3, "H22": 2, "nf_same_as_value": 3, "H12.": 1, "H22.": 1, "H11.": 1, "stepmany_congr_1": 1, "stepmany_congr2": 1, "eval__value": 1, "HE.": 1, "eval_cases": 1, "HE": 1, "v_const.": 1, "Coq.Lists.List.": 1, "Coq.Strings.Ascii.": 1, "ListNotations.": 1, "char.": 1, "Run.": 2, "C.Ret": 3, "handler": 3, "C.Call": 6, "trace": 2, "existT": 1, "Temporal.": 2, "All.": 2, "One.": 2, "CallThis": 1, "CallOther": 1, "Then.": 2, "CallThen": 1, "One.t": 1, "CardBeforeMoney.": 2, "STLC.": 1, "ty_Bool": 10, "ty_arrow": 7, "ty.": 2, "tm_var": 6, "tm_app": 7, "tm_abs": 9, "idB": 2, "idBB": 2, "idBBBB": 2, "v_abs": 1, "t_true": 1, "t_false": 1, "ST_App2": 1, "step_example3": 1, "idB.": 1, "rsc_step.": 2, "ST_App1.": 2, "ST_AppAbs.": 3, "v_abs.": 2, "partial_map": 4, "Context.": 1, "empty": 3, "extend": 1, "Gamma": 10, "has_type": 4, "appears_free_in": 1, "T_Var.": 1, "extend_neq": 1, "Heqe.": 3, "T_Abs.": 1, "context_invariance...": 2, "Hafi.": 2, "extend.": 2, "IHt.": 1, "Coiso1.": 2, "Coiso2.": 3, "HeqCoiso1.": 1, "HeqCoiso2.": 1, "beq_id_false_not_eq.": 1, "ex_falso_quodlibet.": 1, "preservation": 1, "HT.": 1, "substitution_preserves_typing": 1, "T11.": 4, "HT1.": 1, "T_App": 2, "IHHT1.": 1, "IHHT2.": 1, "tm_cases": 1, "Ht": 1, "Ht.": 3, "IHt1": 2, "T11": 2, "T0": 1, "ST_App2.": 1, "ty_Bool.": 1, "T.": 2, "IHt3": 1, "ST_IfTrue.": 1, "ST_IfFalse.": 1, "types_unique": 1, "T1": 1, "T12": 2, "IHhas_type.": 1, "IHhas_type1.": 1, "IHhas_type2.": 1 }, "Creole": { "Creole": 6, "is": 3, "a": 2, "-": 5, "to": 2, "HTML": 1, "converter": 2, "for": 1, "the": 5, "lightweight": 1, "markup": 1, "language": 1, "(": 5, "http": 4, "//wikicreole.org/": 1, ")": 5, ".": 1, "Github": 1, "uses": 1, "this": 1, "render": 1, "*.creole": 1, "files.": 1, "Project": 1, "page": 1, "on": 2, "github": 1, "*": 5, "//github.com/minad/creole": 1, "Travis": 1, "CI": 1, "https": 1, "//travis": 1, "ci.org/minad/creole": 1, "RDOC": 1, "//rdoc.info/projects/minad/creole": 1, "INSTALLATION": 1, "{": 6, "gem": 1, "install": 1, "creole": 1, "}": 6, "SYNOPSIS": 1, "require": 1, "html": 1, "Creole.creolize": 1, "BUGS": 1, "If": 1, "you": 1, "found": 1, "bug": 1, "please": 1, "report": 1, "it": 1, "at": 1, "project": 1, "s": 1, "tracker": 1, "GitHub": 1, "//github.com/minad/creole/issues": 1, "AUTHORS": 1, "Lars": 2, "Christensen": 2, "larsch": 1, "Daniel": 2, "Mendler": 1, "minad": 1, "LICENSE": 1, "Copyright": 1, "c": 1, "Mendler.": 1, "It": 1, "free": 1, "software": 1, "and": 1, "may": 1, "be": 1, "redistributed": 1, "under": 1, "terms": 1, "specified": 1, "in": 1, "README": 1, "file": 1, "of": 1, "Ruby": 1, "distribution.": 1 }, "Crystal": { "SHEBANG#!bin/crystal": 2, "require": 2, "describe": 2, "do": 26, "it": 21, "run": 14, "(": 201, ")": 201, ".to_i.should": 11, "eq": 16, "end": 135, ".to_f32.should": 2, ".to_b.should": 1, "be_true": 1, "assert_type": 7, "{": 7, "int32": 8, "}": 7, "union_of": 1, "char": 1, "result": 3, "types": 3, "[": 9, "]": 9, "mod": 1, "result.program": 1, "foo": 3, "mod.types": 1, "as": 4, "NonGenericClassType": 1, "foo.instance_vars": 1, ".type.should": 3, "mod.int32": 1, "GenericClassType": 2, "foo_i32": 4, "foo.instantiate": 2, "of": 3, "Type": 2, "|": 8, "ASTNode": 4, "foo_i32.lookup_instance_var": 2, "module": 1, "Crystal": 1, "class": 2, "def": 84, "transform": 81, "transformer": 1, "transformer.before_transform": 1, "self": 77, "node": 164, "transformer.transform": 1, "transformer.after_transform": 1, "Transformer": 1, "before_transform": 1, "after_transform": 1, "Expressions": 2, "exps": 6, "node.expressions.each": 1, "exp": 3, "new_exp": 3, "exp.transform": 3, "if": 23, "new_exp.is_a": 1, "exps.concat": 1, "new_exp.expressions": 1, "else": 2, "<<": 1, "exps.length": 1, "node.expressions": 3, "Call": 1, "node_obj": 1, "node.obj": 9, "node_obj.transform": 1, "transform_many": 23, "node.args": 3, "node_block": 1, "node.block": 2, "node_block.transform": 1, "node_block_arg": 1, "node.block_arg": 6, "node_block_arg.transform": 1, "And": 1, "node.left": 3, "node.left.transform": 3, "node.right": 3, "node.right.transform": 3, "Or": 1, "StringInterpolation": 1, "ArrayLiteral": 1, "node.elements": 1, "node_of": 1, "node.of": 2, "node_of.transform": 1, "HashLiteral": 1, "node.keys": 1, "node.values": 2, "of_key": 1, "node.of_key": 2, "of_key.transform": 1, "of_value": 1, "node.of_value": 2, "of_value.transform": 1, "If": 1, "node.cond": 5, "node.cond.transform": 5, "node.then": 3, "node.then.transform": 3, "node.else": 5, "node.else.transform": 3, "Unless": 1, "IfDef": 1, "MultiAssign": 1, "node.targets": 1, "SimpleOr": 1, "Def": 1, "node.body": 12, "node.body.transform": 10, "receiver": 2, "node.receiver": 4, "receiver.transform": 2, "block_arg": 2, "block_arg.transform": 2, "Macro": 1, "PointerOf": 1, "node.exp": 3, "node.exp.transform": 3, "SizeOf": 1, "InstanceSizeOf": 1, "IsA": 1, "node.obj.transform": 5, "node.const": 1, "node.const.transform": 1, "RespondsTo": 1, "Case": 1, "node.whens": 1, "node_else": 1, "node_else.transform": 1, "When": 1, "node.conds": 1, "ImplicitObj": 1, "ClassDef": 1, "superclass": 1, "node.superclass": 2, "superclass.transform": 1, "ModuleDef": 1, "While": 1, "Generic": 1, "node.name": 5, "node.name.transform": 5, "node.type_vars": 1, "ExceptionHandler": 1, "node.rescues": 1, "node_ensure": 1, "node.ensure": 2, "node_ensure.transform": 1, "Rescue": 1, "node.types": 2, "Union": 1, "Hierarchy": 1, "Metaclass": 1, "Arg": 1, "default_value": 1, "node.default_value": 2, "default_value.transform": 1, "restriction": 1, "node.restriction": 2, "restriction.transform": 1, "BlockArg": 1, "node.fun": 1, "node.fun.transform": 1, "Fun": 1, "node.inputs": 1, "output": 1, "node.output": 2, "output.transform": 1, "Block": 1, "node.args.map": 1, "Var": 2, "FunLiteral": 1, "node.def.body": 1, "node.def.body.transform": 1, "FunPointer": 1, "obj": 1, "obj.transform": 1, "Return": 1, "node.exps": 5, "Break": 1, "Next": 1, "Yield": 1, "scope": 1, "node.scope": 2, "scope.transform": 1, "Include": 1, "Extend": 1, "RangeLiteral": 1, "node.from": 1, "node.from.transform": 1, "node.to": 2, "node.to.transform": 2, "Assign": 1, "node.target": 1, "node.target.transform": 1, "node.value": 3, "node.value.transform": 3, "Nop": 1, "NilLiteral": 1, "BoolLiteral": 1, "NumberLiteral": 1, "CharLiteral": 1, "StringLiteral": 1, "SymbolLiteral": 1, "RegexLiteral": 1, "MetaVar": 1, "InstanceVar": 1, "ClassVar": 1, "Global": 1, "Require": 1, "Path": 1, "Self": 1, "LibDef": 1, "FunDef": 1, "body": 1, "body.transform": 1, "TypeDef": 1, "StructDef": 1, "UnionDef": 1, "EnumDef": 1, "ExternalVar": 1, "IndirectRead": 1, "IndirectWrite": 1, "TypeOf": 1, "Primitive": 1, "Not": 1, "TypeFilteredNode": 1, "TupleLiteral": 1, "Cast": 1, "DeclareVar": 1, "node.var": 1, "node.var.transform": 1, "node.declared_type": 1, "node.declared_type.transform": 1, "Alias": 1, "TupleIndexer": 1, "Attribute": 1, "exps.map": 1 }, "Csound": { "sr": 3, "kr": 3, "ksmps": 3, "nchnls": 3, ";": 8, "pvanal": 5, "-": 22, "n": 7, "w": 5, "allglass1": 4, "L.wav": 2, "L.pvc": 2, "R.wav": 2, "R.pvc": 2, "instr": 12, "ktime": 3, "line": 2, "p3": 4, "arL": 2, "pvoc": 2, "arR": 2, "out": 3, "endin": 12, "partA": 4, "partB.wav": 1, "partB.pvc": 1, "iscale": 1, "ktimpnt1": 3, "iscale*": 2, "(": 19, "/44100": 4, ")": 19, "ktimpnt2": 3, "linseg": 6, "iscale*1.25": 1, "kfreqscale": 3, "iscale*0.5": 3, "iscale*1.6": 3, "kfreqinterpL": 2, "iscale*0.25": 2, "kampinterpL": 2, "kfreqinterpR": 2, "iscale*1.2": 2, "kampinterpR": 2, "pvbufread": 2, "apvcL": 1, "pvinterp": 2, "apvcR": 1, "outs": 1, "apvcL*0.8": 1, "apvcR*0.8": 1, "...or": 1, "a": 3, "semicolon.": 1, "nchnls_i": 1, "dbfs": 4, "N_a_M_e_": 1, "+": 6, "Name": 1, "aSignal": 9, "oscil": 2, "prints": 25, "comment": 1, "kNote": 3, "if": 7, "then": 4, "kFrequency": 4, "elseif": 1, "//": 2, "Parentheses": 1, "around": 1, "binary": 1, "expressions": 1, "are": 1, "optional.": 1, "endif": 2, "iIndex": 19, "while": 2, "<": 4, "do": 3, "print": 11, "od": 2, "until": 1, "enduntil": 1, "{": 6, "hello": 1, "world": 1, "}": 6, "outc": 2, "opcode": 1, "anOscillator": 2, "kk": 1, "kAmplitude": 2, "xin": 1, "vco2": 1, "xout": 1, "endop": 1, "TestOscillator": 1, "pyruni": 1, "import": 1, "random": 1, "pool": 4, "[": 2, "i": 12, "/": 1, "**": 1, "for": 1, "in": 1, "range": 1, "]": 2, "def": 1, "get_number_from_pool": 1, "p": 2, "random.random": 2, "int": 1, "*": 1, "len": 1, "return": 1, "random.choice": 1, "#ifdef": 1, "DEBUG": 2, "#undef": 1, "#include": 1, "#endif": 2, "#define": 5, "A_HZ": 1, "#440#": 1, "OSCIL_MACRO": 4, "VOLUME": 5, "TABLE": 2, "#oscil": 3, "FREQUENCY": 3, "TABLE#": 3, "TestMacro": 1, "TestBitwiseNOT": 1, "TestBitwiseXOR": 1, "#": 4, "TestGoto": 1, "goto": 4, "if_label": 2, "else_label": 2, "endif_label": 2, "else": 1, "loop_label": 2, "loop_lt_label": 2, "loop_lt": 1, "TestPrints": 1, "VOLUME#FREQUENCY#TABLE": 1, "TestMacroPeriodSuffix": 1, "OSCIL_MACRO.": 1, "TestAt": 1, "@0": 1, "@@0": 1, "@1": 1, "@@1": 1, "@2": 1, "@@2": 1, "@3": 1, "@@3": 1, "@4": 1, "@@4": 1, "@5": 1, "@@5": 1, "@6": 1, "@@6": 1, "@7": 1, "@@7": 1, "@8": 1, "@@8": 1, "@9": 1, "@@9": 1, "MacroAbuse": 1, "FOO#": 1, "BAR": 1, "This": 1, "ends": 1, "the": 1, "block.": 1, "It": 1, "is": 1, "not": 1, "preprocessor": 1, "directive.": 1, "scoreline_i": 1, "f": 1, "e": 1 }, "Csound Document": { "": 3, "": 3, "sr": 3, "kr": 3, "ksmps": 3, "nchnls": 3, ";": 8, "pvanal": 5, "-": 22, "n": 7, "w": 5, "allglass1": 4, "L.wav": 2, "L.pvc": 2, "R.wav": 2, "R.pvc": 2, "instr": 12, "ktime": 3, "line": 2, "p3": 4, "arL": 2, "pvoc": 2, "arR": 2, "out": 3, "endin": 12, "": 3, "": 3, "i": 14, "e": 3, "": 3, "": 3, "partA": 4, "partB.wav": 1, "partB.pvc": 1, "iscale": 1, "ktimpnt1": 3, "iscale*": 2, "(": 19, "/44100": 4, ")": 19, "ktimpnt2": 3, "linseg": 6, "iscale*1.25": 1, "kfreqscale": 3, "iscale*0.5": 3, "iscale*1.6": 3, "kfreqinterpL": 2, "iscale*0.25": 2, "kampinterpL": 2, "kfreqinterpR": 2, "iscale*1.2": 2, "kampinterpR": 2, "pvbufread": 2, "apvcL": 1, "pvinterp": 2, "apvcR": 1, "outs": 1, "apvcL*0.8": 1, "apvcR*0.8": 1, "...or": 1, "a": 3, "semicolon.": 1, "nchnls_i": 1, "dbfs": 4, "N_a_M_e_": 1, "+": 6, "Name": 1, "aSignal": 9, "oscil": 2, "prints": 25, "comment": 1, "kNote": 3, "if": 7, "then": 4, "kFrequency": 4, "elseif": 1, "//": 2, "Parentheses": 1, "around": 1, "binary": 1, "expressions": 1, "are": 1, "optional.": 1, "endif": 2, "iIndex": 19, "while": 2, "<": 4, "do": 3, "print": 11, "od": 2, "until": 1, "enduntil": 1, "{": 4, "hello": 1, "world": 1, "}": 4, "outc": 2, "opcode": 1, "anOscillator": 2, "kk": 1, "kAmplitude": 2, "xin": 1, "vco2": 1, "xout": 1, "endop": 1, "TestOscillator": 1, "pyruni": 1, "import": 1, "random": 1, "pool": 4, "[": 2, "/": 1, "**": 1, "for": 1, "in": 1, "range": 1, "]": 2, "def": 1, "get_number_from_pool": 1, "p": 2, "random.random": 2, "int": 1, "*": 1, "len": 1, "return": 1, "random.choice": 1, "#ifdef": 1, "DEBUG": 2, "#undef": 1, "#include": 1, "#endif": 2, "#define": 5, "A_HZ": 1, "#440#": 1, "OSCIL_MACRO": 4, "VOLUME": 5, "TABLE": 2, "#oscil": 3, "FREQUENCY": 3, "TABLE#": 3, "TestMacro": 1, "TestBitwiseNOT": 1, "TestBitwiseXOR": 1, "#": 4, "TestGoto": 1, "goto": 4, "if_label": 2, "else_label": 2, "endif_label": 2, "else": 1, "loop_label": 2, "loop_lt_label": 2, "loop_lt": 1, "TestPrints": 1, "VOLUME#FREQUENCY#TABLE": 1, "TestMacroPeriodSuffix": 1, "OSCIL_MACRO.": 1, "TestAt": 1, "@0": 1, "@@0": 1, "@1": 1, "@@1": 1, "@2": 1, "@@2": 1, "@3": 1, "@@3": 1, "@4": 1, "@@4": 1, "@5": 1, "@@5": 1, "@6": 1, "@@6": 1, "@7": 1, "@@7": 1, "@8": 1, "@@8": 1, "@9": 1, "@@9": 1, "MacroAbuse": 1, "FOO#": 1, "BAR": 1, "This": 1, "ends": 1, "the": 1, "block.": 1, "It": 1, "is": 1, "not": 1, "preprocessor": 1, "directive.": 1, "f": 1 }, "Csound Score": { "i": 10, "e": 3, "f": 1 }, "Cuda": { "__global__": 2, "void": 3, "scalarProdGPU": 1, "(": 20, "float": 8, "*d_C": 1, "*d_A": 1, "*d_B": 1, "int": 14, "vectorN": 2, "elementN": 3, ")": 20, "{": 8, "//Accumulators": 1, "cache": 1, "__shared__": 1, "accumResult": 5, "[": 11, "ACCUM_N": 4, "]": 11, ";": 30, "////////////////////////////////////////////////////////////////////////////": 2, "for": 5, "vec": 5, "blockIdx.x": 2, "<": 5, "+": 12, "gridDim.x": 1, "vectorBase": 3, "IMUL": 1, "vectorEnd": 2, "////////////////////////////////////////////////////////////////////////": 4, "iAccum": 10, "threadIdx.x": 4, "blockDim.x": 3, "sum": 3, "pos": 5, "d_A": 2, "*": 2, "d_B": 2, "}": 8, "stride": 5, "/": 2, "__syncthreads": 1, "if": 3, "d_C": 2, "#include": 2, "": 1, "": 1, "vectorAdd": 2, "const": 2, "*A": 1, "*B": 1, "*C": 1, "numElements": 4, "i": 5, "C": 1, "A": 1, "B": 1, "main": 1, "cudaError_t": 1, "err": 5, "cudaSuccess": 2, "threadsPerBlock": 4, "blocksPerGrid": 1, "-": 1, "<<": 1, "": 1, "cudaGetLastError": 1, "fprintf": 1, "stderr": 1, "cudaGetErrorString": 1, "exit": 1, "EXIT_FAILURE": 1, "cudaDeviceReset": 1, "return": 1 }, "Cycript": { "(": 12, "function": 2, "utils": 2, ")": 12, "{": 8, "//": 4, "Load": 1, "C": 2, "functions": 3, "declared": 1, "in": 2, "utils.loadFuncs": 1, "var": 6, "shouldLoadCFuncs": 2, "true": 2, ";": 21, "Expose": 2, "the": 1, "to": 4, "cycript": 2, "s": 2, "global": 1, "scope": 1, "shouldExposeConsts": 2, "defined": 1, "here": 1, "t": 1, "be": 2, "found": 2, "with": 1, "dlsym": 1, "Failed": 1, "load": 1, "mach_vm_address_t": 1, "string": 4, "@encode": 2, "infinite": 1, "*": 1, "length": 1, "[": 8, "object": 1, "Struct": 1, "]": 8, "%": 8, "@": 3, "<%@:>": 1, "0x": 1, "+": 3, "-": 2, "printf": 1, ".3s": 1, "d": 2, "c": 5, "float": 1, "f": 1, "n": 1, "foo": 2, "barrrr": 1, "Args": 1, "needs": 1, "an": 1, "array": 1, "number": 1, "Function": 1, "not": 1, "foobar": 2, "strdup": 2, "pipe": 1, "write": 1, "close": 2, "int": 1, "a": 1, "short": 1, "b": 1, "char": 1, "uint64_t": 1, "double": 1, "e": 1, "struct": 1, "}": 9, "return": 1, "new": 1, "Type": 1, "typeStr": 1, "Various": 1, "constants": 1, "utils.constants": 2, "VM_PROT_NONE": 1, "VM_PROT_READ": 1, "VM_PROT_WRITE": 1, "VM_PROT_EXECUTE": 1, "VM_PROT_NO_CHANGE": 1, "VM_PROT_COPY": 1, "VM_PROT_WANTS_COPY": 1, "VM_PROT_IS_MASK": 1, "c.VM_PROT_DEFAULT": 1, "c.VM_PROT_READ": 2, "|": 3, "c.VM_PROT_WRITE": 2, "c.VM_PROT_ALL": 1, "c.VM_PROT_EXECUTE": 1, "if": 3, "for": 2, "k": 3, "Cycript.all": 2, "shouldExposeFuncs": 1, "i": 4, "<": 1, "funcsToExpose.length": 1, "name": 3, "funcsToExpose": 1, "utils.loadfuncs": 1, "shouldExposeCFuncs": 1, "exports": 1 }, "D": { "module": 1, "mpq": 1, ";": 119, "import": 2, "std.string": 1, "//": 2, "for": 2, "format": 3, "(": 142, ")": 142, "and": 1, "toStringz": 3, "std.traits": 1, "ParameterTypeTuple": 2, "alias": 3, "long": 1, "off_t": 15, "const": 16, "LIBMPQ_ERROR_OPEN": 1, "-": 15, "LIBMPQ_ERROR_CLOSE": 1, "LIBMPQ_ERROR_SEEK": 1, "LIBMPQ_ERROR_READ": 1, "LIBMPQ_ERROR_WRITE": 1, "LIBMPQ_ERROR_MALLOC": 1, "LIBMPQ_ERROR_FORMAT": 1, "LIBMPQ_ERROR_NOT_INITIALIZED": 1, "LIBMPQ_ERROR_SIZE": 1, "LIBMPQ_ERROR_EXIST": 2, "LIBMPQ_ERROR_DECRYPT": 1, "LIBMPQ_ERROR_UNPACK": 1, "extern": 2, "struct": 1, "mpq_archive_s": 22, "C": 1, "{": 29, "char": 24, "*libmpq__version": 1, "int": 26, "libmpq__archive_open": 1, "**mpq_archive": 1, "*mpq_filename": 1, "archive_offset": 1, "libmpq__archive_close": 1, "*mpq_archive": 19, "libmpq__archive_packed_size": 1, "*packed_size": 2, "libmpq__archive_unpacked_size": 1, "*unpacked_size": 3, "libmpq__archive_offset": 1, "*offset": 2, "libmpq__archive_version": 1, "uint": 24, "*version_": 1, "libmpq__archive_files": 1, "*files": 1, "libmpq__file_packed_size": 1, "file_number": 12, "libmpq__file_unpacked_size": 1, "libmpq__file_offset": 1, "libmpq__file_blocks": 1, "*blocks": 1, "libmpq__file_encrypted": 1, "*encrypted": 1, "libmpq__file_compressed": 1, "*compressed": 1, "libmpq__file_imploded": 1, "*imploded": 1, "libmpq__file_number": 1, "*filename": 1, "*number": 1, "libmpq__file_read": 1, "ubyte": 4, "*out_buf": 2, "out_size": 2, "*transferred": 2, "libmpq__block_open_offset": 1, "libmpq__block_close_offset": 1, "libmpq__block_unpacked_size": 1, "block_number": 2, "libmpq__block_read": 1, "}": 29, "class": 3, "MPQException": 5, "Exception": 1, "string": 1, "[": 33, "]": 33, "Errors": 2, "public": 1, "errno": 7, "this": 9, "fnname": 2, "this.errno": 1, "if": 5, "Errors.length": 1, "super": 1, "std.string.format": 1, "MPQ_CHECKERR": 1, "Fn": 4, "args": 2, "result": 4, "<": 1, "throw": 2, "new": 4, "&": 4, ".stringof": 1, "return": 11, "template": 3, "MPQ_FUNC": 22, "func_name": 3, "libmpq__version": 1, "libversion": 1, "mixin": 32, "MPQ_A_GET": 7, "type": 6, "name": 7, "name2": 4, "Archive": 4, "*m": 1, "File": 6, "listfile": 5, "listfiledata": 5, "archivename": 2, "offset": 2, "archive_open": 1, "m": 3, "archive_close": 1, "mpq_archive_s*": 2, "archive": 1, "opIndex": 2, "fname": 2, "fno": 2, "filelist": 1, "try": 2, "cast": 2, "listfile.read": 2, ".splitlines": 2, "catch": 2, "e": 2, "/": 2, "+": 2, "filenumber": 1, "filename": 6, "MPQ_F_GET": 9, "a": 5, "am": 3, "fileno": 8, "this.a": 2, "this.am": 2, "a.archive": 2, "a.files": 1, "this.filename": 2, "this.fileno": 2, "mpq.file_number": 1, "no": 1, "read": 1, "content": 2, "content.length": 3, "this.unpacked_size": 1, "trans": 3, "mpq.file_read": 1, "content.ptr": 1 }, "DIGITAL Command Language": { "Copyright": 1, "Fidelity": 1, "Information": 1, "Services": 1, "Inc": 1, "This": 2, "source": 1, "code": 1, "contains": 2, "the": 26, "intellectual": 1, "property": 1, "of": 8, "its": 1, "copyright": 1, "holder": 1, "(": 175, "s": 2, ")": 173, "and": 11, "is": 13, "made": 1, "available": 4, "under": 2, "a": 11, "license.": 1, "If": 10, "you": 3, "do": 2, "not": 6, "know": 1, "terms": 1, "license": 1, "please": 1, "stop": 1, "read": 1, "further.": 1, "KITINSTAL.COM": 1, "PROCEDURE": 1, "FOR": 1, "THE": 1, "GT.M": 6, "PRODUCT": 1, "ON": 5, "CONTROL_Y": 4, "THEN": 38, "VMI": 51, "CALLBACK": 34, "WARNING": 1, "EXIT": 10, "STATUS": 2, "allow": 1, "warning": 2, "errors": 1, "for": 11, "INSTALL": 11, "REPLACE": 5, "IF": 35, "P1": 6, ".EQS.": 6, "GOTO": 4, "POSTINSTALL": 3, "IVP": 6, "_UNSUPPORTED": 1, "TYPE": 2, "SYS": 13, "INPUT": 2, "c": 1, "COPYRIGHT": 1, "-": 594, "by": 5, "Sanchez": 1, "Computer": 1, "Associates": 1, "ALL": 2, "RIGHTS": 1, "RESERVED": 1, "following": 1, "lines": 1, "must": 4, "be": 5, "maintained": 3, "GTM": 126, "VMS_VERSION": 4, "Minimum": 1, "VMS": 2, "version": 5, "required": 6, "ALPHA": 3, "f": 101, "getsyi": 5, ".eqs.": 16, "DISK_SPACE": 2, "Minumum": 2, "disk": 6, "space": 2, "on": 6, "system": 4, "ELSE": 11, "ENDIF": 20, "F": 25, "ELEMENT": 2, "VMS_IS": 4, ".LTS.": 1, "MESSAGE": 5, "E": 2, "VMSMISMATCH": 1, "_FAILURE": 4, "WRITE": 73, "OUTPUT": 4, ".GES.": 1, "T1": 17, "VERIFY": 2, "KIT_DEBUG": 1, "CHECK_NET_UTILIZATION": 1, "ROOM": 2, ".NOT.": 6, "NOSPACE": 1, "setup": 1, "default": 3, "answers": 1, "DOPURGE": 3, "YES": 15, "RUN_IVP": 6, "STD_CNF": 3, "DST_OWN": 6, "SYSTEM": 1, "IDENTIFIER": 1, ".EQ.": 1, "SYS_DST": 4, "DST_DIR": 9, "GTM_DIST": 1, "DST_CRE": 4, "DST_DEV": 4, "STARTDB": 5, "MGR_COM": 5, "HLP_DIR": 4, "NO": 2, "DEF_DCL": 5, "DEF_SYS": 5, "LNK_LOG": 5, "DEF_GLD": 4, "GBL_DIR": 2, "MUMPS.GLD": 1, "DEF_RTN": 4, "RTN_DIR": 2, "[": 12, "]": 15, "DIST": 2, "PCT_RTN": 6, "ASK": 20, "B": 14, "SET": 9, "PURGE": 1, "DST_LOG": 6, "COMMON": 6, "DIR_TYPE": 4, "Not": 2, "standard": 2, "configuration": 2, "S": 7, "USER": 1, ".OR.": 5, "tell": 1, "them": 1, "what": 1, "/PROTECTION": 1, "WO": 1, "RE": 2, "Creating": 2, "command": 3, "files.": 1, "GTMINSTALL.COM": 1, "installs": 1, "GTMSECSHR": 3, "other": 1, "images.": 1, "small": 2, "protected": 1, "image": 5, "installed.": 2, "GTMSHR": 2, "run": 1, "time": 1, "library": 8, "installed": 1, "performance.": 1, "DMOD": 2, "MCOMPILE": 2, "are": 3, "images": 1, "frequently": 1, "used": 3, "in": 7, "development.": 1, "/OPEN/SHARED/HEADER/PROTECTED": 1, "/OPEN/SHARED/HEADER": 3, "GTMLOGICALS.COM": 1, "defines": 2, "logical": 5, "names": 2, "to": 21, "use": 2, "GT.M.": 1, "By": 1, "definitions": 1, "placed": 2, "PROCESS": 1, "table.": 1, "Parameter": 1, "if": 69, "supplied": 1, "should": 1, "name": 8, "table": 2, "and/or": 1, "mode": 1, "definition.": 1, "Assignments": 1, "permanent": 1, "reduce": 1, "activation": 1, "time.": 1, "The": 2, "LNK": 2, "LIBRARY": 1, "many": 1, "require": 1, "adjustment": 1, "your": 1, "environment.": 1, "GBLDIR": 1, "defined": 3, "provide": 2, "access": 2, "global": 1, "directory.": 1, "ROUTINES": 1, "utilities.": 1, "You": 3, "may": 1, "wish": 1, "define": 6, "different": 1, "structure": 1, "ZROUTINES.": 1, ".NES.": 1, "OUFILE": 81, "N1": 6, "DN": 5, "TRNLNM": 2, "LOCATE": 4, ".NE.": 4, "LENGTH": 4, "lnk": 1, "LNK_LOOP": 2, "+": 29, ".AND.": 1, ".LT.": 1, "gtmlib": 2, "handling": 2, "I": 3, "NOLNKLOG": 1, "setting": 1, "up": 1, "LIBRARYs": 1, "CLOSE": 5, "Create": 3, "GTMLOGIN.COM": 2, "OPEN": 4, "/WRITE": 4, "KWD": 6, "GTMSTART.COM": 3, "PREINS": 1, "GTMFILES.KIT": 3, "as": 7, "kit": 2, "contents": 2, "change": 3, "HLP_LOG": 2, "ROOT": 1, "SYSHLP": 1, "GTMIMAGES.KIT": 3, "Provide": 1, "with": 5, "file.KITs": 1, "PROVIDE_FILE": 1, "T": 2, "PROVIDE_IMAGE": 1, "FININS": 1, "PROVIDE_DCL_COMMAND": 1, "GTMCOMMANDS.CLD": 1, "MODIFY_STARTUP_DB": 1, "ADD": 1, "LPMAIN": 1, "TRUE": 1, "or": 4, "_SUCCESS": 2, "remove": 1, "MUPIP": 3, "from": 4, "tables": 1, "V2.4": 1, "V2.5": 1, "NOON": 1, "DEFINE": 4, "/USER_MODE": 4, "NL": 4, "ERROR": 2, "COMMAND": 2, "/TABLE": 1, "SYSLIB": 2, "DCLTABLES": 2, "/OUTPUT": 2, "/DELETE": 2, "MANAGER": 1, "@": 4, "GTMSTART": 1, "GTMLOGIN": 1, "DEFAULT": 1, "T2": 2, "ENVIRONMENT": 1, "PROTECTION": 1, "REWD": 3, "O": 1, "G": 1, "W": 1, "/DEFAULT": 2, "MUMPS": 1, "DMOD.M": 1, "GTMLIB.OLB/LIB": 1, "GTMSHR.OLB/LIB": 1, "LINK": 2, "DMOD.OBJ/NOTRACE": 1, "real": 1, "Installation": 2, "Verification": 2, "Procedure.": 1, "Procedure": 1, "Extract": 1, ".COM": 1, "file": 2, "text": 1, "library.": 1, "LIBRARIAN": 1, "/EXTRACT": 1, "IVP.COM": 1, "IVP.TLB": 1, "@GTM": 1, "make": 4, "libz": 1, "written": 1, "Martin": 1, "P.J.": 1, "Zinser": 1, "In": 1, "case": 1, "problems": 1, "install": 1, "might": 1, "contact": 1, "me": 1, "at": 1, "zinser@zinser.no": 1, "ip.info": 1, "preferred": 1, "martin.zinser@eurexchange.com": 1, "work": 8, "Make": 8, "procedure": 1, "history": 4, "Zlib": 1, "Version": 3, "First": 3, "receive": 3, "number": 3, "Adapt": 1, "new": 5, "Makefile.in": 1, "Add": 3, "support": 1, "large": 1, "check": 1, "gzclose": 1, "gzlib": 1, "gzread": 1, "gzwrite": 1, "Exchange": 1, "zlibdefs.h": 1, "zconf.h.in": 1, "Fix": 1, "missing": 2, "amiss_err": 1, "update": 2, "zconf_h.in": 1, "fix": 1, "exmples": 1, "subdir": 1, "path": 1, "module": 5, "search": 6, "makefile.in": 3, "Triggered": 1, "done": 1, "Alexey": 1, "Chupahin": 1, "completly": 1, "redesigned": 1, "shared": 2, "creation": 1, "it": 5, "VAX": 2, "again": 1, "pre": 1, "load": 1, "symbols": 2, "SMS.": 3, "sets": 1, "builder": 1, "built": 2, ".": 1, "automatic": 1, "preference": 1, "MMK": 2, "MMS": 1, "in.": 1, "error": 1, "then": 64, "goto": 22, "err_exit": 3, "true": 9, "false": 9, "tmpnam": 4, "getjpi": 1, "tt": 1, "tc": 1, "th": 1, "define/nolog": 2, "tconfig": 2, "its_decc": 9, "its_vaxc": 8, "its_gnuc": 7, "s_case": 3, "False": 1, "Setup": 1, "variables": 1, "holding": 1, "information": 1, "v_string": 1, "v_file": 1, "ccopt": 14, "lopts": 6, "dnsrl": 1, "aconf_in_file": 2, "conf_check_string": 1, "linkonly": 2, "optfile": 1, "mapfile": 1, "libdefs": 1, "vax": 2, ".lt.1024": 1, "axp": 5, ".ge.1024": 1, ".and.": 5, ".lt.4096": 1, "ia64": 4, ".ge.4096": 1, "Why": 3, "this": 1, "needed": 3, "And": 2, "why": 2, "simply": 2, ".or.": 12, "set": 4, "proc/parse": 1, "extended": 1, "whoami": 5, "parse": 5, "environment": 1, "mydef": 1, "mydir": 1, "myproc": 1, "Check": 3, "MMK/MMS": 1, "Search": 3, ".nes.": 19, "Then": 8, "Type": 1, "else": 10, "edit": 11, "endif": 38, "gosub": 8, "find_version": 1, "open/write": 7, "topt": 7, "tmp.opt": 2, "optf": 7, "check_opts": 1, "Look": 2, "compiler": 3, "check_compiler": 1, "close": 6, "trnlnm": 9, "sys": 34, "decc": 3, "library_include": 1, "/NAMES": 1, "AS_IS": 1, "Build": 3, "fake": 1, "configure": 1, "input": 3, "header": 1, "conf_hin": 3, "config.hin": 1, "write": 62, "i": 16, "FIND_ACONF": 1, "fname": 3, "element": 7, "AMISS_ERR": 2, "find_aconf": 1, "open/read/err": 1, "aconf_err": 1, "aconf_in": 4, "aconf": 19, "zconf.h": 33, "ACONF_LOOP": 1, "read/end_of_file": 1, "aconf_exit": 1, "line": 26, "extract": 10, "cdef": 7, "check_config": 1, "aconf_loop": 1, "ACONF_EXIT": 1, "delete": 4, ";": 10, "*": 10, "thing": 1, "plain": 1, "mms": 1, "output": 26, "make.eqs.": 1, "example.obj": 4, "minigzip.obj": 4, "CALL": 18, "MAKE": 19, "adler32.OBJ": 1, "adler32.c": 2, "zlib.h": 32, "compress.OBJ": 1, "compress.c": 2, "crc32.OBJ": 1, "crc32.c": 2, "deflate.OBJ": 1, "deflate.c": 2, "deflate.h": 4, "zutil.h": 24, "gzclose.OBJ": 1, "gzclose.c": 2, "gzlib.OBJ": 1, "gzlib.c": 2, "gzread.OBJ": 1, "gzread.c": 2, "gzwrite.OBJ": 1, "gzwrite.c": 2, "infback.OBJ": 1, "infback.c": 2, "inftrees.h": 5, "inflate.h": 2, "inffast.h": 4, "inffixed.h": 2, "inffast.OBJ": 1, "inffast.c": 2, "inflate.OBJ": 1, "inflate.c": 2, "infblock.h": 1, "inftrees.OBJ": 1, "inftrees.c": 2, "trees.OBJ": 1, "trees.c": 2, "uncompr.OBJ": 1, "uncompr.c": 2, "zutil.OBJ": 1, "zutil.c": 2, "libz.OLB": 1, "*.OBJ": 1, "example.OBJ": 1, ".test": 4, "example.c": 2, "call": 3, "example.exe": 2, "libz.olb": 7, "minigzip.OBJ": 1, "minigzip.c": 2, "minigzip.exe": 2, "crea_mms": 1, "shareable": 2, "crea_olist": 1, "map_2_shopt": 1, "LINK_": 1, "/SHARE": 1, "libzshr.exe": 1, "modules.opt/opt": 1, "/opt": 1, "delete/nolog": 1, "exit": 3, "CC_ERR": 2, "ERR_EXIT": 1, "message/facil/ident/sever/text": 1, "close/nolog": 14, "out": 9, "min": 3, "mod": 2, "h_in": 1, "SUBROUTINE": 2, "TO": 1, "CHECK": 1, "DEPENDENCIES": 1, "V": 2, "arg": 4, "Argument": 2, ".Eqs.": 4, "Goto": 8, "Exit": 4, "El": 4, "Loop2": 2, "File": 4, "Element": 1, "Endl": 1, "AFile": 6, "Loop3": 2, "OFile": 2, ".Or.": 1, "NextEl": 1, "CvTime": 1, ".Ges.": 1, "Time": 1, "Makeit": 2, "NextEL": 1, "EndL": 1, ".Le.": 1, "Loop": 1, "VV": 2, "P2": 2, "Verify": 2, "Set": 1, "ENDSUBROUTINE": 1, "options": 2, "accordingly": 1, "target": 1, "CHECK_OPTS": 1, "OPT_LOOP": 1, ".lt.": 16, "cparm": 25, "p": 1, "parameter": 1, "actually": 1, "something": 1, "locate": 21, "length": 20, "start": 12, "len": 8, "cc_com": 7, "mmks": 4, "bhelp": 1, "opt_loop": 1, "return": 3, "Save/set": 1, "value": 1, "no_rooted_search_lists": 2, "Extend": 1, "GNU": 1, "C": 1, "Compaq": 1, "hp": 1, "CHECK_COMPILER": 1, ".not.": 4, "no": 3, "dnrsl": 1, "cc": 1, "MMS/MMK": 1, "dump": 1, "descrip.mms": 3, "CREA_MMS": 1, "create": 2, "open/append": 3, "copy": 2, "deck": 2, "OBJS": 2, "adler32.obj": 2, "compress.obj": 2, "crc32.obj": 2, "gzclose.obj": 2, "gzlib.obj": 2, "gzread.obj": 2, "gzwrite.obj": 2, "uncompr.obj": 2, "infback.obj": 2, "deflate.obj": 2, "trees.obj": 2, "zutil.obj": 2, "inflate.obj": 2, "inftrees.obj": 2, "inffast.obj": 2, "eod": 2, "link": 3, "LOPTS": 2, "example": 1, "libz.olb/lib": 2, "minigzip": 1, "clean": 1, "*.obj": 1, "*.opt": 1, "*.exe": 1, "Read": 1, "list": 1, "core": 1, "sources": 1, "build": 2, "CREA_OLIST": 1, "open/read": 3, "modules.opt": 1, "src_check_list": 2, "MRLOOP": 1, "read/end": 5, "mrdone": 1, "rec": 4, "SRC_CHECK_LOOP": 1, "src_check": 4, "mrloop": 1, "src_check_loop": 1, "extra_filnam": 1, "trim": 1, "compress": 1, "NAME": 1, ".obj": 1, "TRIM": 2, "#": 2, "#define": 4, "STRING": 3, "_LARGEFILE64_SOURCE": 1, "temp.txt": 1, "r": 1, "comment": 1, "NEED": 1, "Checking": 2, "cdef_val": 6, "...": 3, "INTEGER": 1, "AS": 5, "UL": 1, "#undef": 2, "WRITE_": 1, "p1": 4, "aopt": 8, "a.opt": 3, "bopt": 8, "b.opt": 3, "mod_sym_num": 6, "MOD_SYM_LOOP": 1, "type": 2, "mod_in": 8, "MOD_SYM_IN": 1, "shared_proc": 22, "fao": 7, "mod_sym_in": 1, "mod_sym_loop": 1, "MAP_LOOP": 1, "map_end": 1, "map": 3, "proc": 8, "map_loop": 2, "chop_semi": 6, "MAP_END": 1, "libopt": 9, "ALOOP": 1, "aloop_end": 1, "aloop": 1, "ALOOP_END": 1, "sv": 5, "BLOOP": 1, "bloop_end": 1, "svn": 2, "svn.nes.": 1, "sv.nes.": 1, "bloop": 1, "BLOOP_END": 1, "delete/nolog/noconf": 1, "VMOD_SYM_LOOP": 1, "VMOD_SYM_IN": 1, "vmod_sym_in": 1, "vmod_sym_loop": 1, "VMAP_LOOP": 1, "vmap_end": 1, "vmap_loop": 2, "VMAP_END": 1, "EXIT_M2S": 1, "endsubroutine": 2, "BUILD_XSLT.COM": 1, "XSLT": 1, "Arguments": 1, "want": 2, "debug": 1, "package": 1, "requires": 2, "libxml": 2, "have": 1, "already": 1, "been": 1, "need": 2, "ensure": 1, "that": 1, "LIBXML": 2, "points": 1, "directory": 1, "containing": 1, "/DEBUG/NOOPTIMIZE/LIST/SHOW": 1, "N": 1, "CC": 1, "cc_opts": 1, "Defining": 2, "XML_LIBDIR": 6, "srcdir": 3, "t": 4, "globals.c.": 1, "manually": 1, "XML_SRCDIR": 1, "DEVICE": 1, "DIRECTORY": 1, "h_file": 2, "includedir": 2, "pass_no": 3, "_SRCDIR": 2, "libname": 3, "programs": 1, "progname": 1, ".OLB": 2, "object": 1, "logname": 1, "Building": 1, "pass_description": 1, "next_source": 1, "all": 3, "folks": 1, "EXIT_OUT": 2, "def": 1, "exit_status": 2, "ERROR_OUT": 1, "status": 2, "BUILD": 2, "subroutine.": 1, "Compile": 1, "insert": 1, "into": 2, "subroutine": 1, "EXIT_BUILD": 2, "source_file": 3, "object_file": 4, "compile": 1, "p2": 2, "cc_command": 1, "/object": 1, "dbgopts": 1, "libexslt/lib": 1, "libxslt/lib": 1, "libxml/library": 1, "Compiling": 1, "VAXC": 1, "said": 1, "but": 1, "usual": 1, "cruft": 1, "vaxcrtl": 1, "avoid": 1, "hair": 1, "we": 1, "don": 1, "match": 2, "probably": 1, "doesn": 1, "looking": 1, "issues": 1, "yet.": 1, "CC/DECC/PREFIX": 1, "LINK/exe": 1, "VMSBACKUP.EXE": 1, "vmsbackup.obj": 1, "dclmain.obj": 1, "match.obj": 1, "input/opt": 1, "identification": 1 }, "DM": { "#define": 4, "PI": 6, "#if": 1, "G": 1, "#elif": 1, "I": 1, "#else": 1, "K": 1, "#endif": 1, "var/GlobalCounter": 1, "var/const/CONST_VARIABLE": 1, "var/list/MyList": 1, "list": 3, "(": 17, "new": 1, "/datum/entity": 2, ")": 17, "var/list/EmptyList": 1, "[": 2, "]": 2, "//": 6, "creates": 1, "a": 1, "of": 1, "null": 2, "entries": 1, "var/list/NullList": 1, "var/name": 1, "var/number": 1, "/datum/entity/proc/myFunction": 1, "world.log": 5, "<<": 5, "/datum/entity/New": 1, "number": 2, "GlobalCounter": 1, "+": 3, "/datum/entity/unit": 1, "name": 1, "/datum/entity/unit/New": 1, "..": 1, "calls": 1, "the": 2, "parent": 1, "s": 1, "proc": 1, ";": 3, "equal": 1, "to": 1, "super": 1, "and": 1, "base": 1, "in": 1, "other": 1, "languages": 1, "rand": 1, "/datum/entity/unit/myFunction": 1, "/proc/ReverseList": 1, "var/list/input": 1, "var/list/output": 1, "for": 1, "var/i": 1, "input.len": 1, "i": 3, "-": 2, "IMPORTANT": 1, "List": 1, "Arrays": 1, "count": 1, "from": 1, "output": 2, "input": 1, "is": 2, "return": 3, "/proc/DoStuff": 1, "var/bitflag": 2, "bitflag": 4, "|": 1, "/proc/DoOtherStuff": 1, "bits": 1, "maximum": 1, "amount": 1, "&": 1, "/proc/DoNothing": 1, "var/pi": 1, "if": 2, "pi": 2, "else": 2, "CONST_VARIABLE": 1, "#undef": 1, "Undefine": 1 }, "DNS Zone": { "ORIGIN": 1, "c.2.1.0.3.0.0.2.1.e.f.f.3.ip6.arpa.": 1, "TTL": 3, "@": 2, "IN": 5, "SOA": 2, "ns": 1, "root": 1, "(": 2, ";": 11, "SERIAL": 1, "REFRESH": 1, "RETRY": 1, "EXPIRE": 1, "MINIMUM": 1, ")": 2, "NS": 3, "ns.example.com.": 1, "c.a.7.e.d.7.e.f.f.f.0.2.8.0.a.0": 1, "PTR": 1, "sip01.example.com.": 1, "d": 3, "root.localhost.": 2, "root.sneaky.net.": 1, "serial": 1, "refresh": 1, "h": 2, "retry": 1, "expire": 1, "negative": 1, "response": 1, "localhost.": 1, "secondary": 1, "name": 1, "server": 1, "is": 1, "preferably": 1, "externally": 1, "maintained": 1, "www": 1, "A": 1 }, "DTrace": { "#pragma": 2, "D": 2, "option": 2, "quiet": 1, "self": 4, "int": 38, "tottime": 3, ";": 109, "BEGIN": 1, "{": 15, "timestamp": 6, "}": 16, "php": 1, "target": 1, "function": 1, "-": 16, "entry": 2, "@counts": 2, "[": 20, "copyinstr": 1, "(": 98, "arg0": 5, ")": 98, "]": 20, "count": 3, "END": 2, "printf": 18, "/": 5, "printa": 6, "#define": 8, "LocalTransactionId": 4, "unsigned": 15, "LWLockId": 7, "LWLockMode": 6, "LOCKMODE": 3, "BlockNumber": 11, "Oid": 31, "ForkNumber": 11, "bool": 15, "char": 10, "provider": 1, "postgresql": 1, "probe": 55, "transaction__start": 1, "transaction__commit": 1, "transaction__abort": 1, "lwlock__acquire": 1, "lwlock__release": 1, "lwlock__wait__start": 1, "lwlock__wait__done": 1, "lwlock__condacquire": 1, "lwlock__condacquire__fail": 1, "lock__wait__start": 1, "lock__wait__done": 1, "query__parse__start": 1, "const": 7, "*": 7, "query__parse__done": 1, "query__rewrite__start": 1, "query__rewrite__done": 1, "query__plan__start": 1, "query__plan__done": 1, "query__execute__start": 1, "query__execute__done": 1, "query__start": 1, "query__done": 1, "statement__status": 1, "sort__start": 1, "sort__done": 1, "long": 1, "buffer__read__start": 1, "buffer__read__done": 1, "buffer__flush__start": 1, "buffer__flush__done": 1, "buffer__checkpoint__start": 1, "buffer__checkpoint__sync__start": 1, "buffer__checkpoint__done": 1, "buffer__sync__start": 1, "buffer__sync__written": 1, "buffer__sync__done": 1, "buffer__write__dirty__start": 1, "buffer__write__dirty__done": 1, "deadlock__found": 1, "checkpoint__start": 1, "checkpoint__done": 1, "clog__checkpoint__start": 1, "clog__checkpoint__done": 1, "subtrans__checkpoint__start": 1, "subtrans__checkpoint__done": 1, "multixact__checkpoint__start": 1, "multixact__checkpoint__done": 1, "twophase__checkpoint__start": 1, "twophase__checkpoint__done": 1, "smgr__md__read__start": 1, "smgr__md__read__done": 1, "smgr__md__write__start": 1, "smgr__md__write__done": 1, "xlog__insert": 1, "xlog__switch": 1, "wal__buffer__write__dirty__start": 1, "wal__buffer__write__dirty__done": 1, "SHEBANG#!dtrace": 1, "specsize": 1, "m": 1, "linuxulator*": 33, "futex": 33, "futex_get": 1, "error": 1, "futex_sleep": 2, "requeue_error": 1, "sleep_error": 2, "futex_wait": 3, "copyin_error": 5, "itimerfix_error": 1, "futex_atomic_op": 3, "missing_access_check": 1, "unimplemented_op": 1, "unimplemented_cmp": 1, "linux_sys_futex": 11, "unimplemented_clockswitch": 1, "unhandled_efault": 1, "unimplemented_lock_pi": 1, "unimplemented_unlock_pi": 1, "unimplemented_trylock_pi": 1, "unimplemented_wait_requeue_pi": 1, "unimplemented_cmp_requeue_pi": 1, "unknown_operation": 1, "linux_get_robust_list": 1, "copyout_error": 1, "handle_futex_death": 1, "fetch_robust_entry": 1, "release_futexes": 1, "probename": 2, "probeprov": 5, "probemod": 2, "probefunc": 20, "stack": 5, "ustack": 3, "invalid_cmp_requeue_use": 1, "deprecated_requeue": 1, "linux_set_robust_list": 1, "size_error": 1, "execname": 3, "create": 1, "+": 4, "futex_count": 4, "@max_futexes": 2, "max": 2, "destroy": 2, "/futex_count": 1, "locks": 3, "futex_mtx": 3, "locked": 1, "check": 2, "@stats": 2, "ts": 2, "spec": 5, "speculation": 1, "unlock": 2, "/check": 1, "discard": 1, "tick": 1, "s": 1, "/spec": 1, "&&": 1, "commit": 1, "time": 4, "@calls": 2, "return": 1, "/self": 1, "this": 3, "timediff": 3, "@timestats": 2, "quantize": 1, "@longest": 2 }, "Dart": { "import": 1, "as": 1, "math": 1, ";": 9, "class": 1, "Point": 5, "{": 3, "num": 2, "x": 2, "y": 2, "(": 7, "this.x": 1, "this.y": 1, ")": 7, "distanceTo": 1, "other": 1, "var": 4, "dx": 3, "-": 2, "other.x": 1, "dy": 3, "other.y": 1, "return": 1, "math.sqrt": 1, "*": 2, "+": 1, "}": 3, "void": 1, "main": 1, "p": 1, "new": 2, "q": 1, "print": 1 }, "Diff": { "diff": 1, "-": 5, "git": 1, "a/lib/linguist.rb": 2, "b/lib/linguist.rb": 2, "index": 1, "d472341..8ad9ffb": 1, "+": 3 }, "Dockerfile": { "docker": 1, "-": 27, "version": 1, "from": 1, "ubuntu": 1, "maintainer": 1, "Solomon": 1, "Hykes": 1, "": 1, "run": 13, "apt": 6, "get": 6, "install": 6, "y": 5, "q": 2, "curl": 2, "git": 7, "s": 1, "https": 1, "//go.googlecode.com/files/go1.1.1.linux": 1, "amd64.tar.gz": 1, "|": 1, "tar": 1, "v": 2, "C": 1, "/usr/local": 1, "xz": 1, "env": 4, "PATH": 2, "/usr/local/go/bin": 2, "/usr/local/bin": 2, "/usr/local/sbin": 2, "/usr/bin": 2, "/usr/sbin": 2, "/bin": 2, "/sbin": 2, "GOPATH": 1, "/go": 1, "CGO_ENABLED": 1, "cd": 5, "/tmp": 1, "&&": 9, "echo": 2, "t.go": 1, "go": 2, "test": 1, "a": 1, "i": 1, "PKG": 12, "github.com/kr/pty": 1, "REV": 6, "c699": 1, ";": 3, "clone": 3, "http": 3, "//": 3, "/go/src/": 6, "checkout": 3, "f": 3, "github.com/gorilla/context/": 1, "d61e5": 1, "github.com/gorilla/mux/": 1, "b36453141c": 1, "iptables": 1, "/etc/apt/sources.list": 1, "update": 1, "lxc": 1, "aufs": 1, "tools": 1, "add": 1, ".": 1, "/go/src/github.com/dotcloud/docker": 1, "/go/src/github.com/dotcloud/docker/docker": 1, "ldflags": 1, "/go/bin": 1, "cmd": 1, "[": 1, "]": 1 }, "Dogescript": { "quiet": 1, "wow": 4, "such": 2, "language": 3, "very": 1, "syntax": 1, "github": 1, "recognized": 1, "loud": 1, "much": 1, "friendly": 2, "rly": 1, "is": 2, "true": 1, "plz": 2, "console.loge": 2, "with": 2, "but": 1, "module.exports": 1 }, "E": { "SHEBANG#!rune": 1, "pragma.syntax": 2, "(": 140, ")": 139, "def": 53, "pi": 2, "-": 11, ".acos": 1, "makeEPainter": 2, "": 1, "colors": 1, "": 1, "doWhileUnresolved": 3, "indicator": 2, "task": 2, "{": 77, "loop": 3, "if": 4, "Ref.isResolved": 2, "<": 3, "}": 77, "makeBuckets": 2, "size": 4, "values": 6, "[": 20, "]": 20, "*": 4, ".diverge": 1, "#": 2, "storage": 1, "buckets": 9, "to": 32, "int": 5, "return": 23, "get": 3, "i": 16, "transfer": 1, "j": 10, "amount": 1, "amountLim": 3, "amount.min": 1, ".max": 1, "+": 7, "makeDisplayComponent": 2, "c": 2, "paintCallback": 1, "paintComponent": 1, "g": 1, "pixelsW": 4, "c.getWidth": 1, "pixelsH": 3, "c.getHeight": 1, "bucketsW": 4, "buckets.size": 5, "g.setColor": 3, "colors.getWhite": 1, "g.fillRect": 2, "colors.getDarkGray": 1, "var": 9, "sum": 3, "for": 4, "in": 2, "value": 3, "x0": 3, "/": 3, ".floor": 3, "x1": 2, "colors.getBlack": 1, "g.": 1, "Total": 1, "c.setPreferredSize": 1, "": 1, "done": 6, "Promise": 1, "indicating": 1, "when": 3, "the": 1, "window": 1, "is": 2, "closed": 1, "frame": 1, "": 1, "frame.setContentPane": 1, "display": 1, "frame.addWindowListener": 1, "mainWindowListener": 1, "windowClosing": 1, "event": 2, "void": 6, "bind": 3, "null": 2, "match": 5, "_": 6, "frame.setLocation": 1, "frame.pack": 1, "ni": 4, "fn": 2, "%": 6, "buckets.transfer": 2, "//": 1, "mi": 3, "entropy.nextInt": 2, "#entropy.nextInt": 1, "clock": 1, "timer.every": 1, "clock.stop": 1, "else": 2, "display.repaint": 1, "clock.start": 1, "frame.show": 1, "interp.waitAtTop": 1, "makeVehicle": 3, "self": 1, "vehicle": 2, "milesTillEmpty": 1, "self.milesPerGallon": 1, "self.getFuelRemaining": 1, "makeCar": 4, "fuelRemaining": 4, "car": 8, "extends": 2, "milesPerGallon": 2, "getFuelRemaining": 2, "makeJet": 1, "jet": 3, "println": 2, "The": 2, "can": 1, "go": 1, "car.milesTillEmpty": 1, "miles.": 1, "name": 4, "x": 3, "y": 3, "moveTo": 1, "newX": 2, "newY": 2, "getX": 1, "getY": 1, "setName": 1, "newName": 2, "getName": 1, "sportsCar": 1, "sportsCar.moveTo": 1, "sportsCar.getName": 1, "at": 1, "X": 1, "location": 1, "sportsCar.getX": 1, "makeVOCPair": 1, "brandName": 3, "String": 1, "near": 6, "myTempContents": 6, "none": 2, "brand": 5, "__printOn": 4, "out": 4, "TextWriter": 4, "out.print": 4, "ProveAuth": 2, "<$brandName>": 3, "prover": 1, "getBrand": 4, "coerce": 2, "specimen": 2, "optEjector": 3, "sealedBox": 2, "offerContent": 1, "CheckAuth": 2, "checker": 3, "template": 1, "authList": 2, "any": 2, "specimenBox": 2, "specimenBox.__respondsTo": 1, "specimenBox.offerContent": 1, "auth": 3, "throw.eject": 1, "Unmatched": 1, "authorization": 1, "__respondsTo": 2, "true": 1, "false": 1, "__getAllegedType": 1, "null.__getAllegedType": 1, "#File": 1, "objects": 1, "hardwired": 1, "files": 1, "file1": 1, "": 1, "file2": 1, "": 1, "#Using": 2, "a": 4, "variable": 1, "file": 3, "filePath": 2, "file3": 1, "": 1, "single": 1, "character": 1, "specify": 1, "Windows": 1, "drive": 1, "file4": 1, "": 1, "file5": 1, "": 1, "file6": 1, "": 1, "send": 1, "message": 4, "friend": 4, "<-receive(message))>": 1, "chatUI.showMessage": 4, "catch": 2, "prob": 2, "receive": 1, "receiveFriend": 2, "friendRcvr": 2, "save": 1, "file.setText": 1, "makeURIFromObject": 1, "chatController": 2, "load": 1, "getObjectFromURI": 1, "file.getText": 1, "tempVow": 2, "#...use": 1, "#....": 1, "report": 1, "problem": 1, "finally": 1, "#....log": 1 }, "EBNF": { "Statement": 1, "(": 1, "NamedFunction": 1, "|": 20, "AnonymousFunction": 4, "Assignment": 2, "Expr": 5, ")": 1, ";": 35, "Term": 2, "{": 5, "}": 5, "Symbol": 1, "name": 4, "string": 4, "diffuse": 2, "real": 22, "ambient": 2, "specular": 2, "shininess": 2, "alpha": 2, "mapping": 2, "texture": 2, "material": 1, "[": 3, "]": 3, "vertex_p3n3_name": 3, "vertex_p3n3t2_name": 3, "vertex_type": 2, "vertex_position": 3, "vertex_normal": 3, "vertex_uv": 2, "vertex_p3n3": 2, "vertex_p3n3t2": 2, "vertex": 2, "vertex_array": 2, "positive": 4, "vertices": 2, "triangle": 2, "natural": 4, "triangle_array": 2, "triangles": 2, "material_name": 2, "object": 1, "digit_without_zero": 3, "digit": 4 }, "ECL": { "#option": 1, "(": 32, "true": 1, ")": 32, ";": 23, "namesRecord": 4, "RECORD": 1, "string20": 1, "surname": 1, "string10": 2, "forename": 1, "integer2": 5, "age": 2, "dadAge": 1, "mumAge": 1, "END": 1, "namesRecord2": 3, "record": 1, "extra": 1, "end": 1, "namesTable": 11, "dataset": 2, "FLAT": 2, "namesTable2": 9, "aveAgeL": 3, "l": 1, "l.dadAge": 1, "+": 16, "l.mumAge": 1, "/2": 2, "aveAgeR": 4, "r": 1, "r.dadAge": 1, "r.mumAge": 1, "output": 9, "join": 11, "left": 2, "right": 3, "//Several": 1, "simple": 1, "examples": 1, "of": 1, "sliding": 2, "syntax": 1, "left.age": 8, "right.age": 12, "-": 5, "and": 10, "<": 1, "between": 7, "//Same": 1, "but": 1, "on": 1, "strings.": 1, "Also": 1, "includes": 1, "to": 1, "ensure": 1, "sort": 1, "is": 1, "done": 1, "by": 1, "non": 1, "before": 1, "sliding.": 1, "left.surname": 2, "right.surname": 4, "[": 4, "]": 4, "all": 1, "//This": 1, "should": 1, "not": 1, "generate": 1, "a": 1, "self": 1 }, "ECLiPSe": { "-": 14, "lib": 1, "(": 20, "ic": 1, ")": 20, ".": 8, "vabs": 2, "Val": 8, "AbsVal": 10, "#": 9, ";": 1, "labeling": 2, "[": 9, "]": 9, "vabsIC": 1, "or": 1, "faitListe": 3, "_": 2, "First": 2, "|": 5, "Rest": 6, "Taille": 2, "Min": 2, "Max": 2, "Min..Max": 1, "Taille1": 2, "suite": 3, "Xi": 5, "Xi1": 7, "Xi2": 7, "checkRelation": 3, "VabsXi1": 2, "Xi.": 1, "checkPeriode": 3, "ListVar": 2, "length": 1, "Length": 2, "<": 1, "X1": 2, "X2": 2, "X3": 2, "X4": 2, "X5": 2, "X6": 2, "X7": 2, "X8": 2, "X9": 2, "X10": 3 }, "EJS": { "<%>": 25, "include": 7, "parts": 2, "depend": 2, "
": 16, "class=": 16, "if": 6, "user": 2, "primaryAccount": 2, "teacher": 3, "sidebar": 3, "dashboard": 2, "else": 6, "student": 3, "
": 3, "

": 3, "There": 1, "seems": 1, "to": 3, "be": 1, "a": 5, "problem": 1, "

": 3, "
": 3, "
": 16, "

": 4, "Pieces": 5, "

": 4, "pieces": 5, "length": 5, "1": 1, "

": 9, "You": 3, "have": 3, "": 9, "": 9, "piece": 1, "practice": 2, "

": 9, "<%=>": 11, "undefined": 3, "0": 3, "No": 3, "no": 1, "assigned.": 1, "style=": 2, "role=": 1, "": 2, "Completed": 2, "inProgressPieces": 7, "in": 1, "<": 8, "%": 4, "for": 2, "(": 2, "var": 2, "i": 16, ";": 4, "inProgressPieces.length": 1, "+": 4, ")": 2, "{": 2, "href": 4, "title": 4, "": 4, "By": 2, "author": 2, "Teacher": 2, "teacherName": 2, "Average": 2, "Practice": 4, "Time": 2, "averagePracticeTime": 2, "mins": 2, "class": 2, "completedPieces": 7, "completedPieces.length": 1 }, "EQ": { "IFNDEF": 1, "(": 374, ")": 374, "{": 162, "public": 81, "class": 6, "HTTPServerVirtualHostListener": 5, "EventLoopReadListener": 3, "static": 21, "create": 3, "String": 58, "name": 7, "HTTPServer": 5, "server": 14, "prefix": 4, "null": 60, "Logger": 1, "logger": 3, ";": 256, "if": 68, "server.get_logger": 3, "}": 162, "Log.error": 1, "return": 65, "void": 17, "on_read_ready": 3, "close": 6, "ELSE": 6, "LoggerObject": 2, "Client": 3, "LocalSocket": 3, "socket": 18, "EventLoopEntry": 2, "ee": 8, "embed": 10, "#include": 3, "": 1, "": 1, "": 1, "||": 2, "var": 22, "eventloop": 2, "server.get_eventloop": 2, "v": 19, "new": 6, "v.set_logger": 2, "v.server": 2, "v.socket": 1, "v.ee": 2, "eventloop.entry_for_object": 1, "v.ee.set_read_listener": 1, "ee.remove": 2, "socket.close": 2, "receive_fd": 2, "private": 1, "is": 6, "FileDescriptor": 2, "false": 23, "int": 35, "lsfd": 2, ".get_fd": 1, "r": 6, "newfd": 6, "-": 8, "char": 2, "buf": 2, "[": 5, "]": 5, "struct": 4, "msghdr": 1, "msg": 3, "iovec": 1, "iov": 4, "ssize_t": 1, "n": 2, "union": 1, "cmsghdr": 1, "cm": 1, "control": 1, "CMSG_SPACE": 1, "sizeof": 3, "control_un": 1, "cmsghdr*": 1, "cmptr": 6, "msg.msg_control": 1, "control_un.control": 2, "msg.msg_controllen": 1, "msg.msg_name": 1, "NULL": 2, "msg.msg_namelen": 1, ".iov_base": 1, ".iov_len": 1, "msg.msg_iov": 1, "msg.msg_iovlen": 1, "recvmsg": 1, "&": 2, "<": 5, "log_error": 7, "CMSG_FIRSTHDR": 1, "&&": 6, "cmsg_len": 1, "CMSG_LEN": 1, "cmsg_level": 1, "SOL_SOCKET": 1, "cmsg_type": 1, "SCM_RIGHTS": 1, "*": 1, "int*": 1, "CMSG_DATA": 1, "log_warning": 1, "newsock": 4, "TCPSocket.create": 1, "fds": 2, "as": 2, "FileDescriptorSocket": 1, "fds.set_fd": 1, "server.on_new_client_socket": 1, "socketprefix": 2, "v.socketprefix": 1, "v.start": 1, "bool": 18, "start": 3, "String.is_empty": 5, "LocalSocket.create": 1, "pp": 4, "socketname": 3, ".printf": 5, ".add": 6, ".to_string": 6, "socket.listen": 1, "event_loop": 2, "event_loop.entry_for_object": 1, "ee.set_read_listener": 1, "this": 1, "log_debug": 1, "true": 9, "ns": 3, "socket.accept": 1, "Client.create": 1, "SEButtonEntity": 6, "SESpriteEntity": 1, "SEPointerListener": 1, "SEImageButtonEntity": 2, "property": 9, "SEImage": 7, "image_normal": 4, "image_hover": 3, "image_pressed": 2, "update": 8, "get_pressed": 3, "img": 12, "set_image": 3, "else": 5, "get_has_pointer": 3, "SETextButtonEntity": 2, "button_text": 4, "normal_font": 6, "hover_font": 5, "pressed_font": 4, "ff": 10, "set_text": 3, "for_image": 1, "SEButtonEntity.for_images": 1, "for_images": 1, "normal": 2, "hover": 2, "pressed": 10, ".set_image_normal": 1, ".set_image_hover": 1, ".set_image_pressed": 1, "for_text": 1, "text": 2, ".set_button_text": 1, ".set_normal_font": 1, ".set_hover_font": 1, ".set_pressed_font": 1, "SEMessageListener": 1, "listener": 2, "Object": 10, "data": 4, "has_pointer": 8, "initialize": 1, "SEResourceCache": 1, "rsc": 2, "base.initialize": 1, "virtual": 4, "on_pointer_enter": 2, "SEPointerInfo": 6, "pi": 9, "on_pointer_leave": 2, "on_pointer_move": 1, "pi.is_inside": 3, "get_x": 3, "get_y": 3, "get_width": 3, "get_height": 3, "on_pointer_press": 1, "on_pointer_release": 1, "on_pointer_click": 2, "listener.on_message": 1, "interface": 1, "Stringable": 7, "Integer": 1, "Double": 1, "Boolean": 1, "instance": 1, "o": 26, "as_string": 2, "strptr": 10, "as_strptr": 1, "str": 17, "str.to_strptr": 1, "is_in_collection": 1, "Collection": 2, "c": 6, "foreach": 2, "s": 9, "in": 2, "s.equals": 1, "is_empty": 1, "str.get_char": 2, "for_object": 1, "for_character": 1, "sb": 3, "StringBuffer.create": 3, "sb.append_c": 3, "sb.to_string": 3, "for_integer": 2, "av": 6, "IFDEF": 5, "av.ToString": 2, "String.for_strptr": 5, "st": 9, "java.lang.String.valueOf": 3, "for_long": 1, "long": 1, "for_double": 1, "double": 1, "for_boolean": 1, "val": 2, "for_strptr": 1, "literal": 2, "StringImpl": 2, "v.set_strptr": 1, "for_utf8_buffer": 1, "Buffer": 2, "haszero": 2, "v.set_utf8_buffer": 1, "combine": 1, "strings": 2, "delim": 4, "unique": 2, "HashTable": 1, "flags": 3, "HashTable.create": 1, "String.as_string": 1, "continue": 2, "flags.get": 1, "flags.set": 1, "sb.count": 1, "sb.append": 2, "capitalize": 1, "c0": 5, "+": 1, "str.substring": 1, "StringFormatter": 1, "printf": 1, "dup": 1, "append": 1, "get_length": 1, "get_char": 1, "truncate": 1, "len": 2, "replace": 1, "replace_char": 1, "replace_string": 1, "remove": 1, "insert": 1, "pos": 1, "substring": 1, "alength": 1, "reverse": 1, "lowercase": 1, "uppercase": 1, "strip": 1, "Iterator": 1, "split": 1, "max": 1, "contains": 1, "rstr": 1, "chr": 1, "rchr": 1, "has_prefix": 1, "has_suffix": 1, "suffix": 1, "compare": 1, "ao": 4, "compare_ignore_case": 1, "equals": 1, "equals_ptr": 1, "equals_ignore_case": 1, "equals_ignore_case_ptr": 1, "StringIterator": 2, "iterate": 1, "iterate_reverse": 1, "to_integer_base": 1, "ibase": 1, "to_strptr": 1, "to_utf8_buffer": 1, "zero": 1, "hash": 1, "EditableString": 1, "as_editable": 1 }, "Eagle": { "": 2, "version=": 4, "encoding=": 2, "": 2, "eagle": 4, "SYSTEM": 2, "dtd": 2, "": 2, "": 2, "": 2, "": 4, "alwaysvectorfont=": 2, "verticaltext=": 2, "": 2, "": 2, "distance=": 2, "unitdist=": 2, "unit=": 2, "style=": 2, "multiple=": 2, "display=": 2, "altdistance=": 2, "altunitdist=": 2, "altunit=": 2, "": 2, "": 118, "number=": 119, "name=": 447, "color=": 118, "fill=": 118, "visible=": 118, "active=": 125, "": 2, "": 1, "": 1, "": 497, "x1=": 630, "y1=": 630, "x2=": 630, "y2=": 630, "width=": 512, "layer=": 822, "": 1, "": 2, "": 4, "": 60, "&": 5501, "lt": 2665, ";": 5567, "b": 64, "gt": 2770, "Resistors": 2, "Capacitors": 4, "Inductors": 2, "/b": 64, "p": 65, "Based": 2, "on": 2, "the": 5, "previous": 2, "libraries": 2, "ul": 2, "li": 12, "r.lbr": 2, "cap.lbr": 2, "cap": 2, "-": 768, "fe.lbr": 2, "captant.lbr": 2, "polcap.lbr": 2, "ipc": 2, "smd.lbr": 2, "/ul": 2, "All": 2, "SMD": 4, "packages": 2, "are": 2, "defined": 2, "according": 2, "to": 3, "IPC": 2, "specifications": 2, "and": 5, "CECC": 2, "author": 3, "Created": 3, "by": 3, "librarian@cadsoft.de": 3, "/author": 3, "for": 5, "Electrolyt": 2, "see": 4, "also": 2, "www.bccomponents.com": 2, "www.panasonic.com": 2, "www.kemet.com": 2, "http": 4, "//www.secc.co.jp/pdf/os_e/2004/e_os_all.pdf": 2, "(": 4, "SANYO": 2, ")": 4, "trimmer": 2, "refence": 2, "u": 2, "www.electrospec": 2, "inc.com/cross_references/trimpotcrossref.asp": 2, "/u": 2, "table": 2, "border": 2, "cellspacing": 2, "cellpadding": 2, "width": 6, "cellpaddding": 2, "tr": 2, "valign": 2, "td": 4, "amp": 66, "nbsp": 66, "/td": 4, "font": 2, "color": 20, "size": 2, "TRIM": 4, "POT": 4, "CROSS": 4, "REFERENCE": 4, "/font": 2, "P": 128, "TABLE": 4, "BORDER": 4, "CELLSPACING": 4, "CELLPADDING": 4, "TR": 36, "TD": 170, "COLSPAN": 16, "FONT": 166, "SIZE": 166, "FACE": 166, "ARIAL": 166, "B": 106, "RECTANGULAR": 2, "MULTI": 6, "TURN": 10, "/B": 90, "/FONT": 166, "/TD": 170, "/TR": 36, "ALIGN": 124, "CENTER": 124, "BOURNS": 6, "BI": 10, "TECH": 10, "DALE": 10, "VISHAY": 10, "PHILIPS/MEPCO": 10, "MURATA": 6, "PANASONIC": 10, "SPECTROL": 6, "MILSPEC": 6, "BGCOLOR": 76, "BR": 1478, "W": 92, "Y": 36, "J": 12, "X": 82, "PH": 2, "XH": 2, "SLT": 2, "ALT": 42, "T8S": 2, "T18/784": 2, "/1897": 2, "/1880": 2, "EKP/CT20/RJ": 2, "RJ": 14, "EKQ": 4, "EKR": 4, "EKJ": 2, "EKL": 2, "S": 18, "EVMCOG": 2, "T602": 2, "RT/RTR12": 6, "RJ/RJR12": 6, "SQUARE": 2, "BOURN": 4, "H": 24, "Z": 16, "T63YB": 2, "T63XB": 2, "T93Z": 2, "T93YA": 2, "T93XA": 2, "T93YB": 2, "T93XB": 2, "EKP": 8, "EKW": 6, "EKM": 4, "EKB": 2, "EKN": 2, "P/CT9P": 2, "P/3106P": 2, "W/3106W": 2, "X/3106X": 2, "Y/3106Y": 2, "Z/3105Z": 2, "EVMCBG": 2, "EVMCCG": 2, "RT/RTR22": 8, "RJ/RJR22": 6, "RT/RTR26": 6, "RJ/RJR26": 12, "RT/RTR24": 6, "RJ/RJR24": 12, "SINGLE": 4, "E": 6, "K": 4, "T": 10, "V": 10, "M": 10, "R": 6, "C": 6, "RX": 6, "PA": 2, "A": 16, "XW": 2, "XL": 2, "PM": 2, "PX": 2, "RXW": 2, "RXL": 2, "T7YB": 2, "T7YA": 2, "TXD": 2, "TYA": 2, "TYP": 2, "TYD": 2, "TX": 4, "SX": 6, "ET6P": 2, "ET6S": 2, "ET6X": 2, "W/8014EMW": 2, "P/8014EMP": 2, "X/8014EMX": 2, "TM7W": 2, "TM7P": 2, "TM7X": 2, "SMS": 2, "SMB": 2, "SMA": 2, "CT": 12, "EKV": 2, "EKX": 2, "EKZ": 2, "N": 2, "RVA0911V304A": 2, "RVA0911H413A": 2, "RVG0707V100A": 2, "RVA0607V": 2, "RVA1214H213A": 2, "EVMQ0G": 4, "EVMQIG": 2, "EVMQ3G": 2, "EVMS0G": 2, "EVMG0G": 2, "EVMK4GA00B": 2, "EVM30GA00B": 2, "EVMK0GA00B": 2, "EVM38GA00B": 2, "EVMB6": 2, "EVLQ0": 2, "EVMMSG": 2, "EVMMBG": 2, "EVMMAG": 2, "EVMMCS": 2, "EVMM1": 2, "EVMM0": 2, "EVMM3": 2, "RJ/RJR50": 6, "/TABLE": 4, "TOCOS": 4, "AUX/KYOCERA": 4, "G": 10, "ST63Z": 2, "ST63Y": 2, "ST5P": 2, "ST5W": 2, "ST5X": 2, "A/B": 2, "C/D": 2, "W/X": 2, "ST5YL/ST53YL": 2, "ST5YJ/5T53YJ": 2, "ST": 14, "EVM": 8, "YS": 2, "D": 2, "G4B": 2, "G4A": 2, "TR04": 2, "S1": 4, "TRG04": 2, "DVR": 2, "CVR": 4, "A/C": 2, "ALTERNATE": 2, "/tr": 2, "/table": 2, "": 60, "": 4, "": 53, "RESISTOR": 52, "": 64, "x=": 240, "y=": 242, "dx=": 64, "dy=": 64, "": 108, "size=": 114, "NAME": 52, "": 108, "VALUE": 52, "": 132, "": 52, "": 3, "": 3, "Pin": 1, "Header": 1, "Connectors": 1, "PIN": 1, "HEADER": 1, "": 39, "drill=": 41, "shape=": 39, "ratio=": 41, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "language=": 2, "EAGLE": 2, "Design": 5, "Rules": 5, "Die": 1, "Standard": 1, "sind": 1, "so": 2, "gew": 1, "hlt": 1, "dass": 1, "sie": 1, "f": 1, "r": 1, "die": 3, "meisten": 1, "Anwendungen": 1, "passen.": 1, "Sollte": 1, "ihre": 1, "Platine": 1, "besondere": 1, "Anforderungen": 1, "haben": 1, "treffen": 1, "Sie": 1, "erforderlichen": 1, "Einstellungen": 1, "hier": 1, "und": 1, "speichern": 1, "unter": 1, "einem": 1, "neuen": 1, "Namen": 1, "ab.": 1, "The": 1, "default": 1, "have": 2, "been": 1, "set": 1, "cover": 1, "a": 2, "wide": 1, "range": 1, "of": 1, "applications.": 1, "Your": 1, "particular": 1, "design": 2, "may": 1, "different": 1, "requirements": 1, "please": 1, "make": 1, "necessary": 1, "adjustments": 1, "save": 1, "your": 1, "customized": 1, "rules": 1, "under": 1, "new": 1, "name.": 1, "": 142, "value=": 145, "": 1, "": 1, "": 8, "": 8, "refer=": 7, "": 1, "": 1, "": 3, "library=": 3, "package=": 3, "smashed=": 3, "": 6, "": 3, "1": 1, "778": 1, "16": 1, "002": 1, "": 1, "": 1, "": 3, "": 4, "element=": 4, "pad=": 4, "": 1, "extent=": 1, "": 3, "": 2, "": 8, "": 2, "": 1, "": 1, "": 1, "": 1, "": 1, "xreflabel=": 1, "xrefpart=": 1, "Frames": 1, "Sheet": 2, "Layout": 1, "": 1, "": 1, "font=": 4, "DRAWING_NAME": 1, "LAST_DATE_TIME": 1, "SHEET": 1, "": 1, "columns=": 1, "rows=": 1, "": 1, "": 1, "": 1, "": 1, "prefix=": 1, "uservalue=": 1, "FRAME": 1, "DIN": 1, "A4": 1, "landscape": 1, "with": 1, "location": 1, "doc.": 1, "field": 1, "": 1, "": 1, "symbol=": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "wave": 10, "soldering": 10, "Source": 2, "//download.siliconexpert.com/pdfs/2005/02/24/Semi_Ap/2/VSH/Resistor/dcrcwfre.pdf": 2, "MELF": 8, "type": 20, "grid": 20, "mm": 20, "curve=": 56, "": 12, "radius=": 12 }, "Eiffel": { "note": 2, "description": 2, "date": 1, "revision": 1, "class": 4, "APPLICATION": 1, "inherit": 2, "ARGUMENTS": 1, "HTTP_SERVER_SHARED_CONFIGURATION": 1, "create": 9, "make": 7, "feature": 7, "{": 7, "NONE": 4, "}": 7, "-": 38, "Initialization": 3, "Run": 1, "application.": 1, "local": 2, "l_server": 2, "HTTP_SERVER": 1, "l_cfg": 3, "HTTP_SERVER_CONFIGURATION": 1, "l_http_handler": 2, "HTTP_HANDLER": 1, "do": 7, "l_cfg.make": 1, "l_cfg.http_server_port": 1, "_000": 1, "l_cfg.document_root": 1, "default_document_root": 2, "set_server_configuration": 1, "(": 19, ")": 19, "debug": 1, "l_cfg.set_is_verbose": 1, "True": 1, "end": 14, "l_server.make": 1, "APPLICATION_CONNECTION_HANDLER": 1, "l_http_handler.make": 1, "l_server.setup": 1, "Access": 3, "STRING": 4, "BOOK_COLLECTION": 2, "a_name": 5, "STRING_32": 4, "Create": 1, "a": 1, "book": 1, "collection": 3, "with": 3, ".": 4, "set_name": 1, "book_index.make": 1, "ensure": 2, "name_set": 1, "name": 5, "Name.": 1, "books": 2, "LIST": 4, "[": 7, "BOOK": 6, "]": 7, "of": 2, "book.": 1, "LINKED_LIST": 2, "Result.make": 1, "across": 2, "book_index": 2, "as": 2, "it": 2, "loop": 2, "Result.append": 1, "it.item": 2, "books_by_author": 1, "a_author": 2, "Books": 1, "wrote": 1, "by": 1, "l": 4, "detachable": 1, "book_index.at": 1, "a_book.author.name": 2, "if": 1, "Void": 1, "then": 1, "l.make": 1, "book_index.put": 1, "l.force": 1, "a_book": 1, "add_books": 1, "book_list": 3, "like": 1, "Append": 1, "add_book": 1, "Implementation": 1, "HASH_TABLE": 1, "Association": 1, "author": 2, "and": 1, "its": 1, "books.": 1, "GIT_CHECKOUT_COMMAND": 1, "GIT_COMMAND": 1, "make_master": 2, "a_branch": 5, "Checkout": 2, "the": 2, "branch": 4, "initialize": 1, "arguments.force_last": 1, "branch_set": 1, "master": 1, "branch.": 1, "Branch": 1, "to": 1, "checkout": 1, "Git": 1, "subcommand": 1 }, "Elixir": { "%": 1, "{": 11, "hex": 10, "cowboy": 1, "}": 11, "cowlib": 1, "hackney": 1, "hound": 1, "httpoison": 1, "idna": 1, "phoenix": 1, "plug": 1, "poison": 1, "ranch": 1 }, "Elm": { "import": 3, "List": 1, "(": 118, "intercalate": 2, "intersperse": 3, ")": 115, "Website.Skeleton": 1, "Website.ColorScheme": 1, "addFolder": 4, "folder": 2, "lst": 6, "let": 2, "add": 2, "x": 13, "y": 7, "+": 14, "in": 2, "f": 8, "n": 2, "xs": 9, "map": 11, "elements": 2, "[": 31, "]": 31, "functional": 2, "reactive": 2, "example": 3, "name": 6, "loc": 2, "Text.link": 1, "toText": 6, "toLinks": 2, "title": 2, "links": 2, "flow": 4, "right": 8, "width": 3, "text": 4, "italic": 1, "bold": 2, ".": 9, "Text.color": 1, "accent4": 1, "insertSpace": 2, "case": 5, "of": 7, "{": 1, "-": 9, "spacer": 2, ";": 1, "}": 1, "subsection": 2, "w": 7, "info": 2, "down": 3, "words": 2, "markdown": 1, "|": 3, "###": 1, "Basic": 1, "Examples": 1, "Each": 1, "listed": 1, "below": 1, "focuses": 1, "on": 1, "a": 5, "single": 1, "function": 1, "or": 1, "concept.": 1, "These": 1, "examples": 1, "demonstrate": 1, "all": 1, "the": 1, "basic": 1, "building": 1, "blocks": 1, "Elm.": 1, "content": 2, "exampleSets": 2, "plainText": 1, "main": 3, "lift": 1, "skeleton": 1, "Window.width": 1, "asText": 1, "qsort": 4, "filter": 2, "<)x)>": 1, "data": 1, "Tree": 3, "Node": 8, "Empty": 8, "empty": 2, "singleton": 2, "v": 8, "insert": 4, "tree": 7, "left": 7, "if": 2, "then": 2, "else": 2, "<": 1, "fromList": 3, "foldl": 1, "depth": 5, "max": 1, "t1": 2, "t2": 3, "display": 4, "monospace": 1, "concat": 1, "show": 2 }, "Emacs Lisp": { ";": 504, "-": 809, "*": 5, "mode": 29, "emacs": 10, "lisp": 4, "coding": 2, "mule": 1, "Desktop": 2, "File": 1, "for": 13, "Emacs": 8, "Created": 2, "Sat": 1, "Jan": 1, "file": 25, "format": 4, "version": 6, "Global": 1, "section": 2, "(": 278, "setq": 24, "desktop": 2, "missing": 1, "warning": 1, "nil": 59, ")": 260, "tags": 2, "name": 15, "table": 14, "list": 13, "search": 3, "ring": 3, "regexp": 7, "register": 1, "alist": 11, "history": 1, "Buffer": 1, "buffers": 1, "listed": 1, "in": 20, "same": 1, "order": 1, "as": 2, "buffer": 8, "create": 2, "system": 1, ".": 49, "undecided": 1, "unix": 1, "print": 1, "ess": 48, "julia.el": 2, "ESS": 5, "julia": 39, "and": 14, "inferior": 13, "interaction": 1, "Copyright": 1, "C": 2, "Vitalie": 3, "Spinu.": 1, "Filename": 1, "Author": 1, "Spinu": 2, "based": 1, "on": 4, "mode.el": 1, "from": 6, "lang": 1, "project": 2, "Maintainer": 1, "Keywords": 1, "This": 7, "is": 26, "*NOT*": 1, "part": 2, "of": 24, "GNU": 4, "Emacs.": 1, "program": 6, "free": 1, "software": 1, "you": 8, "can": 2, "redistribute": 1, "it": 13, "and/or": 2, "modify": 5, "under": 1, "the": 40, "terms": 1, "General": 3, "Public": 3, "License": 3, "published": 1, "by": 7, "Free": 2, "Software": 2, "Foundation": 2, "either": 1, "any": 1, "later": 1, "version.": 1, "distributed": 1, "hope": 1, "that": 4, "will": 4, "be": 8, "useful": 2, "but": 3, "WITHOUT": 1, "ANY": 1, "WARRANTY": 1, "without": 2, "even": 1, "implied": 1, "warranty": 1, "MERCHANTABILITY": 1, "or": 7, "FITNESS": 1, "FOR": 1, "A": 4, "PARTICULAR": 1, "PURPOSE.": 1, "See": 1, "more": 3, "details.": 1, "You": 1, "should": 4, "have": 2, "received": 1, "a": 13, "copy": 2, "along": 1, "with": 7, "this": 1, "see": 2, "COPYING.": 1, "If": 17, "not": 4, "write": 2, "to": 28, "Inc.": 1, "Franklin": 1, "Street": 1, "Fifth": 1, "Floor": 1, "Boston": 1, "MA": 1, "USA.": 1, "Commentary": 1, "customise": 1, "point": 7, "your": 2, "release": 1, "basic": 1, "start": 13, "M": 2, "x": 2, "julia.": 2, "require": 2, "auto": 6, "character": 1, "quote": 2, "transpose": 1, "syntax": 8, "entry": 4, "Syntax": 3, "inside": 1, "char": 6, "defvar": 5, "let": 3, "make": 5, "defconst": 5, "regex": 5, "unquote": 1, "forloop": 1, "subset": 2, "font": 7, "lock": 6, "defaults": 2, "identity": 1, "keyword": 2, "face": 4, "constant": 1, "cons": 1, "function": 8, "keep": 2, "string": 11, "paragraph": 3, "concat": 8, "page": 2, "delimiter": 2, "separate": 1, "ignore": 4, "fill": 1, "prefix": 2, "t": 21, "final": 1, "newline": 1, "comment": 6, "add": 7, "skip": 1, "column": 3, "indent": 8, "S": 2, "line": 9, "calculate": 1, "parse": 1, "sexp": 2, "comments": 1, "style": 5, "default": 11, "ignored": 2, "local": 6, "process": 5, "dump": 2, "files": 4, "_": 1, "autoload": 2, "defun": 9, "send": 4, "visibly": 1, "temporary": 1, "directory": 11, "temp": 2, "insert": 3, "load": 6, "command": 6, "get": 3, "help": 3, "topics": 1, "&": 3, "optional": 3, "proc": 3, "words": 1, "vector": 1, "com": 1, "error": 6, "s": 6, "*in": 1, "[": 3, "n": 2, "]": 3, "at": 9, ".*": 2, "+": 7, "w*": 1, "http": 1, "//docs.julialang.org/en/latest/search/": 1, "q": 1, "%": 1, "include": 1, "funargs": 1, "re": 2, "args": 10, "language": 2, "STERM": 1, "editor": 2, "R": 4, "pager": 2, "versions": 4, "Julia": 1, "made": 1, "available.": 1, "String": 1, "arguments": 2, "used": 3, "when": 8, "starting": 1, "group": 1, "###autoload": 2, "interactive": 3, "customize": 5, "<": 1, "hook": 7, "complete": 1, "object": 2, "completion": 4, "functions": 2, "first": 2, "if": 6, "fboundp": 1, "end": 2, "workaround": 1, "set": 10, "variable": 4, "post": 1, "run": 2, "settings": 1, "notably": 1, "null": 1, "dribble": 1, "debugging": 1, "only": 5, "dialect": 1, "current": 4, "arg": 1, "let*": 3, "jl": 2, "space": 1, "just": 1, "case": 1, "read": 1, "..": 3, "multi": 1, "...": 1, "tb": 1, "logo": 1, "goto": 2, "min": 1, "while": 2, "forward": 1, "replace": 1, "match": 1, "max": 1, "inject": 1, "code": 1, "etc": 1, "hooks": 1, "busy": 1, "funname": 5, "eldoc": 1, "show": 3, "symbol": 3, "aggressive": 1, "car": 3, "funname.start": 1, "sequence": 1, "nth": 1, "W": 1, "window": 3, "width": 2, "minibuffer": 1, "length": 1, "doc": 1, "propertize": 1, "use": 3, "classes": 1, "screws": 1, "egrep": 1, "define": 5, "abbrev": 4, "user": 3, "full": 1, "mail": 2, "address": 2, "image": 1, "mm": 1, "inline": 1, "large": 1, "images": 1, "nnimap": 4, "server": 3, "port": 1, "stream": 1, "ssl": 1, "message": 2, "smtpmail": 4, "auth": 1, "credentials": 1, "smtp": 3, "service": 1, "gnus": 1, "addresses": 1, "loaded": 2, "Spacemacs": 1, "startup.": 2, "It": 1, "must": 2, "stored": 2, "home": 1, "directory.": 1, "dotspacemacs/layers": 1, "List": 5, "additional": 2, "paths": 1, "where": 2, "look": 2, "configuration": 4, "layers.": 1, "Paths": 1, "trailing": 1, "slash": 1, "i.e.": 1, "/.mycontribs/": 1, "layers": 2, "load.": 1, "all": 6, "Example": 1, "may": 2, "want": 1, "right": 1, "away.": 1, "Uncomment": 1, "some": 3, "layer": 2, "names": 1, "press": 1, "": 2, "f": 4, "e": 2, "Vim": 2, "": 1, "install": 2, "them.": 1, "charlock_holmes": 1, "escape_utils": 1, "mime": 1, "types": 1, "rugged": 1, "minitest": 1, "mocha": 1, "plist": 1, "pry": 1, "rake": 1, "yajl": 1, "ruby": 1, "colour": 1, "proximity": 1, "licensed": 1, "licensee": 1, "packages": 7, "installed": 2, "being": 1, "wrapped": 1, "layer.": 1, "need": 1, "these": 1, "then": 1, "consider": 1, "also": 1, "put": 1, "dotspacemacs/config": 1, "extensions": 1, "loaded.": 1, "dotspacemacs": 22, "excluded": 1, "delete": 2, "orphan": 1, "dotspacemacs/init": 1, "an": 2, "exhaustive": 1, "supported": 1, "spacemacs": 3, "settings.": 1, "Either": 1, "vim": 1, "Evil": 1, "always": 1, "enabled": 4, "editing": 1, "buffer.": 3, "verbose": 1, "loading": 3, "Specify": 1, "startup": 5, "banner.": 1, "Default": 2, "value": 4, "official": 2, "chooses": 1, "random": 1, "text": 1, "banner": 1, "core/banners": 1, "items": 1, "disabled.": 1, "Possible": 4, "values": 3, "are": 6, "recents": 2, "projects": 2, "bookmarks": 1, "themes": 3, "starts.": 1, "Press": 1, "T": 1, "cycle": 2, "next": 1, "theme": 1, "works": 1, "great": 1, "variants": 1, "one": 6, "dark": 1, "light": 1, "allows": 1, "quickly": 1, "tweak": 1, "size": 1, "separators": 1, "too": 1, "crappy.": 1, "state": 4, "so": 3, "ex": 1, "commands": 2, "executed": 1, "like": 1, "key": 5, "Location": 1, "save": 4, "files.": 1, "original": 1, "another": 1, "cache": 1, "location": 1, "replaces": 1, "helm": 1, "SPC": 1, "replaced.": 1, "ido": 1, "non": 8, "paste": 2, "micro": 2, "enabled.": 2, "When": 1, "pressing": 1, "p": 1, "several": 1, "times": 1, "between": 1, "kill": 1, "content.": 1, "enable": 1, "Guide": 2, "delay": 2, "seconds.": 1, "The": 2, "popup": 1, "listing": 1, "bound": 1, "keystrokes.": 1, "guide": 1, "progress": 2, "bar": 2, "displayed": 2, "loading.": 1, "increase": 1, "boot": 1, "time": 1, "systems": 1, "builds": 1, "boost": 1, "time.": 1, "frame": 3, "fullscreen": 3, "starts": 1, "up.": 1, "spacemacs/toggle": 1, "nil.": 1, "maximized": 1, "range": 2, "increasing": 2, "opacity": 2, "which": 3, "describes": 2, "transparency": 4, "level": 2, "active": 1, "inactive": 1, "unicode": 2, "symbols": 2, "line.": 1, "smooth": 2, "scrolling": 4, "native": 1, "Smooth": 1, "overrides": 1, "behavior": 1, "recenters": 1, "reaches": 1, "top": 3, "bottom": 1, "screen.": 1, "smartparens": 2, "strict": 2, "programming": 1, "modes.": 1, "Select": 1, "scope": 1, "highlight": 2, "delimiters.": 1, "delimiters": 1, "pt": 1, "grep": 1, "package": 2, "repository": 3, "no": 1, "explicit": 1, "has": 1, "been": 1, "specified": 1, "package.": 1, "Not": 1, "now.": 1, "numbers": 1, "turned": 1, "prog": 1, "derivatives.": 1, "relative": 2, "Delete": 1, "whitespace": 2, "saving": 1, "changed": 3, "cleanup": 1, "alchemist": 1, "projectile": 1, "work": 2, "right.": 2, "viper": 3, "inhibit": 1, "Key": 1, "bindings": 1, "vi": 1, "global": 1, "map": 1, "Return": 1, "my": 1, "return": 1, "beginning": 1, "UTF": 1, "support": 1, "environment": 1, "setenv": 2, "tab": 1, "Function": 1, "/.emacs.d/config": 1, "dolist": 1, "element": 3, "attributes": 1, "path": 7, "fullpath": 3, "isdir": 3, "cdr": 1, "dir": 2, "cond": 1, "eq": 2, "substring": 1, "sans": 1, "extension": 1, "Tell": 1, "we": 1, "#": 1, "rust": 2, "Load": 1, "Git": 1, "related": 1, "highlighting": 1, "number": 2, "Disable": 1, "autosave": 1, "Use": 1, "single": 1, "storing": 1, "backup": 3, "copying": 1, "old": 2, "kept": 2, "new": 1, "control": 1, "custom": 4, "variables": 2, "was": 2, "added": 2, "Custom.": 2, "edit": 2, "hand": 2, "could": 2, "mess": 2, "up": 2, "careful.": 2, "Your": 2, "init": 2, "contain": 2, "such": 2, "instance.": 2, "there": 2, "than": 2, "they": 2, "won": 2, "blink": 1, "cursor": 1, "paren": 1, "faces": 2, "Object": 1, "EDE": 1, "ede": 5, "proj": 3, "targets": 1, "target": 2, "elisp": 2, "autoloads": 1, "source": 1, "preload": 2, "compiler": 2, "pre": 1, "versionsource": 1, "aux": 1, "metasubproject": 1 }, "EmberScript": { "class": 1, "App.FromNowView": 2, "extends": 1, "Ember.View": 1, "tagName": 1, "template": 1, "Ember.Handlebars.compile": 1, "output": 1, "return": 1, "moment": 1, "(": 5, "@value": 1, ")": 5, ".fromNow": 1, "didInsertElement": 1, "-": 4, "@tick": 2, "tick": 1, "f": 2, "@notifyPropertyChange": 1, "nextTick": 4, "Ember.run.later": 1, "this": 1, "@set": 1, "willDestroyElement": 1, "@nextTick": 1, "Ember.run.cancel": 1, "Ember.Handlebars.helper": 1 }, "Erlang": { "SHEBANG#!escript": 5, "%": 442, "loop": 7, "(": 456, ")": 453, "-": 431, "io": 10, "read": 4, ".": 128, "{": 397, "ok": 43, "_": 89, "}": 399, ";": 125, "eof": 1, "stop": 1, "error": 15, "Reason": 2, "throw": 9, "main": 9, "[": 209, "]": 204, "Nonterminals": 1, "grammar": 7, "expr_list": 8, "expr": 6, "container_expr": 1, "block_expr": 1, "access_expr": 1, "no_parens_expr": 2, "no_parens_zero_expr": 1, "no_parens_one_expr": 1, "no_parens_one_ambig_expr": 1, "bracket_expr": 1, "bracket_at_expr": 1, "bracket_arg": 1, "matched_expr": 2, "unmatched_expr": 2, "max_expr": 1, "unmatched_op_expr": 1, "matched_op_expr": 1, "no_parens_op_expr": 1, "no_parens_many_expr": 1, "comp_op_eol": 1, "at_op_eol": 1, "unary_op_eol": 1, "and_op_eol": 1, "or_op_eol": 1, "capture_op_eol": 1, "add_op_eol": 1, "mult_op_eol": 1, "two_op_eol": 1, "three_op_eol": 1, "pipe_op_eol": 2, "stab_op_eol": 1, "arrow_op_eol": 1, "match_op_eol": 1, "when_op_eol": 2, "in_op_eol": 1, "in_match_op_eol": 1, "type_op_eol": 2, "rel_op_eol": 1, "open_paren": 1, "close_paren": 1, "empty_paren": 1, "eoe": 7, "list": 6, "list_args": 1, "open_bracket": 1, "close_bracket": 1, "tuple": 2, "open_curly": 1, "close_curly": 1, "bit_string": 1, "open_bit": 1, "close_bit": 1, "map": 1, "map_op": 1, "map_close": 1, "map_args": 1, "map_expr": 1, "struct_op": 1, "assoc_op_eol": 2, "assoc_expr": 1, "assoc_base": 1, "assoc_update": 1, "assoc_update_kw": 1, "assoc": 1, "container_args_base": 1, "container_args": 1, "call_args_parens_expr": 1, "call_args_parens_base": 1, "call_args_parens": 1, "parens_call": 1, "call_args_no_parens_one": 1, "call_args_no_parens_ambig": 1, "call_args_no_parens_expr": 1, "call_args_no_parens_comma_expr": 1, "call_args_no_parens_all": 1, "call_args_no_parens_many": 1, "call_args_no_parens_many_strict": 1, "stab": 1, "stab_eoe": 1, "stab_expr": 1, "stab_op_eol_and_expr": 1, "stab_parens_many": 1, "kw_eol": 1, "kw_base": 1, "kw": 1, "call_args_no_parens_kw_expr": 1, "call_args_no_parens_kw": 1, "dot_op": 1, "dot_alias": 1, "dot_alias_container": 1, "dot_identifier": 1, "dot_op_identifier": 1, "dot_do_identifier": 1, "dot_paren_identifier": 1, "dot_bracket_identifier": 1, "do_block": 1, "fn_eoe": 1, "do_eoe": 1, "end_eoe": 1, "block_eoe": 1, "block_item": 1, "block_list": 1, "Terminals": 1, "identifier": 1, "kw_identifier": 1, "kw_identifier_safe": 1, "kw_identifier_unsafe": 1, "bracket_identifier": 1, "paren_identifier": 1, "do_identifier": 1, "block_identifier": 1, "fn": 4, "aliases": 4, "number": 5, "atom": 10, "atom_safe": 1, "atom_unsafe": 1, "bin_string": 1, "list_string": 1, "sigil": 1, "dot_call_op": 1, "op_identifier": 1, "comp_op": 1, "at_op": 1, "unary_op": 1, "and_op": 1, "or_op": 1, "arrow_op": 2, "match_op": 1, "in_op": 1, "in_match_op": 1, "type_op": 1, "dual_op": 1, "add_op": 1, "mult_op": 1, "two_op": 1, "three_op": 1, "pipe_op": 1, "stab_op": 2, "when_op": 1, "assoc_op": 1, "capture_op": 1, "rel_op": 1, "eol": 1, "Rootsymbol": 1, "grammar.": 1, "Two": 1, "shift/reduce": 1, "conflicts": 1, "coming": 1, "from": 5, "call_args_parens.": 1, "Expect": 1, "Changes": 1, "in": 20, "ops": 1, "and": 23, "precedence": 2, "should": 1, "be": 10, "reflected": 1, "on": 6, "lib/elixir/lib/macro.ex": 1, "Note": 2, "though": 1, "the": 40, "operator": 1, "practice": 1, "has": 3, "lower": 1, "than": 2, "all": 3, "others": 1, "its": 1, "entry": 1, "table": 1, "is": 17, "only": 3, "to": 19, "support": 2, "user": 1, "|": 66, "foo": 1, "bar": 1, "syntax.": 1, "Left": 14, "do.": 1, "Right": 7, "stab_op_eol.": 1, "Nonassoc": 4, "capture_op_eol.": 1, "&": 2, "in_match_op_eol.": 1, "<-,>": 1, "allowed": 1, "matches": 1, "along": 1, "50": 1, "when": 44, "60": 1, "70": 1, "80": 1, "match_op_eol.": 1, "or_op_eol.": 1, "||": 8, "or": 10, "and_op_eol.": 1, "&&": 2, "comp_op_eol.": 1, "rel_op_eol.": 1, "<,>": 2, "<=,>": 1, "arrow_op_eol.": 1, "<<": 37, "<": 15, "<~>": 1, "<|>": 1, "in_op_eol.": 1, "three_op_eol.": 1, "two_op_eol.": 1, "+": 236, "..": 1, "add_op_eol.": 1, "mult_op_eol.": 1, "*": 16, "/": 1, "unary_op_eol.": 1, "not": 6, "dot_call_op.": 1, "dot_op.": 1, "at_op_eol.": 1, "@": 1, "dot_identifier.": 1, "MAIN": 1, "FLOW": 1, "OF": 10, "EXPRESSIONS": 1, "nil.": 2, "to_block": 6, "In": 3, "Elixir": 1, "we": 4, "have": 1, "three": 1, "call": 5, "syntaxes": 1, "with": 8, "parentheses": 3, "without": 5, "do": 4, "blocks.": 2, "They": 1, "are": 9, "represented": 1, "AST": 1, "as": 7, "matched": 1, "no_parens": 1, "unmatched.": 1, "Calls": 1, "further": 1, "divided": 1, "according": 1, "how": 1, "problematic": 1, "they": 2, "a": 35, "no_parens_one": 1, "one": 2, "unproblematic": 1, "argument": 2, "e.g.": 5, "f": 12, "g": 6, "similar": 2, "includes": 2, "unary": 1, "operators": 1, "b": 10, "no_parens_many": 2, "several": 1, "arguments": 1, "c": 4, "no_parens_one_ambig": 3, "which": 4, "itself": 1, "h": 1, "particular": 1, "that": 6, "expressions": 1, "ambiguous": 1, "interpreted": 2, "such": 2, "outer": 1, "function": 2, "arity": 1, "rather": 1, "Hence": 1, "name": 2, "no_parens_one_ambig.": 1, "The": 3, "distinction": 1, "required": 2, "because": 2, "can": 4, "true": 14, "false": 10, "nil": 2, "end": 14, "__aliases__": 4, "__block__": 3, "Elixir.Access": 1, "Elixir.String": 1, "Elixir.Kernel": 1, "t": 6, "actually": 1, "want": 1, "block": 1, "since": 1, "it": 3, "an": 5, "arg": 1, "style": 1, "call.": 1, "unwrap_splice": 3, "unwraps": 1, "splice": 1, "unquote_splicing": 1, "Splice": 2, "Other": 4, "Other.": 2, "unwrap_when": 1, "Args": 3, "case": 12, "elixir_utils": 1, "split_last": 1, "of": 28, "Start": 2, "Meta": 4, "End": 2, "end.": 7, "One": 2, "reverse": 6, "Warnings": 1, "errors": 1, "Error": 6, "Token": 11, "Line": 10, "lists": 15, "keyfind": 1, "line": 2, "L": 19, "MODULE": 1, "throw_bad_atom": 1, "meta_from_token": 4, "throw_no_parens_strict": 1, "throw_no_parens_many_strict": 1, "Node": 4, "meta": 2, "throw_no_parens_container_strict": 1, "throw_invalid_kw_identifier": 2, "elixir_tokenizer": 1, "invalid_do_error": 1, "KW": 2, "atom_to_list": 19, "TODO": 1, "Make": 1, "those": 2, "warnings": 1, "errors.": 1, "warn_empty_stab_clause": 1, "_Begin": 2, "_End": 2, "elixir_errors": 2, "warn": 2, "file": 10, "warn_pipe": 2, "Op": 5, "io_lib": 3, "format": 11, "_Token": 1, "ok.": 1, "erlang": 8, "smp": 1, "enable": 2, "sname": 1, "factorial": 1, "mnesia": 1, "debug": 1, "verbose": 2, "String": 4, "try": 2, "N": 26, "list_to_integer": 4, "F": 18, "fac": 4, "catch": 3, "usage": 3, "halt": 2, "mode": 4, "indent": 3, "level": 1, "tabs": 2, "ex": 1, "ts": 1, "sw": 1, "ft": 1, "et": 1, "This": 3, "sample": 2, "rebar.conf": 1, "shows": 1, "examples": 1, "some": 1, "rebar": 4, "HAVE_SENDFILE": 1, "BACKLOG": 1, "old_inets": 1, "port_env": 1, "port_specs": 2, "List": 4, "filenames": 1, "wildcards": 1, "compiled.": 2, "May": 1, "also": 2, "contain": 1, "consisting": 1, "regular": 1, "expression": 1, "applied": 1, "against": 1, "system": 1, "architecture": 1, "filter.": 1, "env": 2, "escriptize": 1, "escript_name": 1, "escript_incl_apps": 1, "escript_shebang": 1, "escript_comment": 1, "escript_emu_args": 1, "LFE": 3, "Compiler": 2, "files": 4, "compile": 9, "before": 1, "rest": 1, "lfe_first_files": 1, "Options": 4, "for": 11, "compiler": 5, "reuse": 1, "erl_opts": 3, "ErlyDTL": 2, "erlydtl_opts": 2, "Proto": 1, "proto_opts": 1, "protobuffs": 3, "src_dirs": 2, "Available": 1, "compilers": 1, "protocol": 2, "buffer": 2, ".proto": 2, "default": 2, "gpb": 2, "Optional": 2, "directories": 1, "where": 1, "look": 1, "src": 1, "if": 2, "selected": 1, "by": 3, "proto_compiler": 1, "option": 1, "gpb_opts": 1, "EUnit": 1, "eunit": 2, "test": 1, "eunit_opts": 2, "Additional": 1, "options": 1, "eunit.": 1, "used": 3, "eunit_compile_opts": 1, "Same": 1, "erl_first_files": 1, "but": 1, "running": 1, "eunit_first_files": 1, "Cover": 1, "Whether": 2, "coverage": 2, "reporting.": 1, "Default": 2, "cover_print_enabled": 1, "export": 3, "report": 2, "file.": 2, "qc": 1, "raw": 3, "rebar.config": 1, "Only": 1, "subset": 1, "commands": 1, "will": 2, "executed": 1, "subdirectories": 1, "get": 13, "deps": 5, "update": 1, "check": 2, "delete": 1, "deps.": 2, "git": 54, "branch": 1, "app_name": 8, "hg": 1, "rsync": 1, "svn": 2, "bzr": 1, "fossil": 2, "p4": 1, "Subdirectories": 2, "sub_dirs": 2, "Plugins": 2, "you": 2, "wish": 1, "include.": 1, "These": 1, "include": 4, "any": 1, "module": 4, "code": 6, "path": 1, "including": 1, "Alternatively": 1, "plugins": 3, "placed": 1, "source": 3, "plugin_dir": 2, "compiled": 1, "loaded": 1, "dynamically": 1, "at": 3, "runtime.": 1, "plugin1": 1, "plugin2": 1, "Override": 1, "directory": 1, "plugin": 1, "sources": 1, "found.": 1, "Defaults": 1, "./plugins": 1, "Pre/Post": 1, "Command": 4, "Hooks": 1, "pre_hooks": 1, "clean": 2, "post_hooks": 1, "xref": 5, "xref_warnings": 1, "optional": 2, "extra": 1, "paths": 1, "set_library_path/2.": 1, "specified": 2, "relative": 2, "location": 1, "rebar.config.": 1, "xref_extra_paths": 2, "checks": 1, "run": 5, "xref_checks": 1, "undefined_function_calls": 1, "undefined_functions": 1, "locals_not_used": 1, "exports_not_used": 1, "deprecated_function_calls": 1, "deprecated_functions": 1, "custom": 1, "queries": 1, "manual": 1, "details": 1, "xref_queries": 2, "query_string": 1, "expected_query_result": 1, "...": 1, "following": 5, "example": 1, "removes": 1, "references": 1, "mod": 2, "*foo/4": 1, "functions": 3, "undefined": 2, "external": 1, "calls": 1, "generated": 2, "THIS": 3, "FILE": 1, "IS": 3, "GENERATED.": 1, "DO": 1, "NOT": 3, "EDIT": 1, "IT": 1, "MANUALLY": 1, "require_otp_vsn": 1, "cover_enabled": 1, "lib_dirs": 1, "debug_info": 2, "fail_on_warning": 1, "compiler_options": 1, "return": 1, "rebar_lock_deps_plugin": 2, "node_package": 1, "goldrush": 1, "lager": 1, "syslog": 1, "lager_syslog": 1, "cluster_info": 1, "sidejob": 1, "erlang_js": 1, "meck": 1, "getopt": 1, "neotoma": 1, "cuttlefish": 1, "bitcask": 1, "eper": 1, "edown": 1, "sext": 1, "poolboy": 1, "basho_stats": 1, "riak_sysmon": 1, "eleveldb": 1, "riak_ensemble": 1, "pbkdf2": 1, "parse_trans": 1, "bear": 1, "folsom": 1, "setup": 1, "exometer_core": 1, "clique": 1, "riak_core": 1, "riak_pipe": 1, "riak_pb": 1, "mochiweb": 1, "webmachine": 1, "riak_api": 1, "riak_dt": 1, "eunit_formatters": 1, "riak_kv": 1, "merge_index": 1, "riak_search": 1, "erlydtl": 1, "riak_control": 1, "riaknostic": 1, "kvc": 1, "ibrowse": 1, "yokozuna": 1, "canola": 1, "riak_auth_mods": 1, "ref": 4, "main/1": 1, "Copyright": 2, "Robert": 2, "Virding": 2, "Licensed": 1, "under": 3, "Apache": 1, "License": 5, "Version": 1, "may": 3, "use": 3, "this": 5, "except": 1, "compliance": 1, "License.": 2, "You": 1, "obtain": 1, "copy": 2, "http": 1, "//www.apache.org/licenses/LICENSE": 1, "Unless": 1, "applicable": 1, "law": 1, "agreed": 1, "writing": 1, "software": 4, "distributed": 2, "BASIS": 1, "WITHOUT": 1, "WARRANTIES": 3, "OR": 9, "CONDITIONS": 1, "ANY": 5, "KIND": 1, "either": 1, "express": 1, "implied.": 1, "See": 1, "specific": 2, "language": 1, "governing": 1, "permissions": 1, "limitations": 1, "File": 1, "lfe_scan.xrl": 1, "Author": 1, "Purpose": 1, "definitions": 1, "Lisp": 1, "Flavoured": 1, "Erlang.": 1, "Definitions.": 1, "B": 16, "O": 1, "D": 1, "H": 2, "fA": 1, "B36": 1, "zA": 1, "Z": 3, "U": 2, "A": 11, "z": 2, "DEL": 2, "s": 5, "SSYM": 1, "x": 5, "Strip": 1, "quotes.": 1, "S": 11, "string": 9, "substr": 1, "TokenChars": 3, "TokenLen": 1, "token": 7, "TokenLine": 1, "chars": 11, "Binary": 1, "#": 1, "illegal": 2, "integer": 1, "float": 1, "AS": 1, "symbol_char": 2, "C": 57, "orelse": 1, "symbol_token": 2, "Chars": 2, "symbol": 3, "Symbol": 1, "E": 2, "Build": 1, "legal": 1, "characters": 3, "else": 1, "error.": 1, "Cs": 32, "list_to_atom": 1, "base_token": 9, "Base": 14, "Integer.": 1, "Convert": 3, "into": 3, "number.": 1, "We": 2, "allow": 1, "base": 1, "betqeen": 1, "sign": 1, "character": 1, "first.": 1, "base1": 11, "S*N": 1, "SoFar": 8, "Next": 6, "_Base": 2, "define": 1, "IS_UNICODE": 2, "#10FFFF": 1, "char_token": 3, "InputChars": 2, "input": 3, "corresponding": 2, "character.": 1, "For": 2, "sequence": 1, "hex": 1, "resultant": 1, "unicode": 1, "range.": 1, "Chars.": 1, "characters.": 1, "know": 1, "correct.": 1, "Cs0": 4, "hex_char": 5, "Cs1": 2, "_Other": 1, "escape_char": 13, "false.": 1, "BS": 1, "TAB": 1, "n": 3, "LF": 1, "v": 3, "VT": 1, "FF": 1, "r": 3, "CR": 1, "e": 3, "ESC": 1, "SPC": 1, "d": 3, "C.": 1, "Block": 1, "Comment": 1, "Provide": 1, "sensible": 1, "people": 1, "attempt": 1, "nested": 1, "comments": 1, "currently": 1, "parser": 1, "cannot": 1, "process": 1, "them": 1, "rebuild.": 1, "But": 1, "simply": 1, "exploding": 1, "going": 1, "helpful.": 1, "block_comment": 1, "Check": 1, "re": 1, "opening": 1, "another": 1, "comment": 1, "block.": 1, "str": 1, "skip_token": 1, "No": 1, "nesting": 1, "found": 1, "skip_until": 5, "Char1": 2, "Char2": 2, "String.": 2, "skip_past": 5, "C1": 8, "C2": 8, "each": 1, "header": 1, "scans": 1, "thru": 1, "records": 1, "create": 1, "helper": 1, "Helper": 1, "setters": 1, "getters": 1, "fields": 4, "fields_atom": 4, "type": 6, "record_helper": 1, "make/1": 1, "make/2": 1, "make": 3, "HeaderFiles": 5, "X": 12, "<->": 5, "hrl": 1, "current": 1, "dir": 1, "OutDir": 4, "ModuleName": 3, "HeaderComment": 2, "ModuleDeclaration": 2, "Src": 10, "format_src": 8, "sort": 9, "flatten": 6, "generate_type_default_function": 2, "write_file": 1, "erl": 1, "list_to_binary": 1, "HeaderFile": 4, "epp": 1, "parse_file": 1, "Tree": 4, "parse": 2, "catched_error": 1, "T": 24, "length": 7, "Type": 3, "NSrc": 4, "_Type": 1, "Type1": 2, "parse_record": 3, "attribute": 1, "record": 4, "RecordInfo": 2, "RecordName": 41, "RecordFields": 10, "generate_setter_getter_function": 5, "generate_type_function": 3, "generate_fields_function": 2, "generate_fields_atom_function": 2, "parse_field_name": 5, "record_field": 9, "FieldName": 26, "field": 4, "_FieldName": 2, "ParentRecordName": 8, "parent_field": 2, "parse_field_name_atom": 5, "concat": 5, "_S": 3, "concat_ext": 4, "parse_field": 6, "AccFields": 6, "AccParentFields": 6, "Field": 2, "PField": 2, "parse_field_atom": 4, "zzz": 1, "Fields": 4, "field_atom": 1, "to_setter_getter_function": 5, "setter": 2, "getter": 2, "auto": 1, "Please": 1, "don": 1, "edit": 1, "record_utils": 1, "export_all": 1, "abstract_message": 21, "async_message": 12, "clientId": 5, "destination": 5, "messageId": 5, "timestamp": 5, "timeToLive": 5, "headers": 5, "body": 5, "correlationId": 5, "correlationIdBytes": 5, "Obj": 49, "is_record": 25, "Obj#abstract_message.body": 1, "Obj#abstract_message.clientId": 1, "Obj#abstract_message.destination": 1, "Obj#abstract_message.headers": 1, "Obj#abstract_message.messageId": 1, "Obj#abstract_message.timeToLive": 1, "Obj#abstract_message.timestamp": 1, "Obj#async_message.correlationId": 1, "Obj#async_message.correlationIdBytes": 1, "parent": 5, "Obj#async_message.parent": 3, "ParentProperty": 6, "is_atom": 2, "set": 13, "Value": 35, "NewObj": 20, "Obj#abstract_message": 7, "Obj#async_message": 3, "NewParentObject": 2, "undefined.": 1, "Mode": 1, "coding": 1, "utf": 1, "tab": 1, "width": 1, "basic": 1, "offset": 1, "BSD": 1, "LICENSE": 1, "Michael": 2, "Truog": 2, "": 1, "gmail": 1, "dot": 1, "com": 1, "All": 2, "rights": 1, "reserved.": 1, "Redistribution": 1, "binary": 2, "forms": 1, "modification": 1, "permitted": 1, "provided": 2, "conditions": 3, "met": 1, "Redistributions": 2, "must": 3, "retain": 1, "above": 2, "copyright": 2, "notice": 2, "disclaimer.": 1, "form": 1, "reproduce": 1, "disclaimer": 1, "documentation": 1, "and/or": 1, "other": 1, "materials": 2, "distribution.": 1, "advertising": 1, "mentioning": 1, "features": 1, "display": 1, "acknowledgment": 1, "product": 1, "developed": 1, "author": 2, "endorse": 1, "promote": 1, "products": 1, "derived": 1, "prior": 1, "written": 1, "permission": 1, "SOFTWARE": 2, "PROVIDED": 1, "BY": 1, "THE": 5, "COPYRIGHT": 2, "HOLDERS": 1, "AND": 4, "CONTRIBUTORS": 2, "EXPRESS": 1, "IMPLIED": 2, "INCLUDING": 3, "BUT": 2, "LIMITED": 2, "TO": 2, "MERCHANTABILITY": 1, "FITNESS": 1, "FOR": 2, "PARTICULAR": 1, "PURPOSE": 1, "ARE": 1, "DISCLAIMED.": 1, "IN": 3, "NO": 1, "EVENT": 1, "SHALL": 1, "OWNER": 1, "BE": 1, "LIABLE": 1, "DIRECT": 1, "INDIRECT": 1, "INCIDENTAL": 1, "SPECIAL": 1, "EXEMPLARY": 1, "CONSEQUENTIAL": 1, "DAMAGES": 1, "PROCUREMENT": 1, "SUBSTITUTE": 1, "GOODS": 1, "SERVICES": 1, "LOSS": 1, "USE": 2, "DATA": 1, "PROFITS": 1, "BUSINESS": 1, "INTERRUPTION": 1, "HOWEVER": 1, "CAUSED": 1, "ON": 1, "THEORY": 1, "LIABILITY": 2, "WHETHER": 1, "CONTRACT": 1, "STRICT": 1, "TORT": 1, "NEGLIGENCE": 1, "OTHERWISE": 1, "ARISING": 1, "WAY": 1, "OUT": 1, "EVEN": 1, "IF": 1, "ADVISED": 1, "POSSIBILITY": 1, "SUCH": 1, "DAMAGE.": 1, "sys": 2, "RelToolConfig": 5, "target_dir": 2, "TargetDir": 14, "overlay": 2, "OverlayConfig": 4, "consult": 1, "Spec": 2, "reltool": 2, "get_target_spec": 1, "make_dir": 1, "eexist": 1, "exit_code": 3, "eval_target_spec": 1, "root_dir": 1, "process_overlay": 2, "shell": 3, "Arguments": 3, "CommandSuffix": 2, "os": 1, "cmd": 1, "boot_rel_vsn": 2, "Config": 2, "_RelToolConfig": 1, "rel": 2, "_Name": 1, "Ver": 1, "proplists": 1, "lookup": 1, "Ver.": 1, "minimal": 2, "parsing": 1, "handling": 1, "mustache": 11, "syntax": 1, "Body": 2, "Context": 11, "Result": 10, "_Context": 1, "KeyStr": 6, "mustache_key": 4, "Rest": 14, "Key": 2, "list_to_existing_atom": 1, "dict": 2, "find": 1, "based": 1, "overlays": 1, "BootRelVsn": 2, "OverlayVars": 2, "from_list": 1, "erts_vsn": 1, "system_info": 1, "version": 1, "rel_vsn": 1, "hostname": 1, "net_adm": 1, "localhost": 1, "BaseDir": 7, "get_cwd": 1, "execute_overlay": 6, "_Vars": 1, "_BaseDir": 1, "_TargetDir": 1, "mkdir": 1, "Out": 4, "Vars": 7, "filename": 3, "join": 3, "InFile": 3, "OutFile": 2, "filelib": 1, "is_file": 1, "ExitCode": 2, "flush": 1, "application": 1, "description": 1, "vsn": 1, "registered": 1, "sample_app": 1, "applications": 1, "kernel": 1, "stdlib": 1, "modules": 1, "start": 4, "M": 10, "add_pathz": 2, "Ctx": 9, "emonk": 3, "create_ctx": 1, "eval": 1, "js": 2, "wait": 4, "Self": 2, "self": 2, "Pid": 4, "spawn": 1, "fun": 1, "do_js": 4, "receive": 1, "finished": 2, "Parent": 4, "Test": 5, "random_test": 2, "Resp": 2, "Sorted": 2, "Tests": 3, "null": 2, "e10": 1, "split": 1, "random": 1, "uniform": 1, "Props": 2, "objsort": 4, "is_list": 1, "lstsort": 4, "Acc": 8, "K": 2, "V": 2, "Val": 2 }, "F#": { "namespace": 7, "Nessos.FsPickler.Combinators": 1, "open": 34, "Nessos.FsPickler": 7, "Nessos.FsPickler.Json": 6, "///": 50, "Json": 16, "pickling": 1, "methods": 2, "[": 71, "": 1, "]": 71, "module": 3, "let": 131, "private": 2, "jsonSerializer": 1, "lazy": 1, "(": 254, "FsPickler.CreateJson": 1, "omitHeader": 19, "true": 15, ")": 256, "": 13, "Pickles": 1, "a": 11, "value": 47, "to": 1, "Json.": 1, "": 13, "": 9, "name=": 9, "utilized": 1, "pickler.": 1, "": 9, "input": 1, "value.": 2, "pickle": 5, "pickler": 7, "Pickler": 1, "<'T>": 1, "T": 4, "string": 44, "byte": 3, "bsonPickler.Value.UnPickle": 1, "System": 6, "System.IO": 3, "System.Text": 2, "Newtonsoft.Json": 3, "Factory": 1, "for": 9, "the": 2, "serialization": 1, "format.": 2, "type": 18, "JsonPickleFormatProvider": 3, "internal": 5, "indent": 11, "as": 2, "self": 1, "isCustomSeq": 5, "isTopLevelSequence": 19, "&&": 9, "self.OmitHeader": 1, "self.UseCustomTopLevelSequenceSeparator": 1, "mutable": 5, "sequenceSeparator": 5, "member": 77, "val": 4, "Indent": 2, "with": 18, "get": 8, "set": 9, "OmitHeader": 3, "UseCustomTopLevelSequenceSeparator": 1, "false": 22, "__.SequenceSeparator": 1, "and": 5, "sep": 6, "if": 36, "<": 32, "null": 5, "String.IsNullOrWhiteSpace": 1, "then": 38, "<->": 9, "else": 24, "invalidArg": 2, "SequenceSeparator": 1, "should": 4, "be": 4, "non": 2, "whitespace": 2, "interface": 4, "ITextPickleFormatProvider": 1, "__": 8, "Name": 1, "see": 1, "discussion": 1, "https": 1, "github": 1, "com": 1, "nessos": 1, "FsPickler": 8, "issues": 1, "17": 1, "DefaultEncoding": 1, "new": 52, "UTF8Encoding": 1, "Encoding": 1, "__.CreateWriter": 2, "stream": 6, "encoding": 6, "leaveOpen": 18, "#if": 2, "NET40": 2, "raise": 11, "<|>": 11, "NotSupportedException": 3, "not": 14, "supported": 2, "in": 15, "NET": 2, "40": 2, "sw": 3, "StreamWriter": 2, "1024": 2, "endif": 2, "jw": 4, "JsonTextWriter": 2, "JsonPickleWriter": 3, "_": 18, "__.CreateReader": 2, "sr": 3, "StreamReader": 2, "jr": 4, "JsonTextReader": 2, "JsonPickleReader": 3, "textWriter": 2, "__.OmitHeader": 2, "__.Indent": 1, "textReader": 2, "System.Collections.Generic": 3, "System.Globalization": 1, "System.Numerics": 1, "format": 4, "deserializer": 1, "jsonReader": 17, "JsonReader": 1, "do": 7, "jsonReader.CloseInput": 1, "-": 50, "jsonReader.SupportMultipleContent": 1, "isBsonReader": 4, "match": 7, "Bson": 3, "BsonReader": 1, "|": 56, "depth": 35, "arrayStack": 5, "Stack": 4, "": 4, "arrayStack.Push": 5, "Int32.MinValue": 2, "omitTag": 45, "||": 2, "arrayStack.Peek": 2, "IPickleFormatReader": 1, "__.BeginReadRoot": 1, "tag": 88, "jsonReader.Read": 2, "ignore": 11, "jsonReader.TokenType": 5, "JsonToken.StartObject": 1, "FormatException": 6, "jsonReader.MoveNext": 6, "version": 6, "jsonReader.ReadPrimitiveAs": 21, "": 15, "jsonFormatVersion": 2, "v": 1, "Version": 1, "sprintf": 3, "sTag": 3, "InvalidPickleTypeException": 1, "EndReadRoot": 1, "Read": 6, "__.BeginReadObject": 1, "jsonReader.ReadProperty": 1, "1": 7, "ObjectFlags": 3, "IsSequenceHeader": 2, "TokenType": 3, "JsonToken": 5, "Null": 1, "ObjectFlags.IsNull": 2, "JsonToken.StartArray": 1, "StartObject": 1, "+": 7, "jsonReader.ValueAs": 8, "csvFlags": 2, "parseFlagCsv": 1, "ObjectFlags.None": 2, "token": 4, "expected": 2, "start": 1, "of": 2, "object": 2, "but": 2, "was": 2, "O": 2, "EndReadObject": 1, "Pop": 2, "JsonToken.Null": 2, "JsonToken.EndObject": 1, "EndArray": 1, "arrayStack.Pop": 1, "end": 3, "0": 2, "__.SerializeUnionCaseNames": 2, "__.PreferLengthPrefixInSequences": 2, "__.ReadNextSequenceElement": 1, "JsonToken.None": 1, "JsonToken.EndArray": 1, "__.ReadCachedObjectId": 1, "": 10, "__.ReadBoolean": 1, "": 1, "__.ReadByte": 1, "__.ReadSByte": 1, "sbyte": 1, "__.ReadInt16": 1, "int16": 1, "__.ReadInt32": 1, "int": 4, "__.ReadInt64": 1, "__.ReadUInt16": 1, "uint16": 1, "__.ReadUInt32": 1, "uint32": 1, "__.ReadUInt64": 1, "uint64": 1, "__.ReadSingle": 1, "ReadProperty": 3, "MoveNext": 2, "Float": 4, "": 2, "single": 1, "JsonToken.String": 2, "Single.Parse": 1, "CultureInfo.InvariantCulture": 2, "float": 4, "__.ReadDouble": 1, "Double.Parse": 1, "__.ReadChar": 1, "__.ReadString": 1, "__.ReadBigInteger": 1, "BigInteger.Parse": 1, "__.ReadGuid": 1, "": 1, "Guid.Parse": 1, "__.ReadTimeSpan": 1, "TimeSpan.Parse": 1, "__.ReadDecimal": 1, "decimal": 1, "__.ReadDate": 1, "ticks": 2, "DateTime": 2, "": 1, "__.ReadBytes": 1, "bytes": 2, "elif": 2, "": 1, "base64": 2, "Convert.FromBase64String": 1, "__.IsPrimitiveArraySerializationSupported": 2, "__.ReadPrimitiveArray": 1, "NotImplementedException": 1, "Dispose": 1, "IDisposable": 1, ".Dispose": 1, "OAttribute": 1, "System.Runtime.InteropServices.OptionalAttribute": 1, "DAttribute": 1, "System.Runtime.InteropServices.DefaultParameterValueAttribute": 1, "instance.": 5, "JsonSerializer": 2, "inherit": 7, "FsPicklerTextSerializer": 2, "Initializes": 3, "out": 2, "pickles.": 4, "omit": 2, "header": 2, "specify": 3, "custom": 5, "name": 3, "converter.": 3, "": 8, "typeConverter": 12, "defaultArg": 2, "json": 5, "{": 5, "}": 5, "Gets": 4, "or": 4, "sets": 4, "whether": 3, "output": 1, "indented.": 1, "x.Indent": 1, "x.format.Indent": 2, "b": 4, "headers": 1, "ignored": 1, "x.OmitHeader": 1, "x.format.OmitHeader": 2, "that": 1, "serves": 1, "top": 2, "level": 2, "sequence": 1, "separator.": 2, "x.SequenceSeparator": 1, "x.format.SequenceSeparator": 2, "sequences": 1, "serialized": 1, "using": 1, "x.UseCustomTopLevelSequenceSeparator": 1, "x.format.UseCustomTopLevelSequenceSeparator": 2, "e": 2, "BSON": 1, "BsonSerializer": 2, "FsPicklerSerializer": 1, "BsonPickleFormatProvider": 1, "static": 3, "methods.": 1, "CreateJson": 1, "CreateBson": 1, "serializer.": 1, "jsonWriter": 26, "JsonWriter": 1, "indented": 2, "separator": 2, "jsonWriter.Formatting": 1, "Formatting.Indented": 1, "Formatting.None": 1, "jsonWriter.CloseOutput": 1, "isBsonWriter": 2, "BsonWriter": 1, "isTopLevelSequenceHead": 4, "currentValueIsNull": 4, "IPickleFormatWriter": 1, "__.BeginWriteRoot": 1, "jsonWriter.WriteStartObject": 2, "writePrimitive": 23, "__.EndWriteRoot": 1, "jsonWriter.WriteEnd": 1, "__.BeginWriteObject": 1, "flags": 3, "jsonWriter.WritePropertyName": 2, "flags.HasFlag": 2, "jsonWriter.WriteNull": 2, "ObjectFlags.IsSequenceHeader": 1, "jsonWriter.WriteStartArray": 1, "flagCsv": 2, "mkFlagCsv": 1, "__.EndWriteObject": 1, "Peek": 1, "WriteEndArray": 1, "jsonWriter.WriteEndObject": 1, "__.WriteNextSequenceElement": 1, "hasNext": 1, "jsonWriter.WriteWhitespace": 1, "__.WriteCachedObjectId": 1, "id": 3, "__.WriteBoolean": 1, "__.WriteByte": 1, "__.WriteSByte": 1, "__.WriteInt16": 1, "__.WriteInt32": 1, "__.WriteInt64": 1, "__.WriteUInt16": 1, "__.WriteUInt32": 1, "__.WriteUInt64": 1, "__.WriteSingle": 1, "__.WriteDouble": 1, "__.WriteDecimal": 1, "__.WriteChar": 1, "__.WriteString": 1, "__.WriteBigInteger": 1, "__.WriteGuid": 1, "__.WriteTimeSpan": 1, "__.WriteDate": 1, "value.Ticks": 1, "__.WriteBytes": 1, "obj.ReferenceEquals": 1, "jsonWriter.WriteValue": 1, "__.WritePrimitiveArray": 1, "__.Dispose": 1, "jsonWriter.Flush": 1, "Nessos.FsPickler.Tests": 2, "PerfUtil": 2, "PerfUtil.NUnit": 1, "NUnit.Framework": 1, "": 1, "PerfTester": 4, "NUnitPerf": 1, "": 2, "tests": 2, "PerfTest.OfModuleMarker": 1, "": 1, "override": 4, "__.PerfTests": 1, "Serializer": 8, "Comparison": 3, "fsp": 4, "FsPickler.initBinary": 3, "bfs": 2, "BinaryFormatterSerializer": 1, "ndc": 2, "NetDataContractSerializer": 1, "jdn": 2, "JsonDotNetSerializer": 1, "bdn": 2, "JsonDotNetBsonSerializer": 1, "pbn": 2, "ProtoBufSerializer": 1, "ssj": 2, "ServiceStackJsonSerializer": 1, "sst": 2, "ServiceStackTypeSerializer": 1, "comparer": 6, "WeightedComparer": 2, "spaceFactor": 2, "leastAcceptableImprovementFactor": 2, "tester": 6, "ImplementationComparer": 2, "<_>": 4, ";": 17, "throwOnError": 3, "warmup": 3, "__.PerfTester": 3, "Formats": 1, "binary": 2, "FsPickler.initJson": 1, "bson": 2, "FsPickler.initBson": 1, "xml": 2, "FsPickler.initXml": 1, "Past": 1, "Versions": 1, "persistResults": 2, "persistenceFile": 2, "typeof": 2, "": 1, ".Assembly.GetName": 1, ".Version": 1, "PastImplementationComparer": 1, "historyFile": 1, "": 1, "__.Persist": 1, "tester.PersistCurrentResults": 1, "Nessos.FsPickler.Tests.Serializer": 1, "Nessos.FsPickler.Tests.TestTypes": 1, "PerformanceTests": 1, "Marker": 1, "class": 1, "guid": 2, "Guid.NewGuid": 1, "": 13, "Value": 5, "Guid": 1, "s": 68, "roundtrip": 34, "date": 2, "DateTime.Now": 2, "": 9, "String": 4, "stringValue": 12, "boxed": 2, "box": 11, "..": 9, "Boxed": 1, "Object": 1, "fsClass": 2, "Class": 5, "Simple": 1, "F#": 1, "serializableClass": 2, "SerializableClass": 2, "ISerializable": 1, "boxedClass": 2, "Some": 6, "Subtype": 1, "Resolution": 1, "floatArray": 2, "Array.init": 3, "fun": 7, "i": 29, "": 3, "Array": 7, "intArray": 2, "Int": 3, "stringArray": 2, "": 9, "kvarr": 2, "Array.map": 1, "Key": 2, "Pairs": 1, "duArray": 2, "Something": 1, "Discriminated": 1, "Unions": 1, "objArray": 2, "option": 3, "Objects": 1, "array3D": 2, "Array3D.init": 1, "j": 2, "k": 2, "*": 3, "Rank": 1, "bclDict": 2, "dict": 1, ".NET": 4, "Dictionary": 1, "bclStack": 2, "bclList": 2, "List": 6, "bclSet": 2, "SortedSet": 1, "Set": 2, "smallTuple": 2, "FSharp": 15, "Tuple": 3, "Small": 2, "largeTuple": 2, "Large": 2, "intList": 2, "stringList": 2, "pairList": 2, "nestedLst": 2, "n": 10, "Nested": 1, "union": 2, "SomethingElse": 1, "Union": 1, "record": 2, "Record": 1, "peano": 2, "int2Peano": 1, "Peano": 1, "Rectype": 1, "closure": 2, "@": 4, "Set.ofList": 1, "Curried": 1, "Function": 1, "binTree": 2, "mkTree": 1, "Binary": 1, "Tree": 1, "intSet": 2, "List.map": 2, "fsMap": 2, "Seq.map": 2, "Map.ofSeq": 1, "Map": 2, "testType": 2, "ref": 1, "Reflection": 1, "Type": 1, "quotationSmall": 2, "<@>": 1, "x": 4, "pown": 1, "quotationLarge": 2, "async": 2, "rec": 1, "fibAsync": 4, "when": 2, "return": 4, "fn": 2, "fnn": 2, "values": 2, "Async.Parallel": 1, "Seq.sum": 1, "Quotation": 2, "Sample": 1, "Foo": 1, "Bar": 1, "Baz": 1, "Sample1": 1, "xs": 2, "list": 1, "String.concat": 1 }, "FLUX": { "typedef": 18, "engine": 2, "isEngineMessage": 1, ";": 143, "turn": 2, "isTurnMessage": 1, "connect": 2, "isConnectMessage": 1, "disconnect": 2, "isDisconnectMessage": 1, "ClientMessage": 3, "(": 140, "char*": 11, "data": 9, ")": 140, "ParseMessage": 2, "int": 87, "type": 17, "client": 14, "ReadMessage": 8, "ParseEngine": 2, "direction": 4, "DoEngine": 2, "ParseTurn": 2, "DoTurn": 2, "ParseConnect": 2, "host": 2, "port": 2, "DoConnect": 3, "ParseDisconnect": 2, "DoDisconnect": 3, "UpdateBoard": 2, "ClientList": 8, "clients": 8, "SendData": 2, "DoUpdate": 3, "DataTimer": 3, "GetClients": 6, "Wait": 2, "Listen": 9, "source": 9, "-": 32, "[": 18, "_": 56, "]": 18, "atomic": 16, "{": 16, "client_lock": 3, "}": 16, "xml": 1, "TestXML": 1, "html": 1, "TestHTML": 1, "inCache": 2, "TestInCache": 2, "Page": 3, "socket": 32, "ReadRequest": 4, "bool": 22, "close": 22, "image_tag": 22, "*request": 22, "CheckCache": 6, "Handler": 7, "Complete": 6, "ReadInFromDisk": 5, "__u8": 3, "*rgb_data": 3, "Write": 4, "Compress": 4, "StoreInCache": 5, "cache": 6, "handle": 2, "error": 2, "FourOhFor": 2, "choke": 2, "TestChoke": 1, "unchoke": 2, "TestUnchoke": 1, "interested": 2, "TestInterested": 1, "uninterested": 2, "TestUninterested": 1, "request": 2, "TestRequest": 1, "cancel": 2, "TestCancel": 1, "piece": 7, "TestPiece": 1, "bitfield": 2, "TestBitfield": 1, "have": 2, "TestHave": 1, "piececomplete": 2, "TestPieceComplete": 1, "CheckinWithTracker": 4, "torrent_data_t": 44, "*tdata": 44, "SendRequestToTracker": 2, "GetTrackerResponse": 2, "UpdateChokeList": 4, "PickChoked": 2, "chokelist_t": 2, "clist": 2, "SendChokeUnchoke": 2, "SetupConnection": 4, "Handshake": 2, "client_data_t": 38, "*client": 38, "SendBitfield": 2, "Message": 4, "length": 11, "char": 11, "*payload": 11, "HandleMessage": 11, "MessageDone": 2, "CompletePiece": 3, "VerifyPiece": 2, "SendHave": 2, "SendUninterested": 2, "Choke": 2, "Cancel": 2, "Interested": 2, "Uninterested": 2, "Bitfield": 2, "Unchoke": 2, "SendRequest": 4, "Have": 2, "Piece": 2, "Request": 2, "SendKeepAlives": 3, "maxfd": 2, "fd_set": 4, "*fds": 4, "SelectSockets": 2, "CheckSockets": 3, "TrackerTimer": 2, "ChokeTimer": 2, "Connect": 2, "KeepAliveTimer": 2, "BigLock": 7, "Image": 2, "hit": 2 }, "FORTRAN": { "Codes/HYCOM/hycom/ATLb2.00/src_2.0.01_22_one/": 1, "real": 1, "onemu": 1, "twomu": 1, "data": 3, "onemu/0.0098/": 1, "twomu/1./": 1, "threemu/0.e9/": 1, "end": 13, "c": 3, "comment": 8, "*": 4, "program": 3, "main": 3, "subroutine": 3, "foo": 4, "(": 20, "i": 12, "x": 8, "b": 8, ")": 20, "INTEGER": 4, "REAL": 4, "LOGICAL": 4, "if": 6, "i.ne.0": 3, "then": 3, "call": 3, "bar": 4, "-": 4, "return": 6, "double": 3, "complex": 3, "function": 3, "baz": 8, "d0": 8, "PROGRAM": 1, "MAIN": 1, "END": 4, "C": 1, "SUBROUTINE": 1, "IF": 2, "i.NE.0": 1, "THEN": 1, "CALL": 1, "RETURN": 2, "DOUBLE": 1, "COMPLEX": 1, "FUNCTION": 1 }, "Filebench WML": { "#": 8, "set": 7, "dir": 3, "/tmp": 1, "nfiles": 3, "meandirwidth": 3, "meanfilesize": 3, "k": 1, "iosize": 5, "m": 2, "nthreads": 2, "mode": 1, "quit": 1, "firstdone": 1, "define": 3, "fileset": 2, "name": 10, "bigfileset": 2, "path": 2, "size": 2, "entries": 2, "dirwidth": 2, "prealloc": 1, "paralloc": 1, "destfiles": 2, "process": 1, "filereader": 1, "instances": 2, "{": 2, "thread": 1, "filereaderthread": 1, "memsize": 1, "flowop": 6, "openfile": 1, "openfile1": 1, "filesetname": 2, "fd": 6, "readwholefile": 1, "readfile1": 1, "createfile": 1, "createfile2": 1, "writewholefile": 1, "writefile2": 1, "srcfd": 1, "closefile": 2, "closefile1": 1, "closefile2": 1, "}": 2, "echo": 1 }, "Filterscript": { "#include": 1, "static": 1, "rs_matrix4x4": 2, "Mat": 4, ";": 10, "void": 3, "init": 1, "(": 24, ")": 24, "{": 7, "rsMatrixLoadIdentity": 1, "&": 2, "}": 7, "setMatrix": 1, "m": 2, "uchar4": 2, "__attribute__": 5, "kernel": 5, "root": 2, "in": 2, "float4": 1, "f": 6, "convert_float4": 1, "rsMatrixMultiply": 1, "clamp": 1, "return": 4, "convert_uchar4": 1, "#pragma": 2, "version": 1, "rs": 1, "java_package_name": 1, "foo": 1, "int": 3, "uint32_t": 5, "ain": 3, "in_only": 1, "out_only": 1, "everything": 1, "x": 1, "y": 1 }, "Formatted": { "ACCEPTABLE": 1, "LEFT": 1, "PRIMERS": 1, "-": 2816, "based": 1, "#": 1, "self": 2, "hair": 1, "qual": 1, "tgctagctaggcgatgctag": 1, "actgatacgcgatgctagct": 1, "gatcgatgctagctaggcga": 1, "tcgatcgatgctagctaggc": 1, "tagctgatcgatcgtagcgg": 1, "gctgactgatcgatcgatgc": 1, "tatcatctctgcgcgatcga": 1, "agctaggcgatgctagctag": 1, "ctagctaggcgatgctagct": 1, "ggcgatctagctagctgact": 1, "tcgatgctagctaggcgatg": 1, "gctgatcgatcgatgctagc": 1, "gctagctgatcgatcgatgc": 1, "atcatctctgcgcgatcgat": 1, "gactgatacgcgatgctagc": 1, "atcgatgctagctaggcgat": 1, "gctagctgactgatacgcga": 1, "agctagctgactgatacgcg": 1, "atgctagctaggcgatgcta": 1, "ctatcatctctgcgcgatcg": 1, "gatgctagctaggcgatgct": 1, "gctactatcatctctgcgcg": 1, "cgtagcggcgatctagctag": 1, "cggcgatctagctagctgac": 1, "gctagctgatcgatcgtagc": 1, "gatcgatcgatgtgcggcta": 1, "atcgatcgatgtgcggctag": 1, "gctgactgatacgcgatgc": 1, "agctagctgatcatcgatgct": 1, "gctagctagctgactgatcga": 1, "tcatctctgcgcgatcgat": 1, "atcatctctgcgcgatcga": 1, "atcgatcgatgtgcggcta": 1, "gtagcggcgatctagctagc": 1, "gctagctgactgatcgatcg": 1, "gctgatcgatcgatgtgcg": 1, "tatcatctctgcgcgatcgat": 1, "gctagctagctgatcgatcga": 2, "catctctgcgcgatcgatg": 1, "tcgtagcggcgatctagcta": 1, "actgatacgcgatgctagcta": 1, "actgatcgatcgatgctagct": 1, "agctagctgatcgatcgatgt": 1, "tagcggcgatctagctagct": 1, "cgtagcggcgatctagcta": 1, "ctagctgatcgatcgtagcg": 1, "tagcggcgatctagctagc": 1, "catcgatcgatgcatgcatg": 1, "tcatctctgcgcgatcgatg": 1, "gctagctagctgatcgatcg": 3, "agcatcggattagctagctga": 1, "agctgatcgatcgtagcgg": 1, "cggcgatctagctagctga": 1, "ctagctgatcgatcgatgtgc": 1, "gctagctgatcgatcgatgtg": 1, "gctagctaggcgatgctagc": 1, "tagctagctgactgatacgcg": 1, "gctagctgactgatcgatcga": 1, "agctagctgactgatcgatcg": 1, "cgatcgatgctagctaggcg": 1, "gctagctagctgactgatcg": 1, "atgctagctaggcgatgct": 1, "agctagctgatcgatcgtagc": 1, "gctagctagctgatcgatcgt": 1, "tagctaggcgatgctagctag": 1, "ctagctaggcgatgctagcta": 1, "tagctgatcgatcgatgtgc": 1, "gatgctagctaggcgatgcta": 1, "atgctagctaggcgatgctag": 1, "gctagctgatcatcgatgct": 1, "agctagctgatcatcgatgc": 1, "gctgactgatacgcgatgct": 1, "agctgactgatacgcgatgc": 1, "ggcgatctagctagctgacta": 1, "gatcgatgctagctaggcgat": 1, "atcgatcgatgctagctaggc": 1, "ctgatcgatcgatgtgcgg": 1, "agctgatcgatcgatgtgcg": 1, "cgatcatcgatgctagctagc": 1, "tagctaggcgatgctagcta": 1, "agctagctactgatcgatgct": 1, "tcgatcgatgtgcggctag": 1, "gactgatcgatcgatgctagc": 1, "agctagctgactgatcgatca": 1, "ctgactgatacgcgatgctag": 1, "ctagctgactgatacgcgatg": 1, "gctactatcatctctgcgcga": 1, "agctactatcatctctgcgcg": 1, "actatcatctctgcgcgatc": 1, "actgatcgatcgatgctagc": 1, "gctagctgatcgatcgatgt": 1, "ctatcatctctgcgcgatcga": 1, "atcgatgctagctaggcgatg": 1, "tgactgatacgcgatgctag": 1, "ctgactgatacgcgatgcta": 1, "tagctgactgatacgcgatg": 1, "ctgactgatcgatcgatgct": 1, "agctgactgatcgatcgatg": 1, "tcggattagctagctgatgc": 1, "gcatcggattagctagctga": 1, "agcatcggattagctagctg": 1, "gatgctagctaggcgatgc": 1, "ctgatacgcgatgctagctag": 1, "gctagctgactgatacgcg": 1, "ctctgcgcgatcgatgctag": 1, "tctgcgcgatcgatgctag": 1, "ctctgcgcgatcgatgcta": 1, "cgatgctagctaggcgatgc": 1, "gactgatacgcgatgctagct": 1, "gctagctgactgatacgcgat": 1, "tgatacgcgatgctagctag": 1, "ctgatacgcgatgctagcta": 1, "cgcgatcgatgctagctagc": 1, "gcgcgatcgatgctagctag": 1, "ctgatcgatcgatgctagct": 2, "agctgatcgatcgatgctag": 1, "ctagctgatcgatcgatgct": 1, "agctagctgatcgatcgatg": 2, "catcggattagctagctgatgc": 1, "gcatcggattagctagctgatg": 1, "tcgatgctagctaggcgat": 1, "atcgatgctagctaggcga": 1, "actatcatctctgcgcgatcg": 1, "gcgcgatcgatgctagcta": 1, "gctgatcgatcgatgctagct": 1, "agctgatcgatcgatgctagc": 1, "gctagctgatcgatcgatgct": 1, "agctagctgatcgatcgatgc": 1, "cgcgatcgatgctagctag": 1, "tcgtagcggcgatctagc": 1, "cgtagcggcgatctagct": 1, "gcggcgatctagctagct": 1, "agcggcgatctagctagc": 1, "ctagctgactgatacgcgat": 1, "ctagctgatcgatcgtagcgg": 1, "agctactatcatctctgcgc": 1, "gctagctactgatcgatgct": 1, "agctagctactgatcgatgc": 1, "agcatcggattagctagctgat": 1, "tgctagctaggcgatgcta": 1, "aagcatcggattagctagctg": 1, "tctgcgcgatcgatgcta": 1, "cgatgctagctaggcgatg": 1, "agctagctgatcatcgatgcta": 1, "tagctagctgatcatcgatgct": 1, "atcgatcgatgtgcggct": 1, "gctagctgactgatcgatca": 1, "tagctagctgactgatcgatcg": 1, "agctgatcatcatcgatgct": 1, "agctagctgactgatcgatcat": 1, "tgactgatacgcgatgctagc": 1, "gctgactgatacgcgatgcta": 1, "tagctgactgatacgcgatgc": 1, "tagctagctgatcgatcgtagc": 1, "gctagctagctgatcgatcgta": 1, "tgatcgatcgatgctagctagg": 1, "gctgactgatcgatcgatgct": 1, "agctgactgatcgatcgatgc": 1, "gatcgatcgatgtgcggct": 1, "gctgatcatcgatgctactagc": 1, "gctagctgatcatcgatgctac": 1, "gatcgatcgatgtgcggc": 1, "ctagctagctgactgatacgc": 1, "tagctgatcgatcgatgtgcg": 1, "agctgatcgatcgatgtgc": 1, "gctgatcatcatcgatgctagc": 1, "gctagctgatcatcatcgatgc": 1, "aagcatcggattagctagctga": 1, "gatcgatcgtagcggcga": 1, "atcggattagctagctgatgc": 1, "gcatcggattagctagctgat": 1, "gcggcgatctagctagctg": 1, "tgctagtgatgcatgctagt": 1, "ctactatcatctctgcgcga": 1, "actagctagctgactgatacgc": 1, "gctagctagctgatcatcga": 1, "tctctgcgcgatcgatgcta": 1, "tgatcgatcgatgctagctagt": 1, "actgatcgatcgatgctagcta": 1, "tagctagctgatcgatcgatgt": 1, "agctaggcgatgctagcta": 1, "tagctaggcgatgctagct": 1, "gatcgatcgatgctagctagg": 1, "gctagctagctgactgatcgat": 1, "gatcgatgctagctaggcg": 1, "cgatcgatgctagctaggc": 1, "tagctagctgactgatacgc": 1, "agctagctgactgatcgatc": 2, "aaagcatcggattagctagctg": 1, "gctgactgatcgatcatcatgc": 1, "tagctactatcatctctgcgcg": 1, "ctgatcgatcgatgtgcggc": 1, "gctgatcgatcgatgtgcgg": 1, "tcgtagcggcgatctagct": 1, "agcggcgatctagctagct": 1, "ctagctagctgatcatcgatgc": 1, "gctagctagctgatcatcgatg": 1, "tcatctctgcgcgatcga": 1, "tcgatcgatgtgcggcta": 1, "tgatcgatcgatgtgcggc": 1, "ctagctaggcgatgctagctag": 1, "gctagctagctgatcgatcgat": 2, "ctgcgcgatcgatgctag": 1, "aagcatcggattagctagct": 1, "gctagctgatcatcgatgcta": 1, "tagctagctgatcatcgatgc": 1, "actgatacgcgatgctagc": 1, "gctagctgactgatcgatcatc": 1, "atcgatcgatgctagctagg": 1, "atctctgcgcgatcgatgc": 1, "tgatcgatcgtagcggcg": 1, "atcatctctgcgcgatcgatg": 1, "agctagctgatcgatcgtag": 1, "ctagctagctgatcgatcgt": 1, "gctagctgactgatcgatcat": 1, "ctgatcgatcgtagcggcg": 1, "ctgactgatacgcgatgct": 1, "agctgactgatacgcgatg": 1, "gctagctgatcgatcgtagcg": 1, "ctagctgactgatcgatcga": 1, "agctagctactgatcgatgcta": 1, "tagctagctactgatcgatgct": 1, "gactgatacgcgatgctagcta": 1, "actgatacgcgatgctagctag": 1, "gactgatcgatcgatgctagct": 1, "gctagctgactgatcgatcgat": 1, "tgcgcgatcgatgctagcta": 1, "gcggcgatctagctagctga": 1, "agcggcgatctagctagctg": 1, "ctactatcatctctgcgcgatc": 1, "tatcatctctgcgcgatcg": 1, "tactatcatctctgcgcgatcg": 1, "tagctagctgactgatcgatca": 1, "gctgatcgatcgatgctagcta": 1, "tagctgatcgatcgatgctagc": 1, "gctagctgatcgatcgatgcta": 1, "tagctagctgatcgatcgatgc": 1, "gctaggcgatgctagctag": 1, "ctagctaggcgatgctagc": 1, "gctagctaggcgatgctag": 1, "catctctgcgcgatcgatgc": 1, "aaagcatcggattagctagct": 1, "ctgactgatcgatcgatgctag": 1, "ctagctgactgatcgatcgatg": 1, "tactatcatctctgcgcgatc": 1, "gctagctactgatcgatgctac": 1, "ctactatcatctctgcgcgat": 1, "agctgatcatcgatgctact": 1, "gctagctagctgatcatcgat": 1, "ctgatacgcgatgctagct": 1, "ggcgatctagctagctgac": 1, "tgactgatcgatcgatgctag": 1, "ctgactgatcgatcgatgcta": 1, "tagctgactgatcgatcgatg": 1, "actgatcgatcatcatgctagc": 1, "agctgactgatcgatcatca": 1, "ctagctagctgatcgatcga": 2, "gatcgatcgatgtgcggctag": 1, "tgctagctaggcgatgct": 1, "gctgatcgatcgtagcggc": 1, "cgatcgatgtgcggctag": 1, "tgatcgatcgatgtgcggct": 1, "ctgactgatcgatcatcatgct": 1, "agctgactgatcgatcatcatg": 1, "agctagctgactgatacgcga": 1, "tgactgatcgatcgatgctagc": 1, "gctgactgatcgatcgatgcta": 1, "tagctgactgatcgatcgatgc": 1, "agctagctgatcgatcgatgtg": 1, "ctgatcgatcgatgctagctag": 2, "ctagctgatcgatcgatgctag": 1, "ctagctagctgatcgatcgatg": 2, "gactgatcgatcatcatgctagc": 1, "gctagtgatgcatgctagtagtg": 1, "gctactatcatctctgcgcgat": 1, "gtagcggcgatctagctag": 1, "tgactgatcgatcatcatgct": 1, "ctagctactatcatctctgcgc": 1, "gctagctactatcatctctgcg": 1, "ctagctagctactgatcgatgc": 1, "gctagctagctactgatcgatg": 1, "catcgatcgatgctagtatgct": 1, "tgatcgatcgatgctagctag": 2, "ctgatcgatcgatgctagcta": 2, "tagctgatcgatcgatgctag": 1, "ctagctgatcgatcgatgcta": 1, "tagctagctgatcgatcgatg": 2, "gatcgatcgatgctagctagt": 1, "ctatcatctctgcgcgatcgat": 1, "tgatcgatcgtagcggcga": 1, "tcgtagcggcgatctagctag": 1, "tactagctagctgactgatacgc": 1, "ctgatcatcatcgatgctagct": 1, "agctgatcatcatcgatgctag": 1, "ctagctgatcatcatcgatgct": 1, "agctagctgatcatcatcgatg": 1, "ctgatcgatcatcatgctagct": 1, "ctagctgactgatcgatcgat": 1, "ttagctagctgactgatcgatca": 1, "tagctactatcatctctgcgc": 1, "gctagctactgatcgatgcta": 1, "tagctagctactgatcgatgc": 1, "tctctgcgcgatcgatgc": 1, "ctctgcgcgatcgatgct": 1, "agctagctactatcatctctgcg": 1, "ctagctagctactgatcgatgct": 1, "ctgatcgatcgtagcggc": 1, "gctgatcgatcgtagcgg": 1, "agctaggcgatgctagct": 1, "tgctagtgatgcatgctagtagt": 1, "gcgcgatcgatgctagct": 1, "tgatcatcatcgatgctagct": 1, "agctgatcatcatcgatgcta": 1, "tagctgatcatcatcgatgct": 1, "tgatcgatcatcatgctagct": 1, "ctagctagctgactgatacgcg": 1, "tgctagtgatgcatgctagtag": 1, "gctagtgatgcatgctagtagt": 1, "tagctagctgatcatcgatgcta": 1, "agctagctgactgatacgc": 1, "tatcatctctgcgcgatcgatg": 1, "agctgactgatcgatcatcat": 1, "actagctagctgatcatcatcga": 1, "tagctagctgactgatcgatcat": 1, "gatgctagctaggcgatgctag": 1, "cggcgatctagctagctgact": 1, "ctagctagctgatcgatcgat": 2, "actgatcgatcatcatgctagct": 1, "ctagctagctgactgatcgatc": 1, "ctgactgatcgatcatcatgc": 1, "gctgactgatcgatcatcatg": 1, "gatcgatcgatgctagctaggc": 1, "gtgatgcatgctagtagtgatgt": 1, "tgctagtgatgcatgctagta": 1, "tagcggcgatctagctagctg": 1, "gtagcggcgatctagctagct": 1, "tagctgatcgatcgtagcg": 1, "gctagctagctactgatcgat": 1, "agctagctactgatcgatgctac": 1, "atcgatcgatgctagtatgct": 1, "agctactgatcgatgctacatc": 1, "agtgatgcatgctagtagtga": 1, "gactgatcgatcgatgctagcta": 1, "ctgatcgatcgatgctagctagt": 1, "actgatcgatcgatgctagctag": 1, "ctagctagctgatcgatcgatgt": 1, "catcgatcgatgctagtatgc": 1, "tagctagctgactgatcgatc": 2, "ctagctagctgactgatcgat": 1, "tcgatgctagctaggcga": 1, "tgatcgatcgatgctagctagta": 1, "ctgcgcgatcgatgctagc": 1, "agctagctgatcatcatcgat": 1, "tgcgcgatcgatgctagc": 1, "ctagctagctgatcgatcgtag": 1, "actagctagctgactgatacg": 1, "ctagctgactgatacgcga": 1, "gctactagctagctgactgat": 1, "ctgatcatcatcgatgctagc": 1, "gctgatcatcatcgatgctag": 1, "ctagctgatcatcatcgatgc": 1, "gctagctgatcatcatcgatg": 1, "ctgatcgatcatcatgctagc": 1, "agctactgatcgatgctacat": 1, "tgatcgatcgatgtgcggcta": 1, "atctctgcgcgatcgatg": 1, "catctctgcgcgatcgat": 1, "atcatctctgcgcgatcg": 1, "aagcatcggattagctagctgat": 1, "agtgatgcatgctagtagtgatg": 1, "gatcgatgctagctaggcgatg": 1, "atctctgcgcgatcgatgcta": 1, "tagctagctgactgatacgcga": 1, "tagctagctgatcgatcgtag": 1, "ctagctagctgatcgatcgta": 1, "tcgatcgatgctagctagtag": 1, "gctagctactgatcgatgctaca": 1, "agctagctgactgatcgatcatc": 1, "agctagctgactgatcgatcga": 1, "tctctgcgcgatcgatgct": 1, "tgatgcatgctagtagtgatgt": 1, "tgatcgatcgatgtgcgg": 1, "cgatcgatgctagctaggcga": 1, "tcgatcgatgctagctaggcg": 1, "atcgatcgatgcatgcatg": 1, "catcgatcgatgcatgcat": 1, "actagctagctgatcatcatcg": 1, "ctgatcatcgatgctactagct": 1, "agctgatcatcgatgctactag": 1, "ctagctgatcatcgatgctact": 1, "tttagctagctgactgatcga": 1, "tagctagctgatcgatcgatgtg": 1, "gctagctagctgatcatcatct": 1, "ctagctagctgatcatcgatgct": 1, "agctagctactatcatcgatcga": 1, "ttagctagctgactgatcgatc": 1, "ctagctgactgatcgatcatca": 1, "aaagcatcggattagctagctga": 1, "agctgactgatacgcgatgct": 1, "tagctagctactgatcgatgcta": 1, "tcatcatcgatgctagctagt": 1, "tcgatcatcatgctagctact": 1, "tgatcatcgatgctactagct": 1, "agctgatcatcgatgctacta": 1, "tagctgatcatcgatgctact": 1, "tcgatcgatgctagtatgctag": 1, "gcgatctagctagctgact": 1, "gctactgatcgatgctacatc": 1, "cggcgatctagctagctg": 1, "gctagctgactgatcgatcatca": 1, "actatcatctctgcgcgat": 1, "catcggattagctagctgatg": 1, "tagctgactgatcgatcatca": 1, "actagctagctgatcatcatcgat": 1, "agtgatgcatgctagtagtgat": 1, "ctagctagctgatcatcatcga": 1, "gctgatcatcgatgctactagct": 1, "agctgatcatcgatgctactagc": 1, "gctagctgatcatcgatgctact": 1, "agctagctgatcatcgatgctac": 1, "tagctagctactatcatctctgcg": 1, "ctagctagctactgatcgatgcta": 1, "agctactatcatctctgcgcga": 1, "gctatttagctagctgactgatcg": 1, "tgatcgatcatcatgctagctac": 1, "gtgatgcatgctagtagtgatg": 1, "ctagctagctgactgatcgatcg": 1, "ctagctactgatcgatgctaca": 1, "cggcgatctagctagctgacta": 1, "atgctagctaggcgatgc": 1, "ctgatcgatcatcatgctagctac": 1, "gctactagctagctgatcatca": 2, "ctgactgatacgcgatgctagc": 1, "gctgactgatacgcgatgctag": 1, "ctagctgactgatacgcgatgc": 1, "gctagctgactgatacgcgatg": 1, "tgactgatcgatcatcatgctag": 1, "ctgactgatcgatcatcatgcta": 1, "tagctgactgatcgatcatcatg": 1, "ctagctagctgatcgatcgtagc": 1, "gctagctagctgatcgatcgtag": 1, "ctgatcgatcgatgctagctagg": 1, "gatcgatcgatgctagctagtag": 1, "ttagctagctgactgatcgatcat": 1, "ctgactgatcgatcatcatgctag": 1, "ctagctgactgatcgatcatcatg": 1, "ctagctgatcgatcgatgtgcg": 1, "tttagctagctgactgatcgatc": 1, "tgactgatcgatcatcatgcta": 1, "gctagctactatcatcgatcga": 1, "gatcgatcgatgctagctagta": 1, "agctagctactatcatcgatcg": 1, "atcgatcgatgctagctagtag": 1, "tgatcatcatcgatgctagctagt": 1, "tgatcgatcatcatgctagctact": 1, "actgatcgatcatcatgctagcta": 1, "catcgatcgatgctagtatgcta": 1, "tttagctagctgactgatcgat": 1, "atttagctagctgactgatcga": 1, "cgcgatcgatgctagcta": 1, "catcgatcgatgctagtatgctag": 1, "tagctagctactgatcgatgctac": 1, "agcatcggattagctagctgatg": 1, "agctagctgactgatacgcgat": 1, "tgatcatcatcgatgctagctag": 1, "ctgatcatcatcgatgctagcta": 1, "tagctgatcatcatcgatgctag": 1, "ctagctgatcatcatcgatgcta": 1, "tagctagctgatcatcatcgatg": 1, "ctgatcgatcatcatgctagcta": 1, "gatcatcatcgatgctagctagt": 1, "gatcgatcatcatgctagctact": 1, "gctagctagctgactgatcgatc": 1, "tgatcgatcgatgctagctagtag": 1, "ctgatcgatcgatgctagctagta": 1, "ctgatcatcatcgatgctagctag": 1, "ctagctgatcatcatcgatgctag": 1, "ctagctagctgatcatcatcgatg": 1, "tttagctagctgactgatcgatca": 1, "actatcatctctgcgcgatcga": 1, "agctgatcgatcgtagcg": 1, "gctactagctagctgactgatac": 1, "agctgatcgatcgatgctagct": 1, "agctagctgatcgatcgatgct": 1, "ctagctgactgatcgatcatcat": 1, "agctagctactatcatctctgc": 1, "ctagctactatcatctctgcgcg": 1, "tgatcatcatcgatgctagcta": 1, "tagctgatcatcatcgatgcta": 1, "tgatcgatcatcatgctagcta": 1, "atcatcatcgatgctagctagt": 1, "atcgatcatcatgctagctact": 1, "agctagctactatcatcgatcgat": 1, "gctagctgatcgatcgatgtgc": 1, "tagctgactgatcgatcatcat": 1, "tagctagctgactgatcgatcga": 1, "atcgatcgatgctagtatgctag": 1, "ctagtgatgcatgctagtagtga": 1, "tagctagctgactgatcgatcatc": 1, "tactagctagctgatcatcatcga": 1, "gctagctagctactatcatcga": 1, "tgactgatacgcgatgctagct": 1, "agctgactgatacgcgatgcta": 1, "tagctgactgatacgcgatgct": 1, "atcgatcgatgctagtatgcta": 1, "ctagctagctgatcatcatcgat": 1, "agctgactgatcgatcgatgct": 1, "ctagctagctgatcatcgatgcta": 1, "gtgatgcatgctagtagtgatgta": 1, "gctgatcatcatcgatgctagct": 1, "agctgatcatcatcgatgctagc": 1, "gctagctgatcatcatcgatgct": 1, "agctagctgatcatcatcgatgc": 1, "tagtgatgcatgctagtagtga": 1, "ctactagctagctgactgatacg": 1, "tagctactgatcgatgctacatc": 1, "gactgatacgcgatgctagctag": 1, "ctagctactgatcgatgctacat": 1, "gctagctactatcatctctgcgc": 1, "gctagctagctactgatcgatgc": 1, "gctactagctagctgatcatcat": 2, "ctagctactgatcgatgctacatc": 1, "gctactagctagctgatcatcatc": 2, "gctgatcatcatctagctagtagc": 1, "tagctagctgatcatcatcgat": 1, "ctactatcatctctgcgcgatcg": 1, "tactagctagctgactgatacg": 1, "gctgatcgatcgatgctagctag": 1, "ctagctgatcgatcgatgctagc": 1, "gctagctgatcgatcgatgctag": 1, "ctagctagctgatcgatcgatgc": 1, "gctagctagctgatcgatcgatg": 2, "gctactagctagctgactgata": 1, "gatcgatcatcatgctagctac": 1, "cgatgctagctaggcgat": 1, "atcgatgctagctaggcg": 1, "tagctactgatcgatgctacat": 1, "gctagctactatcatcgatcgat": 1, "tgcatgctagtagtgatgtatacg": 1, "gcatgctagtagtgatgtatacgt": 1, "atttagctagctgactgatcgatc": 1, "gactgatcgatcatcatgctag": 1, "atttagctagctgactgatcgat": 1, "gctgactgatcgatcatcatgct": 1, "agctgactgatcgatcatcatgc": 1, "tagctactatcatctctgcgcga": 1, "gctgatcatcgatgctactagcta": 1, "tagctgatcatcgatgctactagc": 1, "gctagctgatcatcgatgctacta": 1, "tagctagctgatcatcgatgctac": 1, "tagtgatgcatgctagtagtgatg": 1, "agtgatgcatgctagtagtgatgt": 1, "tgatgcatgctagtagtgatgta": 1, "ctgactgatcgatcgatgctagc": 1, "gctgactgatcgatcgatgctag": 1, "ctagctgactgatcgatcgatgc": 1, "gctagctgactgatcgatcgatg": 1, "tcatcatcgatgctagctagtag": 1, "tactagctagctgatcatcatcg": 1, "tcgatcatcatgctagctactag": 1, "tgatcatcgatgctactagctag": 1, "ctgatcatcgatgctactagcta": 1, "tagctgatcatcgatgctactag": 1, "ctagctgatcatcgatgctacta": 1, "ctactagctagctgatcatcatcg": 1, "ctgatcatcgatgctactagctag": 1, "ctagctgatcatcgatgctactag": 1, "gctagctagctgatcatcatctag": 1, "gctagctagctgatcatcatcta": 1, "ctagtgatgcatgctagtagtg": 1, "gctactatcatctctgcgcgatc": 1, "gctgatcgatcgatgtgc": 1, "tagctagctactatcatcgatcga": 1, "agctagctgatcgatcgtagcg": 1, "tgactgatacgcgatgct": 1, "gatcatcatcgatgctagctag": 1, "tcatcatcgatgctagctagta": 1, "tcgatcatcatgctagctacta": 1, "tgatcatcgatgctactagcta": 1, "tagctgatcatcgatgctacta": 1, "tagctagctgactgatacgcgat": 1, "ctagctagctactatcatcgatcga": 1, "agctagctgactgatcgatcgat": 1, "ctactagctagctgactgatacgc": 1, "gctactagctagctgactgatacg": 1, "tgatcatcatcgatgctagctagta": 1, "tgatcgatcatcatgctagctacta": 1, "ctagtgatgcatgctagtagtgatg": 1, "gctagctagctactatcatcgatc": 1, "gctagctactgatcgatgctacat": 1, "gctagctagctactatcatcgat": 1, "ctagtgatgcatgctagtagtgat": 1, "tactatcatctctgcgcgatcga": 1, "agctgatcgatcgatgctagcta": 1, "tagctgatcgatcgatgctagct": 1, "agctagctgatcgatcgatgcta": 1, "tagctagctgatcgatcgatgct": 1, "tagtgatgcatgctagtagtgat": 1, "tactagctagctgatcatcatcgat": 1, "gctagctagctgatcatcgatgc": 1, "gctagtgatgcatgctagtagtga": 1, "aaagcatcggattagctagctgat": 1, "gtgatgcatgctagtagtgatgtat": 1, "ctatcatctctgcgcgatcgatg": 1, "tgactgatacgcgatgctagcta": 1, "tagctgactgatacgcgatgcta": 1, "tgctagtagtgatgtatacgtagct": 1, "tgactgatcgatcgatgctagct": 1, "agctgactgatcgatcgatgcta": 1, "tagctgactgatcgatcgatgct": 1, "ctagctagctactatcatcgatcg": 1, "tagctagctactatcatcgatcg": 1, "gactgatcgatcatcatgctagct": 1, "gctagctgactgatcgatcatcat": 1, "ctatttagctagctgactgatcga": 1, "gcatgctagtagtgatgtatacg": 1, "tatttagctagctgactgatcga": 1, "ctactagctagctgatcatcatcga": 1, "agctactatcatctctgcgcgat": 1, "gctgatcatcatcgatgctagcta": 1, "tagctgatcatcatcgatgctagc": 1, "gctagctgatcatcatcgatgcta": 1, "tagctagctgatcatcatcgatgc": 1, "atgcatgctagtagtgatgtatacg": 1, "tgatgcatgctagtagtgatgtat": 1, "gactgatcgatcgatgctagctag": 1, "gctatttagctagctgactgatc": 1, "tgctagtgatgcatgctagtagtg": 1, "ctagctagctactatcatctctgc": 1, "gctagctagctactatcatctctg": 1, "gatcatcatcgatgctagctagta": 1, "gatcgatcatcatgctagctacta": 1, "atcatcatcgatgctagctagtag": 1, "atcgatcatcatgctagctactag": 1, "tagctagctactatcatctctgc": 1, "atcatcatcgatgctagctagta": 1, "atcgatcatcatgctagctacta": 1, "gatcatcatcgatgctagctagtag": 1, "gatcgatcatcatgctagctactag": 1, "actagctagctgatcatcatctact": 1, "tgactgatcgatcatcatgctagc": 1, "gctgactgatcgatcatcatgcta": 1, "tagctgactgatcgatcatcatgc": 1, "tgctagtagtgatgtatacgtagc": 1, "ctagctagctgactgatacgcga": 1, "tagctagctactatcatcgatcgat": 1, "gctactagctagctgatcatcatct": 1, "agctgatcatcatctagctagtagc": 1, "ctagctagctgatcgatcgatgtg": 1, "agtgatgcatgctagtagtgatgta": 1, "tagtgatgcatgctagtagtgatgt": 1, "actatcatctctgcgcgatcgat": 1, "ctatttagctagctgactgatcg": 1, "tagctagctgatcgatcgtagcg": 1, "gcatcggattagctagctgatgc": 1, "tgcatgctagtagtgatgtatacgt": 1, "tttagctagctgactgatcgatcat": 1, "atttagctagctgactgatcgatca": 1, "gctagctagctactatcatctct": 1, "aagcatcggattagctagctgatg": 1, "agtgatgtatacgtagctagtagc": 1, "gctagtagtgatgtatacgtagct": 1, "tagctagctgactgatcgatcgat": 1, "actagctagctgactgatacgcg": 1, "actagctagctgatcatcatctac": 1, "tagctgatcgatcgatgctagcta": 1, "tagctagctgatcgatcgatgcta": 1, "tatttagctagctgactgatcgat": 1, "gcatgctagtagtgatgtatacgta": 1, "tatttagctagctgactgatcgatc": 1, "ctatttagctagctgactgatcgat": 1, "ctagctagctactatcatctctgcg": 1, "tgatcgatcgatgctagctaggc": 1, "agctagctactgatcgatgctaca": 1, "tgactgatcgatcgatgctagcta": 1, "tagctgactgatcgatcgatgcta": 1, "catgctagtagtgatgtatacgtagc": 1, "gcatgctagtagtgatgtatacgtag": 1, "actgatcgatcgatgctagctagt": 1, "ctatttagctagctgactgatcgatc": 1, "ttagctagctgactgatcgatcatc": 1, "atgctagtagtgatgtatacgtagct": 1, "ctagctagctgatcatcatctact": 1, "ctactagctagctgatcatcatct": 1, "agctgatcatcatctagctagtag": 1, "ctagctgatcatcatctagctagt": 1, "tagctactatcatctctgcgcgat": 1, "gactgatcgatcatcatgctagcta": 1, "ctgatcatcatcgatgctagctagt": 1, "actagctagctgatcatcatcgatg": 1, "ctgatcgatcatcatgctagctact": 1, "atgctagtagtgatgtatacgtagc": 1, "ctagctagctactgatcgatgctac": 1, "gctagctagctactatcatctctgc": 1, "agctagctgatcatcatctactatca": 1, "ctgatcgatcgatgctagctagtag": 1, "agctagctgactgatcgatcatca": 1, "gctagctagctactatcatcgatcg": 1, "gctatttagctagctgactgatcga": 1, "ctagctagctactatcatcgatcgat": 1, "agctgatcatcgatgctactagct": 1, "agctagctgatcatcgatgctact": 1, "ctagctagctgactgatcgatcga": 1, "actgatcgatcatcatgctagctac": 1, "tgatgcatgctagtagtgatgtatac": 1, "gtgatgcatgctagtagtgatgtata": 1, "tactatcatctctgcgcgatcgat": 1, "gctagctgatcatcatctactatca": 1, "gctactagctagctgatcatcatcta": 1, "tagctgatcatcatctagctagtagc": 1, "tgctagtagtgatgtatacgtagcta": 1, "gatgcatgctagtagtgatgtatacg": 1, "tagtgatgcatgctagtagtgatgta": 1, "gctagtgatgcatgctagtagtgat": 1, "tgcatgctagtagtgatgtatacgta": 1, "tatttagctagctgactgatcgatca": 1, "tgatgcatgctagtagtgatgtata": 1, "tactagctagctgactgatacgcg": 1, "ctagctactatcatctctgcgcga": 1, "agctagctgatcatcatctactatc": 1, "agctagctgatcatcatctactat": 1, "gctactagctagctgatcatcatcg": 1, "gctgatcatcgatgctactagctag": 1, "ctagctgatcatcgatgctactagc": 1, "gctagctgatcatcgatgctactag": 1, "ctagctagctgatcatcgatgctac": 1, "actagctagctgatcatcatctacta": 1, "tactagctagctgatcatcatctact": 1, "ctactagctagctgatcatcatcgat": 1, "tagctagctactgatcgatgctaca": 1, "gtagtgatgtatacgtagctagtagc": 1, "actgatcgatcgatgctagctagta": 1, "gatgcatgctagtagtgatgtatac": 1, "agctgatcatcatcgatgctagct": 1, "agctagctgatcatcatcgatgct": 1, "ctagctagctgactgatacgcgat": 1, "atgcatgctagtagtgatgtatac": 1, "agctagctactatcatctctgcgc": 1, "gctagctagctactgatcgatgct": 1, "ctactatcatctctgcgcgatcga": 1, "gctagctactgatcgatgctacatc": 1, "tagtgatgtatacgtagctagtagc": 1, "gctagtagtgatgtatacgtagcta": 1, "tgatcatcatcgatgctagctagtag": 1, "ctgatcatcatcgatgctagctagta": 1, "tactagctagctgatcatcatcgatg": 1, "tgatcgatcatcatgctagctactag": 1, "ctgatcgatcatcatgctagctacta": 1, "agctgatcgatcgatgctagctag": 1, "ctagctgatcgatcgatgctagct": 1, "agctagctgatcgatcgatgctag": 1, "ctagctagctgatcgatcgatgct": 1, "tactagctagctgatcatcatctac": 1, "gctagctgatcatcatctactatc": 1, "agtgatgcatgctagtagtgatgtat": 1, "gctagtagtgatgtatacgtagctag": 1, "tagctagctgactgatcgatcatca": 1, "ctactagctagctgatcatcatctac": 1, "agtagtgatgtatacgtagctagt": 1, "gctagctgatcatcatctactatcat": 1, "agctgatcatcatctactatcatca": 1, "atgcatgctagtagtgatgtatacgt": 1, "atttagctagctgactgatcgatcat": 1, "agctgatcatcgatgctactagcta": 1, "tagctgatcatcgatgctactagct": 1, "agctagctgatcatcgatgctacta": 1, "tagctagctgatcatcgatgctact": 1, "atgctagtagtgatgtatacgtagcta": 1, "gctagctgatcatcatctactatcatc": 1, "ctagctagctgatcatcatctacta": 1, "ctactagctagctgatcatcatcta": 1, "tagctgatcatcatctagctagtag": 1, "ctagctgatcatcatctagctagta": 1, "gctgatcatcatcgatgctagctag": 1, "ctagctgatcatcatcgatgctagc": 1, "gctagctgatcatcatcgatgctag": 1, "ctagctagctgatcatcatcgatgc": 1, "agctagctgatcatcatctactatcat": 1, "ctactagctagctgatcatcatctact": 1, "ctagctgatcatcatctagctagtag": 1, "aaagcatcggattagctagctgatg": 1, "agctagctactgatcgatgctacat": 1, "tagctagctgatcatcatctactatca": 1, "actagctagctgatcatcatctactat": 1, "ctgactgatcgatcatcatgctagc": 1, "gctgactgatcgatcatcatgctag": 1, "ctagctgactgatcgatcatcatgc": 1, "gctagctgactgatcgatcatcatg": 1, "tgctagtagtgatgtatacgtagctag": 1, "agtagtgatgtatacgtagctagtagc": 1, "gctagtagtgatgtatacgtagctagt": 1, "ctagtgatgcatgctagtagtgatgt": 1, "gctgatcatcatctactatcatcatca": 1, "agctagctgactgatcgatcatcat": 1, "tttagctagctgactgatcgatcatc": 1, "catgctagtagtgatgtatacgtag": 1, "agctgatcatcatcgatgctagcta": 1, "tagctgatcatcatcgatgctagct": 1, "agctagctgatcatcatcgatgcta": 1, "tagctagctgatcatcatcgatgct": 1, "gctatttagctagctgactgatcgat": 1, "ctagctagctgactgatcgatcgat": 1, "agctgatcatcatctactatcatcat": 1, "tagctagctactatcatctctgcgc": 1, "gctagctagctactgatcgatgcta": 1, "tgctagtgatgcatgctagtagtga": 1, "tagctgatcgatcgatgctagctag": 1, "ctagctgatcgatcgatgctagcta": 1, "tagctagctgatcgatcgatgctag": 1, "ctagctagctgatcgatcgatgcta": 1, "gtgatgcatgctagtagtgatgtatac": 1, "agctgatcatcatctactatcatcatc": 1, "tagctagctgatcatcatctactat": 1, "tagctagctgatcatcatctactatc": 1, "tgactgatcgatcatcatgctagct": 1, "agctgactgatcgatcatcatgcta": 1, "tagctgactgatcgatcatcatgct": 1, "ctagctagctgatcatcatctactat": 1, "agtgatgcatgctagtagtgatgtata": 1, "tagtgatgcatgctagtagtgatgtat": 1, "tgactgatcgatcgatgctagctag": 1, "ctgactgatcgatcgatgctagcta": 1, "tagctgactgatcgatcgatgctag": 1, "ctagctgactgatcgatcgatgcta": 1, "tagctagctgactgatcgatcgatg": 1, "gactgatcgatcgatgctagctagt": 1, "tactagctagctgatcatcatctacta": 1, "tagctgatcatcgatgctactagcta": 1, "tagctagctgatcatcgatgctacta": 1, "atgcatgctagtagtgatgtatacgta": 1, "tatttagctagctgactgatcgatcat": 1, "ctagctagctgatcatcatctactatc": 1, "tagctactatcatctctgcgcgatc": 1, "gctgatcatcatctactatcatcat": 1, "ctagctactatcatctctgcgcgat": 1, "gctgatcatcatctactatcatcatc": 1, "tagctagctactgatcgatgctacat": 1, "agtagtgatgtatacgtagctagtag": 1, "ctagtagtgatgtatacgtagctagt": 1, "catgctagtagtgatgtatacgtagct": 1, "gactgatcgatcatcatgctagctac": 1, "tagctgatcatcatctactatcatca": 1, "ctagctgatcatcatctactatcatca": 1, "ctagctgatcatcatctagctagtagc": 1, "tagctagctgactgatcgatcatcat": 1, "ctagtgatgcatgctagtagtgatgta": 1, "tgcatgctagtagtgatgtatacgtag": 1, "ctatttagctagctgactgatcgatca": 1, "tagctgatcatcatcgatgctagcta": 1, "tagctagctgatcatcatcgatgcta": 1, "gctagctagctactatcatcgatcga": 1, "gctactagctagctgatcatcatctac": 1, "ttagctagctgactgatcgatcatca": 1, "tgactgatcgatcatcatgctagcta": 1, "tagctgactgatcgatcatcatgcta": 1, "actgatcgatcatcatgctagctact": 1, "gctagtgatgcatgctagtagtgatg": 1, "ctagctagctactgatcgatgctaca": 1, "gactgatcgatcgatgctagctagta": 1, "actgatcgatcgatgctagctagtag": 1, "ctagctgatcatcatctactatcatc": 1, "ctgatcatcatcgatgctagctagtag": 1, "ctactagctagctgatcatcatcgatg": 1, "ctgatcgatcatcatgctagctactag": 1, "tagctgatcatcatctactatcatcat": 1, "tgatgcatgctagtagtgatgtatacg": 1, "gatgcatgctagtagtgatgtatacgt": 1, "gctactagctagctgatcatcatcga": 1, "agctgatcatcgatgctactagctag": 1, "ctagctgatcatcgatgctactagct": 1, "agctagctgatcatcgatgctactag": 1, "ctagctagctgatcatcgatgctact": 1, "atttagctagctgactgatcgatcatc": 1, "tctactatcatcatcatctactagct": 1, "tgctagtgatgcatgctagtagtgat": 1, "ctgatcatcatctactatcatcatca": 1, "agctagctactgatcgatgctacatc": 1, "tagtagtgatgtatacgtagctagtag": 1, "ctagtagtgatgtatacgtagctagta": 1, "actgatcgatcatcatgctagctacta": 1, "gcatgctagtagtgatgtatacgtagc": 1, "gctatttagctagctgactgatcgatc": 1, "atctactatcatcatcatctactagct": 1, "catctactatcatcatcatctactagc": 1, "tgatcatcatctactatcatcatcatc": 1, "tagctgatcatcgatgctactagctag": 1, "ctagctgatcatcgatgctactagcta": 1, "tagctagctgatcatcgatgctactag": 1, "ctagctagctgatcatcgatgctacta": 1, "ctgatcatcatctactatcatcatcat": 1, "gctagctagctactatcatcgatcgat": 1, "ttagctagctgactgatcgatcatcat": 1, "tagctagctactgatcgatgctacatc": 1, "ctagctagctactgatcgatgctacat": 1, "gatcatcatctactatcatcatcatct": 1, "tttagctagctgactgatcgatcatca": 1, "tctactatcatcatcatctactagcta": 1, "see": 1, "James": 1, "E": 1, "Angelo": 1, "Neville": 1, "R": 1, "Moody": 1, "Michael": 1, "I": 1, "Baskes": 1, "Modelling": 1, "and": 1, "Simulation": 1, "in": 1, "Materials": 1, "Science": 1, "&": 1, "Engineering": 1, "vol.": 1, "pp.": 1, "(": 1, ")": 1, "Ni": 1, "Al": 1, "H": 1, "fcc": 2, "Weekly": 1, "SST": 5, "data": 1, "starts": 1, "week": 1, "centered": 1, "on": 1, "Jan1990": 1, "Nino1": 1, "+": 1, "Nino3": 1, "Nino34": 1, "Nino4": 1, "Week": 1, "SSTA": 4, "JAN1990": 5, "EB1990": 4, "MAR1990": 4, "APR1990": 4, "MAY1990": 5, "JUN1990": 4, "JUL1990": 4, "AUG1990": 5, "SEP1990": 4, "OCT1990": 5, "NOV1990": 4, "DEC1990": 4, "JAN1991": 5, "EB1991": 4, "MAR1991": 4, "APR1991": 4, "MAY1991": 5, "JUN1991": 4, "JUL1991": 5, "AUG1991": 4, "SEP1991": 4, "OCT1991": 5, "NOV1991": 4, "DEC1991": 4, "JAN1992": 5, "EB1992": 4, "MAR1992": 4, "APR1992": 5, "MAY1992": 4, "JUN1992": 4, "JUL1992": 5, "AUG1992": 4, "SEP1992": 5, "OCT1992": 4, "NOV1992": 4, "DEC1992": 5, "JAN1993": 4, "EB1993": 4, "MAR1993": 5, "APR1993": 4, "MAY1993": 4, "JUN1993": 5, "JUL1993": 4, "AUG1993": 4, "SEP1993": 5, "OCT1993": 4, "NOV1993": 4, "DEC1993": 5, "JAN1994": 4, "EB1994": 4, "MAR1994": 5, "APR1994": 4, "MAY1994": 4, "JUN1994": 5, "JUL1994": 4, "AUG1994": 5, "SEP1994": 4, "OCT1994": 4, "NOV1994": 5, "DEC1994": 4, "JAN1995": 4, "EB1995": 4, "MAR1995": 5, "APR1995": 4, "MAY1995": 5, "JUN1995": 4, "JUL1995": 4, "AUG1995": 5, "SEP1995": 4, "OCT1995": 4, "NOV1995": 5, "DEC1995": 4, "JAN1996": 5, "EB1996": 4, "MAR1996": 4, "APR1996": 4, "MAY1996": 5, "JUN1996": 4, "JUL1996": 5, "AUG1996": 4, "SEP1996": 4, "OCT1996": 5, "NOV1996": 4, "DEC1996": 4, "JAN1997": 5, "EB1997": 4, "MAR1997": 4, "APR1997": 5, "MAY1997": 4, "JUN1997": 4, "JUL1997": 5, "AUG1997": 4, "SEP1997": 4, "OCT1997": 5, "NOV1997": 4, "DEC1997": 5, "JAN1998": 4, "EB1998": 4, "MAR1998": 4, "APR1998": 5, "MAY1998": 4, "JUN1998": 4, "JUL1998": 5, "AUG1998": 4, "SEP1998": 5, "OCT1998": 4, "NOV1998": 4, "DEC1998": 5, "JAN1999": 4, "EB1999": 4, "MAR1999": 5, "APR1999": 4, "MAY1999": 4, "JUN1999": 5, "JUL1999": 4, "AUG1999": 4, "SEP1999": 5, "OCT1999": 4, "NOV1999": 4, "DEC1999": 5, "JAN2000": 4, "EB2000": 4, "MAR2000": 5, "APR2000": 4, "MAY2000": 5, "JUN2000": 4, "JUL2000": 4, "AUG2000": 5, "SEP2000": 4, "OCT2000": 4, "NOV2000": 5, "DEC2000": 4, "JAN2001": 5, "EB2001": 4, "MAR2001": 4, "APR2001": 4, "MAY2001": 5, "JUN2001": 4, "JUL2001": 4, "AUG2001": 5, "SEP2001": 4, "OCT2001": 5, "NOV2001": 4, "DEC2001": 4, "JAN2002": 5, "EB2002": 4, "MAR2002": 4, "APR2002": 4, "MAY2002": 5, "JUN2002": 4, "JUL2002": 5, "AUG2002": 4, "SEP2002": 4, "OCT2002": 5, "NOV2002": 4, "DEC2002": 4, "JAN2003": 5, "EB2003": 4, "MAR2003": 4, "APR2003": 5, "MAY2003": 4, "JUN2003": 4, "JUL2003": 5, "AUG2003": 4, "SEP2003": 4, "OCT2003": 5, "NOV2003": 4, "DEC2003": 5, "JAN2004": 4, "EB2004": 4, "MAR2004": 5, "APR2004": 4, "MAY2004": 4, "JUN2004": 5, "JUL2004": 4, "AUG2004": 4, "SEP2004": 5, "OCT2004": 4, "NOV2004": 4, "DEC2004": 5, "JAN2005": 4, "EB2005": 4, "MAR2005": 5, "APR2005": 4, "MAY2005": 4, "JUN2005": 5, "JUL2005": 4, "AUG2005": 5, "SEP2005": 4, "OCT2005": 4, "NOV2005": 5, "DEC2005": 4, "JAN2006": 4, "EB2006": 4, "MAR2006": 5, "APR2006": 4, "MAY2006": 5, "JUN2006": 4, "JUL2006": 4, "AUG2006": 5, "SEP2006": 4, "OCT2006": 4, "NOV2006": 5, "DEC2006": 4, "JAN2007": 5, "EB2007": 4, "MAR2007": 4, "APR2007": 4, "MAY2007": 5, "JUN2007": 4, "JUL2007": 4, "AUG2007": 5, "SEP2007": 4, "OCT2007": 5, "NOV2007": 4, "DEC2007": 4, "JAN2008": 5, "EB2008": 4, "MAR2008": 4, "APR2008": 5, "MAY2008": 4, "JUN2008": 4, "JUL2008": 5, "AUG2008": 4, "SEP2008": 4, "OCT2008": 5, "NOV2008": 4, "DEC2008": 5, "JAN2009": 4, "EB2009": 4, "MAR2009": 4, "APR2009": 5, "MAY2009": 4, "JUN2009": 4, "JUL2009": 5, "AUG2009": 4, "SEP2009": 5, "OCT2009": 4, "NOV2009": 4, "DEC2009": 5, "JAN2010": 4, "EB2010": 4, "MAR2010": 5, "APR2010": 4, "MAY2010": 4, "JUN2010": 5, "JUL2010": 4, "AUG2010": 4, "SEP2010": 5, "OCT2010": 4, "NOV2010": 4, "DEC2010": 5, "JAN2011": 4, "EB2011": 4, "MAR2011": 5, "APR2011": 4, "MAY2011": 4, "JUN2011": 5, "JUL2011": 4, "AUG2011": 5, "SEP2011": 4, "OCT2011": 4, "NOV2011": 5, "DEC2011": 4, "JAN2012": 4, "EB2012": 5, "MAR2012": 4, "APR2012": 4, "MAY2012": 5, "JUN2012": 4, "JUL2012": 4, "AUG2012": 5, "SEP2012": 4, "OCT2012": 5, "NOV2012": 4, "DEC2012": 4, "JAN2013": 5, "EB2013": 4, "MAR2013": 4, "APR2013": 4, "MAY2013": 5, "JUN2013": 4, "JUL2013": 5, "AUG2013": 4, "SEP2013": 4, "OCT2013": 5, "NOV2013": 4, "DEC2013": 4, "JAN2014": 5, "EB2014": 4, "MAR2014": 4, "APR2014": 5, "MAY2014": 4, "JUN2014": 4, "JUL2014": 5, "AUG2014": 4, "SEP2014": 4, "OCT2014": 5, "NOV2014": 4, "DEC2014": 5, "JAN2015": 4, "EB2015": 4 }, "Forth": { "Copyright": 9, "-": 995, "Lars": 9, "Brinkhoff": 9, "Assembler": 1, "for": 2, "x86.": 1, "Adds": 1, "to": 5, "FORTH": 1, "vocabulary": 3, "ASSEMBLER": 2, "CODE": 3, ";": 245, "CODE.": 2, "Creates": 1, "with": 4, "END": 1, "and": 14, "x86": 1, "opcodes.": 1, "Conventional": 1, "prefix": 1, "syntax": 2, ".": 10, "Addressing": 2, "modes": 2, "immediate": 105, "direct": 2, "n": 40, "register": 2, "": 1, "indirect": 4, "displacement": 1, "indexed": 2, "not": 3, "supported": 1, "yet": 1, "require": 2, "lib/common.fth": 1, "search.fth": 1, "assembler": 6, "also": 2, "definitions": 2, "Access": 1, "the": 9, "target": 1, "image.": 1, "cell": 7, "defer": 3, "is": 11, "]": 56, "nop": 3, "mrrm": 16, "mod": 1, "c0": 1, "bits": 9, "reg@": 1, "@bits": 2, "reg": 24, "rm@": 4, "rm": 10, "lshift": 4, "opcode": 17, "@": 52, "dup": 36, "rshift": 5, "Write": 1, "parts": 1, "of": 4, "instruction": 3, "memory.": 1, "ds": 12, "d": 7, "s": 20, "+": 52, "twobyte": 2, "FF": 5, "if": 26, "c": 20, "then": 19, "sib": 5, "imm8": 6, "imm": 13, "imm16": 2, "h": 1, "imm32": 2, "disp8": 2, "disp": 5, "disp32": 2, "Set": 2, "operand": 1, "size.": 1, "opsize": 6, "drop": 20, "r": 43, "[": 56, "op32": 2, "SIB": 1, "byte.": 1, "Implements": 2, "addressing": 1, "direct.": 1, "reg1": 1, "reg2": 2, "off": 5, "alu#": 9, "sign": 1, "extend": 1, "mov#": 2, "B0": 1, "push#": 2, "test#": 2, "F6": 1, "op": 53, "Process": 1, "one": 1, "operand.": 1, "All": 1, "operands": 1, "except": 1, "a": 7, "address": 1, "have": 2, "stack": 4, "picture": 1, "(": 245, "n*x": 1, "xt": 1, "addr": 45, ")": 240, "<": 25, "else": 23, "execute": 6, "Define": 1, "formats.": 2, "asm": 2, "mnemonic": 1, "u": 6, "create": 8, "latestxt": 1, "body": 2, "Instruction": 2, "format": 8, "relative": 1, "op8": 2, "mnemonics.": 1, "add": 1, "or": 3, "cmove": 6, "Todo": 1, "other": 1, "condition": 1, "codes.": 1, "B6": 1, "movzx": 1, "BE": 1, "movsx": 1, "adc": 1, "sbb": 1, "es": 1, "sub": 1, "E": 2, "cs": 5, "xor": 1, "ss": 1, "cmp": 1, "push": 2, "pop": 2, "fs": 1, "gs": 1, "jcc": 1, "test": 2, "xchg": 1, "mov": 3, "D": 1, "lea": 1, "/0": 1, "C3": 1, "ret": 1, "C6/0": 1, "r/m": 2, "C7/0": 1, "CD": 1, "int": 1, "E8": 1, "call": 2, "E9": 1, "jmp": 3, "EB": 1, "rel8": 1, "F0": 1, "lock": 1, "F2": 1, "rep": 1, "F3": 1, "repz": 1, "F4": 1, "hlt": 1, "F5": 1, "cmc": 1, "F610": 1, "F618": 1, "neg": 1, "F8": 1, "clc": 1, "F9": 1, "stc": 1, "FA": 1, "cli": 1, "FB": 1, "sti": 1, "FC": 1, "cld": 1, "FD": 1, "std": 1, "FE": 1, "inc": 1, "dec": 1, "sp": 2, "mode": 1, "displaced": 1, "indirect.": 1, "#": 1, "idx": 1, "idx#": 1, "reg16": 2, "does": 26, "reg8": 1, "reg32": 1, "Register": 1, "names.": 1, "al": 1, "ax": 1, "eax": 1, "cl": 1, "cx": 1, "ecx": 1, "dl": 1, "dx": 1, "edx": 1, "bl": 18, "bx": 1, "ebx": 1, "ah": 1, "esp": 1, "ch": 1, "bp": 1, "ebp": 1, "dh": 1, "si": 1, "esi": 1, "bh": 1, "di": 1, "edi": 1, "Runtime": 1, "defined": 3, "elsewhere.": 1, "code": 17, "base": 1, "only": 1, "forth": 4, "Standard": 1, "entry": 1, "points.": 1, "parse": 18, "name": 2, "header": 1, "start": 2, "postpone": 69, "reveal": 3, "csp": 1, "previous": 1, "Bit": 1, "arrays.": 1, "u1": 1, "u2": 1, "bitmap": 1, "here": 39, "over": 21, "erase": 1, "allot": 7, "x": 25, "rot": 6, "bit@": 1, "f": 2, "swap": 44, "c@": 13, "bit": 5, "invert": 3, "Block": 2, "words.": 10, "variable": 3, "blk": 3, "current": 5, "block": 8, "buffer": 2, "evaluate": 1, "extended": 3, "semantics": 3, "flush": 1, "load": 2, "...": 12, "save": 2, "input": 2, "in": 10, "source": 17, "#source": 2, "interpret": 1, "restore": 1, "buffers": 2, "update": 1, "extension": 6, "empty": 2, "scr": 2, "list": 1, "bounds": 1, "do": 2, "i": 5, "emit": 3, "loop": 4, "refill": 6, "thru": 1, "y": 5, "*": 12, "Kernel": 5, "#tib": 2, "TODO": 19, ".r": 1, "char": 43, "type": 8, "flag": 8, "x1": 5, "x2": 5, "R": 17, "r@": 6, "noname": 1, "align": 6, "lastxt": 16, "SP": 1, "query": 1, "tib": 1, "true": 1, "tuck": 3, "u.r": 1, "false": 1, "unused": 1, "value": 1, "within": 1, "compile": 6, "Forth2012": 3, "core": 1, "action": 1, "negate": 5, "nip": 7, "word": 35, "ahead": 10, "resolve": 20, "literal": 20, "nonimmediate": 5, "caddr": 5, "C": 45, "find": 7, "cells": 5, "postponers": 5, "unresolved": 20, "orig": 25, "chars": 5, "n1": 6, "n2": 6, "orig1": 5, "orig2": 5, "branch": 25, "dodoes_code": 5, "begin": 11, "dest": 25, "while": 10, "repeat": 10, "until": 5, "recurse": 5, "pad": 15, "If": 5, "necessary": 5, "keep": 5, "parsing.": 5, "string": 15, "state": 7, "cr": 12, "abort": 15, "": 5, "Undefined": 5, "ok": 5, "ENUM.": 1, "Double": 1, "DOES": 1, "enum": 2, "But": 1, "this": 1, "simpler.": 1, "constant": 1, "HELLO": 4, "KataDiversion": 1, "Forth": 1, "utils": 1, "EMPTY": 1, "DEPTH": 2, "IF": 10, "BEGIN": 3, "DROP": 5, "UNTIL": 3, "THEN": 10, "power": 2, "**": 2, "n1_pow_n2": 1, "SWAP": 8, "DUP": 14, "DO": 2, "OVER": 2, "LOOP": 2, "NIP": 4, "compute": 1, "highest": 1, "below": 1, "N.": 1, "e.g.": 2, "MAXPOW2": 2, "log2_n": 1, "ABORT": 1, "ELSE": 7, "|": 4, "I": 5, "i*2": 1, "/": 3, "kata": 1, "given": 3, "N": 6, "has": 1, "two": 2, "adjacent": 2, "NOT": 3, "TWO": 3, "ADJACENT": 3, "BITS": 3, "bool": 1, "uses": 1, "following": 1, "algorithm": 1, "return": 5, "A": 5, "X": 5, "LOG2": 1, "end": 1, "OR": 1, "INVERT": 1, "maximum": 1, "number": 4, "which": 3, "can": 2, "be": 2, "made": 2, "MAX": 2, "NB": 3, "m": 2, "**n": 1, "numbers": 1, "less": 1, "bits.": 1, "see": 1, "http": 1, "//www.codekata.com/2007/01/code_kata_fifte.html": 1, "HOW": 1, "MANY": 1, "Simplifies": 1, "compiling": 1, "Usage": 1, "foo": 2, "bar": 1, "Tools": 4, ".s": 2, "depth": 2, "traverse": 2, "dictionary": 2, "kernel": 2, "bye": 2, "pick": 2, "roll": 2, "editor": 2, "forget": 2, "tools": 2, "nr": 2, "synonym": 2, "undefined": 4, "/cell": 4 }, "FreeMarker": { "<#import>": 1, "layout": 2, "ftl": 1, "as": 2, "<#assign>": 1, "results": 3, "title": 3, "Example": 1, "Result": 1, "description": 1, "Lorem": 1, "ipsum": 1, "dolor": 1, "sit": 1, "amet": 1, "pede": 1, "id": 1, "pellentesque": 1, "sollicitudin": 1, "turpis": 1, "sed": 3, "in": 1, "libero": 1, "dictum": 1, "<@layout.page>": 1, "title=": 1, "<#if>": 1, "size": 1, "0": 1, "There": 1, "were": 1, "no": 1, "results.": 1, "<#else>": 1, "
    ": 1, "<#list>": 1, "result": 1, "
  • ": 1, "": 1, "{": 5, "result.title": 1, "}": 5, "": 1, "

    ": 2, "result.description": 1, "

    ": 2, "
  • ": 1, "": 1, "
": 1, "": 1, "<#-->": 1, "This": 2, "is": 2, "a": 1, "FreeMarker": 2, "comment": 1, "<@currentTime>": 1, "": 1, "<#macro>": 4, "currentTime": 1, ".now": 1, "string.full": 1, "": 4, "<#ftl>": 1, "strip_text=": 1, "page": 2, "": 1, "html": 1, "": 1, "lang=": 1, "": 1, "": 1, "": 1, "<@metaTags>": 1, "": 1, "": 1, "<#nested>": 1, "<@footer>": 1, "": 1, "": 1, "<#--->": 1, "Default": 1, "meta": 1, "tags": 1, "metaTags": 1, "<#compress>": 1, "": 4, "charset=": 1, "http": 1, "equiv=": 1, "content=": 3, "name=": 2, "": 1, "footer": 1, "using": 1, "v": 1, ".version": 1 }, "Frege": { "module": 2, "examples.CommandLineClock": 1, "where": 38, "data": 3, "Date": 5, "native": 4, "java.util.Date": 1, "new": 8, "(": 293, ")": 300, "-": 288, "IO": 13, "MutableIO": 1, "toString": 2, "Mutable": 1, "s": 21, "ST": 1, "String": 9, "d.toString": 1, "action": 2, "to": 8, "give": 1, "us": 1, "the": 15, "current": 4, "time": 1, "as": 30, "do": 36, "d": 3, "<->": 29, "java": 5, "lang": 2, "Thread": 2, "sleep": 4, "takes": 1, "a": 84, "long": 4, "and": 10, "returns": 1, "nothing": 1, "but": 1, "may": 1, "throw": 1, "an": 3, "InterruptedException": 4, "This": 1, "is": 18, "without": 1, "doubt": 1, "public": 1, "static": 1, "void": 2, "millis": 1, "throws": 4, "Encoded": 1, "in": 11, "Frege": 1, "argument": 1, "type": 8, "Long": 3, "result": 11, "does": 1, "defined": 1, "frege": 1, "Lang": 1, "main": 11, "args": 2, "forever": 1, "print": 6, "stdout.flush": 1, "Thread.sleep": 4, "examples.Concurrent": 1, "import": 7, "System.Random": 1, "Java.Net": 1, "URL": 2, "Control.Concurrent": 1, "C": 5, "main2": 1, "m": 2, "<": 81, "newEmptyMVar": 1, "forkIO": 11, "m.put": 3, "replicateM_": 3, "c": 30, "m.take": 1, "println": 22, "example1": 1, "putChar": 2, "example2": 2, "getLine": 2, "case": 6, "of": 21, "Right": 6, "n": 33, "setReminder": 3, "Left": 4, "_": 47, "+": 191, "show": 21, "*n": 1, "table": 1, "mainPhil": 2, "[": 104, "fork1": 3, "fork2": 3, "fork3": 3, "fork4": 3, "fork5": 3, "]": 101, "mapM": 3, "MVar": 3, "1": 2, "5": 1, "philosopher": 7, "Kant": 1, "Locke": 1, "Wittgenstein": 1, "Nozick": 1, "Mises": 1, "return": 14, "Int": 6, "me": 13, "left": 3, "right": 3, "g": 4, "Random.newStdGen": 1, "let": 8, "phil": 4, "tT": 2, "g1": 2, "Random.randomR": 2, "eT": 2, "g2": 3, "thinkTime": 3, "*": 5, "eatTime": 3, "fl": 4, "left.take": 1, "rFork": 2, "poll": 1, "Just": 2, "fr": 3, "right.put": 1, "left.put": 2, "table.notifyAll": 2, "Nothing": 2, "table.wait": 1, "inter": 3, "catch": 2, "getURL": 4, "xx": 2, "url": 1, "URL.new": 1, "con": 3, "url.openConnection": 1, "con.connect": 1, "con.getInputStream": 1, "typ": 4, "con.getContentType": 1, "ir": 2, "InputStreamReader.new": 2, "fromMaybe": 1, "charset": 2, "unsupportedEncoding": 3, "br": 4, "BufferedReader": 1, "getLines": 1, "InputStream": 1, "UnsupportedEncodingException": 1, "InputStreamReader": 1, "x": 41, "stderr.println": 2, "x.catched": 1, "ctyp": 2, "charset=": 1, "m.group": 1, "SomeException": 2, "Throwable": 1, "m1": 1, "MVar.newEmpty": 3, "m2": 1, "m3": 2, "r": 7, "catchAll": 3, ".": 40, "m1.put": 1, "m2.put": 1, "m3.put": 1, "r1": 2, "m1.take": 1, "r2": 2, "m2.take": 1, "r3": 3, "take": 13, "ss": 8, "mapM_": 4, "putStrLn": 1, "|": 55, "x.getClass.getName": 1, "y": 15, "sum": 2, "map": 48, "length": 17, "package": 2, "examples.Sudoku": 1, "Data.TreeMap": 1, "Tree": 4, "keys": 2, "Data.List": 1, "DL": 1, "hiding": 1, "find": 13, "union": 10, "Element": 6, "Zelle": 8, "set": 3, "candidates": 13, "Position": 21, "Feld": 3, "Brett": 13, "for": 15, "assumptions": 7, "conclusions": 2, "Assumption": 17, "ISNOT": 13, "IS": 15, "derive": 2, "Eq": 1, "Ord": 1, "instance": 1, "Show": 1, "p": 67, "e": 13, "pname": 7, "e.show": 2, "showcs": 5, "cs": 27, "joined": 4, "Assumption.show": 1, "elements": 11, "all": 17, "possible": 2, "..": 1, "positions": 16, "rowstarts": 4, "row": 19, "starting": 3, "colstarts": 3, "column": 2, "boxstarts": 3, "box": 14, "boxmuster": 3, "pattern": 1, "by": 2, "adding": 1, "upper": 1, "position": 9, "results": 1, "real": 1, "extract": 2, "field": 5, "getf": 16, "f": 19, "fs": 22, "fst": 9, "otherwise": 8, "cell": 22, "getc": 12, "b": 100, "snd": 19, "compute": 4, "list": 5, "that": 8, "belong": 3, "same": 6, "given": 3, "z..": 1, "z": 11, "quot": 1, "col": 16, "mod": 3, "ri": 2, "div": 3, "or": 8, "depending": 1, "on": 2, "ci": 2, "index": 3, "middle": 2, "check": 1, "if": 4, "candidate": 6, "has": 2, "exactly": 1, "one": 2, "member": 1, "i.e.": 1, "been": 1, "solved": 1, "single": 8, "Bool": 2, "true": 14, "false": 11, "unsolved": 10, "allrows": 8, "allcols": 5, "allboxs": 5, "allrcb": 5, "zip": 7, "repeat": 3, "containers": 5, "packed": 1, "chr": 2, "ord": 6, "printb": 3, "p1line": 2, "pfld": 4, "line": 2, "zs": 1, "msg": 5, "res012": 2, "concatMap": 1, "a*100": 1, "b*10": 1, "turnoff1": 3, "i": 13, "off": 9, "nc": 5, "newb": 7, "filter": 25, "notElem": 7, "turnoff": 11, "turnoffh": 1, "ps": 7, "foldM": 2, "toh": 2, "setto": 3, "cname": 3, "nf": 2, "reduce": 2, "sss": 3, "each": 1, "with": 14, "more": 2, "than": 2, "rcb": 16, "elem": 16, "collect": 1, "remove": 1, "from": 5, "hiddenSingle": 2, "select": 1, "number": 2, "containername": 1, "FOR": 9, "IN": 7, "occurs": 5, "nakedPair": 2, "t": 14, "nm": 6, "SELECT": 3, "pos": 5, "tuple": 2, "name": 2, "fields": 5, "u": 6, "fold": 6, "non": 2, "outof": 6, "tuples": 2, "hit": 7, "subset": 3, "any": 3, "hiddenPair": 2, "minus": 2, "uniq": 4, "sort": 4, "common": 3, "bs": 7, "undefined": 1, "cannot": 1, "happen": 1, "because": 1, "either": 1, "empty": 2, "not": 2, "intersectionlist": 2, "intersections": 2, "reason": 8, "reson": 1, "container": 6, "cpos": 7, "WHERE": 2, "head": 16, "tail": 2, "are": 1, "intersection": 1, "look": 3, "XY": 2, "Wing": 1, "there": 6, "exists": 6, "A": 6, "X": 4, "Y": 4, "B": 4, "Z": 5, "shares": 2, "reasoning": 1, "will": 4, "be": 5, "since": 1, "indeed": 1, "xyWing": 2, "board": 36, "rcba": 4, "share": 1, "b1": 11, "b2": 10, "&&": 9, "||": 2, "then": 1, "else": 1, "c1": 3, "c2": 3, "fish": 5, "fishname": 5, "rset": 4, "rows": 1, "cols": 5, "certain": 1, "rflds": 2, "rowset": 1, "colss": 3, "must": 2, "appear": 1, "at": 2, "least": 2, "cstart": 2, "conseq": 3, "cp": 3, "contradicts": 7, "aPos": 5, "toClear": 7, "chain": 2, "paths": 10, "solution": 6, "reverse": 4, "css": 7, "chainContra": 2, "pro": 7, "contra": 4, "ALL": 2, "conlusions": 1, "uniqBy": 2, "using": 2, "sortBy": 2, "comparing": 2, "conslusion": 1, "chains": 3, "LET": 1, "BE": 1, "final": 2, "conclusion": 4, "THE": 1, "FIRST": 1, "cellRegionChain": 2, "os": 3, "cellas": 2, "regionas": 2, "iss": 3, "implications": 3, "ass": 2, "first": 2, "assumption": 4, "candidates@": 1, "region": 2, "oss": 2, "Liste": 1, "aller": 1, "Annahmen": 1, "ein": 1, "bestimmtes": 1, "consequences": 5, "acstree": 3, "Tree.fromList": 1, "lookup": 1, "error": 1, "no": 1, "performance": 1, "resons": 1, "we": 1, "confine": 1, "ourselves": 1, "implication": 1, "20": 1, "per": 1, "mkPaths": 3, "acst": 3, "impl": 2, "{": 1, "a1": 1, "a2": 1, "a3": 1, "impls": 2, "ns": 2, "concat": 1, "takeUntil": 1, "null": 1, "iterate": 1, "expandchain": 2, "avoid": 1, "loops": 1, "solve": 13, "res@": 10, "apply": 11, "res": 10, "smallest": 1, "sets": 1, "HIDDEN": 2, "SINGLES": 1, "locked": 1, "2": 3, "NAKED": 1, "PAIRS": 2, "TRIPLES": 2, "QUADRUPELS": 2, "WINGS": 1, "FISH": 1, "9": 5, "forcing": 1, "allow": 1, "infer": 1, "both": 1, "brd": 2, "turn": 1, "string": 3, "into": 1, "mkrow": 2, "mkrow1": 2, "xs": 4, "make": 1, "sure": 1, "unpacked": 2, "<=>": 1, "0": 2, "ignored": 1, "h": 1, "help": 1, "stderr": 1, "usage": 1, "Sudoku": 2, "file": 4, "81": 3, "char": 1, "consisting": 1, "digits": 2, "One": 1, "can": 1, "get": 1, "such": 1, "going": 1, "http": 1, "www": 1, "sudokuoftheday": 1, "com": 1, "pages": 1, "o": 1, "php": 1, "click": 1, "puzzle": 1, "open": 1, "it": 1, "tab": 1, "Copy": 1, "address": 1, "your": 1, "browser": 1, "There": 1, "also": 1, "hard": 1, "sudokus": 1, "examples": 1, "top95": 1, "txt": 1, "W": 1, "felder": 2, "decode": 4, "files": 2, "forM_": 1, "sudoku": 2, "openReader": 1, "lines": 2, "BufferedReader.getLines": 1, "process": 5, "candi": 2, "consider": 3, "acht": 4, "neun": 2, "examples.SwingExamples": 1, "Java.Awt": 1, "ActionListener": 2, "Java.Swing": 1, "rs": 2, "Runnable.new": 1, "helloWorldGUI": 2, "buttonDemoGUI": 2, "celsiusConverterGUI": 2, "invokeLater": 1, "tempTextField": 2, "JTextField.new": 1, "celsiusLabel": 1, "JLabel.new": 3, "convertButton": 1, "JButton.new": 3, "fahrenheitLabel": 1, "frame": 3, "JFrame.new": 3, "frame.setDefaultCloseOperation": 3, "JFrame.dispose_on_close": 3, "frame.setTitle": 1, "celsiusLabel.setText": 1, "convertButton.setText": 1, "convertButtonActionPerformed": 2, "celsius": 3, "getText": 1, "double": 1, "fahrenheitLabel.setText": 3, "c*1.8": 1, ".long": 1, "ActionListener.new": 2, "convertButton.addActionListener": 1, "contentPane": 2, "frame.getContentPane": 2, "layout": 2, "GroupLayout.new": 1, "contentPane.setLayout": 1, "frame.pack": 3, "frame.setVisible": 3, "label": 2, "cp.add": 1, "newContentPane": 2, "JPanel.new": 1, "JButton": 4, "b1.setVerticalTextPosition": 1, "SwingConstants.center": 2, "b1.setHorizontalTextPosition": 1, "SwingConstants.leading": 2, "b2.setVerticalTextPosition": 1, "b2.setHorizontalTextPosition": 1, "b3": 7, "Enable": 1, "button": 1, "setVerticalTextPosition": 1, "SwingConstants": 2, "center": 1, "setHorizontalTextPosition": 1, "leading": 1, "setEnabled": 7, "action1": 2, "action3": 2, "b1.addActionListener": 1, "b3.addActionListener": 1, "newContentPane.add": 3, "newContentPane.setOpaque": 1, "frame.setContentPane": 1 }, "G-code": { ";": 8, "RepRapPro": 1, "Ormerod": 1, "Board": 1, "test": 1, "GCodes": 1, "M111": 1, "S1": 1, "Debug": 1, "on": 1, "G21": 1, "mm": 1, "G90": 1, "Absolute": 1, "positioning": 1, "M83": 1, "Extrusion": 1, "relative": 1, "M906": 1, "X800": 1, "Y800": 1, "Z800": 1, "E800": 1, "Motor": 1, "currents": 1, "(": 1, "mA": 1, ")": 1, "T0": 2, "Extruder": 1, "G1": 17, "X50": 1, "F500": 2, "X0": 2, "G4": 18, "P500": 6, "Y50": 1, "Y0": 2, "Z20": 1, "F200": 2, "Z0": 1, "E20": 1, "E": 1, "-": 1, "M106": 2, "S255": 1, "S0": 1, "M105": 13, "G10": 1, "P0": 1, "S100": 2, "M140": 1, "P5000": 12, "M0": 2, "G28": 1, "X55": 3, "Y5": 3, "F2000": 1, "Y180": 2, "X180": 2 }, "GAMS": { "*Basic": 1, "example": 2, "of": 7, "transport": 5, "model": 6, "from": 2, "GAMS": 5, "library": 3, "Title": 1, "A": 3, "Transportation": 1, "Problem": 1, "(": 22, "TRNSPORT": 1, "SEQ": 1, ")": 22, "Ontext": 1, "This": 2, "problem": 1, "finds": 1, "a": 3, "least": 1, "cost": 4, "shipping": 1, "schedule": 1, "that": 1, "meets": 1, "requirements": 1, "at": 5, "markets": 2, "and": 2, "supplies": 1, "factories.": 1, "Dantzig": 1, "G": 1, "B": 1, "Chapter": 2, "In": 2, "Linear": 1, "Programming": 1, "Extensions.": 1, "Princeton": 2, "University": 1, "Press": 2, "New": 1, "Jersey": 1, "formulation": 1, "is": 1, "described": 1, "in": 10, "detail": 1, "Rosenthal": 1, "R": 1, "E": 1, "Tutorial.": 1, "User": 1, "s": 1, "Guide.": 1, "The": 2, "Scientific": 1, "Redwood": 1, "City": 1, "California": 1, "line": 1, "numbers": 1, "will": 1, "not": 1, "match": 1, "those": 1, "the": 1, "book": 1, "because": 1, "these": 1, "comments.": 1, "Offtext": 1, "Sets": 1, "i": 18, "canning": 1, "plants": 1, "/": 9, "seattle": 3, "san": 3, "-": 6, "diego": 3, "j": 18, "new": 3, "york": 3, "chicago": 3, "topeka": 3, ";": 15, "Parameters": 1, "capacity": 1, "plant": 2, "cases": 3, "b": 2, "demand": 4, "market": 2, "Table": 1, "d": 2, "distance": 1, "thousands": 3, "miles": 2, "Scalar": 1, "f": 2, "freight": 1, "dollars": 3, "per": 3, "case": 2, "thousand": 1, "/90/": 1, "Parameter": 1, "c": 3, "*": 1, "Variables": 1, "x": 4, "shipment": 1, "quantities": 1, "z": 3, "total": 1, "transportation": 1, "costs": 1, "Positive": 1, "Variable": 1, "Equations": 1, "define": 1, "objective": 1, "function": 1, "supply": 3, "observe": 1, "limit": 1, "satisfy": 1, "..": 3, "e": 1, "sum": 3, "*x": 1, "l": 1, "g": 1, "Model": 1, "/all/": 1, "Solve": 1, "using": 1, "lp": 1, "minimizing": 1, "Display": 1, "x.l": 1, "x.m": 1, "ontext": 1, "#user": 1, "stuff": 1, "Main": 1, "topic": 1, "Basic": 2, "Featured": 4, "item": 4, "Trnsport": 1, "Description": 1, "offtext": 1 }, "GAP": { "gap": 133, "START_TEST": 2, "(": 794, ")": 794, ";": 649, "#": 100, "The": 32, "following": 8, "used": 19, "to": 47, "trigger": 9, "an": 24, "error": 8, "starting": 1, "with": 54, "K": 16, "AbelianPcpGroup": 3, "[": 232, "]": 256, "A": 17, "Subgroup": 11, "K.1": 5, "cr": 2, "CRRecordBySubgroup": 1, "ExtensionsCR": 1, "hom1": 3, "GroupHomomorphismByImages": 4, "hom2": 3, "true": 28, "IdentityMapping": 2, "incorrectly": 1, "triggered": 1, "at": 1, "some": 3, "point": 1, "IsTorsionFree": 1, "ExamplesOfSomePcpGroups": 2, "Verify": 1, "IsGeneratorsOfMagmaWithInverses": 2, "warnings": 1, "are": 15, "silenced": 1, "GeneratorsOfGroup": 1, "Check": 6, "for": 61, "a": 117, "bug": 6, "reported": 2, "-": 137, "by": 21, "Robert": 2, "Morse": 2, "g": 3, "PcGroupToPcpGroup": 2, "SmallGroup": 2, "Pcp": 28, "group": 32, "orders": 28, "next": 11, "two": 15, "commands": 1, "errors": 1, "NonAbelianTensorSquare": 2, "Centre": 2, "NonAbelianExteriorSquare": 1, "F": 62, "FreeGroup": 1, "": 1, "on": 7, "the": 142, "generators": 18, "x": 19, "y": 14, "F.1": 1, "F.2": 1, "G": 24, "F/": 1, "/y": 1, "x/y": 1, "": 1, "iso": 2, "IsomorphismPcGroup": 1, "f1": 2, "f2*f5": 1, "iso1": 1, "IsomorphismPcpGroup": 1, "Image": 3, "f2": 1, "f3": 1, "f4": 1, "f5": 1, "g1": 2, "g2": 1, "g3": 1, "g4": 1, "g5": 2, "iso*iso1": 2, "command": 4, "problem": 2, "previous": 1, "example": 5, "is/was": 1, "that": 42, "Igs": 3, "is": 74, "set": 7, "non": 6, "standard": 1, "value": 10, "g2*g5": 1, "g3*g4*g5": 1, "g4*g5": 1, "Unfortunately": 1, "it": 9, "seems": 2, "lot": 1, "of": 120, "code": 3, "really": 5, "should": 3, "be": 25, "using": 4, "Ngs": 1, "or": 14, "Cgs": 1, "incorrectly.": 1, "For": 11, "direct": 1, "products": 1, "could": 1, "return": 42, "*invalid*": 1, "embeddings": 1, "D": 39, "DirectProduct": 1, "hom": 8, "Embedding": 1, "mapi": 6, "MappingGeneratorsImages": 2, "Source": 3, "Range": 3, "<": 19, "fail": 20, "Projection": 1, "computing": 4, "Schur": 3, "extension": 4, "infinite": 2, "cyclic": 1, "groups": 2, "found": 5, "Max": 3, "Horn": 3, "SchurExtension": 3, "extensions": 3, "subgroups": 3, "MH": 3, "HeisenbergPcpGroup": 4, "H": 6, "G.2": 4, "*G.3": 1, "G.1": 4, "normalizer": 1, "was": 3, "caused": 1, "incorrect": 1, "resp.": 1, "overly": 1, "restrictive": 1, "use": 6, "Parent": 5, ".": 258, "G.3": 4, "G.4": 6, "G.5": 4, "B": 22, "Normalizer": 4, "In": 4, "polycyclic": 1, "and": 103, "cohomology": 1, "computations": 1, "broken.": 1, "UnitriangularPcpGroup": 1, "mats": 7, ".mats": 1, "C": 13, "CRRecordByMats": 1, "cc": 1, "TwoCohomologyCR": 1, "cc.factor.rels": 1, "c": 1, "cc.factor.prei": 1, "cc.gcb": 1, "cc.gcc": 1, "LowerCentralSeriesOfGroup": 2, "nilpotent": 1, "pcp": 1, "recursion": 2, "STOP_TEST": 2, "#############################################################################": 63, "##": 766, "#W": 4, "example.gd": 2, "This": 10, "file": 7, "contains": 7, "sample": 2, "GAP": 15, "declaration": 1, "file.": 3, "DeclareProperty": 2, "IsLeftModule": 6, "DeclareGlobalFunction": 5, "#C": 7, "IsQuuxFrobnicator": 1, "": 3, "": 28, "": 7, "Name=": 33, "Arg=": 33, "Type=": 7, "": 28, "Tests": 1, "whether": 5, "R": 5, "quux": 1, "frobnicator.": 1, "": 28, "": 28, "DeclareSynonym": 17, "IsField": 1, "IsGroup": 1, "implementation": 1, "#M": 20, "SomeOperation": 1, "": 2, "performs": 1, "operation": 1, "InstallMethod": 18, "SomeProperty": 1, "function": 37, "M": 7, "if": 103, "IsFreeLeftModule": 3, "not": 49, "IsTrivial": 1, "then": 128, "fi": 91, "TryNextMethod": 7, "end": 34, "#F": 17, "SomeGlobalFunction": 2, "global": 1, "variadic": 1, "funfion.": 1, "InstallGlobalFunction": 5, "arg": 16, "Length": 13, "+": 9, "*": 12, "elif": 21, "else": 25, "Error": 7, "SomeFunc": 1, "local": 16, "z": 3, "func": 3, "tmp": 20, "j": 3, "mod": 2, "List": 6, "while": 5, "do": 18, "in": 64, "Print": 24, "od": 15, "repeat": 1, "until": 1, "G/H": 1, "NaturalHomomorphism": 1, "Magic.gd": 1, "AutoDoc": 4, "package": 10, "Copyright": 6, "JLU": 2, "Giessen": 2, "Sebastian": 2, "Gutsche": 2, "University": 4, "Kaiserslautern": 2, "SHEBANG#!#! @Description": 1, "SHEBANG#!#! This": 1, "SHEBANG#!#! any": 1, "SHEBANG#!#! ": 1, "SHEBANG#!#! ": 5, "SHEBANG#!#! It": 3, "SHEBANG#!#! That": 1, "SHEBANG#!#! of": 1, "SHEBANG#!#! (with": 1, "SHEBANG#!#! main": 1, "SHEBANG#!#! XML": 1, "SHEBANG#!#! other": 1, "SHEBANG#!#! as": 1, "SHEBANG#!#! to": 2, "SHEBANG#!#! Secondly,": 1, "SHEBANG#!#! page": 1, "SHEBANG#!#! (name,": 1, "SHEBANG#!#! on": 1, "SHEBANG#!Item>": 25, "SHEBANG#!#! tags": 1, "SHEBANG#!#! This": 1, "SHEBANG#!#! produce": 1, "SHEBANG#!#! MathJaX": 1, "SHEBANG#!#! generated": 1, "SHEBANG#!#! this,": 1, "SHEBANG#!#! supplementary": 1, "SHEBANG#!#! (see": 1, "SHEBANG#!Enum>": 1, "SHEBANG#!#! For": 1, "SHEBANG#!>": 11, "SHEBANG#!#! The": 1, "SHEBANG#!#! ": 1, "SHEBANG#!Mark>": 22, "SHEBANG#!#! The": 2, "SHEBANG#!A>": 1, "SHEBANG#!#! ": 1, "SHEBANG#!#! ": 4, "SHEBANG#!#! This": 4, "SHEBANG#!#! Directory()": 1, "SHEBANG#!#! (i.e.": 1, "SHEBANG#!#! Default": 1, "SHEBANG#!#! for": 1, "SHEBANG#!#! The": 3, "SHEBANG#!#! record.": 3, "SHEBANG#!#! equivalent": 3, "SHEBANG#!#! enabled.": 3, "SHEBANG#!#! package's": 1, "SHEBANG#!#! In": 3, "SHEBANG#!K>),": 3, "SHEBANG#!#! If": 3, "####": 34, "TODO": 3, "mention": 1, "merging": 1, "PackageInfo.AutoDoc": 1, "SHEBANG#!#! ": 3, "SHEBANG#!#! ": 13, "SHEBANG#!#! A": 6, "SHEBANG#!#! If": 2, "SHEBANG#!#! your": 1, "SHEBANG#!#! you": 1, "SHEBANG#!#! to": 4, "SHEBANG#!#! is": 1, "SHEBANG#!#! of": 2, "SHEBANG#!#! This": 3, "SHEBANG#!#! i.e.": 1, "SHEBANG#!#! The": 2, "SHEBANG#!#! then": 1, "param": 1, "bit": 2, "strange.": 1, "We": 4, "probably": 2, "change": 1, "more": 3, "general": 1, "as": 23, "one": 11, "might": 1, "want": 1, "define": 2, "other": 4, "entities...": 1, "now": 1, "we": 3, "document": 1, "leave": 1, "us": 1, "choice": 1, "revising": 1, "how": 1, "works.": 1, "": 2, "": 117, "entities": 2, "": 117, "": 2, "": 2, "list": 16, "names": 1, "which": 8, "corresponding": 1, "XML": 4, "entities.": 1, "containing": 1, "string": 6, "": 2, "SomePackage": 3, "": 2, "added": 1, "preamble": 1, "": 2, "CDATA": 2, "ENTITY": 2, "": 2, "allows": 1, "you": 3, "write": 3, "&": 37, "amp": 1, "your": 1, "documentation": 2, "reference": 1, "package.": 2, "If": 11, "another": 1, "type": 2, "entity": 1, "desired": 1, "can": 12, "simply": 2, "add": 2, "instead": 1, "entry": 2, "list.": 2, "It": 1, "will": 5, "handled": 3, "so": 3, "please": 1, "careful.": 1, "": 2, "SHEBANG#!#! for": 1, "SHEBANG#!#! statement": 1, "SHEBANG#!#! components": 2, "SHEBANG#!#! example,": 1, "SHEBANG#!#! acknowledgements": 1, "SHEBANG#!#! ": 6, "SHEBANG#!#! by": 1, "SHEBANG#!#! package": 1, "SHEBANG#!#! Usually": 2, "SHEBANG#!#! are": 2, "SHEBANG#!#! Default": 3, "SHEBANG#!#! When": 1, "SHEBANG#!#! they": 1, "Document": 1, "section_intros": 2, "later": 1, "on.": 1, "However": 2, "note": 2, "thanks": 1, "new": 2, "comment": 1, "syntax": 1, "only": 5, "remaining": 1, "this": 15, "ability": 1, "specify": 3, "order": 1, "chapters": 1, "sections.": 1, "TODO.": 1, "SHEBANG#!#! files": 1, "Note": 3, "strictly": 1, "speaking": 1, "also": 3, "scaffold.": 1, "uses": 2, "scaffolding": 2, "mechanism": 4, "necessary": 2, "custom": 1, "name": 2, "main": 1, "Thus": 3, "purpose": 1, "parameter": 1, "cater": 1, "packages": 5, "have": 3, "existing": 1, "different": 2, "wish": 1, "scaffolding.": 1, "explain": 1, "why": 2, "allow": 1, "specifying": 1, "gapdoc.main.": 1, "still": 1, "honor": 1, "though": 1, "just": 1, "case.": 1, "SHEBANG#!#! In": 1, "maketest": 12, "part.": 1, "Still": 1, "under": 1, "construction.": 1, "SHEBANG#!#! ": 1, "SHEBANG#!#! The": 1, "SHEBANG#!#! a": 1, "SHEBANG#!#! which": 1, "SHEBANG#!#! the": 1, "SHEBANG#!#! ": 1, "SHEBANG#!#! ": 2, "SHEBANG#!#! Sets": 1, "SHEBANG#!#! A": 1, "SHEBANG#!#! will": 1, "SHEBANG#!#! @Returns": 1, "SHEBANG#!#! @Arguments": 1, "SHEBANG#!#! @ChapterInfo": 1, "Magic.gi": 1, "BindGlobal": 7, "str": 8, "suffix": 3, "n": 31, "m": 8, "{": 21, "}": 21, "i": 25, "ength": 1, "d": 16, "IsDirectoryPath": 1, "CreateDir": 2, "currently": 1, "undocumented": 1, "LastSystemError": 1, ".message": 1, "false": 7, "pkg": 32, "subdirs": 2, "d_rel": 6, "files": 4, "result": 9, "DirectoriesPackageLibrary": 2, "IsEmpty": 6, "continue": 3, "Directory": 5, "DirectoryContents": 1, "Sort": 1, "AUTODOC_GetSuffix": 2, "IsReadableFile": 2, "Filename": 8, "Add": 4, "Make": 1, "callable": 1, "package_name": 1, "AutoDocWorksheet.": 1, "Which": 1, "create": 1, "worksheet": 1, "package_info": 3, "opt": 3, "scaffold": 12, "gapdoc": 7, "autodoc": 8, "pkg_dir": 5, "doc_dir": 18, "doc_dir_rel": 3, "title_page": 7, "tree": 8, "is_worksheet": 13, "position_document_class": 7, "gapdoc_latex_option_record": 4, "LowercaseString": 3, "rec": 20, "DirectoryCurrent": 1, "PackageInfo": 1, "key": 3, "val": 4, "ValueOption": 1, "opt.": 1, "IsBound": 39, "opt.dir": 4, "IsString": 7, "IsDirectory": 1, "AUTODOC_CreateDirIfMissing": 1, "opt.scaffold": 5, "package_info.AutoDoc": 3, "IsRecord": 7, "IsBool": 4, "AUTODOC_APPEND_RECORD_WRITEONCE": 3, "AUTODOC_WriteOnce": 10, "opt.autodoc": 5, "Concatenation": 15, "package_info.Dependencies.NeededOtherPackages": 1, "package_info.Dependencies.SuggestedOtherPackages": 1, "ForAny": 1, "autodoc.files": 7, "autodoc.scan_dirs": 5, "autodoc.level": 3, "PushOptions": 1, "level_value": 1, "Append": 2, "AUTODOC_FindMatchingFiles": 2, "opt.gapdoc": 5, "opt.maketest": 4, "gapdoc.main": 8, "package_info.PackageDoc": 3, ".BookName": 2, "gapdoc.bookname": 4, "#Print": 1, "gapdoc.files": 9, "gapdoc.scan_dirs": 3, "Set": 1, "Number": 1, "ListWithIdenticalEntries": 1, "f": 11, "DocumentationTree": 1, "autodoc.section_intros": 2, "AUTODOC_PROCESS_INTRO_STRINGS": 1, "Tree": 2, "AutoDocScanFiles": 1, "PackageName": 2, "scaffold.TitlePage": 4, "scaffold.TitlePage.Title": 2, ".TitlePage.Title": 2, "Position": 2, "Remove": 2, "JoinStringsWithSeparator": 1, "ReplacedString": 2, "Syntax": 1, "scaffold.document_class": 7, "PositionSublist": 5, "GAPDoc2LaTeXProcs.Head": 14, "..": 6, "scaffold.latex_header_file": 2, "StringFile": 2, "scaffold.gapdoc_latex_options": 4, "RecNames": 1, "scaffold.gapdoc_latex_options.": 5, "IsList": 1, "scaffold.includes": 4, "scaffold.bib": 7, "Unbind": 1, "scaffold.main_xml_file": 2, ".TitlePage": 1, "ExtractTitleInfoFromPackageInfo": 1, "CreateTitlePage": 1, "scaffold.MainPage": 2, "scaffold.dir": 1, "scaffold.book_name": 1, "CreateMainPage": 1, "WriteDocumentation": 1, "SetGapDocLaTeXOptions": 1, "MakeGAPDocDoc": 1, "CopyHTMLStyleFiles": 1, "GAPDocManualLab": 1, "maketest.folder": 3, "maketest.scan_dir": 3, "CreateMakeTest": 1, "PackageInfo.g": 2, "cvec": 1, "s": 4, "template": 1, "SetPackageInfo": 1, "Subtitle": 1, "Version": 1, "Date": 1, "dd/mm/yyyy": 1, "format": 2, "Information": 1, "about": 3, "authors": 1, "maintainers.": 1, "Persons": 1, "LastName": 1, "FirstNames": 1, "IsAuthor": 1, "IsMaintainer": 1, "Email": 1, "WWWHome": 1, "PostalAddress": 1, "Place": 1, "Institution": 1, "Status": 2, "information.": 1, "Currently": 1, "cases": 2, "recognized": 1, "successfully": 2, "refereed": 2, "developers": 1, "agreed": 1, "distribute": 1, "them": 1, "core": 1, "system": 1, "development": 1, "versions": 1, "all": 18, "You": 1, "must": 6, "provide": 2, "entries": 8, "status": 1, "because": 2, "#CommunicatedBy": 1, "#AcceptDate": 1, "PackageWWWHome": 1, "README_URL": 1, ".PackageWWWHome": 2, "PackageInfoURL": 1, "ArchiveURL": 1, ".Version": 2, "ArchiveFormats": 1, "Here": 2, "short": 1, "abstract": 1, "explaining": 1, "content": 1, "HTML": 1, "overview": 1, "Web": 1, "page": 1, "URL": 1, "Webpage": 1, "detailed": 1, "information": 1, "than": 1, "few": 1, "lines": 1, "less": 1, "ok": 1, "Please": 1, "specifing": 1, "names.": 1, "AbstractHTML": 1, "PackageDoc": 1, "BookName": 1, "ArchiveURLSubset": 1, "HTMLStart": 1, "PDFFile": 1, "SixFile": 1, "LongTitle": 1, "Dependencies": 1, "NeededOtherPackages": 1, "SuggestedOtherPackages": 1, "ExternalConditions": 1, "AvailabilityTest": 1, "SHOW_STAT": 1, "DirectoriesPackagePrograms": 1, "#Info": 1, "InfoWarning": 1, "*Optional*": 2, "but": 1, "recommended": 1, "path": 1, "relative": 1, "root": 1, "many": 1, "tests": 1, "functionality": 1, "sensible.": 1, "#TestFile": 1, "keyword": 1, "related": 1, "topic": 1, "Keywords": 1, "vspc.gd": 1, "library": 2, "Thomas": 2, "Breuer": 2, "#Y": 6, "Lehrstuhl": 2, "r": 2, "Mathematik": 2, "RWTH": 2, "Aachen": 2, "Germany": 2, "School": 2, "Math": 2, "Comp.": 2, "Sci.": 2, "St": 2, "Andrews": 2, "Scotland": 2, "Group": 3, "declares": 1, "operations": 2, "vector": 67, "spaces.": 4, "bases": 5, "free": 3, "left": 15, "modules": 1, "": 10, "lib/basis.gd": 1, "IsLeftOperatorRing": 1, "IsLeftOperatorAdditiveGroup": 2, "IsRing": 1, "IsAssociativeLOpDProd": 2, "#T": 6, "IsLeftOperatorRingWithOne": 2, "IsRingWithOne": 1, "IsLeftVectorSpace": 3, "": 38, "IsVectorSpace": 26, "<#GAPDoc>": 17, "Label=": 19, "": 12, "space": 74, "": 12, "module": 2, "see": 30, "nbsp": 30, "": 71, "Func=": 40, "over": 24, "division": 15, "ring": 14, "Chapter": 3, "Chap=": 3, "

": 23, "Whenever": 1, "talk": 1, "": 42, "": 41, "V": 151, "additive": 1, "acts": 1, "via": 6, "multiplication": 1, "from": 5, "such": 4, "action": 4, "addition": 1, "right": 2, "distributive.": 1, "accessed": 1, "attribute": 2, "Vector": 1, "spaces": 15, "always": 1, "Filt=": 4, "synonyms.": 1, "<#/GAPDoc>": 17, "IsLeftActedOnByDivisionRing": 4, "InstallTrueMethod": 4, "IsGaussianSpace": 10, "": 14, "filter": 3, "Sect=": 6, "row": 17, "matrix": 5, "field": 12, "say": 1, "indicates": 3, "vectors": 16, "matrices": 5, "respectively": 1, "contained": 4, "case": 2, "called": 1, "Gaussian": 19, "space.": 5, "Bases": 1, "computed": 2, "elimination": 5, "given": 4, "generators.": 1, "": 12, "": 12, "VectorSpace": 13, "Rationals": 13, "E": 2, "element": 2, "Field": 1, "": 12, "DeclareFilter": 1, "IsFullMatrixModule": 1, "IsFullRowModule": 1, "IsDivisionRing": 5, "": 12, "nontrivial": 1, "associative": 1, "algebra": 2, "multiplicative": 1, "inverse": 1, "each": 2, "nonzero": 3, "element.": 1, "every": 1, "possibly": 1, "itself": 1, "being": 2, "thus": 1, "property": 2, "get": 1, "usually": 1, "represented": 1, "coefficients": 3, "stored": 1, "DeclareSynonymAttr": 4, "IsMagmaWithInversesIfNonzero": 1, "IsNonTrivial": 1, "IsAssociative": 1, "IsEuclideanRing": 1, "#A": 7, "GeneratorsOfLeftVectorSpace": 1, "GeneratorsOfVectorSpace": 2, "": 7, "Attr=": 10, "returns": 14, "generate": 1, "FullRowSpace": 5, "GeneratorsOfLeftOperatorAdditiveGroup": 2, "CanonicalBasis": 3, "supports": 1, "canonical": 6, "basis": 14, "otherwise": 2, "": 3, "": 3, "returned.": 4, "defining": 1, "its": 2, "uniquely": 1, "determined": 1, "exist": 1, "same": 6, "acting": 8, "domain": 17, "equality": 1, "these": 5, "decided": 1, "comparing": 1, "bases.": 1, "exact": 1, "meaning": 1, "depends": 1, "Canonical": 1, "defined": 3, "designs": 1, "kind": 1, "defines": 1, "method": 4, "installs": 1, "call": 1, "On": 1, "hand": 1, "install": 1, "calls": 1, "": 10, "CANONICAL_BASIS_FLAGS": 1, "": 9, "vecs": 4, "": 8, "3": 5, "BasisVectors": 4, "DeclareAttribute": 4, "IsRowSpace": 2, "consists": 7, "IsRowModule": 1, "IsGaussianRowSpace": 1, "scalars": 2, "occur": 2, "vectors.": 2, "calculations.": 2, "Otherwise": 3, "Gaussian.": 2, "need": 3, "flag": 2, "down": 2, "methods": 4, "delegate": 2, "ones.": 2, "IsNonGaussianRowSpace": 1, "expresses": 2, "cannot": 2, "compute": 3, "nice": 4, "way.": 2, "Let": 4, "spanned": 4, "Then": 1, "/": 12, "cap": 1, "v": 5, "replacing": 1, "forming": 1, "concatenation.": 1, "So": 2, "associated": 3, "DeclareHandlingByNiceBasis": 2, "IsMatrixSpace": 2, "IsMatrixModule": 1, "IsGaussianMatrixSpace": 1, "IsNonGaussianMatrixSpace": 1, "irrelevant": 1, "concatenation": 1, "rows": 1, "necessarily": 1, "NormedRowVectors": 2, "normed": 1, "finite": 5, "those": 1, "first": 1, "component.": 1, "yields": 1, "natural": 1, "dimensional": 5, "subspaces": 17, "GF": 22, "*Z": 5, "Z": 6, "Action": 1, "GL": 1, "OnLines": 1, "TrivialSubspace": 2, "subspace": 7, "zero": 4, "triv": 2, "0": 2, "AsSet": 1, "TrivialSubmodule": 1, "": 5, "": 2, "collection": 3, "gens": 16, "elements": 7, "optional": 3, "argument": 1, "empty.": 1, "known": 5, "linearly": 3, "independent": 3, "particular": 1, "dimension": 9, "immediately": 2, "formed": 1, "argument.": 1, "2": 1, "Subspace": 4, "generated": 1, "SubspaceNC": 2, "subset": 4, "empty": 1, "trivial": 1, "parent": 3, "returned": 3, "does": 1, "except": 1, "omits": 1, "check": 5, "both": 2, "W": 32, "1": 3, "Submodule": 1, "SubmoduleNC": 1, "#O": 2, "AsVectorSpace": 4, "view": 4, "": 2, "domain.": 1, "form": 2, "Oper=": 6, "smaller": 1, "larger": 1, "ring.": 3, "Dimension": 6, "LeftActingDomain": 28, "9": 1, "AsLeftModule": 6, "AsSubspace": 5, "": 6, "U": 12, "collection.": 1, "/2": 4, "DeclareOperation": 2, "IsCollection": 3, "Intersection2Spaces": 4, "": 2, "": 2, "": 2, "takes": 1, "arguments": 1, "intersection": 5, "domains": 3, "let": 1, "their": 1, "intersection.": 1, "AsStruct": 2, "equal": 1, "either": 2, "Substruct": 1, "common": 1, "Struct": 1, "basis.": 1, "handle": 1, "intersections": 1, "algebras": 2, "ideals": 2, "sided": 1, "ideals.": 1, "": 2, "": 2, "nonnegative": 2, "integer": 2, "length": 1, "An": 2, "alternative": 2, "construct": 2, "above": 2, "FullRowModule": 2, "FullMatrixSpace": 2, "": 1, "positive": 1, "integers": 1, "fact": 1, "FullMatrixModule": 3, "IsSubspacesVectorSpace": 9, "fixed": 1, "lies": 1, "category": 1, "Subspaces": 8, "Size": 5, "iter": 17, "Iterator": 5, "NextIterator": 5, "DeclareCategory": 1, "IsDomain": 1, "IsFinite": 4, "Returns": 1, "": 1, "Called": 2, "k": 17, "Special": 1, "provided": 1, "domains.": 1, "IsInt": 3, "IsSubspace": 3, "OrthogonalSpaceInFullRowSpace": 1, "complement": 1, "full": 2, "#P": 1, "IsVectorSpaceHomomorphism": 3, "": 2, "": 1, "mapping": 2, "homomorphism": 1, "linear": 1, "source": 2, "range": 1, "b": 8, "hold": 1, "IsGeneralMapping": 2, "#E": 2, "vspc.gi": 1, "generic": 1, "SetLeftActingDomain": 2, "": 2, "external": 1, "knows": 1, "e.g.": 1, "tell": 1, "InstallOtherMethod": 3, "IsAttributeStoringRep": 2, "IsLeftActedOnByRing": 2, "IsObject": 1, "extL": 2, "HasIsDivisionRing": 1, "SetIsLeftActedOnByDivisionRing": 1, "IsExtLSet": 1, "IsIdenticalObj": 5, "difference": 1, "between": 1, "shall": 1, "CallFuncList": 1, "FreeLeftModule": 1, "newC": 7, "IsSubset": 4, "SetParent": 1, "UseIsomorphismRelation": 2, "UseSubsetRelation": 4, "View": 1, "base": 5, "gen": 5, "loop": 2, "newgens": 4, "extended": 1, "Characteristic": 2, "Basis": 5, "AsField": 2, "GeneratorsOfLeftModule": 9, "LeftModuleByGenerators": 5, "Zero": 5, "Intersection": 1, "ViewObj": 4, "print": 1, "no.": 1, "HasGeneratorsOfLeftModule": 2, "HasDimension": 1, "override": 1, "PrintObj": 5, "HasZero": 1, "": 2, "factor": 2, "": 1, "ImagesSource": 1, "NaturalHomomorphismBySubspace": 1, "AsStructure": 3, "Substructure": 3, "Structure": 2, "inters": 17, "gensV": 7, "gensW": 7, "VW": 3, "sum": 1, "Intersection2": 4, "IsFiniteDimensional": 2, "Coefficients": 3, "SumIntersectionMat": 1, "LinearCombination": 2, "HasParent": 2, "SetIsTrivial": 1, "ClosureLeftModule": 2, "": 1, "closure": 1, "IsCollsElms": 1, "HasBasis": 1, "IsVector": 1, "w": 3, "easily": 1, "UseBasis": 1, "Methods": 1, "collections": 1, "#R": 1, "IsSubspacesVectorSpaceDefaultRep": 7, "representation": 1, "components": 1, "means": 1, "DeclareRepresentation": 1, "IsComponentObjectRep": 1, ".dimension": 9, ".structure": 9, "number": 2, "q": 20, "prod_": 2, "frac": 3, "sum_": 1, "size": 12, "qn": 10, "qd": 10, "ank": 6, "Int": 1, "Enumerator": 2, "Use": 1, "iterator": 3, "allowed": 1, "elms": 4, "IsDoneIterator": 3, ".associatedIterator": 3, ".basis": 2, "structure": 4, "associatedIterator": 2, "ShallowCopy": 2, "IteratorByFunctions": 1, "IsDoneIterator_Subspaces": 1, "NextIterator_Subspaces": 1, "ShallowCopy_Subspaces": 1, "": 1, "dim": 2, "Objectify": 2, "NewType": 2, "CollectionsFamily": 2, "FamilyObj": 2, "map": 4, "S": 4, "IsLinearMapping": 1 }, "GAS": { ".macro": 1, "invalid": 2, ".word": 2, "stc": 1, "cr0": 1, "[": 3, "r0": 6, "]": 3, ".endm": 1, ".global": 1, "_start": 2, "nop": 1, "bl": 1, "skip_output": 2, "hello_text": 1, ".asciz": 1, ".p2align": 2, "mov": 6, "r4": 9, "r14": 1, "output_next": 2, "adr": 2, "into_thumb": 2, "+": 3, "bx": 2, ".thumb": 1, "#3": 2, "@": 2, "writec": 1, "angel": 1, "call": 2, "r1": 3, "swi": 3, "Confirm": 1, "number.": 1, "r5": 6, "back_to_arm": 2, ".arm": 1, "add": 2, "#1": 2, "sub": 2, "r3": 8, "ldrb": 2, "teq": 2, "#0": 2, "beq": 1, "done": 2, "#0x123456": 2, "bne": 1, "#0x18": 1, "ldr": 1, "exit_code": 2, ".cstring": 1, "LC0": 2, ".ascii": 2, ".text": 1, ".globl": 2, "_main": 2, "LFB3": 4, "pushq": 1, "%": 6, "rbp": 2, "LCFI0": 3, "movq": 1, "rsp": 1, "LCFI1": 2, "leaq": 1, "(": 1, "rip": 1, ")": 1, "rdi": 1, "_puts": 1, "movl": 1, "eax": 1, "leave": 1, "ret": 1, "LFE3": 2, ".section": 1, "__TEXT": 1, "__eh_frame": 1, "coalesced": 1, "no_toc": 1, "strip_static_syms": 1, "live_support": 1, "EH_frame1": 2, ".set": 5, "L": 10, "set": 10, "LECIE1": 2, "-": 7, "LSCIE1": 2, ".long": 6, ".byte": 20, ".align": 2, "_main.eh": 2, "LSFDE1": 1, "LEFDE1": 2, "LASFDE1": 3, ".quad": 2, ".": 1, ".subsections_via_symbols": 1 }, "GCC Machine Description": { ";": 1329, "-": 80, "Machine": 1, "description": 1, "for": 10, "the": 54, "PDP": 1, "Copyright": 1, "(": 397, "C": 1, ")": 399, "Lars": 2, "Brinkhoff.": 1, "Contributed": 1, "by": 16, "Brinkhoff": 1, "": 1, "funded": 1, "XKL": 1, "LLC.": 1, "Index": 2, "Front": 1, "Page": 1, "Constraints": 2, "Immediate": 2, "Operands": 3, "To": 2, "do": 2, "List": 4, "Instruction": 3, "Wish": 2, "Attributes": 2, "length": 54, "skip": 15, "reorg_type": 7, "Unspec": 2, "Usage": 2, "UNSPEC_ADJSP": 2, "UNSPEC_ADJBP": 2, "UNSPEC_ADDRESS": 2, "UNSPEC_FFO": 2, "UNSPEC_SUBBP": 2, "VUNSPEC_BLT": 2, "VUNSPEC_FSC": 1, "VUNSPEC_XBLT": 2, "VUNSPEC_MOVSLJ": 2, "VUNSPEC_MOVST": 2, "Constants": 2, "RIGHT_HALF": 6, "LEFT_HALF": 5, "SIGNBIT": 2, "SP_REGNUM": 4, "Optimizations": 2, "Data": 2, "Movement": 2, "LDB": 1, "ILDB": 1, "LDBI": 2, "LDBE": 2, "ILDBE": 2, "LDBEI": 2, "DPB": 1, "IDPB": 1, "DPBI": 2, "HRR": 3, "HRL": 2, "HLR": 3, "HLL": 3, "HRRM": 1, "HRLM": 1, "HLRM": 1, "HLLM": 2, "HRRZ": 3, "HRLZ": 2, "HLRZ": 2, "HLLZ": 2, "HRRE": 3, "HRLE": 1, "HLRE": 2, "HLLE": 1, "SETZM": 1, "SETOM": 1, "MOVE": 1, "MOVEI": 3, "MOVSI": 2, "HRLOI": 2, "HRROI": 2, "MOVEM": 1, "MOVS": 1, "EXCH": 1, "SETZB": 1, "DMOVE": 2, "DMOVEM": 1, "BLT": 3, "XBLT": 3, "MOVSLJ": 3, "MOVST": 3, "CMPS": 3, "Conditional": 2, "SKIPL": 1, "SKIPE": 1, "SKIPLE": 1, "SKIPGE": 1, "SKIPN": 1, "SKIPG": 1, "TDZA": 1, "Integer": 7, "Arithmetic": 4, "AOS": 2, "SOS": 2, "ADD": 1, "ADDI": 1, "ADDM": 1, "ADDB": 1, "DADD": 1, "SUB": 1, "SUBI": 1, "SUBM": 1, "SUBB": 1, "DSUB": 1, "IMUL": 1, "IMULI": 1, "IMULM": 1, "IMULB": 1, "MUL": 2, "MULI": 1, "MULM": 1, "MULB": 1, "DMUL": 2, "IDIV": 2, "IDIVI": 1, "IDIVM": 2, "DIV": 1, "DIVI": 1, "DIVM": 1, "DDIV": 2, "UIDIV": 2, "UIDIVI": 1, "UIDIVM": 1, "UIMOD": 2, "UIMODI": 1, "UIMODM": 1, "MOVN": 2, "MOVNM": 2, "MOVNS": 2, "MOVNI": 1, "DMOVN": 3, "DMOVNM": 2, "MOVM": 2, "MOVMM": 2, "MOVMS": 2, "FFS": 2, "Conversions": 2, "ANDI": 3, "SEXT": 2, "Shifting": 1, "and": 30, "Rotating": 1, "LSH": 1, "LSHC": 1, "ASH": 1, "ASHC": 3, "ROT": 1, "ROTC": 1, "Logical": 2, "Operations": 1, "AND": 1, "ANDM": 1, "ANDB": 1, "TLZ": 2, "ANDCMI": 3, "ANDCA": 1, "ANDCAI": 1, "ANDCAM": 1, "ANDCAB": 1, "ANDCBI": 2, "ANDCM": 1, "ANDCMM": 1, "ANDCMB": 1, "XOR": 1, "XORI": 1, "XORM": 1, "XORB": 1, "TLC": 2, "EQVI": 1, "IOR": 1, "IORI": 1, "IORM": 1, "IORB": 1, "TLO": 6, "ORCMI": 2, "ANDCB": 1, "ANDCBM": 1, "ANDCBB": 1, "EQV": 1, "EQVM": 1, "EQVB": 1, "SETCA": 1, "SETCAM": 1, "SETCAB": 1, "SETCM": 1, "SETCMM": 1, "SETCMB": 1, "ORCA": 1, "ORCAI": 1, "ORCAM": 1, "ORCAB": 1, "ORCBI": 1, "ORCM": 1, "ORCMM": 1, "ORCMB": 1, "ORCB": 1, "ORCBM": 1, "ORCBB": 1, "Floating": 6, "point": 5, "FADR": 1, "FADRI": 1, "FADRM": 1, "FADRB": 1, "DFAD": 1, "GFAD": 1, "FSBR": 1, "FSBRI": 1, "FSBRM": 1, "FSBRB": 1, "DFSB": 1, "GFSB": 1, "FMPR": 1, "FMPRI": 1, "FMPRM": 1, "FMPRB": 1, "DFMP": 1, "GFMP": 1, "FDVR": 1, "FDVRI": 1, "FDVRM": 1, "FDVRB": 1, "DFDV": 1, "GFDV": 1, "SQRT": 2, "DSQRT": 2, "GSQRT": 2, "FSC": 2, "DFSC": 1, "GFSC": 1, "FIX": 1, "DFIX": 3, "GFIX": 1, "DDFIX": 2, "GDFIX": 1, "FLTR": 1, "DFLTR": 3, "GFLTR": 1, "DDFLTR": 2, "DGFLTR": 1, "GSNGL": 1, "GDBLE": 1, "Pointer": 1, "IBP": 1, "ADJBP": 2, "SUBBP": 2, "Unconditional": 1, "Jumps": 2, "JFCL": 1, "JRST": 1, "PUSHJ": 3, "TRNE": 2, "TLNE": 4, "TDNE": 1, "TRNN": 1, "TLNN": 1, "TDNN": 1, "TLZN": 1, "JUMP": 1, "SKIP": 1, "CAI": 1, "CAM": 1, "SOJ": 1, "AOJ": 1, "JFFO": 1, "CMPBP": 2, "Function": 1, "prologue": 1, "epilogue": 1, "POPJ": 4, "ADJSP": 2, "PUSH": 1, "POP": 1, "Peepholes": 2, "Miscellaneous": 1, "Instructions": 1, "in": 22, "parentheses": 1, "are": 2, "either": 1, "commented": 1, "out": 1, "or": 6, "not": 1, "generated": 3, "compiler.": 1, "Any": 2, "valid": 1, "immediate": 1, "floating": 3, "constant.": 1, "..": 3, "xxxxxx": 3, "TLN": 1, "zero.": 1, "Local": 1, "symbol.": 1, "Use": 2, "peep2_reg_dead_p": 1, "peepholes.": 1, "Unsigned": 3, "multiplication.": 1, "mul": 8, "multiply": 5, "AC1": 17, "AC3": 8, "lsh": 22, "lshc": 13, "result": 11, "AC2": 14, "bit": 8, "arithmetic.": 2, "Addition": 2, "subtraction": 1, "multiplication": 5, "division": 2, "arithmetic": 5, "shift": 19, "supported": 1, "hardware.": 1, "left": 2, "right": 3, ".": 47, "x": 53, "jfcl": 17, "+": 81, "add": 13, "to": 31, "AC4": 4, "jcry0": 13, "[": 234, "aoja": 10, "]": 234, "Subtraction": 1, "sub": 6, "subi": 5, "Negation": 1, "setcm": 2, "movn": 6, "jumpe": 6, "self": 1, "setca": 3, "Magnitude": 1, "conditional": 1, "negation": 2, "jumpge": 2, "mask": 3, "y": 4, "move": 30, "ash": 12, "shortcut": 1, "xor": 2, "Signed": 3, "Variable": 1, "amount": 7, "only": 3, "works": 2, "if": 46, "n": 6, "<": 3, "operand": 13, "loop": 1, "jumple": 1, "tlne": 6, "tlo": 5, "sojg": 1, "tlnn": 1, "tdza": 1, "movsi": 10, "movei": 14, "ashc": 1, "ior": 5, "Fixed": 1, "mask1": 1, "mask2": 1, "skipge": 3, "cail": 3, "iori": 2, "<2^n-1>": 1, "rotc": 2, "jov": 4, "jrst": 7, "cam": 3, "...": 2, "trne": 7, "tloa": 1, "tlz": 3, "*": 9, "high": 1, "part": 1, "mulm": 3, "Multiplication": 1, "dmul": 4, "Comparisons": 1, "CAMN": 1, "CAME": 1, "here": 1, "false": 1, "TSC": 1, "TSO": 1, "TSZ.": 1, "TSNE": 1, "TSNN.": 1, "Ok": 1, "negate": 1, "double": 5, "word": 6, "integer": 2, "with": 3, "Answer": 1, "perhaps": 1, "not.": 1, "If": 1, "comparison": 2, "code": 1, "cares": 1, "about": 1, "second": 2, "of": 6, "a": 9, "has": 1, "set": 36, "value.": 1, "Converting": 1, "from": 2, "float": 2, "single": 2, "truncdfsf2": 1, "needs": 1, "rounding.": 1, "really": 1, "faster": 1, "than": 1, "TRZ": 1, "Add": 1, "cmpdi": 1, "*move_and_skipsi": 3, "*move_and_skipsf": 2, "clobbers": 1, "accumulator": 1, "Is": 1, "it": 1, "possible": 1, "allocate": 1, "scratch": 1, "register": 10, "AOSA": 1, "SOSA.": 1, "half": 1, "instructions.": 2, "AOBJP": 1, "AOBJN": 1, "SUBREG": 6, "DImode": 19, "causes": 1, "bad": 1, "allocation": 1, "divmodsi4": 1, "divmoddi4": 2, "expand_builtin_jffo": 1, "ffssi.": 1, "String": 1, "Avoid": 1, "them": 1, "now.": 1, "REG": 4, "Test": 2, "modify": 1, "instructions": 1, "In": 1, "case": 3, "anyone": 1, "would": 1, "like": 1, "play": 1, "strange": 1, "games": 1, "this": 1, "could": 1, "be": 1, "optimized": 1, "use": 2, "instruction": 4, "static": 2, "foo": 1, "void": 4, "**p": 2, "*f": 2, "FOO": 1, "{": 17, "p": 4, "&&": 47, "label": 5, "goto": 2, "return": 15, "}": 17, "And": 1, "bar": 1, "BAR": 1, "*p": 1, "JSP": 1, "call": 1, "functions": 1, "__attribute__": 1, "fastcall": 1, "similar.": 1, "Historical": 1, "KA10": 1, "software": 1, "precision": 1, "point.": 1, "increment": 1, "load": 1, "sign": 2, "extended": 1, "byte.": 2, "load/deposit": 1, "byte": 7, "then": 1, "increment.": 1, "subtract": 1, "pointers.": 2, "compare": 2, "r": 330, "extend": 18, "r.": 1, "Clear/set": 1, "<0.>": 1, "UDIV": 1, "UDDIV": 1, "unsigned": 3, "udivsi3": 2, "udivdi3": 1, "UMOD": 1, "UDMOD": 1, "modulo": 1, "umodsi3": 2, "umoddi3": 1, "UJUMP": 1, "USKIP": 1, "UCAI": 1, "UCAM": 1, "values": 1, "MIN": 1, "MAX": 1, "UMIN": 1, "UMAX": 1, "min": 1, "max": 1, "minsi3": 1, "maxsi3": 1, "uminsi3": 2, "umaxsi3": 2, "square": 1, "root": 1, "sqrtM2": 1, "SIN": 1, "DSIN": 1, "GSIN": 1, "sine": 1, "function": 3, "__builtin_sin": 1, "COS": 1, "DCOS": 1, "GCOS": 1, "cosine": 1, "__builtin_cos": 1, "other": 1, "mathematical": 1, "TAN": 1, "ASIN": 1, "ACOS": 1, "ATAN": 1, "SINH": 1, "COSH": 1, "TANH": 1, "ASINH": 1, "ACOSH": 1, "ATANH": 1, "EXP": 1, "LN": 1, "LOG2": 1, "LOG10": 1, "POW": 1, "All": 1, "potentially": 1, "giant": 1, "versions": 2, "find": 1, "first": 4, "counting": 1, "least": 1, "significant": 1, "ffsM2": 1, "DFIXR": 2, "Double": 8, "fix_truncdfsi2": 1, "Single": 1, "Precision": 4, "fix_truncsfdi2": 1, "DDFIXR": 1, "fix_truncdfdi2": 1, "Float": 4, "Round": 4, "floatsidf2": 1, "floatdisf2": 1, "floatdidf2": 1, "UDFLTR": 1, "UGFLTR": 1, "floatuns": 1, "WAIT": 1, "wait": 1, "interrupt": 1, "XPUSH": 1, "XPUSHJ": 1, "XPOP": 1, "XPOPJ": 1, "fast": 1, "global": 1, "stack": 4, "pointer": 16, "Length": 1, "words": 1, "define_attr": 3, "const_int": 42, "1": 101, "The": 1, "is": 47, "no": 2, "yes": 4, "const_string": 2, "type": 1, "used": 1, "machine": 1, "dependent": 1, "reorg": 1, "pass": 1, "none": 8, "ibp": 1, "ldb": 7, "dpb": 2, "define_constants": 3, "0": 128, "operation": 13, "Pmode": 7, "Operand": 38, "adjustment": 2, "2": 14, "Effective": 1, "address": 5, "calculation": 1, "memory": 1, "3": 5, "Find": 1, "one": 1, "FFO": 1, "SImode": 64, "UNSPEC_FSC": 1, "4": 2, "SFmode": 1, "DFmode": 7, "value": 10, "scale": 1, "factor": 1, "UNSPEC_SHIFT": 1, "5": 2, "Left": 1, "Used": 2, "compensate": 2, "unnecessary": 2, "shifts": 2, "count": 2, "UNSPEC_SHIFTRT": 1, "6": 1, "Right": 1, "UNSPEC_TLNE_TLZA_TLO": 1, "TLZA": 2, "sequence": 2, "7": 1, "8": 1, "Byte": 1, "difference": 1, "UNSPEC_CMPBP": 1, "9": 4, "Prepare": 1, "UNSPEC_REAL_ASHIFT": 1, "10": 1, "UNSPEC_ASH71": 1, "11": 1, "71": 2, "UNSPEC_MUL71": 1, "12": 1, "multiplicands": 1, "UNSPEC_SIGN_EXTEND": 2, "13": 2, "Sign": 1, "extension": 2, "number": 3, "bits": 3, "UNSPEC_ZERO_EXTEND": 1, "14": 1, "Zero": 1, "UNSPEC_TRUNCATE": 1, "15": 2, "Truncate": 1, "truncate": 1, "trunc": 1, "UNSPEC_TRNE_TLO": 1, "16": 1, "UNSPEC_ASHC": 1, "17": 3, "UNSPEC_LSHC": 1, "18": 29, "VUNSPEC_BLOCKAGE": 1, "BLKmode": 5, "source": 2, "destination": 2, "block": 5, "VUNSPEC_CMPS": 1, "262143": 1, "0000000777777": 1, "262144": 1, "0777777000000": 1, "34359738368": 1, "0400000000000": 1, "FP_REGNUM": 1, "Frame": 1, "Stack": 1, "Adding": 1, "constant": 1, "done": 2, "fastest": 2, "X": 2, "op0": 2, "const": 2, "op1": 8, "As": 2, "special": 2, "recognize": 2, "define_insn": 33, "MOVEI_sp": 1, "match_operand": 68, "SI": 88, "register_operand": 275, "plus": 1, "reg": 5, "const_int_operand": 70, "operands": 248, "gen_rtx_PLUS": 1, "stack_pointer_rtx": 1, "ADDRESS": 3, "TARGET_EXTENDED": 6, "xmovei": 3, "a1": 2, "Moving": 1, "any": 1, "move_from_sp": 1, "Load": 1, "scalar": 1, "signed": 1, "chars": 1, "using": 1, "sign_extend": 3, "QI": 10, "pdp10_maybe_volatile_memory_operand": 16, "m": 99, "MEM_SCALAR_P": 23, "hrre": 7, "W1": 18, "sign_extract": 2, "27": 3, "subreg": 10, "zero_extract": 12, "memory_operand": 57, "movem": 18, "HI": 17, "unspec": 1, "INTVAL": 40, "%": 843, "W0": 14, "*sgeu": 1, "reg_or_mem_operand": 118, "rm": 90, "skipl": 4, "_caml": 4, "_": 37, "_trna": 2, "_tdza": 10, "_movei": 21, "_cail": 4, "*sgeu_plus": 1, "&": 1, "caml": 2, "*cbranchgeu": 1, "*cbranchgeu_mem": 1, "*cbranchgeu_plus": 1, "*sltu": 1, "*sltu_plus": 1, "*cbranchltu": 1, "*cbranchltu_mem": 1, "*cbranchltu_plus": 1, "i": 22, "TARGET_LARGE": 1, "pdp10_constaddr_memory_operand": 1, "hllzs": 2, "MEM_ALIGN": 1, "hrrzs": 2, "hrlzs": 1, "hlrzs": 1, "hrros": 1, "hllos": 1, "hrlo": 1, "hlro": 1, "movqi": 1, "general_operand": 52, "no_new_pseudos": 2, "REG_P": 4, "GET_CODE": 30, "CONST_INT": 9, "gen_rtx_REG": 2, "REGNO": 4, "else": 12, "SUBREG_REG": 22, "ZERO_EXTRACT": 5, "XEXP": 33, "MEM": 5, "SUBREG_BYTE": 3, "emit_move_insn": 22, "convert_to_mode": 4, "DONE": 19, "rtx": 20, "temp": 46, "gen_reg_rtx": 19, "gen_rtx_SUBREG": 35, "QImode": 3, "emit_insn": 21, "gen_movsi": 2, "force_reg": 5, "*movqi_reg": 1, "*LDBzqi_sequence": 1, "CONSTANT_ADDRESS_P": 3, "pdp10_pointer_alignment": 3, "UNITS_PER_WORD": 6, "||": 11, "*LDBzqi": 1, "*return": 25, "pdp10_output_load_unsigned_byte": 4, "insn": 26, "*LDBIzqi": 1, "<\")))]>": 1, "TARGET_XKL2": 19, "LDBEqi": 1, "<,m\")))]>": 1, "pdp10_output_load_signed_byte": 1, "set_attr": 1, "LDBEqi_sequence": 1, "ildb": 2, "_orcmi": 4, "*LDBqi": 1, "@": 44, "*LDBIqi": 1, "<\"))]>": 1, "DPBqi": 1, "pdp10_output_store_byte": 2, "*DPBIqi": 1, "<\")>": 1, "define_expand": 1, "movhi": 2, "HImode": 3, "halfword_move": 1, "pdp10_halfword_destination": 1, "pdp10_halfword_source": 1, "pdp10_output_halfword_move": 1, "hlr": 2, "hll": 2, "mem": 2, "address_operand": 1, "zero_extend": 1, "match_dup": 1, "CONST": 1, "TARGET_SMALLISH": 1, "hllm": 3, "hrr": 2, "hrrm": 1, "hrl": 1, "hrlm": 1, "HxR": 1, "pdp10_output_halfword_insv": 2, "HxRM": 1, "pdp10_output_halfword_extv": 2, "HxL": 1, "HxLM": 1, "lshiftrt": 4, "hlrm": 1, "zero_extended_p": 1, "char": 1, "hrrz": 3, "hrrzm": 2, "which_alternative": 3, "HRRO": 1, "hrro": 1, "hrrom": 1, "hllz": 1, "hllzm": 1, "HLLO": 1, "hllo": 1, "hllom": 1, "hlrz": 1, "hlrzm": 1, "ashiftrt": 1, "hlre": 2, "hlrem": 1, "HLRE_extract": 1, "ashift": 1, "hrlz": 1, "hrlzm": 1, "loadhi": 1, "pdp10_output_movhi": 4, "*zloadhi": 1, "*sloadhi_1": 1, "*sloadhi_2": 1, "storehi": 1, "*zstorehi": 1, "*sstorehi": 1, "hrrem": 1, "extv": 1, "BITS_PER_WORD": 4, "FAIL": 12, "pdp10_expand_extv": 1, "*extv_reg": 1, "pdp10_output_extv_sequence": 3, "*extv_mem": 1, "*extv_memsi": 1, "*LDBE_reg": 1, "pdp10_output_extv": 3, "*LDBE_regqi": 1, "*LDBE_mem": 1, "extzv": 1, "pdp10_expand_extzv": 1, "*extzv_reg_sequence": 1, "pdp10_output_extzv_sequence": 3, "*extzv_memsi_sequence": 1, "PLUS": 2, "*extzv_mem_sequence": 1, "*extzv_reg": 1, "pdp10_output_extzv": 3, "*extzv_mem": 1, "*extzv_memsi": 1, "*move_dpb": 1, "*move_dpb2": 1, "insv": 1, "gen_rtx_MEM": 1, "pdp10_output_insv": 4, "*insv_reg": 1, "*insv_mem": 1, "*insv_memsi": 1, "*movsi_cache": 1, "I": 23, "S": 3, "L": 2, "M": 8, "N": 2, "P": 2, "O": 9, "TARGET_CACHE": 1, "optimize_size": 1, "pdp10_output_movsi": 2, "*movsi_nocache": 1, "move_two_halves": 1, "immediate_operand": 9, "*MOVEI_const_plus_reg": 1, "pdp10_const_ok_for_letter_p": 5, "*MOVS": 1, "pdp10_rotate_operator": 1, "movs": 1, "movsm": 1, "*EXCH": 1, "exch": 1, "*SETZB": 1, "setzb": 5, "movdi": 1, "HAVE_DMOVE": 2, "pdp10_expand_dmove": 2, "o": 10, "J": 4, "TARGET_KI10up": 7, "dmove": 4, "Z0": 35, "seto": 2, "movni": 5, "n1": 2, "D1": 1, "setzm": 9, "dmovem": 2, "*movdi": 1, "ro": 6, "Z1": 6, "A1": 2, "B1": 2, "movti": 1, "pdp10_expand_move_4": 1, "movsf": 7, "R": 13, "G": 3, "F": 3, "G1": 3, "movdf": 17, "*movdf_KI10up": 1, "*movdf_notKI10up": 1, "movstrsi": 1, "pdp10_expand_movstrsi": 1, "clrstrsi": 1, "pdp10_expand_clrstrsi": 1, "cmpstrsi": 1, "TARGET_KL10up": 11, "TARGET_STRING": 4, "pdp10_expand_cmpstrsi": 1, "blt": 1, "xblt": 1, "movslj": 1, "movst": 1, "cmps": 1, "cstoresi4": 1, "cstoresf4": 1, "seq": 1, "GET_MODE": 6, "pdp10_compare_op0": 16, "pdp10_compare_op1": 10, "sne": 1, "slt": 1, "sgt": 1, "sle": 1, "sge": 1, "sltu": 1, "pdp10_flip_sign_bit": 8, "sgtu": 1, "sleu": 1, "sgeu": 1, "*snesi": 1, "skipe": 4, "*sgesi": 1, "xori": 3, "tlc": 1, "*sccsi": 1, "pdp10_comparison_operator": 5, "*snesf": 1, "*sltsf": 1, "*sgesf": 1, "*sccsf": 1, "*snedf": 1, "pdp10_const_double_0_operand": 2, "skipn": 1, "_skipe": 1, "*sltdf": 1, "*sgedf": 1, "cmovsi6": 1, "cmovsf6": 1, "preferably_register_operand": 6, "jump": 10, "F2": 7, "R0": 3, "alternative": 7, "F3": 3, "addsi3": 1, "*addsi3": 1, "Q": 2, "addi": 4, "N2": 2, "X2": 1, "addm": 2, "aos": 6, "sos": 5, "*ADDI_reg": 1, "*ADDI_const_plus_reg": 1, "*ADDB1": 1, "addb": 2, "*ADDB2": 1, "*AOS_and_move": 1, "adddi3": 1, "TARGET_71BIT": 17, "*adddi3": 1, "Z2": 4, "_subi": 2, "B2": 1, "A2": 1, "*DADD": 1, "dadd": 2, "D2": 5, "subsi3": 1, "*subsi3": 1, "subm": 3, "*SUBI_reg": 1, "*SUBI_const_plus_reg": 1, "*SUBB": 1, "subb": 1, "*SOS_and_move": 1, "subdi3": 1, "*subdi3": 1, "_sos": 1, "*DSUB": 1, "dsub": 2, "mulsi3": 1, "imul": 2, "imuli": 3, "imulm": 1, "*IMULI_reg": 1, "*IMULI_const_plus_reg": 1, "*IMULB1": 1, "imulb": 2, "*IMULB2": 1, "mulsidi3": 1, "*mulsidi3": 1, "muli": 2, "smulsi3_highpart": 1, "*smulsi3_highpart": 1, "_jrst": 1, "*smulsi3_highpart_71": 1, "muldi3": 1, "TImode": 2, "gen_DMUL": 1, "gen_ashlsi3": 3, "GEN_INT": 10, "gen_lshrdi3": 2, "gen_TRNE_TLO": 1, "TRNE_TLO": 1, "_tlo": 2, "mulditi3": 1, "idiv": 2, "idivi": 1, "idivm": 1, "divsi3": 1, "temp0": 11, "gen_IDIV": 3, "gen_IDIVM": 1, "modsi3": 1, "temp1": 4, "_divmodsi4": 1, "*DIV": 1, "div": 2, "divi": 1, "*DIVM": 1, "divm": 1, "ddiv": 2, "gen_ashrsi3": 1, "gen_DDIV": 1, "uidivi": 1, "uidiv": 2, "uidivm": 1, "uimodi": 1, "uimod": 2, "uimodm": 1, "negsi2": 1, "movnm": 1, "N1": 1, "movns": 2, "*MOVNI_reg": 1, "*MOVNI_const_plus_reg": 1, "*MOVNS": 1, "negdi2": 1, "*negdi2": 1, "_movn": 1, "*DMOVN": 1, "dmovn": 1, "abssi2": 1, "movm": 1, "movmm": 1, "movms": 2, "*MOVMS": 1, "smaxsi3": 1, "camge": 8, "_move": 14, "caige": 2, "_seto": 2, "camle": 8, "caile": 2, "_skipa": 6, "*umaxsi3": 1, "sminsi3": 1, "skiple": 1, "*uminsi3": 1, "ffssi2": 1, "TARGET_KA10up": 1, "t1": 3, "t2": 3, "t3": 5, "t4": 3, "gen_label_rtx": 1, "extern": 1, "int": 1, "pdp10_expand_ffs": 2, "gen_negsi2": 2, "gen_andsi3": 1, "emit_jump_insn": 1, "gen_JFFO": 1, "gen_rtx_LABEL_REF": 1, "emit_label": 1, "gen_subsi3": 1, "*FFS": 1, "ffs": 1, "popcountsi": 1, "zero_extendqisi2": 3, "andi": 4, "zero_extendhisi2": 2, "zero_extendsi": 1, "*extendqisi2_reg": 1, "extendqisi2_reg": 1, "extendqisi2": 1, "gen_ASH_right": 1, "*extendqisi2": 1, "*extendqisi2_xkl2": 1, "sext": 1, "extendhisi2": 2, "sign_extendsi": 1, "truncsiqi2": 2, "truncsihi2": 2, "truncsi": 3, "real_ashlsi3": 1, "K": 3, "*ASH_left_plus": 1, "lshrsi3": 1, "gen_LSH_right": 1, "LSH_right": 1, "*LSH_right_plus": 1 }, "GDB": { "#": 13, "define": 12, "aswhere": 2, "set": 24, "var": 24, "fcount": 2, "avmplus": 51, "AvmCore": 8, "getActiveCore": 8, "(": 84, ")": 84, "-": 19, "debugger": 9, "frameCount": 1, "i": 5, "while": 4, "<": 4, "asprintframe": 6, "+": 4, "end": 48, "document": 7, "Print": 5, "backtrace": 1, "of": 5, "all": 4, "the": 13, "ActionScript": 2, "stack": 6, "frames.": 1, "May": 2, "not": 4, "work": 2, "in": 4, "contexts": 1, "notably": 1, "inside": 1, "MMgc": 1, ".": 3, "properly": 1, "until": 1, "gdb": 4, "is": 2, "called": 1, "at": 2, "least": 1, "once.": 1, "_asframe_selected": 7, "frame": 36, "frameAt": 4, "arg0": 16, "if": 27, "echo": 20, "no": 9, "n": 13, "else": 7, "aspstring": 7, "Debugger": 43, "methodNameAt": 1, "vcount": 3, "autoVarCount": 3, "AUTO_ARGUMENT": 11, "j": 7, "argname": 2, "autoVarName": 3, "_atom": 2, "autoAtomAt": 1, "call": 8, "void": 2, "printAtom": 1, "asframe": 2, "argc": 3, "Select": 1, "and": 1, "print": 14, "an": 1, "frame.": 4, "With": 5, "argument": 8, "selected": 4, "AS": 3, "An": 1, "specifies": 1, "number": 1, "to": 2, "select.": 1, "printString": 1, "AS3": 1, "string.": 1, "aslocal": 3, "lcount": 2, "AUTO_LOCAL": 8, "k": 14, "lname": 2, "output": 4, "_last_type": 18, "autoAtomKindAt": 2, "unknown": 2, "autoVarAsObject": 3, "autoVarAsString": 2, "ecno": 1, "namespace": 2, "unfinished": 2, "undefined": 2, "autoVarAsBoolean": 2, "autoVarAsInteger": 2, "autoVarAsDouble": 2, "local": 3, "variables": 1, "currently": 3, "debuging": 1, "information": 2, "present.": 1, "Information": 1, "may": 1, "be": 2, "incorrect": 1, "a": 3, "safepoint.": 1, "variables.": 1, "numeric": 2, "specific": 2, "variable": 1, "will": 4, "store": 2, "value": 2, "history": 2, "for": 2, "further": 2, "manipulation": 2, "asarg": 3, "acount": 2, "name": 3, "arguments": 1, "If": 1, "debugging": 2, "available": 1, "names": 1, "printed.": 1, "arguments.": 1, "asthis": 2, "AUTO_THIS": 1, "receiver": 1, "asmixon": 2, "avmshell": 2, "DebugCLI": 2, "debuggerInterruptOnEnter": 2, "true": 1, "turn": 1, "on": 1, "stepping.": 1, "Execution": 1, "return": 1, "propmpt": 1, "after": 1, "asstep*": 1, "instructions.": 1, "Requires": 1, "symbols": 1, ".abcs": 1, "asstepout": 1, "stepOut": 1, "continue": 3, "asstepinto": 1, "stepInto": 1, "asstepover": 1, "stepOver": 1, "asprint": 1, "traits": 1, "target": 1, "remote": 1, "localhost": 1, "monitor": 10, "reset": 2, "halt": 1, "sleep": 2, "wait_halt": 1, "flash": 3, "probe": 1, "info": 1, "write_image": 1, "erase": 1, "unlock": 1, "USBtoSerial.hex": 1, "run": 1, "exit": 1, "quit": 1 }, "GDScript": { "extends": 4, "BaseClass": 1, "var": 86, "a": 6, "s": 4, "arr": 1, "[": 22, "]": 22, "dict": 1, "{": 2, "}": 2, "const": 11, "answer": 1, "thename": 1, "v2": 1, "Vector2": 61, "(": 314, ")": 313, "v3": 1, "Vector3": 9, "func": 19, "some_function": 1, "param1": 4, "param2": 5, "local_var": 2, "if": 56, "<": 14, "print": 6, "elif": 4, "else": 11, "for": 9, "i": 7, "in": 12, "range": 6, "while": 1, "-": 31, "local_var2": 2, "+": 24, "return": 14, "class": 1, "Something": 1, "_init": 1, "lv": 10, "Something.new": 1, "lv.a": 1, "Control": 1, "score": 4, "score_label": 2, "null": 1, "MAX_SHAPES": 2, "block": 3, "preload": 2, "block_colors": 3, "Color": 7, "block_shapes": 4, "#": 18, "I": 1, "O": 1, "S": 1, "Z": 1, "L": 1, "J": 1, "T": 1, "block_rotations": 2, "Matrix32": 4, "width": 5, "height": 6, "cells": 8, "piece_active": 7, "false": 16, "piece_shape": 8, "piece_pos": 3, "piece_rot": 5, "piece_cell_xform": 4, "p": 2, "er": 4, "r": 2, "%": 3, ".xform": 1, "_draw": 1, "sb": 2, "get_stylebox": 1, "use": 1, "line": 1, "edit": 1, "bg": 1, "draw_style_box": 1, "Rect2": 5, "get_size": 1, ".grow": 1, "bs": 3, "block.get_size": 1, "y": 12, "x": 12, "draw_texture_rect": 2, "*bs": 2, "c": 6, "piece_check_fit": 6, "ofs": 2, "pos": 4, "pos.x": 2, "pos.y": 2, "true": 11, "new_piece": 3, "randi": 1, "width/2": 1, "piece_pos.y": 2, "not": 5, "#game": 1, "over": 1, "#print": 1, "game_over": 2, "update": 7, "test_collapse_rows": 2, "accum_down": 6, "collapse": 3, "cells.erase": 1, "accum_down*100": 1, "score_label.set_text": 2, "str": 1, "get_node": 24, ".set_text": 2, "restart_pressed": 1, "cells.clear": 1, "piece_move_down": 2, "piece_rotate": 2, "adv": 2, "_input": 1, "ie": 1, "ie.is_pressed": 1, "ie.is_action": 4, "piece_pos.x": 2, "setup": 2, "w": 3, "h": 3, "set_size": 1, "*block.get_size": 1, ".start": 1, "_ready": 3, "Initalization": 2, "here": 2, "set_process_input": 1, "RigidBody": 1, "#var": 1, "dir": 8, "ANIM_FLOOR": 2, "ANIM_AIR_UP": 2, "ANIM_AIR_DOWN": 2, "SHOOT_TIME": 2, "SHOOT_SCALE": 2, "CHAR_SCALE": 2, "facing_dir": 2, "movement_dir": 3, "jumping": 5, "turn_speed": 2, "keep_jump_inertia": 2, "air_idle_deaccel": 2, "accel": 2, "deaccel": 2, "sharp_turn_threshhold": 2, "max_speed": 5, "on_floor": 3, "prev_shoot": 3, "last_floor_velocity": 5, "shoot_blend": 7, "adjust_facing": 3, "p_facing": 4, "p_target": 2, "p_step": 2, "p_adjust_rate": 2, "current_gn": 2, "n": 2, "normal": 1, "t": 2, "n.cross": 1, ".normalized": 2, "n.dot": 1, "t.dot": 1, "ang": 12, "atan2": 1, "abs": 1, "too": 1, "small": 1, "sign": 1, "*": 15, "turn": 3, "cos": 2, "sin": 1, "p_facing.length": 1, "_integrate_forces": 1, "state": 5, "state.get_linear_velocity": 1, "linear": 1, "velocity": 3, "g": 3, "state.get_total_gravity": 1, "delta": 8, "state.get_step": 1, "d": 2, "delta*state.get_total_density": 1, "<0):>": 2, "d=": 1, "apply": 1, "gravity": 2, "anim": 4, "up": 12, "normalized": 6, "is": 1, "against": 1, "vv": 5, "dot": 3, "vertical": 1, "hv": 8, "horizontal": 3, "hdir": 7, "direction": 6, "hspeed": 14, "length": 1, "speed": 2, "floor_velocity": 5, "onfloor": 6, "get_contact_count": 2, "0": 6, "get_contact_local_shape": 1, "1": 2, "continue": 1, "get_contact_collider_velocity_at_pos": 1, "break": 1, "where": 1, "does": 1, "the": 1, "player": 1, "intend": 1, "to": 3, "walk": 1, "cam_xform": 5, "target": 1, "camera": 1, "get_global_transform": 1, "Input": 6, "is_action_pressed": 6, "move_forward": 1, "basis": 5, "2": 2, "move_backwards": 1, "move_left": 1, "move_right": 1, "jump_attempt": 2, "jump": 2, "shoot_attempt": 3, "shoot": 1, "target_dir": 5, "sharp_turn": 2, "and": 16, "rad2deg": 1, "acos": 1, "target_dir.dot": 1, "dir.length": 2, "#linear_dir": 1, "linear_h_velocity/linear_vel": 1, "#if": 2, "linear_vel": 1, "brake_velocity_limit": 1, "linear_dir.dot": 1, "ctarget_dir": 1, "Math": 1, "deg2rad": 1, "brake_angular_limit": 1, "brake": 1, "#else": 1, "/hspeed*turn_speed": 1, "accel*delta": 1, "deaccel*delta": 1, "hspeed=": 1, "mesh_xform": 2, "Armature": 2, "get_transform": 1, "facing_mesh=": 1, "facing_mesh": 7, "m3": 2, "Matrix3": 1, "cross": 1, "scaled": 1, "set_transform": 1, "Transform": 1, "origin": 1, "7": 1, "sfx": 1, "play": 1, "hs": 1, "hv.length": 1, "hv.normalized": 1, "hdir*hspeed": 1, "up*vv": 1, "#lv": 1, "pass": 2, "state.set_linear_velocity": 1, "bullet": 3, ".instance": 1, "bullet.set_transform": 1, ".get_global_transform": 2, ".orthonormalized": 1, "get_parent": 1, ".add_child": 1, "bullet.set_linear_velocity": 1, ".basis": 1, "PS.body_add_collision_exception": 1, "bullet.get_rid": 1, "get_rid": 1, "#add": 1, "it": 1, ".play": 1, ".blend2_node_set_amount": 2, "/": 1, ".transition_node_set_current": 1, "min": 1, "state.set_angular_velocity": 1, ".set_active": 1, "Node2D": 1, "INITIAL_BALL_SPEED": 3, "ball_speed": 2, "screen_size": 2, "#default": 1, "ball": 3, "pad_size": 4, "PAD_SPEED": 1, "_process": 1, "get": 2, "positio": 1, "pad": 3, "rectangles": 1, "ball_pos": 8, ".get_pos": 5, "left_rect": 1, "pad_size*0.5": 2, "right_rect": 1, "#integrate": 1, "new": 1, "postion": 1, "direction*ball_speed*delta": 1, "#flip": 2, "when": 2, "touching": 2, "roof": 1, "or": 4, "floor": 1, "ball_pos.y": 1, "direction.y": 5, "<0)>": 1, "screen_size.y": 3, "change": 1, "increase": 1, "pads": 1, "left_rect.has_point": 1, "direction.x": 4, "right_rect.has_point": 1, "ball_speed*": 1, "randf": 1, "*2.0": 1, "direction.normalized": 1, "#check": 1, "gameover": 1, "ball_pos.x": 1, "<0>": 1, "screen_size.x": 1, "screen_size*0.5": 1, ".set_pos": 3, "#move": 2, "left": 1, "left_pos": 2, "left_pos.y": 4, "Input.is_action_pressed": 4, "PAD_SPEED*delta": 4, "right": 1, "right_pos": 2, "right_pos.y": 4, "get_viewport_rect": 1, ".size": 1, "actual": 1, "size": 1, ".get_texture": 1, ".get_size": 1, "set_process": 1 }, "GLSL": { "#version": 5, "uniform": 9, "sampler2D": 2, "texture": 2, ";": 431, "varying": 10, "vec3": 167, "color": 3, "vec2": 28, "texcoord": 4, "vec4": 81, "GetDiffuse": 2, "(": 491, ")": 491, "{": 107, "diffuse": 9, "color.rgb": 1, "*": 117, "texture2D": 7, "return": 48, "}": 107, "void": 59, "main": 10, "gl_FragData": 1, "[": 30, "]": 30, "gl_Color.rgb": 1, "gl_MultiTexCoord0.st": 1, "gl_Position": 2, "ftransform": 1, "////": 4, "High": 1, "quality": 2, "Some": 1, "browsers": 1, "may": 1, "freeze": 1, "or": 1, "crash": 1, "//#define": 10, "HIGHQUALITY": 2, "Medium": 1, "Should": 1, "be": 1, "fine": 1, "on": 3, "all": 1, "systems": 1, "works": 1, "Intel": 1, "HD2000": 1, "Win7": 1, "but": 1, "quite": 1, "slow": 1, "MEDIUMQUALITY": 2, "Defaults": 1, "REFLECTIONS": 3, "#define": 13, "SHADOWS": 5, "GRASS": 3, "SMALL_WAVES": 4, "RAGGED_LEAVES": 5, "DETAILED_NOISE": 3, "LIGHT_AA": 3, "//": 40, "sample": 2, "SSAA": 2, "HEAVY_AA": 2, "x2": 5, "RG": 1, "TONEMAP": 5, "Configurations": 1, "#ifdef": 14, "#endif": 14, "const": 19, "float": 107, "eps": 5, "PI": 3, "sunDir": 5, "-": 105, "skyCol": 4, "sandCol": 2, "treeCol": 2, "grassCol": 2, "leavesCol": 4, "leavesPos": 4, "sunCol": 5, "#else": 5, "exposure": 1, "Only": 1, "used": 1, "when": 1, "tonemapping": 1, "mod289": 4, "x": 11, "floor": 8, "/": 24, "permute": 4, "x*34.0": 1, "+": 108, "*x": 3, "taylorInvSqrt": 2, "r": 14, "snoise": 7, "v": 8, "C": 1, "/6.0": 1, "/3.0": 1, "D": 1, "i": 38, "dot": 30, "C.yyy": 2, "x0": 7, "C.xxx": 2, "g": 2, "step": 2, "x0.yzx": 1, "x0.xyz": 1, "l": 1, "i1": 2, "min": 11, "g.xyz": 2, "l.zxy": 2, "i2": 2, "max": 9, "x1": 4, "*C.x": 2, "/3": 1, "C.y": 1, "x3": 4, "D.yyy": 1, "D.y": 1, "p": 26, "i.z": 1, "i1.z": 1, "i2.z": 1, "i.y": 1, "i1.y": 1, "i2.y": 1, "i.x": 1, "i1.x": 1, "i2.x": 1, "n_": 2, "/7.0": 1, "ns": 4, "D.wyz": 1, "D.xzx": 1, "j": 4, "ns.z": 3, "mod": 2, "*7": 1, "x_": 3, "y_": 2, "N": 1, "*ns.x": 2, "ns.yyyy": 2, "y": 2, "h": 21, "abs": 2, "b0": 3, "x.xy": 1, "y.xy": 1, "b1": 3, "x.zw": 1, "y.zw": 1, "//vec4": 3, "s0": 2, "lessThan": 2, "*2.0": 4, "s1": 2, "sh": 1, "a0": 1, "b0.xzyw": 1, "s0.xzyw*sh.xxyy": 1, "a1": 1, "b1.xzyw": 1, "s1.xzyw*sh.zzww": 1, "p0": 5, "a0.xy": 1, "h.x": 1, "p1": 5, "a0.zw": 1, "h.y": 1, "p2": 5, "a1.xy": 1, "h.z": 1, "p3": 5, "a1.zw": 1, "h.w": 1, "//Normalise": 1, "gradients": 1, "norm": 1, "norm.x": 1, "norm.y": 1, "norm.z": 1, "norm.w": 1, "m": 8, "m*m": 1, "fbm": 2, "final": 5, "waterHeight": 4, "d": 10, "length": 7, "p.xz": 2, "sin": 8, "iGlobalTime": 7, "Island": 1, "waves": 3, "p*0.5": 1, "Other": 1, "bump": 2, "pos": 43, "rayDir": 43, "s": 23, "Fade": 1, "out": 1, "to": 1, "reduce": 1, "aliasing": 1, "dist": 7, "<": 23, "sqrt": 6, "Calculate": 1, "normal": 7, "from": 2, "heightmap": 1, "e": 1, "pos.x": 1, "iGlobalTime*0.5": 1, "pos.z": 2, "*0.7": 1, "*s": 4, "normalize": 14, "e.xyy": 1, "e.yxy": 1, "intersectSphere": 2, "rpos": 5, "rdir": 3, "rad": 2, "op": 5, "b": 5, "det": 11, "b*b": 2, "rad*rad": 2, "if": 29, "t": 44, "rdir*t": 1, "intersectCylinder": 1, "rdir2": 2, "rdir.yz": 1, "op.yz": 3, "rpos.yz": 2, "rdir2*t": 2, "pos.yz": 2, "intersectPlane": 3, "rayPos": 38, "n": 18, "sign": 1, "rotate": 5, "theta": 6, "c": 6, "cos": 4, "p.x": 2, "p.z": 2, "p.y": 1, "impulse": 2, "k": 8, "by": 1, "iq": 2, "k*x": 1, "exp": 2, "grass": 2, "Optimization": 1, "Avoid": 1, "noise": 1, "too": 1, "far": 1, "away": 1, "pos.y": 8, "tree": 2, "pos.y*0.03": 2, "mat2": 2, "m*pos.xy": 1, "width": 2, "clamp": 4, "scene": 7, "vtree": 4, "vgrass": 2, ".x": 4, "eps.xyy": 1, "eps.yxy": 1, "eps.yyx": 1, "plantsShadow": 2, "Soft": 1, "shadow": 4, "taken": 1, "for": 7, "int": 9, "rayDir*t": 2, "res": 6, "res.x": 3, "k*res.x/t": 1, "s*s*": 1, "intersectWater": 2, "rayPos.y": 1, "rayDir.y": 1, "intersectSand": 3, "intersectTreasure": 2, "intersectLeaf": 2, "openAmount": 4, "dir": 2, "offset": 5, "rayDir*res.w": 1, "pos*0.8": 2, "||": 3, "res.w": 6, "res2": 2, "dir.xy": 1, "dir.z": 1, "rayDir*res2.w": 1, "res2.w": 3, "&&": 10, "leaves": 7, "e20": 3, "sway": 5, "fract": 1, "upDownSway": 2, "angleOffset": 3, "Left": 1, "right": 1, "alpha": 3, "Up": 1, "down": 1, "k*10.0": 1, "p.xzy": 1, ".xzy": 2, "d.xzy": 1, "Shift": 1, "Intersect": 11, "individual": 1, "leaf": 1, "res.xyz": 1, "sand": 2, "resSand": 2, "//if": 1, "resSand.w": 4, "plants": 6, "resLeaves": 3, "resLeaves.w": 10, "e7": 3, "light": 5, "sunDir*0.01": 2, "col": 32, "n.y": 3, "lightLeaves": 3, "ao": 5, "sky": 5, "res.y": 2, "uvFact": 2, "uv": 12, "n.x": 1, "tex": 6, "iChannel0": 3, ".rgb": 2, "e8": 1, "traceReflection": 2, "resPlants": 2, "resPlants.w": 6, "resPlants.xyz": 2, "pos.xz": 2, "leavesPos.xz": 2, ".r": 3, "resLeaves.xyz": 2, "trace": 2, "resSand.xyz": 1, "treasure": 1, "chest": 1, "resTreasure": 1, "resTreasure.w": 4, "resTreasure.xyz": 1, "water": 1, "resWater": 1, "resWater.w": 4, "ct": 2, "fresnel": 2, "pow": 3, "trans": 2, "reflDir": 3, "reflect": 1, "refl": 3, "resWater.t": 1, "mix": 2, "camera": 8, "px": 4, "rd": 1, "iResolution.yy": 1, "iResolution.x/iResolution.y*0.5": 1, "rd.x": 1, "rd.y": 1, "gl_FragCoord.xy": 7, "*0.25": 4, "*0.5": 1, "Optimized": 1, "Haarm": 1, "Peter": 1, "Duiker": 1, "curve": 1, "col*exposure": 1, "x*": 2, ".5": 1, "gl_FragColor": 4, "v_color": 4, "mat4": 1, "u_MVPMatrix": 2, "attribute": 2, "a_position": 1, "a_color": 2, "core": 2, "cbar": 4, "cfoo": 2, "CB": 4, "CD": 4, "CA": 2, "CC": 2, "CBT": 10, "CDT": 6, "CAT": 2, "CCT": 2, "norA": 8, "norB": 6, "norC": 2, "norD": 2, "norE": 8, "norF": 2, "norG": 2, "norH": 2, "norI": 2, "norcA": 4, "norcB": 6, "norcC": 4, "norcD": 4, "head": 2, "of": 2, "cycle": 4, "norcE": 2, "lead": 2, "into": 2, "NUM_LIGHTS": 4, "AMBIENT": 2, "MAX_DIST": 3, "MAX_DIST_SQUARED": 3, "lightColor": 3, "fragmentNormal": 2, "cameraVector": 2, "lightVector": 4, "initialize": 1, "diffuse/specular": 1, "lighting": 1, "specular": 4, "the": 1, "fragment": 1, "and": 2, "direction": 1, "cameraDir": 2, "loop": 1, "through": 1, "each": 1, "calculate": 1, "distance": 1, "between": 1, "distFactor": 3, "lightDir": 3, "diffuseDot": 2, "halfAngle": 2, "specularColor": 2, "specularDot": 2, "sample.rgb": 1, "sample.a": 1, "static": 1, "char*": 1, "SimpleFragmentShader": 1, "STRINGIFY": 1, "FrontColor": 2, "kCoeff": 2, "kCube": 2, "uShift": 3, "vShift": 3, "chroma_red": 2, "chroma_green": 2, "chroma_blue": 2, "bool": 1, "apply_disto": 4, "input1": 4, "adsk_input1_w": 4, "adsk_input1_h": 3, "adsk_input1_aspect": 1, "adsk_input1_frameratio": 5, "adsk_result_w": 3, "adsk_result_h": 2, "distortion_f": 3, "f": 17, "r*r": 1, "inverse_f": 2, "lut": 9, "max_r": 2, "incr": 2, "lut_r": 5, ".z": 5, ".y": 2, "aberrate": 4, "chroma": 2, "chromaticize_and_invert": 2, "rgb_f": 5, "px.x": 2, "px.y": 2, "uv.x": 11, "uv.y": 7, "*2": 2, "uv.x*uv.x": 1, "uv.y*uv.y": 1, "else": 1, "rgb_uvs": 12, "rgb_f.rr": 1, "rgb_f.gg": 1, "rgb_f.bb": 1, "sampled": 1, "sampled.r": 1, "sampled.g": 1, ".g": 1, "sampled.b": 1, ".b": 1, "gl_FragColor.rgba": 1, "sampled.rgb": 1 }, "GN": { "import": 54, "(": 2261, ")": 2257, "assert": 111, "is_android": 36, "#": 285, "template": 61, "{": 1271, "forward_variables_from": 129, "invoker": 127, "[": 1455, "]": 1454, "_libraries_list": 5, "_find_deps_target_name": 2, "action": 48, "script": 50, "depfile": 61, "inputs": 66, "invoker.binary": 4, "android_readelf": 3, "outputs": 96, "rebased_binaries": 1, "rebase_path": 266, "root_build_dir": 255, "args": 192, "root_shlib_dir": 1, "}": 1267, "copy_ex": 1, "target_name": 77, "clear_dir": 1, "true": 61, "dest": 1, "invoker.dist_dir": 1, "data": 6, "_rebased_libraries_list": 1, "_rebased_binaries_list": 1, "if": 782, "defined": 402, "invoker.extra_files": 2, "_rebased_extra_files": 1, "+": 792, "deps": 208, "invoker.deps": 53, "_name": 1, "get_path_info": 11, "invoker.target": 3, "_output": 3, "root_out_dir": 3, "invoker.flag_name": 1, "enable_java_templates": 3, "set_sources_assignment_filter": 46, "invoker.sources": 14, "invoker.jni_package": 4, "jni_package": 2, "base_output_dir": 4, "package_output_dir": 2, "jni_output_dir": 6, "jni_generator_include": 4, "foreach_target_name": 2, "action_foreach": 2, "sources": 122, "enable_profiling": 4, "config": 47, "include_dirs": 9, "group": 34, "public_deps": 67, "public_configs": 12, "invoker.classes": 2, "invoker.jar_file": 2, "jar_file": 4, "else": 187, "android_sdk_jar": 6, "jni_actions": 3, "foreach": 22, "class": 3, "_classname_list": 3, "process_file_template": 4, "classname": 1, "jni_target_name": 2, "check_includes": 2, "false": 29, "_include_path": 3, "invoker.include_path": 2, "_apply_gcc_target_name": 2, "_base_gen_dir": 2, "invoker.inputs": 4, "invoker.defines": 2, "def": 2, "get_target_outputs": 12, "zip": 3, "output": 9, "base_dir": 4, "_srcjar_path": 3, "_rebased_srcjar_path": 1, "_rebased_sources": 2, "invoker.input": 3, "invoker.output": 9, "invoker.variables": 4, "variables": 3, "invoker.resources": 3, "invoker.res_dir": 2, "_base_path": 11, "_resources_zip": 10, "_build_config": 40, "write_build_config": 10, "build_config": 28, "resources_zip": 8, "type": 33, "possible_config_deps": 9, "rebased_resources": 1, "invoker.resource_dirs": 10, "base_path": 13, "zip_path": 6, "srcjar_path": 12, "r_text_path": 6, "build_config_target_name": 8, "process_resources_target_name": 2, "final_target_name": 4, "resource_dirs": 6, "invoker.generated_resource_dirs": 4, "invoker.android_manifest_dep": 6, "custom_package": 1, "||": 110, "android_manifest": 17, "r_text": 1, "srcjar": 1, "process_resources": 2, "shared_resources": 1, "_build_config_target_name": 4, "asset_sources": 1, "invoker.renaming_sources": 6, "invoker.renaming_destinations": 5, "_source_count": 3, "_": 2, "_dest_count": 3, "asset_renaming_sources": 1, "asset_renaming_destinations": 1, "extra_output_path": 1, "grit_target_name": 2, "grit_output_dir": 3, "grit": 1, "grit_flags": 1, "output_dir": 4, "resource_ids": 1, "source": 2, "invoker.grd_file": 1, "invoker.outputs": 1, "generate_strings_outputs": 2, "zip_target_name": 2, "visibility": 49, "invoker.grit_output_dir": 1, "invoker.generated_files": 1, "java_library_impl": 4, "supports_android": 15, "main_class": 2, "invoker.main_class": 8, "is_java_binary": 1, "testonly": 9, "_java_binary_target_name": 2, "_test_runner_target_name": 4, "test_runner_script": 3, "test_name": 3, "invoker.target_name": 5, "test_suite": 1, "test_type": 3, "ignore_all_data_deps": 1, "java_binary": 1, "output_name": 13, "bypass_platform_checks": 2, "wrapper_script_name": 1, "java_prebuilt_impl": 2, "invoker.jar_path": 15, "invoker.alternative_android_sdk_ijar": 3, "invoker.alternative_android_sdk_ijar_dep": 2, "requires_android": 13, "jar_excluded_patterns": 3, "deps_dex": 1, "strip_resource_classes": 1, "invoker.final_apk_path": 3, "invoker.apk_name": 5, "invoker.android_manifest": 14, "gen_dir": 1, "resources_zip_path": 3, "_all_resources_zip_path": 3, "_jar_path": 21, "_lib_dex_path": 4, "_rebased_lib_dex_path": 1, "_template_name": 6, "enable_multidex": 5, "invoker.enable_multidex": 4, "&&": 184, "final_dex_path": 5, "final_dex_target_name": 1, "_final_apk_path": 10, "_final_apk_path_no_ext_list": 2, "_final_apk_path_no_ext": 3, "Mark": 17, "as": 16, "used.": 17, "_install_script_name": 4, "invoker.install_script_name": 2, "_incremental_install_script_path": 4, "_version_code": 7, "android_default_version_code": 1, "invoker.version_code": 5, "_version_name": 7, "android_default_version_name": 1, "invoker.version_name": 5, "_keystore_path": 8, "android_keystore_path": 1, "_keystore_name": 8, "android_keystore_name": 1, "_keystore_password": 8, "android_keystore_password": 1, "invoker.keystore_path": 5, "invoker.keystore_name": 3, "invoker.keystore_password": 3, "_srcjar_deps": 15, "invoker.srcjar_deps": 9, "_use_chromium_linker": 6, "invoker.use_chromium_linker": 2, "_enable_relocation_packing": 3, "invoker.enable_relocation_packing": 2, "_load_library_from_apk": 8, "invoker.load_library_from_apk": 3, "_requires_sdk_api_level_23": 4, "invoker.requires_sdk_api_level_23": 2, "_native_libs_deps": 15, "_shared_libraries_is_valid": 3, "invoker.shared_libraries": 3, "_secondary_abi_native_libs_deps": 10, "mark": 1, "_secondary_abi_shared_libraries_is_valid": 3, "invoker.secondary_abi_shared_libraries": 3, "is_component_build": 10, "is_asan": 5, "_runtime_deps_file": 7, "write_runtime_deps": 3, "_native_lib_version_rule": 4, "invoker.native_lib_version_rule": 2, "_native_lib_version_arg": 2, "invoker.native_lib_version_arg": 2, "_secondary_abi_runtime_deps_file": 3, "_bad_deps": 1, "-": 6, "_android_manifest_deps": 8, "_android_manifest": 18, "_rebased_build_config": 9, "_create_abi_split": 5, "invoker.create_abi_split": 2, "_create_density_splits": 3, "invoker.create_density_splits": 4, "_create_language_splits": 2, "invoker.language_splits": 4, "_proguard_enabled": 8, "invoker.proguard_enabled": 8, "_proguard_output_jar_path": 3, "_emma_never_instrument": 9, "invoker.testonly": 2, "build_config_target": 2, "jar_path": 12, "dex_path": 7, "apk_path": 3, "incremental_apk_path": 1, "incremental_install_script_path": 1, "emma_coverage": 7, "proguard_enabled": 1, "proguard_info": 1, "shared_libraries_runtime_deps_file": 1, "secondary_abi_shared_libraries_runtime_deps_file": 1, "_final_deps": 9, "_generated_proguard_config": 3, "process_resources_target": 2, "all_resources_zip_path": 1, "generate_constant_ids": 1, "proguard_file": 1, "_enable_chromium_linker_tests": 3, "invoker.enable_chromium_linker_tests": 2, "_ordered_libraries_json": 4, "_rebased_ordered_libraries_json": 1, "_ordered_libraries_target": 2, "_rebased_android_readelf": 1, "java_cpp_template": 2, "package_name": 2, "defines": 72, "invoker.apk_under_test": 15, "is_java_debug": 2, "dcheck_always_on": 3, "java_target": 2, "override_build_config": 1, "srcjar_deps": 3, "emma_never_instrument": 1, "invoker.dist_ijar_path": 2, "_dist_ijar_path": 6, "Generates": 2, "the": 3, "build": 2, "file.": 2, "jar": 1, "_proguard_configs": 5, "invoker.proguard_configs": 6, "_proguard_target": 4, "proguard": 2, "output_jar_path": 5, "_rebased_proguard_configs": 3, "_apk_under_test_build_config": 4, "get_label_info": 35, "_rebased_apk_under_test_build_config": 2, "_dex_sources": 4, "_dex_deps": 3, "_copy_proguard_mapping_target": 2, "copy": 3, "dex": 4, "_dex_arg_key": 3, "_native_libs_file_arg_dep": 5, "_native_libs_file_arg": 5, "_secondary_abi_native_libs_file_arg_dep": 4, "_secondary_abi_native_libs_file_arg": 4, "_prepare_native_target_name": 4, "_native_libs_json": 6, "_rebased_native_libs_json": 2, "pack_relocation_section": 2, "file_list_json": 2, "libraries_filearg": 2, "_extra_native_libs": 6, "_extra_native_libs_deps": 5, "_extra_native_libs_even_when_incremental": 7, "_extra_native_libs_even_when_incremental_deps": 4, "is_debug": 15, "invoker.page_align_shared_libraries": 4, "android_gdbserver": 1, "invoker.loadable_modules": 3, "create_apk": 2, "assets_build_config": 1, "load_library_from_apk": 2, "create_density_splits": 1, "emma_instrument": 2, "extensions_to_not_compress": 2, "version_code": 2, "version_name": 2, "keystore_name": 5, "keystore_path": 5, "keystore_password": 5, "incremental_deps": 3, "native_libs_filearg": 2, "native_libs": 4, "native_libs_even_when_incremental": 2, "secondary_abi_native_libs_filearg": 1, "_manifest_rule": 2, "generate_split_manifest": 1, "main_manifest": 1, "out_manifest": 1, "split_name": 1, "_apk_rule": 2, "manifest_outputs": 2, "_create_incremental_script_rule_name": 2, "_rebased_apk_path_no_ext": 1, "_rebased_incremental_install_script_path": 2, "_rebased_depfile": 3, "_rebased_extra_native_libs": 1, "data_deps": 19, "_apk_target_name": 2, "apk_target": 2, "test_jar": 2, "incremental_install": 1, "android_apk": 2, "install_script_name": 1, "invoker.additional_apks": 4, "proguard_configs": 5, "dist_ijar_path": 1, "invoker.run_findbugs_override": 4, "run_findbugs_override": 1, "invoker.java_files": 15, "_use_native_activity": 2, "invoker.use_native_activity": 2, "invoker.shared_library": 4, "jinja_template": 1, "_native_library_name": 1, "input": 1, "apk_name": 2, "android_manifest_dep": 2, "final_apk_path": 1, "use_default_launcher": 2, "shared_libraries": 1, "host_os": 2, "aidl_path": 3, "framework_aidl": 2, "imports": 4, "invoker.interface_file": 3, "rebased_imports": 1, "invoker.import_include": 4, "rebased_import_includes": 1, "_java_files_build_rel": 2, "exec_script": 4, "_java_files": 12, "_protoc_dep": 3, "_protoc_out_dir": 1, "_protoc_bin": 2, "_proto_path": 2, "invoker.proto_path": 1, "android_library": 1, "chromium_code": 2, "java_files": 3, "_output_path": 5, "_unpack_target_name": 2, "_ignore_aidl": 2, "invoker.ignore_aidl": 2, "_ignore_assets": 2, "invoker.ignore_assets": 2, "_ignore_manifest": 2, "invoker.ignore_manifest": 2, "_ignore_native_libraries": 2, "invoker.ignore_native_libraries": 2, "_scanned_files": 1, "invoker.aar_path": 3, "_scanned_files.aidl": 1, "_scanned_files.assets": 1, "_scanned_files.has_native_libraries": 1, "_scanned_files.is_manifest_empty": 1, "_scanned_files.has_classes_jar": 3, "_scanned_files.subjars": 2, "Unzips": 1, "AAR": 1, "_scanned_files.resources": 4, "_scanned_files.has_proguard_flags": 2, "_res_target_name": 3, "android_resources": 1, "generated_resource_dirs": 1, "generated_resource_files": 1, "v14_skip": 1, "_subjar_targets": 3, "_tuple": 1, "_scanned_files.subjar_tuples": 1, "_current_target": 2, "java_prebuilt": 2, "_base_output_name": 1, "_jar_target_name": 3, "java_group": 1, "v8_test_isolation_mode": 7, "v8_isolate_run": 6, "isolate": 6, "current_cpu": 37, "is_mac": 19, "declare_args": 4, "treat_warnings_as_errors": 4, "android_full_debug": 2, "linux_use_bundled_binutils": 5, "linux_use_bundled_binutils_override": 1, "is_linux": 14, "binutils_path": 1, "enable_full_stack_frames_for_profiling": 2, "gold_path": 4, "is_win": 33, "msvs_xtree_patched": 1, "exclude_unwind_tables": 2, "is_chrome_branded": 1, "is_official_build": 7, "gdb_index": 2, "optimize_for_size": 3, "is_ios": 14, "fatal_linker_warnings": 2, "auto_profile_path": 2, "optimize_for_fuzzing": 5, "is_clang": 38, "is_nacl": 23, "update_args": 3, "llvm_force_head_revision": 1, "clang_revision": 1, "use_gold": 4, "use_debug_fission": 4, "cc_wrapper": 2, "root_gen_dir": 1, "asmflags": 9, "cflags": 126, "cflags_c": 3, "cflags_cc": 18, "cflags_objc": 4, "cflags_objcc": 5, "ldflags": 76, "configs": 58, "is_posix": 13, "See": 1, "http": 1, "//crbug.com/32204": 1, "is_chromeos": 7, "use_order_profiling": 2, "Use": 1, "pipes": 1, "for": 2, "communicating": 1, "between": 1, "sub": 1, "processes.": 1, "Faster.": 1, "using_sanitizer": 4, "use_cfi_diag": 2, "_rebased_android_toolchain_root": 1, "android_toolchain_root": 1, "use_lld": 6, "#if": 1, "is_lsan": 1, "is_tsan": 2, "is_msan": 2, "absolute_path": 1, "allow_posix_link_time_opt": 1, "is_cfi": 2, "use_thin_lto": 1, "arm_tune": 1, "mips_arch_variant": 10, "mips_use_msa": 2, "mips_float_abi": 1, "mips_fpu_mode": 4, "mips_dsp_rev": 2, "is_nacl_nonsfi": 1, "target_cpu": 5, "arm_use_thumb": 1, "Unreferenced": 2, "formal": 1, "function": 4, "parameter.": 1, "Alignment": 1, "of": 3, "a": 1, "member": 1, "was": 1, "sensitive": 1, "to": 4, "packing.": 1, "Conversion": 1, "possible": 1, "loss": 1, "data.": 2, "local": 1, "has": 1, "been": 1, "removed.": 1, "Default": 2, "constructor": 2, "could": 2, "not": 3, "be": 4, "generated.": 2, "Assignment": 1, "operator": 1, "Class": 1, "can": 20, "never": 1, "instantiated": 1, "required.": 1, "Narrowing": 1, "conversion.": 1, "Doesn": 1, "X": 1, "t": 1, "give": 1, "this": 20, "Unused": 1, "parameters.": 1, "use_xcode_clang": 2, "Warning": 2, "level": 2, "Disable": 4, "warning": 1, "when": 2, "forcing": 1, "value": 1, "bool.": 1, "TODO": 1, "jschuh": 1, "size_t": 1, "int.": 1, "Deprecated": 1, "warning.": 1, "is_ubsan_vptr": 1, "is_ubsan_security": 1, "common_optimize_on_cflags": 19, "Both": 1, "explicit": 1, "and": 2, "auto": 1, "inlining.": 1, "omitting": 1, "frame": 1, "pointers": 1, "must": 1, "after": 1, "/O2.": 1, "Improve": 1, "debugging": 1, "optimized": 1, "code.": 1, "Remove": 2, "unreferenced": 2, "COMDAT": 2, "faster": 1, "links": 1, ".": 5, "common_optimize_on_ldflags": 15, "Redundant": 1, "folding.": 1, "use_incremental_wpo": 2, "Link": 2, "time": 2, "code": 1, "generation.": 1, "full_wpo_on_official": 2, "arflags": 2, "symbol_level": 4, "Whole": 3, "program": 4, "optimization.": 4, "all": 1, "inlining": 1, "on": 20, "by": 1, "default": 1, "is_nacl_irt": 3, "optimization": 2, "whole": 1, "current_toolchain": 18, "default_toolchain": 11, "Produce": 1, "PDB": 1, "file": 20, "no": 1, "edit": 1, "continue.": 1, "is_win_fastlink": 1, "enable_dsyms": 2, "common_flags": 3, "v8_android_log_stdout": 2, "v8_enable_verify_heap": 2, "v8_deprecation_warnings": 2, "v8_imminent_deprecation_warnings": 5, "v8_embed_script": 4, "v8_enable_disassembler": 4, "v8_enable_gdbjit": 5, "v8_enable_handle_zapping": 2, "v8_enable_i18n_support": 10, "v8_enable_slow_dchecks": 2, "v8_interpreted_regexp": 2, "v8_object_print": 4, "v8_postmortem_support": 2, "v8_can_use_fpu_instructions": 3, "v8_use_mips_abi_hardfloat": 3, "v8_imminent_deprecation_warnings_default": 2, "v8_enable_gdbjit_default": 2, "v8_optimized_debug": 2, "v8_generated_peephole_source": 4, "v8_random_seed": 3, "v8_toolset_for_shell": 4, "###############################################################################": 5, "Only": 19, "targets": 19, "in": 19, "depend": 19, "this.": 19, "libs": 9, "host_toolchain": 6, "v8_use_external_startup_data": 12, "v8_current_cpu": 18, "arm_version": 1, "arm_fpu": 3, "arm_float_abi": 2, "host_cpu": 2, "v8_enable_backtrace": 1, "v8_extra_library_files": 1, "v8_experimental_extra_library_files": 1, "android_assets": 1, "renaming_sources": 1, "renaming_destinations": 3, "disable_compression": 1, "source_set": 5, "v8_use_snapshot": 3, "v8_source_set": 14, "rand_s": 1, "v8_snapshot_toolchain": 2, "v8_executable": 8, "want_v8_shell": 3, "v8_component": 1, "name": 6, "v8_fuzzer": 5, "clang_use_chrome_plugins": 1, "clang_base_path": 1, "buildconfig": 1, "secondary_source": 1, "check_targets": 1, "exec_script_whitelist": 1, "build_dotfile_settings.exec_script_whitelist": 1, "toolchain": 2, "invoker.ar": 2, "invoker.cc": 2, "invoker.cxx": 2, "invoker.ld": 2, "invoker.rebuild_define": 2, "rebuild_string": 2, "invoker.toolchain_args": 4, "invoker_toolchain_args": 2, "invoker_toolchain_args.current_cpu": 2, "invoker_toolchain_args.current_os": 1, "toolchain_args": 2, "invoker_toolchain_args.v8_current_cpu": 1, "toolchain_args.use_goma": 2, "toolchain_uses_goma": 3, "use_goma": 1, "toolchain_args.cc_wrapper": 2, "toolchain_cc_wrapper": 5, "compiler_prefix": 5, "cc": 2, "cxx": 3, "ar": 2, "ld": 2, "invoker.readelf": 2, "readelf": 4, "invoker.nm": 2, "nm": 4, "invoker.shlib_extension": 2, "default_shlib_extension": 4, "shlib_extension": 1, "invoker.executable_extension": 2, "default_executable_extension": 3, "invoker.libs_section_prefix": 2, "libs_section_prefix": 2, "invoker.libs_section_postfix": 2, "libs_section_postfix": 2, "invoker.solink_libs_section_prefix": 2, "solink_libs_section_prefix": 2, "invoker.solink_libs_section_postfix": 2, "solink_libs_section_postfix": 2, "invoker.extra_cflags": 3, "extra_cflags": 2, "invoker.extra_cppflags": 3, "extra_cppflags": 2, "invoker.extra_cxxflags": 3, "extra_cxxflags": 2, "invoker.extra_ldflags": 3, "extra_ldflags": 2, "lib_switch": 1, "lib_dir_switch": 1, "object_subdir": 1, "tool": 9, "command": 13, "depsformat": 3, "description": 9, "enable_resource_whitelist_generation": 5, "compile_wrapper": 2, "rspfile": 4, "whitelist_flag": 4, "ar_wrapper": 1, "rspfile_content": 4, "default_output_dir": 6, "default_output_extension": 5, "output_prefix": 3, "soname": 2, "e.g.": 3, "sofile": 12, "Possibly": 1, "including": 1, "dir.": 1, "pool": 3, "whitelist_file": 2, "invoker.strip": 6, "unstripped_sofile": 8, "tocfile": 3, "link_command": 1, "strip_switch": 2, "solink_wrapper": 1, "shlib_subdir": 2, "restat": 1, "link_output": 1, "depend_output": 1, "strip_command": 2, "invoker.loadable_module_extension": 2, "exename": 1, "outfile": 4, "unstripped_outfile": 4, "link_wrapper": 1, "invoker.link_outputs": 2, "stamp_command": 1, "stamp_description": 1, "copy_command": 1, "copy_description": 1, "invoker.toolprefix": 2, "toolprefix": 2, "gcc_toolchain": 1, "prefix": 1, "pkg_config": 2, "packages": 2, "shim_headers": 2, "root_path": 2, "headers": 2, "_java_target_whitelist": 3, "java_test_support": 1, "_java_target_blacklist": 3, "invoker.type": 1, "_is_prebuilt_binary": 2, "invoker.is_prebuilt_binary": 2, "_parent_invoker": 1, "invoker.invoker": 1, "_target_label": 6, "invoker.build_config": 11, "_deps_configs": 3, "invoker.possible_config_deps": 2, "_possible_dep": 4, "_dep_gen_dir": 3, "_dep_name": 3, "_rebased_deps_configs": 1, "is_java": 6, "is_apk": 9, "is_android_assets": 4, "is_android_resources": 6, "is_deps_dex": 5, "is_group": 3, "invoker.supports_android": 12, "invoker.requires_android": 8, "invoker.dex_path": 10, "invoker.bypass_platform_checks": 4, "apk_under_test_gen_dir": 1, "apk_under_test_name": 1, "apk_under_test_config": 2, "invoker.asset_sources": 2, "_rebased_asset_sources": 1, "invoker.asset_renaming_sources": 2, "_rebased_asset_renaming_sources": 1, "invoker.disable_compression": 2, "invoker.resources_zip": 4, "invoker.custom_package": 4, "invoker.r_text": 2, "invoker.shared_libraries_runtime_deps_file": 2, "invoker.secondary_abi_shared_libraries_runtime_deps_file": 2, "invoker.proguard_info": 1, "invoker.apk_path": 3, "_rebased_apk_path": 1, "_rebased_incremental_apk_path": 1, "invoker.incremental_apk_path": 1, "invoker.incremental_install_script_path": 1, "invoker.java_sources_file": 7, "invoker.srcjar": 2, "invoker.bundled_srcjars": 2, "_rebased_bundled_srcjars": 1, "invoker.input_jars_paths": 2, "_rebased_input_jars_paths": 1, "invoker.gradle_treat_as_prebuilt": 2, "_msg": 1, "_stamp_file": 3, "invoker.dest": 1, "rebased_sources": 1, "invoker.clear_dir": 2, "invoker.args": 10, "rebased_renaming_sources": 1, "_test_name": 1, "invoker.test_name": 1, "_test_type": 6, "invoker.test_type": 1, "_incremental_install": 4, "invoker.incremental_install": 2, "_runtime_deps": 3, "invoker.ignore_all_data_deps": 2, "_target_dir_name": 2, "_runtime_deps_target": 2, "test_runner_args": 15, "invoker.apk_target": 3, "invoker.executable_dist_dir": 3, "_apk_build_config": 2, "_rebased_apk_build_config": 2, "invoker.test_suite": 4, "_test_apk": 2, "invoker.test_jar": 1, "_apk_under_test": 2, "additional_apk": 3, "invoker.shard_timeout": 1, "generated_script": 4, "android_test_runner_script": 2, "rebased_android_sdk": 1, "android_sdk": 1, "rebased_android_sdk_build_tools": 3, "android_sdk_build_tools": 1, "rebased_android_sdk_jar": 4, "android_default_aapt_path": 3, "android_configuration_name": 2, "lint_suppressions_file": 3, "_cache_dir": 2, "_result_path": 6, "_config_path": 3, "_suppressions_file": 3, "_platform_xml_path": 3, "_rebased_lint_android_sdk_root": 1, "lint_android_sdk_root": 1, "invoker.create_cache": 2, "_rebased_java_sources_file": 2, "invoker.proguard_jar_path": 3, "_proguard_jar_path": 4, "_output_jar_path": 5, "invoker.output_jar_path": 4, "invoker.alternative_android_sdk_jar": 7, "_rebased_android_sdk_jar": 9, "proguard_verbose": 1, "_exclusions_file": 3, "findbugs_verbose": 1, "_main_class": 2, "_script_name": 1, "invoker.script_name": 1, "java_script": 3, "invoker.wrapper_script_args": 2, "invoker.bootclasspath": 2, "_enable_multidex": 3, "_main_dex_list_path": 5, "_main_dex_list_target_name": 2, "main_dex_rules": 3, "rebased_output": 2, "enable_incremental_dx": 1, "_input_jar_path": 2, "invoker.input_jar_path": 3, "_jar_excluded_patterns": 3, "invoker.jar_excluded_patterns": 2, "_strip_resource_classes": 3, "invoker.strip_resource_classes": 2, "_filter_jar": 2, "_proguard_preprocess": 2, "invoker.proguard_preprocess": 6, "_enable_assert": 2, "_retrolambda": 2, "use_java8": 2, "_deps": 24, "_previous_output_jar": 10, "_filter_target": 2, "_filter_input_jar": 3, "_filter_output_jar": 4, "invoker.public_deps": 10, "_proguard_input_jar": 3, "_proguard_output_jar": 3, "_proguard_config_path": 3, "invoker.proguard_preprocess_config": 1, "_rebased_input_paths": 1, "_assert_target": 2, "_assert_input_jar": 3, "_assert_output_jar": 4, "_retrolambda_target": 2, "_retrolambda_input_jar": 3, "_retrolambda_output_jar": 4, "_output_jar_target": 2, "_coverage_file": 3, "_source_dirs_listing_file": 3, "_emma_jar": 3, "emma_filter": 2, "_native_lib_placeholders": 4, "invoker.native_lib_placeholders": 2, "Used": 1, "deploying": 1, "APKs": 1, "invoker.native_libs": 6, "invoker.resource_packaged_apk_path": 4, "invoker.output_apk_path": 5, "_rebased_resource_packaged_apk_path": 1, "_rebased_packaged_apk_path": 1, "invoker.assets_build_config": 3, "invoker.write_asset_list": 2, "_rebased_dex_path": 1, "invoker.native_libs_filearg": 3, "_rebased_native_libs": 1, "invoker.secondary_abi_native_libs_filearg": 1, "android_app_secondary_abi": 2, "invoker.secondary_native_libs": 4, "_secondary_native_libs": 1, "invoker.emma_instrument": 4, "_emma_device_jar": 2, "_rebased_emma_device_jar": 1, "invoker.uncompress_shared_libraries": 2, "invoker.input_apk_path": 2, "zipalign_path": 1, "invoker.rezip_apk": 2, "_rezip_jar_path": 2, "invoker.base_path": 1, "_incremental_final_apk_path_helper": 2, "_incremental_final_apk_path": 2, "_dex_path": 11, "_incremental_deps": 5, "invoker.incremental_deps": 2, "_native_libs": 4, "_native_libs_even_when_incremental": 5, "invoker.native_libs_even_when_incremental": 2, "_base_apk_path": 5, "_resource_packaged_apk_path": 3, "_incremental_resource_packaged_apk_path": 3, "_packaged_apk_path": 3, "_incremental_packaged_apk_path": 3, "_shared_resources": 4, "invoker.shared_resources": 4, "_app_as_shared_lib": 4, "invoker.app_as_shared_lib": 4, "_split_densities": 5, "_split_languages": 5, "invoker.android_aapt_path": 4, "_android_aapt_path": 6, "_density": 1, "_language": 1, "invoker.extensions_to_not_compress": 2, "_package_resources_target_name": 2, "package_resources_helper": 2, "resource_packaged_apk_path": 4, "_generate_incremental_manifest_target_name": 3, "_incremental_android_manifest": 4, "_rebased_src_manifest": 1, "_rebased_incremental_manifest": 1, "disable_incremental_isolated_processes": 1, "_incremental_package_resources_target_name": 2, "package_target": 2, "package_apk": 2, "output_apk_path": 5, "_incremental_package_target": 2, "_dex_target": 3, "_has_native_libs": 2, "native_lib_placeholders": 1, "_finalize_apk_rule_name": 2, "finalize_apk": 3, "input_apk_path": 3, "rezip_apk": 1, "_incremental_finalize_apk_rule_name": 2, "_split_deps": 5, "_config": 3, "invoker.split_config": 1, "_type": 1, "invoker.split_type": 1, "_output_paths": 2, "_split": 4, "_split_rule": 4, "finalize_split": 2, "split_type": 2, "split_config": 2, "_supports_android": 19, "invoker.output_name": 14, "_output_name": 28, "_ijar_path": 2, "_jar_deps": 5, "invoker.jar_dep": 2, "_process_jar_target_name": 2, "_ijar_target_name": 4, "_dex_target_name": 2, "is_prebuilt_binary": 1, "process_java_prebuilt": 2, "input_jar_path": 3, "generate_interface_jar": 2, "input_jar": 4, "output_jar": 2, "_binary_script_target_name": 2, "java_binary_script": 2, "script_name": 4, "invoker.wrapper_script_name": 4, "_chromium_code": 11, "invoker.chromium_code": 4, "_requires_android": 6, "_enable_errorprone": 4, "use_errorprone_java_compiler": 1, "invoker.enable_errorprone": 2, "_provider_configurations": 3, "invoker.provider_configurations": 2, "_processors": 4, "_enable_interface_jars_javac": 3, "invoker.processors_javac": 2, "_processor_args": 3, "invoker.processor_args_javac": 2, "_additional_jar_files": 3, "invoker.additional_jar_files": 2, "invoker.enable_incremental_javac_override": 2, "_enable_incremental_javac": 3, "enable_incremental_javac": 1, "_manifest_entries": 3, "invoker.manifest_entries": 2, "_java_srcjars": 5, "invoker.srcjars": 5, "dep": 3, "_javac_target_name": 2, "_process_prebuilt_target_name": 2, "_final_target_name": 2, "_final_jar_path": 5, "_javac_jar_path": 6, "_process_prebuilt_jar_path": 5, "_final_ijar_path": 2, "_emma_instrument": 6, "_emma_instr_target_name": 2, "_rebased_jar_path": 1, "_rebased_java_srcjars": 1, "_android_sdk_ijar": 4, "_rebased_android_sdk_ijar": 1, "e": 8, "file_tuple": 4, "emma_instr": 1, "_accumulated_deps": 9, "target_dir_name": 1, "_run_findbugs": 5, "run_findbugs": 1, "arg": 1, "overridden.": 1, "invoker.emma_never_instrument": 2, "used": 1, "_java_sources_file": 5, "write_file": 1, "invoker.override_build_config": 2, "invoker.is_java_binary": 2, "java_sources_file": 3, "bundled_srcjars": 2, "d": 3, "_srcjars": 4, "_compile_java_target": 2, "compile_java": 1, "srcjars": 1, "_has_lint_target": 3, "android_lint": 1, "findbugs": 1, "invoker.zip_path": 1, "invoker.srcjar_path": 1, "invoker.r_text_path": 1, "non_constant_id": 3, "invoker.generate_constant_ids": 2, "_all_resource_dirs": 4, "_sources_build_rel": 2, "invoker.generated_resource_files": 2, "_rebased_all_resource_dirs": 1, "rebase_build_config": 1, "invoker.v14_skip": 2, "invoker.include_all_resources": 2, "invoker.all_resources_zip_path": 2, "all_resources_zip": 3, "invoker.proguard_file": 3, "rebased_build_config": 1, "dex_arg_key": 1, "invoker.excluded_jars": 2, "excluded_jars": 1, "invoker.main_manifest": 3, "invoker.out_manifest": 3, "invoker.split_name": 2, "invoker.has_code": 2, "invoker.file_list_json": 3, "invoker.libraries_filearg": 1, "_packed_libraries_dir": 2, "relocation_packer_target": 1, "relocation_packer_exe": 1, "invoker.arch_binary_target": 2, "_target_name": 36, "_all_target_cpu": 2, "additional_target_cpus": 1, "_all_toolchains": 2, "additional_toolchains": 1, "_arch_binary_target": 2, "_arch_binary_output": 2, "invoker.arch_binary_output": 2, "_index": 4, "_cpu": 1, "_toolchain": 1, "use_system_xcode": 3, "hermetic_xcode_path": 3, "_dsyms_output_dir": 1, "enable_stripping": 1, "_strip_all_in_config": 3, "invoker.configs": 2, "save_unstripped_output": 1, "invoker.product_type": 1, "invoker.bundle_extension": 2, "invoker.bundle_binary_target": 2, "_bundle_binary_target": 4, "_bundle_binary_output": 2, "invoker.bundle_binary_output": 2, "_bundle_extension": 1, "_bundle_root_dir": 4, "invoker.entitlements_target": 8, "_entitlements_path": 10, "invoker.entitlements_path": 6, "_entitlements_target_outputs": 4, "_enable_code_signing": 4, "ios_enable_code_signing": 1, "invoker.enable_code_signing": 2, "create_bundle": 1, "bundle_root_dir": 2, "bundle_resources_dir": 1, "bundle_executable_dir": 1, "bundle_plugins_dir": 1, "invoker.bundle_deps": 4, "code_signing_script": 1, "code_signing_sources": 1, "code_signing_outputs": 4, "ios_code_signing_identity": 2, "use_ios_simulator": 4, "invoker.extra_system_frameworks": 4, "_framework": 4, "code_signing_args": 5, "ios_sdk_name": 1, "invoker.info_plist": 4, "invoker.info_plist_target": 5, "_info_plist": 3, "_info_plist_target_output": 2, "info_plist": 3, "format": 2, "extra_substitutions": 4, "invoker.extra_substitutions": 2, "plist_templates": 1, "_arch_executable_source": 2, "_arch_executable_target": 2, "_lipo_executable_target": 2, "_generate_entitlements_target": 2, "_generate_entitlements_output": 4, "executable": 1, "output_prefix_override": 3, "lipo_binary": 3, "arch_binary_target": 3, "arch_binary_output": 3, "_generate_info_plist": 2, "ios_info_plist": 3, "executable_name": 3, "_gen_info_plist_outputs": 2, "_info_plist_path": 3, "_bundle_data_info_plist": 2, "bundle_data": 7, "create_signed_bundle": 3, "bundle_binary_target": 3, "bundle_binary_output": 3, "bundle_deps": 6, "product_type": 5, "bundle_extension": 5, "set_defaults": 4, "default_executable_configs": 3, "ios_app_bundle": 2, "invoker.source": 7, "_source_extension": 5, "_compile_xib": 2, "compile_xibs": 1, "ibtool_flags": 1, "ios_deployment_target": 1, "_convert_target": 2, "convert_plist": 1, "_has_public_headers": 5, "invoker.public_headers": 3, "_framework_headers_target": 2, "_framework_headers_config": 2, "_headers_map_config": 2, "_arch_shared_library_source": 2, "_arch_shared_library_target": 2, "_lipo_shared_library_target": 2, "shared_library": 1, "output_extension": 2, "_public_headers": 2, "_framework_root": 2, "_header_map_filename": 4, "_compile_headers_map_target": 2, "_create_module_map_target": 2, "_copy_public_headers_target": 2, "_framework_public_config": 2, "lib_dirs": 1, "_info_plist_target": 2, "_info_plist_bundle": 2, "default_shared_library_configs": 1, "_xctest_target": 8, "_xctest_output": 6, "_host_target": 2, "_host_output": 3, "_xctest_arch_loadable_module_target": 2, "_xctest_lipo_loadable_module_target": 2, "loadable_module": 1, "_xctest_info_plist_target": 2, "_xctest_info_plist_bundle": 2, "_xctest_bundle": 2, "_ios_platform_library": 1, "extra_system_frameworks": 1, "invoker.isolate": 3, "asan": 2, "msan": 2, "tsan": 2, "cfi_vptr": 2, "target_arch": 2, "configuration_name": 2, "component": 2, "icu_use_data_file": 1, "icu_use_data_file_flag": 2, "v8_enable_inspector": 1, "enable_inspector": 2, "use_external_startup_data": 2, "use_snapshot": 2, "v8_has_valgrind": 1, "has_valgrind": 2, "v8_gcmole": 1, "gcmole": 2 }, "Game Maker Language": { "var": 76, "jsonMap": 11, "fh": 7, ";": 773, "otz": 2, "date_get_timezone": 3, "(": 1050, ")": 1052, "date_set_timezone": 6, "timezone_utc": 1, "requestToCache": 3, "argument0": 28, "+": 208, "_piwikUrlEncode": 20, "string": 41, "current_year": 1, "current_month": 1, "current_day": 1, "current_hour": 1, "current_minute": 1, "current_second": 1, "if": 282, "file_exists": 1, "_Piwik_CacheFile": 5, "{": 194, "//Verify": 1, "cache": 2, "signature": 1, "to": 79, "make": 2, "sure": 1, "no": 1, "unwanted": 1, "heaven": 1, "-": 194, "forbid": 1, "malicious": 1, "requests": 3, "have": 1, "been": 1, "added.": 1, "curCacheSig": 2, "sha1_string_utf8": 2, "sha1_file": 2, "game_id": 4, "ini_open": 2, "_Piwik_IniFile": 2, "storedSig": 2, "ini_read_string": 1, "ini_close": 2, "string_count": 1, "file_text_open_read": 1, "cachedJson": 2, "base64_decode": 1, "file_text_read_string": 1, "file_text_close": 2, "json_decode": 1, "ds_exists": 1, "ds_type_map": 1, "ds_map_create": 7, "}": 212, "else": 110, "_PiwikDebugOutput": 1, "show_debug_message": 1, "//Start": 1, "with": 34, "a": 48, "fresh": 1, "since": 1, "the": 96, "old": 1, "one": 45, "is": 17, "corrupted.": 1, "An": 5, "ounce": 1, "of": 40, "lost": 1, "analytics": 1, "worth": 1, "pound": 1, "security.": 1, "is_undefined": 1, "[": 27, "]": 31, "ds_list_add": 9, "requestList": 3, "ds_list_create": 4, "ds_map_add_list": 1, "newCachedJson": 2, "json_encode": 1, "ds_map_destroy": 9, "file_text_open_write": 1, "file_text_write_string": 1, "base64_encode": 1, "cacheSig": 2, "ini_write_string": 1, "//Build": 5, "argument": 16, "map": 44, "args": 43, "//": 12, "//Required": 2, "ds_map_add": 40, "_Piwik_idsite": 2, "_Piwik_baseurl": 2, "room_get_name": 1, "room": 5, "_Piwik_id": 2, "round": 4, "random": 2, "//ds_map_add": 2, "//Pass": 5, "local": 4, "time": 2, "API": 2, "ctz": 4, "timezone_local": 2, "now": 8, "date_current_datetime": 2, "date_get_hour": 2, "date_get_minute": 2, "date_get_second": 2, "arg_keyval": 8, "for": 27, "i": 95, "<": 31, "argument_count": 3, "_piwikStringExplode": 2, "argstring": 8, "prevkey": 14, "ds_map_find_first": 3, "repeat": 3, "ds_map_size": 2, "ds_map_find_next": 3, "//Append": 2, "query": 6, "ds_list": 2, "be": 8, "sent": 2, "at": 25, "End": 2, "Step.": 2, "_PIWIK_REQS": 2, "display": 1, "resolution": 1, "display_get_width": 1, "display_get_height": 1, "language": 1, "os_get_language": 1, "stored": 1, "values": 5, "they": 5, "exist": 1, "_Piwik_idvc": 2, "_Piwik_idts": 2, "_Piwik_viewts": 2, "//draws": 1, "sprite": 2, "draw": 5, "true": 59, "facing": 17, "RIGHT": 10, "image_xscale": 5, "blinkToggle": 1, "state": 50, "CLIMBING": 5, "or": 69, "sprite_index": 12, "sPExit": 1, "sDamselExit": 1, "sTunnelExit": 1, "and": 146, "global.hasJetpack": 4, "not": 61, "whipping": 5, "draw_sprite_ext": 3, "x": 54, "y": 64, "image_yscale": 3, "image_angle": 3, "image_blend": 2, "image_alpha": 3, "//draw_sprite": 1, "draw_sprite": 9, "sJetpackBack": 1, "false": 53, "sJetpackRight": 1, "sJetpackLeft": 1, "redColor": 2, "make_color_rgb": 1, "holdArrow": 4, "ARROW_NORM": 2, "sArrowRight": 1, "ARROW_BOMB": 2, "holdArrowToggle": 2, "sBombArrowRight": 2, "LEFT": 7, "sArrowLeft": 1, "sBombArrowLeft": 2, "hangCountMax": 2, "//////////////////////////////////////": 2, "kLeft": 12, "checkLeft": 1, "kLeftPushedSteps": 3, "kLeftPressed": 2, "checkLeftPressed": 1, "kLeftReleased": 3, "checkLeftReleased": 1, "kRight": 12, "checkRight": 1, "kRightPushedSteps": 3, "kRightPressed": 2, "checkRightPressed": 1, "kRightReleased": 3, "checkRightReleased": 1, "kUp": 5, "checkUp": 1, "kDown": 5, "checkDown": 1, "//key": 1, "canRun": 1, "kRun": 2, "kJump": 6, "checkJump": 1, "kJumpPressed": 11, "checkJumpPressed": 1, "kJumpReleased": 5, "checkJumpReleased": 1, "cantJump": 3, "global.isTunnelMan": 1, "sTunnelAttackL": 1, "holdItem": 1, "kAttack": 2, "checkAttack": 2, "kAttackPressed": 2, "checkAttackPressed": 1, "kAttackReleased": 2, "checkAttackReleased": 1, "kItemPressed": 2, "checkItemPressed": 1, "xPrev": 1, "yPrev": 1, "stunned": 3, "dead": 3, "//////////////////////////////////////////": 2, "colSolidLeft": 4, "colSolidRight": 3, "colLeft": 6, "colRight": 6, "colTop": 4, "colBot": 11, "colLadder": 3, "colPlatBot": 6, "colPlat": 5, "colWaterTop": 3, "colIceBot": 2, "runKey": 4, "isCollisionMoveableSolidLeft": 1, "isCollisionMoveableSolidRight": 1, "isCollisionLeft": 2, "isCollisionRight": 2, "isCollisionTop": 1, "isCollisionBottom": 1, "isCollisionLadder": 1, "isCollisionPlatformBottom": 1, "isCollisionPlatform": 1, "isCollisionWaterTop": 1, "collision_point": 28, "oIce": 1, "checkRun": 1, "runHeld": 3, "HANGING": 10, "approximatelyZero": 4, "xVel": 24, "xAcc": 12, "platformCharacterIs": 23, "ON_GROUND": 18, "DUCKING": 4, "pushTimer": 3, "//if": 5, "SS_IsSoundPlaying": 2, "global.sndPush": 4, "playSound": 3, "runAcc": 2, "abs": 8, "alarm": 11, "floor": 2, "/": 1, "/xVel": 1, "instance_exists": 4, "oCape": 2, "oCape.open": 6, "kJumped": 7, "ladderTimer": 4, "ladder": 5, "oLadder": 4, "ladder.x": 3, "oLadderTop": 2, "yAcc": 26, "climbAcc": 2, "FALLING": 8, "STANDING": 2, "departLadderXVel": 2, "departLadderYVel": 1, "JUMPING": 6, "jumpButtonReleased": 7, "jumpTime": 8, "IN_AIR": 5, "gravityIntensity": 2, "yVel": 20, "RUNNING": 3, "jumps": 3, "//playSound": 1, "global.sndLand": 1, "grav": 22, "global.hasGloves": 3, "hangCount": 14, "*": 12, "yVel*0.3": 1, "oWeb": 2, "obj": 14, "instance_place": 3, "obj.life": 1, "initialJumpAcc": 6, "xVel/2": 3, "gravNorm": 7, "global.hasCape": 1, "jetpackFuel": 2, "fallTimer": 2, "global.hasJordans": 1, "yAccLimit": 2, "global.hasSpringShoes": 1, "global.sndJump": 1, "jumpTimeTotal": 2, "//let": 1, "character": 26, "continue": 4, "jump": 1, "jumpTime/jumpTimeTotal": 1, "looking": 2, "UP": 1, "LOOKING_UP": 4, "oSolid": 14, "move_snap": 6, "oTree": 4, "oArrow": 5, "instance_nearest": 1, "obj.stuck": 1, "//the": 2, "can": 5, "t": 31, "want": 5, "use": 4, "because": 2, "too": 1, "high": 1, "yPrevHigh": 1, "we": 10, "ll": 3, "move": 2, "correct": 1, "distance": 1, "but": 4, "need": 1, "shorten": 1, "out": 4, "little": 1, "ratio": 1, "xVelInteger": 2, "/dist*0.9": 1, "//can": 1, "changed": 1, "moveTo": 2, "xVelInteger*ratio": 1, "yVelInteger*ratio": 1, "slopeChangeInY": 1, "maxDownSlope": 1, "floating": 1, "just": 1, "above": 1, "slope": 1, "so": 6, "down": 1, "upYPrev": 1, "<=upYPrev+maxDownSlope;y+=1)>": 1, "hit": 1, "solid": 1, "below": 1, "upYPrev=": 1, "I": 7, "know": 1, "that": 5, "this": 14, "doesn": 1, "seem": 1, "sense": 1, "name": 1, "variable": 1, "it": 12, "all": 3, "works": 3, "correctly": 1, "after": 1, "break": 9, "loop": 3, "y=": 1, "figures": 1, "what": 1, "index": 10, "should": 29, "characterSprite": 1, "sets": 1, "previous": 2, "previously": 1, "statePrevPrev": 1, "statePrev": 2, "calculates": 1, "image_speed": 9, "based": 1, "on": 2, "s": 5, "velocity": 1, "runAnimSpeed": 1, "0": 17, "1": 23, "sqrt": 1, "sqr": 2, "climbAnimSpeed": 1, "<=>": 3, "4": 2, "setCollisionBounds": 3, "8": 9, "5": 8, "DUCKTOHANG": 1, "image_index": 1, "limit": 5, "animation": 1, "always": 3, "looks": 1, "good": 1, "///draw_menu": 2, "str": 10, "background": 10, "foreground": 8, "hpadding": 8, "vpadding": 12, "height": 20, "mouse_button": 2, "//Distributed": 2, "under": 2, "MIT": 2, "licence": 2, "/////////////////////////////////////////": 4, "//Height": 2, "box": 2, "//Menu": 2, "syntax": 2, "xx": 28, "yy": 28, "width": 20, "//A": 2, "hacky": 4, "thing": 2, "draws": 2, "first": 7, "item": 6, "properly": 4, "probably": 2, "fix": 2, "later": 2, "argument1": 10, "argument2": 4, "argument3": 2, "argument4": 2, "//argument5": 2, "argument5": 2, "argument6": 2, "argument7": 2, "mb": 4, "argument8": 2, "//This": 2, "main": 2, "mouse": 2, "button": 2, "added": 2, "give": 2, "more": 2, "choice": 2, "dev": 2, "//xx": 2, "corrected": 2, "are": 2, "placed": 2, "outside": 2, "will": 2, "lead": 2, "menu": 4, "being": 2, "cut": 2, "off": 2, "by": 6, "edge": 2, "item_list": 14, "item_string": 14, "///////////////////////////////////": 2, "string_length": 23, "//Parse": 2, "read": 2, "otherwise": 2, "yes": 2, "very": 2, "stupid": 2, "drawn": 2, "//For": 2, "some": 2, "reason": 2, "//But": 2, "perfectly": 2, "fine": 2, "an": 26, "escape": 4, "code": 4, "isn": 2, "go": 2, "any": 2, "further": 2, "next": 2, "backslash": 2, "//If": 2, "hasn": 2, "string_char_at": 12, "ii": 2, "string_width": 4, "//Add": 2, "new": 2, "list": 30, "//Reset": 2, "draw_set_color": 6, "//draw_rectangle": 2, "height*ds_list_size": 2, "//Background": 4, "temporary": 4, "draw_button": 2, "hpadding*2": 2, "height*": 2, "ds_list_size": 9, "": 2, "Go": 2, "through": 2, "items": 2, "draw_rectangle": 2, "Draw": 4, "rectange": 2, "re": 2, "doing": 2, "add": 2, "cool": 2, "effects": 2, "each": 19, "them": 2, "ds_list_find_value": 10, "draw_line": 2, "2": 10, "seperator": 2, "draw_text": 4, "10": 2, "padding": 2, "mouse_x": 4, "mouse_y": 4, "": 2, "mouse_check_button_released": 2, "//show_message": 2, "//Debugging": 2, "return": 54, "//Returns": 2, "number": 9, "in": 23, "already": 2, "returned": 2, "something": 3, "indicate": 2, "nothing": 2, "was": 3, "clicked": 2, "#define": 27, "__http_init": 3, "global.__HttpClient": 4, "object_add": 1, "object_set_persistent": 1, "__http_split": 3, "text": 11, "delimeter": 7, "count": 4, "while": 8, "string_pos": 15, "string_copy": 29, "__http_parse_url": 4, "url": 57, "colonPos": 22, "slashPos": 13, "real": 12, "queryPos": 12, "__http_resolve_url": 2, "baseUrl": 3, "refUrl": 18, "urlParts": 15, "refUrlParts": 5, "canParseRefUrl": 3, "result": 11, "ds_map_find_value": 22, "__http_resolve_path": 3, "ds_map_replace": 3, "ds_map_exists": 11, "ds_map_delete": 1, "path": 10, "relUrl": 1, "__http_construct_url": 2, "basePath": 4, "refPath": 7, "parts": 29, "refParts": 5, "lastPart": 3, "ds_list_delete": 5, "ds_list_destroy": 1, "part": 6, "ds_list_replace": 2, "__http_parse_hex": 2, "hexString": 4, "hexValues": 3, "digit": 4, "__http_prepare_request": 4, "client": 33, "headers": 11, "parsed": 18, "show_error": 2, "destroyed": 3, "CR": 10, "chr": 2, "LF": 5, "CRLF": 17, "socket": 19, "tcp_connect": 1, "errored": 19, "error": 18, "linebuf": 33, "line": 19, "statusCode": 6, "reasonPhrase": 2, "responseBody": 19, "buffer_create": 2, "responseBodySize": 5, "responseBodyProgress": 5, "responseHeaders": 9, "requestUrl": 2, "requestHeaders": 2, "write_string": 8, "key": 17, "is_string": 2, "socket_send": 1, "__http_parse_header": 3, "ord": 2, "headerValue": 9, "string_lower": 3, "headerName": 4, "__http_client_step": 2, "exit": 2, "socket_has_error": 1, "socket_error": 1, "__http_client_destroy": 20, "available": 7, "tcp_receive_available": 1, "switch": 1, "case": 3, "&&": 1, "tcp_eof": 2, "bytesRead": 6, "c": 20, "read_string": 7, "Reached": 2, "end": 11, "HTTP": 1, "defines": 1, "sequence": 2, "as": 1, "marker": 1, "protocol": 2, "elements": 1, "except": 2, "entity": 1, "body": 2, "see": 1, "appendix": 1, "19": 1, "3": 1, "tolerant": 1, "applications": 1, "Strip": 1, "trailing": 1, "First": 1, "status": 2, "The": 3, "Response": 1, "message": 1, "Status": 1, "Line": 1, "consisting": 1, "version": 1, "followed": 1, "numeric": 1, "its": 1, "associated": 1, "textual": 1, "phrase": 1, "element": 8, "separated": 1, "SP": 1, "characters": 3, "No": 3, "allowed": 1, "final": 1, "httpVer": 2, "spacePos": 11, "space": 2, "response": 5, "second": 1, "Other": 1, "Blank": 1, "write": 1, "remainder": 1, "write_buffer_part": 2, "Header": 1, "Receiving": 1, "write_buffer": 1, "transfer": 6, "encoding": 2, "chunked": 4, "Chunked": 1, "let": 1, "decode": 36, "actualResponseBody": 8, "actualResponseSize": 1, "actualResponseBodySize": 3, "Parse": 1, "chunks": 1, "chunk": 12, "size": 7, "extension": 3, "data": 4, "HEX": 1, "buffer_bytes_left": 6, "chunkSize": 11, "Read": 1, "byte": 2, "We": 1, "found": 21, "semicolon": 1, "beginning": 1, "skip": 1, "stuff": 1, "header": 2, "Doesn": 1, "did": 1, "buffer_destroy": 6, "empty": 13, "up": 5, "Parsing": 1, "failed": 53, "hex": 2, "hexadecimal": 1, "Is": 1, "bigger": 1, "than": 1, "remaining": 1, "responseHaders": 1, "location": 4, "resolved": 5, "socket_destroy": 1, "http_new_get": 1, "variable_global_exists": 2, "instance_create": 10, "http_new_get_ex": 1, "http_step": 1, "client.errored": 3, "||": 1, "client.state": 3, "http_status_code": 1, "client.statusCode": 1, "http_reason_phrase": 1, "client.error": 1, "client.reasonPhrase": 1, "http_response_body": 1, "client.responseBody": 1, "http_response_body_size": 1, "client.responseBodySize": 1, "http_response_body_progress": 1, "client.responseBodyProgress": 1, "http_response_headers": 1, "client.responseHeaders": 1, "http_destroy": 1, "instance_destroy": 2, "draw_menu": 1, "__jso_gmt_tuple": 1, "//Position": 1, "address": 1, "table": 1, "pos": 2, "addr_table": 2, "*argument_count": 1, "tuple": 1, "ca": 1, "isstr": 1, "datastr": 1, "//Check": 1, "Unexpected": 18, "position": 16, ".": 11, "f": 5, "JSON": 5, "string.": 5, "Cannot": 5, "parse": 3, "boolean": 3, "value": 13, "expecting": 9, "digit.": 9, "e": 4, "E": 4, "dot": 1, "integer": 6, "Expected": 6, "least": 6, "arguments": 26, "got": 6, "find": 10, "lookup.": 4, "indices": 1, "nested": 27, "lists": 6, "Index": 1, "overflow": 4, "Recursive": 1, "abcdef": 1, "Invalid": 1, "num": 1, "assert_true": 1, "_assert_error_popup": 2, "string_repeat": 2, "_assert_newline": 2, "assert_false": 1, "assert_equal": 1, "//Safe": 1, "equality": 1, "check": 1, "won": 1, "support": 1, "show_message": 1, "instead": 1, "_assert_debug_value": 1, "//String": 1, "os_browser": 1, "browser_not_a_browser": 1, "string_replace_all": 1, "//Numeric": 1, "GMTuple": 1, "jso_encode_string": 1, "encode": 8, "jso_encode_map": 4, "key1": 3, "key2": 3, "multi": 7, "jso_encode_list": 3, "three": 36, "_jso_decode_string": 5, "small": 1, "quick": 2, "brown": 2, "fox": 2, "over": 2, "lazy": 2, "dog.": 2, "simple": 1, "Waahoo": 1, "negg": 1, "mixed": 1, "_jso_decode_boolean": 2, "_jso_decode_real": 11, "standard": 1, "zero": 4, "signed": 2, "decimal": 1, "digits": 1, "positive": 7, "negative": 7, "exponent": 4, "_jso_decode_integer": 3, "_jso_decode_map": 14, "didn": 14, "include": 14, "right": 14, "prefix": 14, "#1": 14, "#2": 14, "entry": 29, "pi": 2, "bool": 2, "waahoo": 10, "woohah": 8, "mix": 4, "_jso_decode_list": 14, "woo": 2, "maps": 4, "Empty": 4, "equal": 20, "other.": 12, "junk": 2, "info": 1, "taxi": 1, "filled": 4, "map.": 2, "A": 24, "B": 18, "C": 8, "Maps": 8, "same": 4, "content": 4, "entered": 4, "different": 12, "orders": 4, "D": 1, "keys": 2, "six": 1, "corresponding": 4, "types": 4, "other": 4, "crash.": 4, "list.": 2, "Lists": 4, "two": 16, "entries": 2, "also": 2, "jso_map_check": 9, "existing": 9, "single": 11, "jso_map_lookup": 3, "wrong": 10, "trap": 2, "jso_map_lookup_type": 3, "type": 8, "four": 21, "inexistent": 11, "multiple": 20, "jso_list_check": 8, "jso_list_lookup": 3, "jso_list_lookup_type": 3, "inner": 1, "indexing": 1, "bad": 1, "jso_cleanup_map": 1, "one_map": 1, "global.levelType": 22, "//global.currLevel": 1, "global.currLevel": 22, "global.hadDarkLevel": 4, "global.startRoomX": 1, "global.startRoomY": 1, "global.endRoomX": 1, "global.endRoomY": 1, "oGame.levelGen": 2, "j": 14, "global.roomPath": 1, "k": 5, "global.lake": 3, "isLevel": 1, "999": 2, "global": 4, "levelType": 2, "16": 14, "656": 3, "oDark": 2, "invincible": 2, "sDark": 1, "oTemple": 2, "cityOfGold": 1, "sTemple": 2, "lake": 1, "i*16": 8, "j*16": 6, "oLush": 2, "obj.sprite_index": 4, "sLush": 2, "obj.invincible": 3, "oBrick": 1, "sBrick": 1, "global.cityOfGold": 2, "*16": 2, "//instance_create": 2, "oSpikes": 1, "background_index": 1, "bgTemple": 1, "global.temp1": 1, "global.gameStart": 3, "scrLevelGen": 1, "global.cemetary": 3, "rand": 10, "global.probCemetary": 1, "oRoom": 1, "scrRoomGen": 1, "global.blackMarket": 3, "scrRoomGenMarket": 1, "scrRoomGen2": 1, "global.yetiLair": 2, "scrRoomGenYeti": 1, "scrRoomGen3": 1, "scrRoomGen4": 1, "scrRoomGen5": 1, "global.darkLevel": 4, "global.noDarkLevel": 1, "global.probDarkLevel": 1, "oPlayer1.x": 2, "oPlayer1.y": 2, "oFlare": 1, "global.genUdjatEye": 4, "global.madeUdjatEye": 1, "global.genMarketEntrance": 4, "global.madeMarketEntrance": 1, "////////////////////////////": 2, "global.temp2": 1, "isRoom": 3, "scrEntityGen": 1, "oEntrance": 1, "global.customLevel": 1, "oEntrance.x": 1, "oEntrance.y": 1, "global.snakePit": 1, "global.alienCraft": 1, "global.sacrificePit": 1, "oPlayer1": 1, "scrSetupWalls": 3, "global.graphicsHigh": 1, "tile_add": 4, "bgExtrasLush": 1, "*rand": 12, "bgExtrasIce": 1, "bgExtrasTemple": 1, "bgExtras": 1, "global.murderer": 1, "global.thiefLevel": 1, "isRealLevel": 1, "oExit": 1, "oShopkeeper": 1, "obj.status": 1, "oTreasure": 1, "oWater": 1, "sWaterTop": 1, "sLavaTop": 1, "scrCheckWaterTop": 1, "global.temp3": 1 }, "Gnuplot": { "set": 98, "label": 14, "at": 14, "-": 102, "left": 15, "norotate": 18, "back": 23, "textcolor": 13, "rgb": 8, "nopoint": 14, "offset": 25, "character": 22, "lt": 15, "style": 7, "line": 4, "linetype": 11, "linecolor": 4, "linewidth": 11, "pointtype": 4, "pointsize": 4, "default": 4, "pointinterval": 4, "noxtics": 2, "noytics": 2, "title": 13, "xlabel": 6, "xrange": 3, "[": 18, "]": 18, "noreverse": 13, "nowriteback": 12, "yrange": 4, "bmargin": 1, "unset": 2, "colorbox": 3, "plot": 3, "cos": 9, "(": 52, "x": 7, ")": 52, "ls": 4, ".2": 1, ".4": 1, ".6": 1, ".8": 1, "lc": 3, "boxwidth": 1, "absolute": 1, "fill": 1, "solid": 1, "border": 3, "key": 1, "inside": 1, "right": 1, "top": 1, "vertical": 2, "Right": 1, "noenhanced": 1, "autotitles": 1, "nobox": 1, "histogram": 1, "clustered": 1, "gap": 1, "datafile": 1, "missing": 1, "data": 1, "histograms": 1, "xtics": 3, "in": 1, "scale": 1, "nomirror": 1, "rotate": 3, "by": 3, "autojustify": 1, "norangelimit": 3, "font": 8, "i": 1, "using": 2, "xtic": 1, "ti": 4, "col": 4, "u": 25, "SHEBANG#!gnuplot": 1, "reset": 1, "terminal": 1, "png": 1, "output": 1, "ylabel": 5, "#set": 2, "xr": 1, "yr": 1, "pt": 2, "notitle": 15, "dummy": 3, "v": 31, "arrow": 7, "from": 7, "to": 7, "head": 7, "nofilled": 7, "parametric": 3, "view": 3, "samples": 3, "isosamples": 3, "hidden3d": 2, "trianglepattern": 2, "undefined": 2, "altdiagonal": 2, "bentover": 2, "ztics": 2, "zlabel": 4, "zrange": 2, "sinc": 13, "sin": 3, "sqrt": 4, "u**2": 4, "+": 6, "v**2": 4, "/": 2, "GPFUN_sinc": 2, "xx": 2, "dx": 2, "x0": 4, "x1": 4, "x2": 4, "x3": 4, "x4": 4, "x5": 4, "x6": 4, "x7": 4, "x8": 4, "x9": 4, "splot": 3, "<": 10, "xmin": 3, "xmax": 1, "n": 1, "zbase": 2, ".5": 2, "*n": 1, "floor": 3, "u/3": 1, "*dx": 1, "%": 2, "u/3.*dx": 1, "/0": 1, "angles": 1, "degrees": 1, "mapping": 1, "spherical": 1, "noztics": 1, "urange": 1, "vrange": 1, "cblabel": 1, "cbrange": 1, "user": 1, "origin": 1, "screen": 2, "size": 1, "front": 1, "bdefault": 1, "*cos": 1, "*sin": 1, "with": 3, "lines": 2, "labels": 1, "point": 1, "lw": 1, ".1": 1, "tc": 1, "pal": 1 }, "Go": { "package": 3, "proto": 1, "import": 4, "proto1": 1, "math": 1, "var": 13, "_": 6, "proto1.Marshal": 1, "math.Inf": 1, "//": 39, "type": 35, "ClientCmdID": 4, "struct": 33, "{": 326, "Nanoseconds": 1, "since": 1, "Unix": 1, "epoch.": 1, "WallTime": 1, "int64": 21, "protobuf": 81, "json": 111, "Random": 1, "XXX_unrecognized": 30, "[": 55, "]": 54, "byte": 46, "}": 325, "func": 161, "(": 360, "m": 182, "*ClientCmdID": 4, ")": 396, "Reset": 30, "*m": 30, "String": 30, "string": 34, "return": 181, "proto1.CompactTextString": 30, "ProtoMessage": 30, "GetWallTime": 1, "if": 82, "nil": 132, "m.WallTime": 1, "GetRandom": 1, "m.Random": 1, "RequestHeader": 14, "Timestamp": 3, "specifies": 4, "time": 3, "at": 2, "which": 2, "read": 1, "or": 1, "writes": 1, "should": 3, "be": 7, "performed.": 1, "If": 3, "the": 19, "timestamp": 1, "is": 9, "set": 1, "to": 13, "zero": 1, "value": 8, "its": 1, "initialized": 1, "wall": 1, "of": 4, "receiving": 2, "node.": 2, "CmdID": 2, "optionally": 1, "specified": 1, "for": 8, "request": 4, "idempotence": 1, "i.e.": 1, "replay": 1, "protection": 1, ".": 3, "The": 2, "key": 4, "request.": 2, "operates": 1, "on": 1, "a": 16, "range": 2, "this": 5, "represents": 1, "starting": 1, "range.": 2, "Key": 5, "End": 1, "empty": 2, "spans": 1, "only": 2, "single": 1, "key.": 1, "EndKey": 2, "User": 2, "originating": 1, "user.": 1, "Used": 1, "lookup": 1, "priority": 2, "when": 1, "scheduling": 1, "queued": 1, "operations": 1, "target": 1, "Replica": 3, "destination": 1, "This": 4, "specific": 1, "instance": 1, "available": 1, "replicas": 1, "belonging": 1, "RangeID.": 1, "RaftID": 2, "ID": 1, "Raft": 1, "consensus": 1, "group": 1, "belongs": 1, "to.": 1, "used": 1, "by": 1, "node": 1, "route": 1, "correct": 1, "UserPriority": 1, "multiple": 1, "non": 2, "-": 4, "transactional": 1, "commands.": 1, "positive": 1, "integer": 1, "It": 1, "t": 1, "exist": 1, "returns": 1, "Value.Bytes.": 1, "GetResponse": 3, "ResponseHeader": 14, "Value": 14, "*Value": 4, "*GetResponse": 6, "GetValue": 5, "m.Value": 3, "PutRequest": 3, "*PutRequest": 6, "PutResponse": 3, "*PutResponse": 5, "ConditionalPutRequest": 3, "put.": 1, "ExpValue.Bytes": 1, "test": 1, "existence.": 1, "Specify": 1, "as": 1, "indicate": 1, "there": 1, "no": 2, "existing": 1, "entry.": 1, "different": 1, "from": 1, "expectation": 1, "that": 2, "exists": 1, "but": 1, "empty.": 1, "ExpValue": 1, "*ConditionalPutRequest": 7, "GetExpValue": 1, "m.ExpValue": 1, "ConditionalPutResponse": 3, "*ConditionalPutResponse": 5, "IncrementRequest": 3, "Increment": 3, "*IncrementRequest": 6, "GetIncrement": 3, "m.Increment": 3, "IncrementResponse": 3, "NewValue": 1, "*IncrementResponse": 6, "GetNewValue": 1, "m.NewValue": 1, "DeleteRequest": 3, "*DeleteRequest": 5, "DeleteResponse": 3, "*DeleteResponse": 5, "DeleteRangeRequest": 3, "*all*": 1, "entries": 2, "between": 1, "inclusive": 1, "and": 3, "exclusive": 1, "are": 2, "deleted.": 1, "Must": 2, "MaxEntriesToDelete": 1, "*DeleteRangeRequest": 6, "GetMaxEntriesToDelete": 1, "m.MaxEntriesToDelete": 1, "DeleteRangeResponse": 3, "Number": 1, "removed.": 1, "NumDeleted": 1, "*DeleteRangeResponse": 6, "GetNumDeleted": 1, "m.NumDeleted": 1, "ScanRequest": 3, "MaxResults": 2, "*ScanRequest": 6, "GetMaxResults": 2, "m.MaxResults": 2, "ScanResponse": 3, "Empty": 1, "rows": 1, "were": 1, "scanned.": 1, "Rows": 1, "KeyValue": 2, "*ScanResponse": 6, "GetRows": 1, "m.Rows": 1, "EndTransactionRequest": 3, "False": 1, "abort": 1, "rollback.": 1, "Commit": 1, "bool": 5, "Optional": 1, "commit": 2, "triggers.": 1, "Note": 1, "triggers": 1, "internal": 1, "use": 1, "will": 1, "ignored": 1, "requested": 1, "through": 1, "public": 1, "facing": 1, "KV": 1, "API.": 1, "SplitTrigger": 1, "*SplitTrigger": 2, "MergeTrigger": 1, "*MergeTrigger": 2, "*EndTransactionRequest": 8, "GetCommit": 1, "m.Commit": 1, "false": 4, "GetSplitTrigger": 1, "m.SplitTrigger": 1, "GetMergeTrigger": 1, "m.MergeTrigger": 1, "EndTransactionResponse": 3, "Remaining": 1, "ns": 1, "CommitWait": 1, "*EndTransactionResponse": 6, "GetCommitWait": 1, "m.CommitWait": 1, "ReapQueueRequest": 3, "Maximum": 1, "results": 1, ";": 1, "must": 1, "*ReapQueueRequest": 6, "ReapQueueResponse": 3, "Messages": 1, "*ReapQueueResponse": 6, "GetMessages": 1, "m.Messages": 1, "EnqueueUpdateRequest": 3, "*EnqueueUpdateRequest": 5, "EnqueueUpdateResponse": 3, "*EnqueueUpdateResponse": 5, "EnqueueMessageRequest": 3, "Message": 1, "delivery": 1, "inbox.": 1, "Msg": 1, "*EnqueueMessageRequest": 6, "GetMsg": 1, "m.Msg": 1, "EnqueueMessageResponse": 3, "*EnqueueMessageResponse": 5, "RequestUnion": 5, "Contains": 2, "*ContainsRequest": 3, "Get": 2, "*GetRequest": 3, "Put": 2, "ConditionalPut": 2, "Delete": 2, "DeleteRange": 2, "Scan": 2, "EndTransaction": 2, "ReapQueue": 2, "EnqueueUpdate": 2, "EnqueueMessage": 2, "*RequestUnion": 16, "GetContains": 2, "m.Contains": 2, "GetGet": 2, "m.Get": 2, "GetPut": 2, "m.Put": 2, "GetConditionalPut": 2, "m.ConditionalPut": 2, "GetDelete": 2, "m.Delete": 2, "GetDeleteRange": 2, "m.DeleteRange": 2, "GetScan": 2, "m.Scan": 2, "GetEndTransaction": 2, "m.EndTransaction": 2, "GetReapQueue": 2, "m.ReapQueue": 2, "GetEnqueueUpdate": 2, "m.EnqueueUpdate": 2, "GetEnqueueMessage": 2, "m.EnqueueMessage": 2, "ResponseUnion": 5, "*ContainsResponse": 3, "*ResponseUnion": 16, "BatchRequest": 3, "Requests": 1, "*BatchRequest": 3, "GetRequests": 1, "m.Requests": 1, "BatchResponse": 3, "Responses": 1, "*BatchResponse": 3, "GetResponses": 1, "m.Responses": 1, "AdminSplitRequest": 3, "SplitKey": 1, "*AdminSplitRequest": 2, "AdminSplitResponse": 3, "*AdminSplitResponse": 2, "AdminMergeRequest": 3, "SubsumedRange": 1, "RangeDescriptor": 3, "*AdminMergeRequest": 3, "GetSubsumedRange": 1, "m.SubsumedRange": 1, "AdminMergeResponse": 3, "*AdminMergeResponse": 2, "init": 2, "interface": 5, "this.Contains": 6, "this.Get": 6, "this.Put": 6, "this.ConditionalPut": 6, "this.Increment": 6, "this.Delete": 6, "this.DeleteRange": 6, "this.Scan": 6, "this.EndTransaction": 6, "this.ReapQueue": 6, "this.EnqueueUpdate": 6, "this.EnqueueMessage": 6, "SetValue": 2, "switch": 2, "vt": 26, "value.": 2, "case": 24, "default": 2, "true": 2, "resource": 1, "bindataRead": 7, "data": 2, "name": 10, "error": 13, "gz": 2, "err": 25, "gzip.NewReader": 1, "bytes.NewBuffer": 1, "fmt.Errorf": 2, "buf": 2, "bytes.Buffer": 1, "io.Copy": 1, "&": 7, "clErr": 2, "gz.Close": 1, "buf.Bytes": 1, "asset": 13, "bytes": 19, "info": 19, "os.FileInfo": 1, "bindataFileInfo": 13, "size": 7, "mode": 7, "os.FileMode": 8, "modTime": 7, "time.Time": 2, "fi": 6, "Name": 1, "fi.name": 1, "Size": 1, "fi.size": 1, "Mode": 1, "fi.mode": 1, "ModTime": 1, "fi.modTime": 1, "IsDir": 1, "Sys": 1, "_uiCssAppCss": 2, "uiCssAppCssBytes": 2, "uiCssAppCss": 1, "time.Unix": 6, "_uiCssGraphCss": 2, "uiCssGraphCssBytes": 2, "uiCssGraphCss": 1, "_uiCssLibsNvd3171NvD3MinCss": 2, "uiCssLibsNvd3171NvD3MinCssBytes": 2, "uiCssLibsNvd3171NvD3MinCss": 1, "_uiCssRest_explorerCss": 2, "uiCssRest_explorerCssBytes": 2, "uiCssRest_explorerCss": 1, "_uiIndexHtml": 2, "uiIndexHtmlBytes": 2, "uiIndexHtml": 1, "_uiJsAppJs": 2, "uiJsAppJsBytes": 2, "uiJsAppJs": 1, "_uiJsLibsD3335D3MinJs": 1, "linguist": 1, "thrift.ZERO": 1, "fmt.Printf": 1, "bytes.Equal": 1 }, "Golo": { "module": 27, "samples.Adapters": 1, "local": 27, "function": 87, "list_sample": 2, "|": 228, "fabric": 7, "{": 151, "println": 170, "(": 642, ")": 644, "let": 91, "carbonCopy": 5, "list": 27, "[": 33, "]": 33, "conf": 4, "map": 10, "super": 2, "name": 9, "args": 44, "if": 7, "length": 8, "add": 22, "get": 16, "}": 150, "else": 5, "return": 28, "invokeWithArguments": 6, "maker": 2, "newInstance": 2, "+": 114, "getClass": 3, "runnable_sample": 2, "result": 13, "array": 2, "this": 29, "for": 2, "var": 5, "i": 20, "<": 3, "set": 13, "runner": 4, "run": 7, "toString": 5, "oftype": 2, "java.io.Serializable.class": 1, "java.lang.Runnable.class": 1, "main": 27, "AdapterFabric": 1, "samples.AsyncHelpers": 1, "import": 32, "gololang.Async": 1, "java.util.concurrent.TimeUnit": 1, "java.util.concurrent.Executors": 1, "fib": 15, "n": 17, "<=>": 3, "1": 6, "2": 3, "executor": 11, "newCachedThreadPool": 1, "Let": 1, "s": 1, "do": 1, "some": 1, "useless": 1, "asynchronous": 1, "operations": 1, "f": 9, "enqueue": 2, "Thread": 5, "sleep": 1, "1000_L": 1, "666": 1, "onSet": 5, "v": 22, "onFail": 2, "e": 42, "-": 58, "cancel": 1, "true": 4, "Thread.sleep": 4, "_L": 6, "fib_10": 3, "promise": 5, "fib_20": 3, "fib_30": 3, "fib_40": 3, "futures": 2, "future": 5, "submit": 6, "all": 1, "results": 2, "truth": 3, "shutdown": 2, "awaitTermination": 2, "SECONDS": 1, "samples.Augmentations": 1, "java.util.LinkedList": 5, "augment": 4, "java.util.List": 2, "with": 4, "value": 8, "java.util.Collection": 1, "doToEach": 2, "func": 12, "foreach": 11, "element": 8, "in": 11, "LinkedList": 4, "Closures": 1, "sayHello": 3, "who": 2, "adder": 5, "a": 22, "b": 14, "addToTen": 3, "bindTo": 5, "adding": 3, "x": 19, "y": 16, "addingTen": 2, "pump_it": 2, "CoinChange": 1, "change": 9, "money": 5, "coins": 13, "match": 2, "when": 5, "then": 5, "or": 1, "isEmpty": 1, "otherwise": 2, "head": 1, "tail": 1, "append": 7, "samples.CollectionLiterals": 1, "play_with_tuples": 2, "hello": 6, "str": 2, "print": 1, "join": 3, "play_with_literals": 2, "data": 4, "tuple": 1, "vector": 1, "each": 1, "#": 18, "samples.ContextDecorator": 1, "gololang.Decorators": 3, "myContext": 3, "defaultContext": 1, "count": 4, "define": 5, "require": 1, "throw": 1, "@withContext": 1, "foo": 17, "withContext": 1, "*a": 2, "try": 19, "catch": 19, "samples.Decorators": 1, "simple_decorator": 1, "@simple_decorator": 1, "simple_adder": 2, "decorator_with_params": 1, "param1": 2, "param2": 2, "@decorator_with_params": 1, "parametrized_adder": 2, "generic_decorator": 1, "args...": 3, "@generic_decorator": 4, "generic_adder0": 2, "generic_adder1": 2, "generic_adder2": 2, "generic_adder3": 2, "z": 2, "list_sum_decorator": 1, "@list_sum_decorator": 1, "sum": 2, "acc": 6, "elem": 2, "samples.DynamicEvaluation": 1, "gololang.EvaluationEnvironment": 1, "test_asModule": 2, "env": 25, "code": 12, "mod": 6, "asModule": 1, "fun": 6, "test_anonymousModule": 2, "anonymousModule": 1, "test_asFunction": 2, "asFunction": 1, "test_def": 2, "def": 1, "test_run": 2, "test_run_map": 2, "values": 3, "java.util.TreeMap": 1, "EvaluationEnvironment": 1, "samples.DynamicObjectPerson": 1, "mrbean": 5, "DynamicObject": 1, "email": 3, "bean": 4, "EchoArgs": 1, "arg": 2, "range": 4, "sample.EnumsThreadState": 1, "java.lang.Thread": 2, "State": 1, "new": 3, "State.NEW": 1, "ordinal": 2, "State.values": 1, "samples.Fibonacci": 1, "java.lang.System": 2, "start": 10, "System": 2, "currentTimeMillis": 2, "40": 1, "duration": 5, "took": 1, "ms": 1, "while": 2, "hello.World": 1, "samples.WebServer": 1, "java.lang": 2, "java.net.InetSocketAddress": 2, "com.sun.net.httpserver": 2, "com.sun.net.httpserver.HttpServer": 2, "server": 8, "HttpServer.create": 2, "InetSocketAddress": 2, "createContext": 3, "exchange": 27, "headers": 2, "getResponseHeaders": 4, "response": 6, "StringBuilder": 1, "getRequestURI": 1, "java.util.Date": 1, "sendResponseHeaders": 4, "getResponseBody": 3, "write": 3, "getBytes": 3, "close": 5, "stop": 1, "samples.LogDeco": 1, "log1": 2, "msg": 2, "@log1": 2, "bar": 2, "@sayHello": 1, "baz": 2, "log2": 4, "msgBefore": 2, "msgAfter": 2, "res": 2, "@log2": 1, "spam": 2, "logEnterExit": 1, "@logEnterExit": 1, "egg": 2, "strange_use": 2, "Matching": 1, "what_it_could_be": 2, "item": 10, "contains": 1, "startsWith": 3, "samples.MaxInt": 1, "max_int": 2, "java.lang.Integer.MAX_VALUE": 1, "samples.MemoizeDecorator": 1, "memo": 2, "memoizer": 1, "@memo": 1, "System.currentTimeMillis": 4, "run2": 2, "DealingWithNull": 1, "java.util": 1, "contacts": 3, "larry": 2, "orIfNull": 3, "street": 1, "number": 1, "samples.PrepostDecorator": 1, "isInteger": 4, "isOfType": 1, "Integer.class": 1, "@checkResult": 1, "isString": 2, "andThen": 4, "lengthIs": 1, "@checkArguments": 4, "isPositive": 3, "myCheck": 1, "checkArguments": 1, "@myCheck": 1, "inv": 3, "/": 1, "isPositiveInt": 2, "mul": 3, "*": 1, "isNumber": 1, "num": 7, "isNotNull": 1, "notnull": 3, "_F": 3, "null": 2, "StructDemo": 1, "struct": 1, "Point": 4, "StructDemo.types.Point": 1, "move": 2, "offsetX": 4, "offsetY": 4, "relative": 2, "p1": 15, "p2": 3, "p3": 4, "frozenCopy": 2, "p4": 3, "hashCode": 4, "members": 1, "p5": 3, "ImmutablePoint": 1, "expected": 2, "getMessage": 1, "samples.SwingActionListener": 1, "java.awt.event": 1, "javax.swing": 2, "javax.swing.WindowConstants": 2, "listener": 2, "handler": 2, "asInterfaceInstance": 1, "ActionListener.class": 2, "frame": 10, "JFrame": 2, "setDefaultCloseOperation": 2, "EXIT_ON_CLOSE": 2, "button": 7, "JButton": 1, "setFont": 2, "getFont": 2, "deriveFont": 2, "addActionListener": 3, "event": 3, "to": 3, "getContentPane": 2, "pack": 2, "setVisible": 2, "samples.SwingHelloWorld": 1, "label": 4, "JLabel": 1, "samples.TemplatesChatWebapp": 1, "java.io": 1, "redirect": 2, "respond": 2, "body": 3, "extract_post": 2, "posts": 7, "reader": 4, "BufferedReader": 1, "InputStreamReader": 1, "getRequestBody": 1, "line": 5, "readLine": 2, "isnt": 1, "java.net.URLDecoder.decode": 1, "substring": 1, "index": 2, "template": 2, "getRequestMethod": 1, "index_template": 2, "index_tpl": 2, "gololang.TemplateEngine": 1, "compile": 1, "java.util.concurrent.ConcurrentLinkedDeque": 1, "MoreCoolContainers": 1, "dyn": 7, "DynamicVariable": 1, "t1": 3, "withValue": 2, "t2": 3, "Observable": 1, "onChange": 2, "mapped": 2, "Workers": 1, "java.util.concurrent": 1, "gololang.concurrent.workers.WorkerEnvironment": 1, "pusher": 2, "queue": 5, "message": 4, "offer": 1, "generator": 2, "port": 2, "send": 3, "WorkerEnvironment.builder": 1, "withFixedThreadPool": 1, "ConcurrentLinkedQueue": 1, "pusherPort": 2, "spawn": 3, "generatorPort": 2, "finishPort": 2, "any": 1, "reduce": 1, "next": 2 }, "Gosu": { "<%!-->": 1, "defined": 1, "in": 3, "Hello": 2, "gst": 1, "<": 2, "%": 2, "@": 1, "params": 1, "(": 122, "users": 2, "Collection": 1, "": 1, ")": 123, "<%>": 2, "for": 2, "user": 1, "{": 72, "user.LastName": 1, "}": 72, "user.FirstName": 1, "user.Department": 1, "package": 3, "example": 2, "enhancement": 1, "String": 14, "function": 16, "toPerson": 1, "Person": 7, "var": 17, "vals": 4, "this.split": 1, "return": 17, "new": 8, "[": 4, "]": 4, "as": 7, "int": 2, "Relationship.valueOf": 2, "hello": 1, "print": 3, "uses": 8, "java.util.*": 1, "java.io.File": 1, "class": 2, "extends": 1, "Contact": 1, "implements": 1, "IEmailable": 2, "_name": 4, "_age": 3, "Integer": 3, "Age": 1, "_relationship": 2, "Relationship": 3, "readonly": 1, "RelationshipOfPerson": 1, "delegate": 1, "_emailHelper": 2, "represents": 1, "enum": 2, "FRIEND": 1, "FAMILY": 1, "BUSINESS_CONTACT": 1, "static": 26, "ALL_PEOPLE": 2, "HashMap": 1, "": 1, "construct": 2, "name": 12, "age": 4, "relationship": 2, "EmailHelper": 1, "this": 1, "property": 13, "get": 11, "Name": 3, "set": 2, "override": 1, "getEmailName": 1, "incrementAge": 1, "+": 2, "@Deprecated": 1, "printPersonInfo": 1, "addPerson": 4, "p": 5, "if": 19, "ALL_PEOPLE.containsKey": 2, ".Name": 1, "throw": 5, "IllegalArgumentException": 1, "p.Name": 2, "addAllPeople": 1, "contacts": 2, "List": 1, "": 1, "contact": 3, "typeis": 2, "and": 1, "not": 1, "contact.Name": 1, "getAllPeopleOlderThanNOrderedByName": 1, "allPeople": 1, "ALL_PEOPLE.Values": 3, "allPeople.where": 1, "-": 3, "p.Age": 1, ".orderBy": 1, "loadPersonFromDB": 1, "id": 1, "using": 2, "conn": 1, "DBConnectionManager.getConnection": 1, "stmt": 1, "conn.prepareStatement": 1, "stmt.setInt": 1, "result": 1, "stmt.executeQuery": 1, "result.next": 1, "result.getString": 2, "result.getInt": 1, "loadFromFile": 1, "file": 3, "File": 3, "file.eachLine": 1, "line": 1, "line.HasContent": 1, "line.toPerson": 1, "saveToFile": 1, "writer": 2, "FileWriter": 1, "PersonCSVTemplate.renderToString": 1, "PersonCSVTemplate.render": 1, "ronin": 1, "gw.util.concurrent.LockingLazyVar": 1, "gw.lang.reflect.*": 1, "java.lang.*": 1, "java.io.*": 1, "ronin.config.*": 1, "org.slf4j.*": 1, "Ronin": 1, "_CONFIG": 13, "IRoninConfig": 2, "Config": 1, "_CURRENT_REQUEST": 1, "ThreadLocal": 1, "": 1, ";": 1, "private": 1, "internal": 2, "init": 1, "servlet": 3, "RoninServlet": 3, "m": 3, "ApplicationMode": 2, "src": 2, "null": 15, "cfg": 2, "TypeSystem.getByFullNameIfValid": 2, "defaultWarning": 3, "false": 1, "ctor": 2, "cfg.TypeInfo.getConstructor": 1, "ronin.config.ApplicationMode": 1, "ronin.RoninServlet": 1, "ctor.Constructor.newInstance": 1, "else": 9, "DefaultRoninConfig": 1, "true": 2, "roninLogger": 2, "roninLogger.TypeInfo.getMethod": 1, "ronin.config.LogLevel": 1, ".CallHandler.handleCall": 1, "LogLevel": 5, "log": 2, "level": 7, "WARN": 2, "Quartz.maybeStart": 1, "ReloadManager.setSourceRoot": 1, "CurrentRequest": 3, "req": 2, "RoninRequest": 2, "_CURRENT_REQUEST.set": 1, "//": 2, "CurrentTrace": 1, "Trace": 1, ".Trace": 1, "_CURRENT_REQUEST.get": 1, "Mode": 1, ".Mode": 1, "TESTING": 1, ".LogLevel": 1, "DEBUG": 2, "TraceEnabled": 1, "boolean": 1, "_CONFIG.TraceEnabled": 1, "DefaultAction": 1, ".DefaultAction": 1, "DefaultController": 1, "Type": 1, ".DefaultController": 1, ".RoninServlet": 1, "ErrorHandler": 1, "IErrorHandler": 1, ".ErrorHandler": 1, "LogHandler": 1, "ILogHandler": 1, ".LogHandler": 2, "msg": 4, "Object": 1, "component": 7, "exception": 7, "java.lang.Throwable": 1, "INFO": 2, "msgStr": 9, "block": 3, "_CONFIG.LogHandler.log": 1, "switch": 1, "case": 6, "TRACE": 1, "LoggerFactory.getLogger": 5, "Logger.ROOT_LOGGER_NAME": 5, ".trace": 1, "break": 5, ".debug": 1, ".info": 1, ".warn": 1, "ERROR": 1, "FATAL": 1, ".error": 1, "CacheStore": 3, "REQUEST": 3, "SESSION": 3, "APPLICATION": 3, "cache": 1, "": 2, "value": 4, "T": 2, "store": 10, "or": 2, "_CONFIG.RequestCache.getValue": 1, "_CONFIG.SessionCache.getValue": 1, "_CONFIG.ApplicationCache.getValue": 1, "invalidate": 1, "_CONFIG.RequestCache.invalidate": 1, "_CONFIG.SessionCache.invalidate": 1, "_CONFIG.ApplicationCache.invalidate": 1, "loadChanges": 1, "ReloadManager.detectAndReloadChangedResources": 1 }, "Grace": { "method": 10, "ack": 4, "(": 215, "m": 5, "Number": 4, "n": 4, ")": 215, "-": 16, "{": 61, "print": 2, "if": 23, "<": 5, "then": 24, "+": 29, "}": 61, "elseif": 1, "else": 7, "import": 7, "as": 7, "gtk": 1, "io": 1, "collections": 1, "button_factory": 1, "dialog_factory": 1, "highlighter": 1, "aComp": 1, "//TODO": 1, "def": 56, "window": 2, "gtk.window": 3, "gtk.GTK_WINDOW_TOPLEVEL": 3, "window.title": 1, "window.set_default_size": 1, "var": 33, "popped": 3, "mBox": 2, "gtk.box": 6, "gtk.GTK_ORIENTATION_VERTICAL": 4, "buttonBox": 2, "gtk.GTK_ORIENTATION_HORIZONTAL": 5, "consoleButtons": 2, "consoleBox": 2, "editorBox": 2, "splitPane": 4, "gtk.paned": 1, "menuBox": 2, "runButton": 2, "button_factory.make": 10, "clearButton": 2, "outButton": 2, "errorButton": 2, "popButton": 2, "newButton": 2, "openButton": 2, "saveButton": 2, "saveAsButton": 2, "closeButton": 2, "tEdit": 3, "gtk.text_view": 5, "tEdit.set_size_request": 1, "scrolled_main": 4, "gtk.scrolled_window": 5, "scrolled_main.set_size_request": 1, "scrolled_main.add": 1, "notebook": 8, "gtk.notebook": 1, "notebook.scrollable": 1, "true": 8, "editor_map": 8, "collections.map.new": 4, "editor_map.put": 1, "scrolled_map": 6, "scrolled_map.put": 1, "lighter": 3, "highlighter.Syntax_Highlighter.new": 1, "tEdit.buffer.on": 1, "do": 14, "lighter.highlightLine": 1, "completer": 1, "aComp.Auto_Completer.new": 1, "deleteCompileFiles": 3, "page_num": 7, "cur_scrolled": 9, "scrolled_map.get": 8, "filename": 6, "notebook.get_tab_label_text": 3, "filename.substringFrom": 1, "to": 1, "filename.size": 1, "//Removes": 1, ".grace": 1, "extension": 1, "io.system": 13, "currentConsole": 17, "//": 3, "Which": 1, "console": 1, "is": 1, "being": 1, "shown": 1, "out": 9, "false": 9, "outText": 4, "errorText": 4, "runButton.on": 1, "clearConsoles": 4, "cur_page_num": 15, "notebook.current_page": 6, "cur_page": 5, "editor_map.get": 7, "cur_page_label": 6, "sIter": 9, "gtk.text_iter": 6, "eIter": 9, "cur_page.buffer.get_iter_at_offset": 4, "text": 4, "cur_page.buffer.get_text": 2, "file": 2, "io.open": 4, "file.write": 2, "file.close": 2, "outputFile": 1, "errorFile": 1, "outputFile.read": 1, "errorFile.read": 1, "switched": 4, "outText.size": 2, "&&": 4, "switch_to_output": 3, "errorText.size": 2, "switch_to_errors": 3, "populateConsoles": 4, "clearButton.on": 1, "outButton.on": 1, "errorButton.on": 1, "popButton.on": 1, "popIn": 2, "popOut": 2, "newButton.on": 1, "new_window_class": 1, "dialog_factory.new.new": 1, "new_window": 1, "new_window_class.window": 1, "new_window.show_all": 1, "openButton.on": 1, "open_window_class": 1, "dialog_factory.open.new": 1, "open_window": 1, "open_window_class.window": 1, "open_window.show_all": 1, "saveButton.on": 1, "saveAs_window_class": 2, "dialog_factory.save.new": 2, "saveAs_window": 2, "saveAs_window_class.window": 2, "saveAs_window.show_all": 2, "saveAsButton.on": 1, "closeButton.on": 1, "num_pages": 3, "notebook.n_pages": 2, "e_map": 2, "s_map": 2, "x": 21, "while": 3, "eValue": 4, "sValue": 4, "e_map.put": 2, "s_map.put": 2, "notebook.remove_page": 1, "notebook.show_all": 1, "outConsole": 4, "outScroll": 5, "errorConsole": 4, "errorScroll": 4, "errorTag": 3, "errorConsole.buffer.create_tag": 2, "createOut": 3, "outScroll.add": 1, "outConsole.set_size_request": 5, "outScroll.set_size_request": 5, "outConsole.editable": 1, "outConsole.buffer.set_text": 3, "createError": 3, "errorScroll.add": 1, "errorConsole.set_size_request": 5, "errorScroll.set_size_request": 5, "errorConsole.editable": 1, "errorConsole.buffer.set_text": 3, "consoleBox.remove": 2, "This": 2, "destroys": 2, "the": 2, "consoleBox.add": 5, "popped.show_all": 3, "window.show_all": 3, "errorConsole.buffer.get_iter_at_offset": 2, "errorConsole.buffer.apply_tag": 1, "popInBlock": 2, "consoleBox.reparent": 3, "popButton.label": 3, "cur_page.set_size_request": 3, "cur_scrolled.set_size_request": 3, "popped.visible": 3, "popped.connect": 1, "hSeparator1": 2, "gtk.separator": 2, "hSeparator2": 2, "menuBox.add": 4, "buttonBox.add": 2, "consoleButtons.add": 4, "editorBox.add": 2, "notebook.add": 1, "notebook.set_tab_label_text": 1, "splitPane.add1": 1, "splitPane.add2": 1, "mBox.add": 3, "window.add": 1, "exit": 2, "gtk.main_quit": 1, "window.connect": 1, "gtk.main": 1 }, "Gradle": { "apply": 4, "plugin": 2, "GreetingPlugin": 4, "greeting.message": 1, "class": 4, "implements": 2, "Plugin": 2, "": 2, "{": 9, "void": 2, "(": 6, "Project": 2, "project": 2, ")": 6, "project.extensions.create": 2, "GreetingPluginExtension": 4, "project.task": 2, "<<": 2, "println": 2, "project.greeting.message": 1, "}": 9, "def": 1, "String": 3, "message": 3, "greeting": 1, "greeter": 2 }, "Grammatical Framework": { "abstract": 1, "Foods": 34, "{": 577, "flags": 32, "startcat": 1, "Comment": 31, ";": 1395, "cat": 1, "Item": 31, "Kind": 33, "Quality": 34, "fun": 1, "Pred": 29, "-": 498, "This": 29, "That": 29, "These": 28, "Those": 28, "Mod": 29, "Wine": 29, "Cheese": 29, "Fish": 29, "Pizza": 28, "Very": 29, "Fresh": 29, "Warm": 29, "Italian": 29, "Expensive": 29, "Delicious": 29, "Boring": 29, "}": 578, "concrete": 33, "FoodsAfr": 1, "of": 81, "open": 23, "Prelude": 11, "Predef": 3, "in": 31, "coding": 29, "utf8": 29, "lincat": 28, "s": 365, "Str": 393, "Number": 206, "n": 204, "AdjAP": 10, "lin": 28, "item": 35, "quality": 89, "item.s": 23, "+": 476, "(": 223, "quality.s": 49, "Predic": 3, ")": 223, "kind": 115, "kind.s": 46, "Sg": 183, "Pl": 181, "table": 148, "Attr": 9, "declNoun_e": 2, "declNoun_aa": 2, "declNoun_ss": 2, "declNoun_s": 2, "veryAdj": 2, "regAdj": 61, "smartAdj_e": 4, "param": 22, "|": 122, "oper": 29, "Noun": 9, "operations": 2, "wyn": 1, "kaas": 1, "vis": 1, "pizza": 1, "x": 74, "let": 8, "v": 6, "tk": 1, "last": 3, "Adjective": 9, "mkAdj": 27, "y": 3, "declAdj_e": 2, "declAdj_g": 2, "w": 15, "init": 4, "declAdj_oog": 2, "i": 2, "a": 56, "x.s": 8, "case": 42, "_": 68, "FoodsAmh": 1, "FoodsBul": 1, "Gender": 93, "Masc": 66, "Fem": 64, "Neutr": 21, "Agr": 3, "ASg": 23, "APl": 11, "g": 130, "qual": 8, "item.a": 2, "qual.s": 8, "kind.g": 38, "#": 14, "path": 14, ".": 13, "present": 7, "FoodsCat": 1, "FoodsI": 6, "with": 5, "Syntax": 7, "SyntaxCat": 2, "LexFoods": 12, "LexFoodsCat": 2, "FoodsChi": 1, "c": 41, "p": 11, "quality.p": 2, "kind.c": 11, "geKind": 5, "longQuality": 8, "mkKind": 2, "FoodsCze": 1, "ResCze": 2, "NounPhrase": 3, "copula": 28, "item.n": 27, "item.g": 10, "det": 86, "noun": 51, "regnfAdj": 2, "FoodsDut": 1, "AForm": 4, "APred": 8, "AAttr": 3, "regNoun": 38, "f": 16, "a.s": 8, "regadj": 6, "adj": 37, "noun.s": 7, "man": 10, "men": 10, "wijn": 3, "koud": 3, "duur": 2, "dure": 2, "FoodsEng": 1, "language": 2, "en_US": 1, "car": 6, "cold": 4, "FoodsEpo": 1, "SS": 6, "ss": 12, "d": 6, "cn": 11, "cn.s": 8, "vino": 3, "nova": 3, "FoodsFin": 1, "SyntaxFin": 2, "LexFoodsFin": 2, "../foods": 1, "FoodsFre": 1, "SyntaxFre": 1, "ParadigmsFre": 1, "Utt": 4, "NP": 4, "CN": 4, "AP": 4, "mkUtt": 4, "mkCl": 4, "mkNP": 16, "this_QuantSg": 2, "that_QuantSg": 2, "these_QuantPl": 2, "those_QuantPl": 2, "mkCN": 20, "mkAP": 28, "very_AdA": 4, "mkN": 46, "masculine": 4, "feminine": 2, "mkA": 47, "FoodsGer": 1, "SyntaxGer": 2, "LexFoodsGer": 2, "alltenses": 3, "Dana": 1, "Dannells": 1, "FoodsHeb": 2, "Species": 8, "mod": 7, "Modified": 5, "sp": 11, "Indef": 6, "Def": 21, "T": 2, "regAdj2": 3, "F": 2, "Type": 9, "Adj": 4, "m": 9, "cn.mod": 2, "cn.g": 10, "gvina": 6, "hagvina": 3, "gvinot": 6, "hagvinot": 3, "defH": 7, "replaceLastLetter": 7, "adjective": 22, "tov": 6, "tova": 3, "tovim": 3, "tovot": 3, "to": 5, "c@": 3, "italki": 3, "italk": 4, "FoodsHin": 2, "regN": 15, "lark": 8, "ms": 4, "mp": 4, "acch": 6, "incomplete": 1, "this_Det": 2, "that_Det": 2, "these_Det": 2, "those_Det": 2, "wine_N": 7, "pizza_N": 7, "cheese_N": 7, "fish_N": 8, "fresh_A": 7, "warm_A": 8, "italian_A": 7, "expensive_A": 7, "delicious_A": 7, "boring_A": 7, "prelude": 2, "FoodsIce": 1, "Defin": 9, "Ind": 14, "defOrInd": 2, "masc": 3, "fem": 2, "neutr": 2, "x1": 3, "x9": 1, "ferskur": 5, "fersk": 11, "ferskt": 2, "ferskir": 2, "ferskar": 2, "fersk_pl": 2, "ferski": 2, "ferska": 2, "fersku": 2, "t": 28, "": 1, "<": 10, "Predef.tk": 2, "FoodsIta": 1, "SyntaxIta": 2, "LexFoodsIta": 2, "../lib/src/prelude": 1, "FoodsJpn": 1, "Style": 3, "AdjUse": 4, "AdjType": 4, "quality.t": 3, "IAdj": 4, "Plain": 3, "Polite": 4, "NaAdj": 4, "na": 1, "adjectives": 1, "have": 1, "different": 1, "forms": 1, "as": 2, "attributes": 1, "and": 1, "predicates": 2, "for": 1, "phrase": 1, "types": 1, "can": 1, "form": 1, "without": 1, "the": 1, "cannot": 1, "sakana": 6, "chosenna": 2, "chosen": 2, "akai": 2, "FoodsLav": 1, "Q": 5, "Q1": 5, "q": 10, "spec": 2, "Q2": 3, "specAdj": 2, "skaists": 5, "skaista": 2, "skaisti": 2, "skaistas": 2, "skaistais": 2, "skaistaa": 2, "skaistie": 2, "skaistaas": 2, "skaist": 8, "FoodsMlt": 1, "uniAdj": 2, "Create": 6, "an": 2, "full": 1, "function": 1, "Params": 4, "Sing": 4, "Plural": 2, "iswed": 2, "sewda": 2, "suwed": 3, "regular": 2, "Param": 2, "frisk": 4, "eg": 1, "tal": 1, "buzz": 1, "uni": 4, "Singular": 1, "inherent": 1, "ktieb": 2, "kotba": 2, "Copula": 1, "is": 1, "linking": 1, "verb": 1, "article": 3, "taking": 1, "into": 1, "account": 1, "first": 1, "letter": 1, "next": 1, "word": 1, "pre": 1, "cons@": 1, "cons": 1, "determinant": 1, "Sg/Pl": 1, "string": 1, "default": 1, "gender": 1, "number": 1, "/GF/lib/src/prelude": 1, "FoodsMon": 1, "prefixSS": 1, "FoodsNep": 1, "adjPl": 2, "bor": 2, "FoodsOri": 1, "FoodsPes": 1, "optimize": 1, "noexpand": 1, "Add": 8, "prep": 11, "Indep": 4, "kind.prep": 1, "quality.prep": 1, "at": 2, "a.prep": 1, "it": 1, "must": 1, "be": 1, "written": 1, "x4": 2, "pytzA": 3, "pytzAy": 1, "pytzAhA": 3, "pr": 4, "": 1, "": 1, "": 1, "": 1, "": 1, "mrd": 8, "tAzh": 8, "tAzhy": 2, "FoodsPor": 1, "mkAdjReg": 7, "QualityT": 5, "bonito": 2, "bonita": 2, "bonitos": 2, "bonitas": 2, "pattern": 1, "adjSozinho": 2, "sozinho": 3, "sozinh": 4, "adjUtil": 2, "util": 3, "uteis": 3, "ItemT": 2, "KindT": 4, "num": 6, "noun.g": 3, "animal": 2, "animais": 2, "gen": 4, "carro": 3, "FoodsRon": 1, "NGender": 6, "NMasc": 2, "NFem": 3, "NNeut": 2, "mkTab": 5, "mkNoun": 5, "getAgrGender": 3, "acesta": 2, "aceasta": 2, "gg": 3, "det.s": 1, "peste": 2, "pesti": 2, "scump": 2, "scumpa": 2, "scumpi": 2, "scumpe": 2, "": 1, "": 1, "": 1, "": 1, "": 1, "ng": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "FoodsSpa": 1, "SyntaxSpa": 1, "StructuralSpa": 1, "ParadigmsSpa": 1, "FoodsSwe": 1, "SyntaxSwe": 2, "LexFoodsSwe": 2, "**": 1, "sv_SE": 1, "FoodsTha": 1, "SyntaxTha": 1, "LexiconTha": 1, "ParadigmsTha": 1, "R": 4, "ResTha": 1, "R.thword": 4, "FoodsTsn": 1, "NounClass": 28, "r": 9, "b": 9, "Bool": 5, "p_form": 18, "TType": 16, "mkPredDescrCop": 2, "item.c": 1, "quality.p_form": 1, "kind.w": 4, "mkDemPron1": 3, "kind.q": 4, "mkDemPron2": 3, "mkMod": 2, "Lexicon": 1, "mkNounNC14_6": 2, "mkNounNC9_10": 4, "smartVery": 2, "mkVarAdj": 2, "mkOrdAdj": 4, "mkPerAdj": 2, "mkVerbRel": 2, "NC9_10": 14, "NC14_6": 14, "P": 4, "V": 4, "ModV": 4, "y.b": 1, "True": 3, "y.w": 2, "y.r": 2, "y.c": 14, "y.q": 4, "smartQualRelPart": 5, "x.t": 10, "smartDescrCop": 5, "False": 3, "mkVeryAdj": 2, "x.p_form": 2, "mkVeryVerb": 3, "mkQualRelPart_PName": 2, "mkQualRelPart": 2, "mkDescrCop_PName": 2, "mkDescrCop": 2, "FoodsTur": 1, "Case": 10, "softness": 4, "Softness": 5, "h": 4, "Harmony": 5, "quality.softness": 1, "quality.h": 1, "quality.c": 1, "Nom": 9, "Gen": 5, "a.c": 1, "a.softness": 1, "a.h": 1, "I_Har": 4, "Ih_Har": 4, "U_Har": 4, "Uh_Har": 4, "Ih": 1, "Uh": 1, "Soft": 3, "Hard": 3, "overload": 1, "mkn": 1, "peynir": 2, "peynirler": 2, "[": 2, "]": 2, "sarap": 2, "saraplar": 2, "sarabi": 2, "saraplari": 2, "italyan": 4, "ca": 2, "getSoftness": 2, "getHarmony": 2, "base": 4, "*": 1, "FoodsUrd": 1, "coupla": 2, "interface": 1, "N": 4, "A": 6, "instance": 5, "ParadigmsCat": 1, "M": 1, "MorphoCat": 1, "M.Masc": 2, "ParadigmsFin": 1, "ParadigmsGer": 1, "ParadigmsIta": 1, "ParadigmsSwe": 1, "resource": 1, "ne": 2, "muz": 2, "muzi": 2, "msg": 3, "fsg": 3, "nsg": 3, "mpl": 3, "fpl": 3, "npl": 3, "mlad": 7, "vynikajici": 7 }, "Graph Modeling Language": { "graph": 1, "[": 4, "directed": 1, "node": 2, "id": 2, "label": 2, "value": 2, "]": 4, "edge": 1, "source": 1, "target": 1 }, "GraphQL": { "#": 2, "query": 3, "queryName": 1, "(": 19, "foo": 5, "ComplexType": 1, "site": 1, "Site": 2, "MOBILE": 2, ")": 19, "{": 25, "whoever123is": 1, "node": 1, "id": 7, "[": 4, "]": 4, "...": 3, "on": 4, "User": 1, "@defer": 2, "field2": 1, "alias": 1, "field1": 1, "first": 1, "after": 1, "@include": 2, "if": 3, "...frag": 1, "}": 25, "@skip": 2, "unless": 1, "mutation": 2, "likeStory": 1, "like": 1, "story": 3, "subscription": 1, "StoryLikeSubscription": 1, "input": 4, "StoryLikeSubscribeInput": 1, "storyLikeSubscribe": 1, "likers": 1, "count": 1, "likeSentence": 1, "text": 1, "fragment": 1, "frag": 1, "Friend": 1, "size": 2, "bar": 1, "b": 1, "obj": 1, "key": 3, "unnamed": 1, "truthy": 1, "true": 1, "falsey": 1, "false": 1, "schema": 1, "QueryType": 1, "MutationType": 1, "type": 2, "Foo": 2, "implements": 1, "Bar": 2, "one": 2, "Type": 5, "two": 1, "argument": 7, "InputType": 4, "three": 1, "other": 1, "String": 9, "Int": 2, "four": 2, "five": 1, "six": 1, "interface": 1, "union": 1, "Feed": 1, "Story": 1, "|": 6, "Article": 1, "Advert": 1, "scalar": 1, "CustomScalar": 1, "enum": 1, "DESKTOP": 1, "answer": 1, "extend": 1, "seven": 1, "directive": 2, "Boolean": 2, "FIELD": 2, "FRAGMENT_SPREAD": 2, "INLINE_FRAGMENT": 2 }, "Graphviz (DOT)": { "digraph": 2, "G": 6, "{": 2, "edge": 2, "[": 78, "label": 75, "]": 78, ";": 100, "graph": 2, "ranksep": 2, "T": 4, "shape": 17, "record": 17, "S": 4, "SPACE": 4, "A": 4, "H": 4, "U": 4, "L": 4, "N": 4, "I": 4, "O": 4, "F": 4, "GF": 3, "W": 4, "Y": 4, "B": 2, "D": 4, "BD": 3, "WYBD": 3, "GFWYBD": 3, "-": 82, "}": 2, "node": 1, "K": 2, "_3": 2, "_9": 2, "_39": 3, "X": 2, "YX": 3, "J": 2, "JW": 3, "YXJW": 3, "M": 2, "E": 2, "DOT": 2, "_1": 2, "DOT1": 3, "_7": 2, "R": 2, "C": 2 }, "Groff": { ".": 83, "[": 37, "fB": 20, "fP": 87, "]": 37, "": 4, "href=": 4, "*": 12, "(": 46, "m1": 3, "": 2, "&": 10, "}": 15, "el": 1, "la": 1, "ra": 1, "hy": 2, "n": 6, "HY": 2, "..": 7, "Continuation": 1, "line": 1, "for": 58, ".TP": 1, "header.": 1, ".de": 6, "TQ": 1, "br": 1, "ns": 1, "TP": 1, "no": 6, "doublequotes": 1, "around": 2, "argument": 3, "Start": 2, "example.": 2, "EX": 1, "do": 5, "ds": 1, "mF": 2, ".fam": 1, "nr": 1, "mE": 2, ".f": 1, "nf": 1, "nh": 1, "fam": 2, "C": 2, "ft": 2, "CW": 1, "End": 3, "EE": 1, "fi": 1, "display.": 2, "DS": 1, "XXX": 2, "to": 127, "be": 64, "written": 5, "DE": 1, "EOF": 1, "CREATE": 3, "VIEW": 2, "-": 76, "SQL": 2, "Language": 2, "Statements": 1, "Commands": 2, "DESCRIPTION": 2, "PARAMETERS": 1, "NOTES": 1, "EXAMPLES": 1, "COMPATIBILITY": 1, "SEE": 1, "ALSO": 1, "DROP": 1, "fBdrop_view": 1, "fR": 13, "l": 1, ")": 37, "NetBSD": 1, "fsinterface.ms": 2, "v": 1, "/08/07": 1, "agc": 1, "Exp": 1, "Copyright": 1, "c": 3, "The": 68, "Regents": 1, "of": 131, "the": 360, "University": 5, "California.": 1, "All": 4, "rights": 1, "reserved.": 1, "Redistribution": 1, "and": 91, "use": 19, "in": 84, "source": 5, "binary": 3, "forms": 1, "with": 27, "or": 30, "without": 5, "modification": 3, "are": 41, "permitted": 1, "provided": 5, "that": 40, "following": 5, "conditions": 3, "met": 1, "Redistributions": 2, "code": 2, "must": 12, "retain": 5, "above": 4, "copyright": 2, "notice": 2, "this": 17, "list": 3, "disclaimer.": 1, "form": 5, "reproduce": 1, "disclaimer": 1, "documentation": 1, "and/or": 2, "other": 13, "materials": 1, "distribution.": 1, "Neither": 1, "name": 23, "nor": 1, "names": 3, "its": 8, "contributors": 1, "may": 35, "used": 23, "endorse": 1, "promote": 1, "products": 1, "derived": 2, "from": 27, "software": 1, "specific": 9, "prior": 1, "permission.": 1, "THIS": 2, "SOFTWARE": 2, "IS": 2, "PROVIDED": 1, "BY": 1, "THE": 5, "REGENTS": 2, "AND": 4, "CONTRIBUTORS": 2, "AS": 1, "ANY": 4, "EXPRESS": 1, "OR": 8, "IMPLIED": 2, "WARRANTIES": 2, "INCLUDING": 3, "BUT": 2, "NOT": 2, "LIMITED": 2, "TO": 2, "OF": 8, "MERCHANTABILITY": 1, "FITNESS": 1, "FOR": 2, "A": 10, "PARTICULAR": 1, "PURPOSE": 1, "ARE": 1, "DISCLAIMED.": 1, "IN": 3, "NO": 1, "EVENT": 1, "SHALL": 1, "BE": 1, "LIABLE": 1, "DIRECT": 1, "INDIRECT": 1, "INCIDENTAL": 1, "SPECIAL": 1, "EXEMPLARY": 1, "CONSEQUENTIAL": 1, "DAMAGES": 1, "PROCUREMENT": 1, "SUBSTITUTE": 1, "GOODS": 1, "SERVICES": 1, ";": 77, "LOSS": 1, "USE": 2, "DATA": 1, "PROFITS": 1, "BUSINESS": 1, "INTERRUPTION": 1, "HOWEVER": 1, "CAUSED": 1, "ON": 1, "THEORY": 1, "LIABILITY": 2, "WHETHER": 1, "CONTRACT": 1, "STRICT": 1, "TORT": 1, "NEGLIGENCE": 1, "OTHERWISE": 1, "ARISING": 1, "WAY": 1, "OUT": 1, "EVEN": 1, "IF": 1, "ADVISED": 1, "POSSIBILITY": 1, "SUCH": 1, "DAMAGE.": 1, "@": 1, "#": 1, "Berkeley": 6, "/16/91": 1, ".if": 1, "nv": 1, ".rm": 1, "CM": 1, "UX": 3, ".ie": 1, "s": 13, "NIX": 3, "s0": 3, ".el": 1, "{": 14, "dg": 2, ".FS": 3, "is": 77, "a": 110, "registered": 1, "trademark": 2, "AT": 9, "T.": 1, ".FE": 2, ".nr": 1, ".TL": 1, "Toward": 1, "Compatible": 1, "Filesystem": 4, "Interface": 1, ".AU": 1, "Michael": 1, "J.": 1, "Karels": 3, "Marshall": 2, "Kirk": 1, "McKusick": 4, ".AI": 1, "Computer": 5, "Systems": 4, "Research": 2, "Group": 2, "Science": 2, "Division": 1, "Department": 1, "Electrical": 1, "Engineering": 1, "California": 4, ".AB": 1, ".LP": 5, "As": 10, "network": 6, "remote": 9, "filesystems": 22, "have": 12, "been": 11, "implemented": 5, ".UX": 12, "several": 7, "stylized": 3, "interfaces": 11, "between": 7, "filesystem": 81, "implementation": 4, "rest": 2, "kernel": 3, "developed.": 1, "This": 12, "an": 12, "update": 1, "paper": 1, "originally": 2, "presented": 3, "at": 15, "September": 1, "conference": 1, "European": 1, "Users": 1, "Virtual": 1, "interface": 36, "VFS": 9, "using": 6, "vnodes": 5, "Digital": 3, "Equipment": 2, "File": 10, "System": 14, "Switch": 2, "FSS": 2, "Each": 7, "design": 8, "attempts": 3, "isolate": 1, "dependent": 5, "details": 2, "below": 1, "generic": 7, "provide": 2, "framework": 1, "within": 8, "which": 14, "new": 12, "incorporated.": 1, "However": 4, "each": 4, "these": 16, "different": 13, "incompatible": 1, "others.": 1, "them": 4, "addresses": 1, "somewhat": 3, "goals.": 1, "was": 3, "based": 1, "on": 11, "starting": 1, "version": 2, "targetted": 2, "set": 6, "varying": 5, "characteristics": 1, "uses": 5, "primitive": 1, "operations": 17, "by": 37, "filesystem.": 7, "current": 11, "study": 1, "compares": 1, "various": 3, "interfaces.": 1, "Criteria": 1, "comparison": 2, "include": 4, "generality": 1, "completeness": 1, "robustness": 1, "efficiency": 3, "esthetics.": 1, "Several": 4, "underlying": 3, "issues": 4, "examined": 3, "detail.": 1, "result": 2, "proposal": 2, "advanced": 2, "includes": 2, "best": 3, "features": 1, "existing": 3, "implementations.": 2, "adopts": 1, "calling": 3, "convention": 2, "lookup": 17, "introduced": 3, "BSD": 13, "but": 6, "otherwise": 4, "closely": 1, "related": 3, "Sun": 23, "Network": 3, "NFS": 3, "Sandberg85": 2, "T": 8, "extended": 1, "Cole85": 2, "Other": 2, "research": 2, "university": 1, "groups": 5, "internal": 6, "notably": 1, "Eighth": 1, "Edition": 1, "system": 20, "Weinberger84": 2, "two": 6, "Carnegie": 1, "Mellon": 1, "Satyanarayanan85": 2, "Numerous": 1, "file": 24, "access": 2, "methods": 1, "devised": 2, "individual": 4, "processes": 2, "many": 1, "modifications": 2, "I/O": 2, "library": 1, "similar": 3, "those": 3, "Newcastle": 2, "Connection": 2, "Brownbridge82": 2, ".PP": 27, "Multiple": 2, "frequently": 2, "found": 1, "single": 9, "organization.": 1, "These": 5, "circumstances": 1, "make": 3, "it": 22, "highly": 1, "desirable": 2, "able": 1, "transport": 1, "implementations": 4, "one": 7, "another.": 1, "Such": 1, "portability": 1, "considerably": 2, "enhanced": 1, "carefully": 1, "defined": 2, "entry": 16, "points": 7, "separate": 4, "operating": 3, "system.": 4, "should": 5, "device": 11, "drivers": 3, "kernel.": 1, "Although": 6, "among": 3, "common": 1, "versions": 2, "driver": 1, "sufficiently": 1, "moved": 1, "another": 2, "major": 3, "problems.": 1, "clean": 2, "well": 4, "also": 8, "allows": 6, "support": 4, "multiple": 3, "local": 9, "types.": 2, "For": 13, "reasons": 1, "such": 10, "as": 27, "when": 5, "integrating": 1, "into": 16, "known": 2, "Microsystems": 1, "FSS.": 1, "Another": 3, "Generic": 2, "GFS": 7, "has": 15, "ULTRIX": 6, "dd": 2, "Corp.": 1, "Rodriguez86": 2, "There": 2, "numerous": 1, "differences": 3, "designs.": 3, "understood": 2, "philosophies": 1, "goals": 5, "involved": 1, "systems": 8, "under": 1, "were": 6, "done": 4, "summarized": 1, "sections": 1, "limitations": 1, "published": 1, "specifications.": 1, ".SH": 11, "Design": 3, "degrees": 1, "driven": 1, "divide": 1, "type": 5, "independent": 5, "layer": 5, "division": 1, "layers": 3, "occurs": 1, "places": 1, "reflecting": 1, "views": 1, "diversity": 1, "types": 3, "accommodated.": 1, "Compatibility": 1, "importance": 1, "user": 6, "process": 12, "level": 3, "completely": 1, "transparent": 1, "except": 4, "few": 3, "management": 1, "programs.": 1, "makes": 2, "effort": 1, "familiar": 1, "even": 3, "object": 3, "compatibility": 3, "modules": 2, "drivers.": 1, "Both": 4, "DEC": 5, "willing": 1, "change": 3, "data": 17, "structures": 2, "so": 5, "might": 4, "require": 2, "recompilation": 1, "modification.": 1, "statelessness": 1, "permeates": 1, "interface.": 8, "No": 1, "locking": 5, "occur": 1, "only": 5, "during": 6, "call": 9, "layer.": 3, "final": 9, "goal": 2, "most": 9, "implementors": 1, "performance.": 3, "tends": 1, "conflict": 1, "complete": 4, "semantic": 1, "consistency": 4, "modularity.": 1, "chosen": 1, "performance": 5, "over": 2, "modularity": 2, "some": 2, "areas": 2, "emphasized": 1, "separation": 2, "expense": 2, "RFS": 3, "yet": 3, "seen": 2, "seems": 1, "considered": 4, "far": 1, "more": 6, "important": 2, "than": 10, "Differences": 1, "characterized": 1, "ways.": 1, "centered": 1, "objects": 2, "along": 1, "primitives": 2, "performing": 5, "upon": 4, "objects.": 2, "In": 11, "original": 1, "Ritchie74": 2, "basic": 1, "inode": 16, "index": 3, "node.": 1, "contains": 4, "all": 6, "information": 5, "about": 2, "identification": 1, "ownership": 2, "permissions": 2, "timestamps": 2, "location.": 2, "Inodes": 1, "identified": 1, "number": 7, "fInamei": 15, "translates": 1, "pathname": 11, "fIiget": 4, "locates": 1, "installs": 1, "core": 1, "table.": 2, "fINamei": 1, "performs": 2, "translation": 11, "iterative": 1, "component": 8, "directory": 10, "find": 3, "inumber": 1, "then": 6, "return": 4, "actual": 4, "inode.": 2, "If": 5, "last": 3, "reached": 1, "returned": 2, "describes": 1, "next": 1, "searched.": 1, "ways": 1, "caller": 1, "read": 12, "checked": 1, "fields": 3, "modified.": 1, "Modified": 1, "inodes": 2, "automatically": 1, "back": 2, "disk": 4, "reference": 12, "released": 1, "fIiput": 1, "fP.": 3, "same": 7, "general": 2, "scheme": 3, "faster": 1, "Mckusick85": 1, "lesser": 1, "extent": 1, "attempt": 2, "preserve": 1, "oriented": 2, "modify": 1, "allow": 2, "varieties": 1, "structure": 15, "separating": 1, "parts": 4, "arm": 1, "union.": 1, "equivalent": 1, "old": 1, "performed": 3, "operations.": 4, "Implicit": 1, "files": 8, "conveniently": 1, "named": 2, "located": 2, "provides": 3, "properties": 2, "rather": 7, "allowing": 1, "arbitrary": 1, "changes": 8, "made": 3, "part": 2, "contrast": 1, "replaces": 1, "primary": 1, "vnode.": 1, "vnode": 30, "pointer": 2, "Properties": 1, "transient": 1, "size": 1, "maintained": 2, "lower": 1, "format": 1, "request": 3, "callers": 1, "expected": 1, "not": 13, "hold": 2, "any": 6, "length": 1, "time": 5, "they": 4, "up": 4, "date": 1, "later": 2, "on.": 1, "corollary": 1, "external": 1, "obtaining": 1, "operation.": 2, "Separate": 1, "procedures": 1, "outside": 1, "obtain": 2, "handle": 1, "given": 5, "client": 2, "server": 1, "retrieved": 1, "presentation": 2, "handle.": 1, "Name": 1, "described": 5, "mechanism": 1, "representation": 1, "translation.": 1, "style": 3, "function": 3, "very": 1, "three": 3, "systems.": 4, "function.": 1, "quite": 1, "however": 1, "BSD.": 3, "parameters": 4, "context": 3, "operation": 15, "collected": 1, "fInameidata": 7, "passed": 3, "Intent": 1, "create": 2, "delete": 1, "declared": 1, "advance": 1, "scan": 1, "offset": 6, "will": 7, "made.": 1, "Filesystems": 1, "mechanisms": 1, "avoid": 5, "redundant": 2, "work": 2, "therefore": 1, "lock": 2, "modified": 6, "before": 3, "completion.": 1, "V": 2, "previous": 1, "stored": 4, "per": 6, "fIuser": 1, "low": 1, "routine": 7, "called": 1, "after": 3, "creation": 14, "deletion": 7, "itself.": 1, "side": 1, "effects": 1, "implementing": 1, "deletion.": 2, "responsible": 1, "copying": 4, "buffer": 19, "validating": 1, "interpolating": 1, "contents": 1, "symbolic": 2, "links": 1, "indirecting": 1, "mount": 2, "points.": 1, "copied": 3, "according": 1, "location": 1, "name.": 1, "After": 1, "determining": 1, "start": 1, "root": 1, "calls": 10, "replaced": 1, "fIlookupname": 1, "simply": 1, "handling": 2, "module": 1, "allocate": 1, "copy": 3, "character": 1, "fIlookuppn": 1, "fILookuppn": 1, "iteration": 1, "directories": 2, "leading": 1, "destination": 1, "copies": 1, "fIlookup": 2, "locate": 1, "directory.": 3, "Per": 1, "routines": 5, "translate": 1, "call.": 2, "unmodified": 1, "serves": 1, "check": 1, "existence": 1, "file.": 1, "subsequent": 2, "if": 6, "repeat": 1, "associated": 1, "scan.": 1, "particular": 3, "inefficient": 1, "requires": 1, "scans": 1, "improvements": 3, "McKusick85": 2, "Leffler84": 2, ".IP": 17, "wide": 1, "cache": 31, "recent": 1, "translations": 1, "maintained.": 1, "present": 2, "cache.": 3, "does": 3, "hard": 2, "references": 2, "normal": 2, "pattern": 1, "disturbed.": 1, "kept": 1, "successful": 1, "done.": 1, "sequential": 1, "lookups": 2, "entries": 3, "linear": 1, "time.": 1, "entire": 2, "subroutine": 2, "character.": 1, "pool": 1, "buffers": 3, "held": 2, "avoiding": 2, "allocation": 2, "overhead.": 1, "worth": 1, "generalized": 1, "framework.": 2, "generalization": 3, "already": 1, "expensive": 1, "costly.": 1, "Most": 2, "derives": 2, "beta": 1, "test": 1, "generally": 1, "like": 3, "facility": 1, "routines.": 1, "first": 2, "unlike": 1, "holds": 1, "increments": 1, "count": 2, "soft": 2, "cannot": 1, "allocates": 1, "dynamically": 1, "frees": 1, "returns": 4, "zero": 1, "caching": 2, "them.": 3, "fewer": 1, "distorts": 1, "patterns": 1, "LRU": 1, "overflow": 1, "table": 1, "purged": 1, "room": 1, "Also": 2, "determine": 1, "whether": 1, "example": 3, "mounting": 2, "flushed": 1, "free": 1, "reference.": 1, "problems": 5, "corrected": 2, "scheme.": 1, "observation": 1, "architecture": 1, "multi": 1, "dramatically": 1, "larger": 1, "suffers": 2, "problem": 3, "much": 1, "less": 1, "violation": 1, "layering.": 1, "synchronization": 2, "consistency.": 1, "broken": 1, "difficult": 1, "guarantee": 1, "throughout": 1, "synchronize": 1, "severely": 1, "forbids": 1, "across": 1, "It": 6, "possible": 3, "created": 2, "requested.": 1, "Perhaps": 1, "strangely": 1, "fails": 1, "target": 6, "now": 2, "exists": 1, "link.": 1, "either": 4, "fail": 1, "unexpectedly": 1, "wrong": 1, "note": 1, "error": 1, "restart": 1, "lookup.": 1, "always": 1, "exist": 1, "stateless": 2, "forces": 2, "share": 1, "problem.": 1, "restriction": 1, "against": 2, "duplication": 1, "unacceptable.": 1, "Support": 1, "facilities": 3, "interactions": 1, "portable": 2, "uniform": 1, "behave": 1, "consistent": 2, "manner": 1, "prominent": 1, "standard": 3, "physical": 5, "blocks": 7, "containing": 2, "works": 1, "obvious": 1, "filesystems.": 1, "describe": 3, "device.": 1, "block": 9, "numbers": 2, "virtual": 8, "blocks.": 3, "Use": 1, "description": 1, "easily": 1, "accommodate": 2, "indirect": 2, "superblocks": 1, "cylinder": 1, "group": 4, "describing": 1, "internally": 2, "looked": 1, "searching": 1, "private": 2, "holding": 1, "structure.": 4, "better": 1, "needed.": 1, "currently": 1, "thus": 3, "probably": 1, "unmodified.": 1, "unknown": 1, "us.": 1, "subsystem": 1, "large": 1, "interaction": 1, "memory": 9, "satisfy": 1, "fill": 3, "demand": 2, "page": 2, "faults.": 1, "arranged": 1, "place": 1, "directly": 2, "pages": 2, "assigned": 1, "raw": 3, "data.": 2, "normally": 1, "bypasses": 1, "checking": 1, "flushing": 1, "disk.": 1, "maintains": 1, "own": 1, "reusable": 1, "text": 1, "pages.": 1, "creates": 2, "additional": 1, "complications.": 1, "redesigned": 1, "resolved": 1, "reading": 1, "through": 1, "mapping": 2, "cached": 1, "address": 5, "space.": 3, "changed": 1, "while": 2, "remains": 2, "would": 1, "write": 3, "meantime": 1, "optimization": 1, "logical": 2, "setting": 1, "image": 1, "process.": 1, "analogous": 1, "fIbmap": 2, "Given": 1, "number.": 1, "startup": 1, "remain": 1, "once": 1, "read.": 1, "addition": 2, "fIstrategy": 1, "reads": 1, "space": 2, "copying.": 2, "header": 1, "fIbuf": 1, "instead": 1, "fIuio": 5, "internally.": 1, "difference": 1, "avoided": 1, "to/from": 1, "Instead": 1, "could": 1, "When": 1, "loading": 1, "received": 1, "buffer.": 1, "suitably": 1, "aligned": 1, "mapped": 1, "swap": 1, "case": 2, "devising": 1, "implicit": 1, "global": 1, "reentrancy": 1, "conventions": 1, "sleep/wakeup": 1, "interrupted": 1, "semaphores": 1, "Proposal": 1, "widely": 2, "here.": 1, "separated": 1, "disadvantages": 1, "minor": 1, "philosophical": 1, "advantages": 1, "optimizations.": 1, "components": 1, "translated": 3, "accommodates": 1, "preference.": 1, "least": 2, "there": 1, "little": 1, "public": 1, "groups.": 1, "Accordingly": 1, "proposed": 3, "central": 1, "pass": 2, "communicate": 1, "completion": 2, "status": 2, "routine.": 3, "requests": 1, ".br": 2, ".ne": 2, "i": 2, ".ID": 1, ".nf": 1, ".ta": 5, ".5i": 4, "+": 21, "w": 13, "u": 13, "struct": 18, "nameidata": 1, "caddr_t": 5, "ni_dirp": 1, "enum": 2, "uio_seg": 1, "ni_seg": 1, "short": 7, "ni_nameiop": 1, "*ni_cdir": 1, "*ni_rdir": 1, "ucred": 1, "*ni_cred": 1, "ni_pnbuf": 1, "char": 3, "*ni_ptr": 1, "int": 10, "ni_pathlen": 1, "ni_more": 1, "ni_loopcnt": 1, "*ni_vp": 1, "*ni_dvp": 1, "diroffcache": 1, "*nc_prevdir": 4, "long": 14, "nc_id": 1, "off_t": 1, "nc_prevoffset": 1, "ni_nc": 1, ".DE": 6, ".DS": 4, "#define": 15, "LOOKUP": 2, "DELETE": 2, "WANTPARENT": 2, "NOCACHE": 1, "FOLLOW": 1, "NOFOLLOW": 3, "credentials": 1, "slightly": 1, "accounting": 1, "ID": 3, "merged": 1, "array.": 1, "array": 1, "explicitly": 1, "reserved": 1, "terminator.": 1, "typedefs": 1, "UIO_USERISPACE": 1, "vfsops": 2, "*vfs_vnodecovered": 1, "VFS_EXPORTED": 2, "t": 1, "exec": 1, "*/": 1, "VFS_MLOCK": 1, "VFS_MWAIT": 1, "VFS_NOSUID": 1, "EX_RDONLY": 1, "supported": 1, "vfs_mount": 1, "vfs_unmount": 1, "vfs_mountroot": 1, "vfs_root": 1, "vfs_statfs": 1, "vfs_sync": 1, "vfs_fhtovp": 1, "vfs_vptofh": 1, "fIvfs_statfs": 1, "statfs": 1, "f_type": 1, "f_flags": 1, "f_fsize": 1, "f_bsize": 1, "f_blocks": 1, "f_bfree": 1, "f_bavail": 1, "f_files": 1, "f_ffree": 1, "fsid_t": 2, "f_fsid": 1, "*f_mntonname": 1, "*f_mntfromname": 1, "f_spare": 1, "typedef": 1, "vnodeops": 1, "*v_vfsmountedhere": 1, "vn_getattr": 1, "obviously": 1, "fIvn_lookup": 1, "receives": 1, "arguments": 1, "described.": 1, "fIvn_abortop": 1, "undertaken.": 1, "perform": 1, "implement": 1, "action": 1, "left": 1, "untranslated": 1, "parent": 1, "flexible": 1, "enough": 1, "fully": 2, "stateful": 1, "whenever": 1, "possible.": 1, "One": 1, "problematical": 1, "fIvn_rename": 1, "tempting": 1, "look": 1, "rename": 1, "creation.": 1, "deadlock": 1, "paths": 1, "cross.": 1, "reason": 1, "flag": 3, "CREATE.": 1, "concerned": 1, "fIvn_rdrw": 1, "split": 1, "fIvn_read": 1, "fIvn_write": 1, "read/write": 1, "amounts": 2, "checks": 1, "direction": 2, "identical": 1, "contained": 1, "argument.": 1, "locations.": 1, "updated": 1, "return.": 1, "fIvn_readdir": 1, "token": 2, "added.": 1, "fIvn_seek": 1, "concession": 1, "record": 1, "directories.": 1, "verify": 1, "seek": 1, "leaves": 1, "sensible": 1, "relative": 1, "earlier": 1, "one.": 1, "simple": 1, "arithmetic.": 1, "point": 1, "fIvn_mmap": 1, "Its": 1, "semantics": 1, "decided.": 1, "additions": 1, "fIvn_lock": 1, "fIvn_unlock": 1, "entries.": 1, "locked": 1, "periods": 1, "it.": 1, "They": 1, "maintain": 1, "fIexec": 1, "construct": 1, "atomic": 1, "attributes": 1, "need": 1, "source.": 1, "Attributes": 1, "vattr": 1, "vtype": 1, "va_type": 1, "u_short": 1, "va_mode": 1, "uid_t": 1, "va_uid": 1, "gid_t": 1, "va_gid": 1, "va_fsid": 1, "va_fileid": 1, "va_nlink": 1, "u_long": 4, "va_size": 1, "va_size1": 1, "va_blocksize": 1, "timeval": 3, "va_atime": 1, "va_mtime": 1, "va_ctime": 1, "dev_t": 1, "va_rdev": 1, "va_bytes": 1, "va_bytes1": 1, "Conclusions": 1, "Of": 1, "cleanest": 1, "structures.": 1, "flaws": 1, "felt": 1, "certain": 1, "can": 1, "ameliorate": 1, "here": 2, "changes.": 1, "being": 1, "Berkeley.": 1, "succeeds": 1, "improving": 1, "flexibility": 1, "layering": 1, "model": 1, "Acknowledgements": 1, "We": 1, "indebted": 1, "members": 1, "discussions": 1, "involved.": 1, "References": 2, "Brownbridge": 1, "D.R.": 1, "L.F.": 1, "B.": 2, "Randell": 1, "UNIXes": 1, "World": 1, "Unite": 1, "fISoftware": 1, "Practice": 1, "Experience": 1, "Vol.": 3, "pp.": 11, "Cole": 1, "C.T.": 1, "P.B.": 1, "Flinn": 1, "A.B.": 1, "Atlas": 1, "An": 2, "Implementation": 2, "Extended": 1, "UNIX": 3, "fIUsenix": 8, "Conference": 8, "Proceedings": 7, "June": 8, "Kleiman86": 1, "Vnodes": 1, "Architecture": 2, "Types": 1, "Leffler": 3, "S.": 4, "M.K.": 3, "M.": 5, "Measuring": 1, "Improving": 1, "Performance": 2, "McKusick84": 1, "W.N.": 1, "Joy": 1, "S.J.": 1, "R.S.": 1, "Fabry": 1, "Fast": 1, "fITransactions": 1, "ACM": 3, "August": 1, "Improvements": 1, "Functional": 1, "Enhancements": 1, "Rifkin86": 1, "Rifkin": 1, "A.P.": 1, "M.P.": 1, "Forbes": 1, "R.L.": 1, "Hamilton": 1, "Sabrio": 1, "Shah": 1, "K.": 2, "Yueh": 1, "Architectural": 1, "Overview": 1, "Ritchie": 1, "D.M.": 1, "Thompson": 1, "Unix": 1, "Time": 1, "Sharing": 1, "fICommunications": 1, "July": 1, "Rodriguez": 1, "R.": 3, "Koehler": 1, "Hyde": 1, "Sandberg": 1, "D.": 2, "Goldberg": 1, "Kleiman": 1, "Walsh": 1, "Lyon": 1, "Satyanarayanan": 1, "fIet": 1, "al.": 1, "ITC": 1, "Distributed": 3, "Principles": 2, "fIProc.": 1, "th": 1, "Symposium": 1, "Operating": 1, "December": 1, "Walker85": 1, "Walker": 2, "B.J.": 2, "S.H.": 1, "Kiser": 1, "LOCUS": 2, "fIThe": 1, "G.J.": 1, "Popek": 1, "ed.": 1, "MIT": 1, "Press": 1, "Cambridge": 1, "MA": 1, "Weinberger": 1, "P.J.": 1, "Version": 1, "Bac78": 1, "Fod80": 1, "Joy79": 1, "Mc60": 1, "Pat80": 1, "Pat81": 1, "Dorab": 1, "Patel": 1, "lqFunctional": 1, "Interpreter": 1, "User": 1, "Manual": 1, "rq": 1, "Los": 1, "Angeles": 1, ".bp": 1, ".TH": 1, "FOO": 1, "NAME": 1, "foo": 2, "bar": 4, "SYNOPSIS": 1, ".B": 2, ".I": 1, "Foo": 2, ".BR": 1, "baz": 1, "quux.": 1, "baz.": 1, "license.terms": 1, "Tcl": 1, "Built": 1, "fBCommands.": 1, "fBEvaluation.": 1, "fBWords.": 1, "fBDouble": 1, "quotes.": 1, "fBArgument": 1, "expansion.": 1, "cmd": 2, "b": 2, "d": 2, "e": 2, "f": 2, "g": 2, "h": 2, "fBBraces.": 1, "fBCommand": 1, "substitution.": 4, "fBVariable": 1, "fBBackslash": 1, "fBComments.": 1, "fBOrder": 1, "fBSubstitution": 1, "word": 3, "boundaries.": 1, "Substitutions": 1, "affect": 1, "boundaries": 1, "command": 1, "expansion": 1, "specified": 1, "rule": 1, "variable": 3, "substitution": 1, "value": 1, "becomes": 1, "Local": 1, "Variables": 1, "column": 1 }, "Groovy": { "task": 1, "echoDirListViaAntBuilder": 1, "(": 13, ")": 13, "{": 19, "description": 1, "//Docs": 1, "http": 1, "//ant.apache.org/manual/Types/fileset.html": 1, "//Echo": 1, "the": 3, "Gradle": 1, "project": 1, "name": 4, "via": 1, "ant": 1, "echo": 3, "plugin": 1, "ant.echo": 3, "message": 2, "project.name": 1, "path": 2, "//Gather": 1, "list": 1, "of": 1, "files": 1, "in": 1, "a": 1, "subdirectory": 1, "ant.fileScanner": 1, "fileset": 1, "dir": 2, "}": 19, ".each": 1, "//Print": 1, "each": 1, "file": 1, "to": 1, "screen": 1, "with": 1, "CWD": 1, "projectDir": 1, "removed.": 1, "println": 3, "it.toString": 1, "-": 2, "jettyUrl": 1, "def": 3, "servers": 5, "stage": 4, "node": 4, "checkout": 2, "scm": 2, "load": 1, "mvn": 3, "stash": 1, "includes": 1, "parallel": 1, "longerTests": 1, "runTests": 3, "quickerTests": 1, "concurrency": 2, "servers.deploy": 2, "input": 1, "sh": 2, "args": 1, "duration": 1, "servers.runWithServer": 1, "id": 1, "SHEBANG#!groovy": 2, "html": 3, "head": 2, "component": 1, "title": 2, "body": 1, "p": 1 }, "Groovy Server Pages": { "": 4, "": 4, "": 4, "http": 3, "equiv=": 3, "content=": 4, "": 4, "Testing": 3, "with": 3, "SiteMesh": 2, "and": 2, "Resources": 2, "": 4, "name=": 1, "": 2, "module=": 2, "": 4, "": 4, "": 4, "": 4, "<%@>": 1, "page": 2, "contentType=": 1, "Using": 1, "directive": 1, "tag": 1, "

": 2, "Print": 1, "{": 1, "example": 1, "}": 1 }, "HCL": { "consul": 1, "template": 1, "{": 4, "bar": 1, "}": 4, "resource": 1, "provisioner": 2, "source": 2, "destination": 2 }, "HLSL": { "//": 2, "struct": 8, "Vertex": 3, "{": 30, "float4": 21, "position": 1, "POSITION": 5, ";": 169, "float2": 8, "texCoord": 3, "TEXCOORD0": 5, "}": 30, "texture": 7, "t": 1, "sampler": 6, "s": 7, "vertexMain": 1, "(": 64, "input": 3, ")": 64, "return": 9, "pixelMain": 1, "COLOR0": 3, "tex2D": 6, "float4x4": 6, "matWorldView": 5, "WORLDVIEW": 2, "matWorldViewProjection": 5, "WORLDVIEWPROJECTION": 2, "VS_INPUT": 4, "Position": 2, "POSITION0": 2, "float3": 23, "Normal": 2, "NORMAL": 2, "Tangent": 2, "TANGENT": 2, "Binormal": 2, "BINORMAL": 2, "TexCoord0": 2, "TexCoord1": 2, "TEXCOORD1": 4, "VS_OUTPUT": 12, "float3x3": 1, "TangentToView": 1, "TEXCOORD2": 2, "vs_main": 4, "output": 2, "output.Position": 1, "mul": 7, "input.Position": 1, "output.TexCoord0": 1, "input.TexCoord0": 1, "*": 17, "output.TexCoord1": 1, "input.TexCoord1": 1, "output.TangentToView": 3, "[": 3, "]": 3, "input.Tangent": 1, ".xyz": 4, "input.Binormal": 1, "input.Normal": 1, "PS_OUTPUT": 6, "gbuffer0": 1, "gbuffer1": 1, "COLOR1": 1, "albedo_tex": 2, "albedo_samp": 2, "sampler_state": 7, "Texture": 7, "MipFilter": 7, "Linear": 12, "MinFilter": 7, "MagFilter": 7, "AddressU": 5, "Wrap": 8, "AddressV": 5, "sRGBTexture": 4, "True": 4, "normal_tex": 2, "normal_samp": 2, "False": 2, "specular_tex": 2, "specular_samp": 2, "ao_tex": 2, "ao_samp": 2, "ps_main": 4, "Input": 1, "o": 2, "tangentNormal": 2, "normalize": 7, "Input.TexCoord0": 3, "-": 6, "eyeNormal": 2, "Input.TangentToView": 1, "albedo": 2, ".rgb": 1, "float": 7, "ao": 3, "Input.TexCoord1": 1, ".r": 2, "spec": 2, "o.gbuffer0": 1, "o.gbuffer1": 1, "technique": 3, "mesh": 1, "pass": 3, "Geometry": 1, "VertexShader": 3, "compile": 6, "vs_3_0": 1, "PixelShader": 3, "ps_3_0": 1, "AlphaBlendEnable": 1, "ZWriteEnable": 1, "matWorld": 1, "WORLD": 1, "matView": 1, "VIEW": 1, "uniform": 4, "vViewPosition": 1, "Pos": 2, "reflection": 3, "refraction": 3, "fresnel": 5, "TEXCOORD3": 1, "amt": 1, "scale": 2, "phase": 2, "deform": 4, "p": 3, "p2": 6, "+": 6, "sin": 3, "p2.x": 1, "amt.x": 1, "p2.y": 1, "amt.y": 1, "p2.z": 1, "amt.z": 1, "/": 1, "In": 3, "Out": 6, "pos": 10, "In.Pos": 1, "norm": 7, "In.Normal": 1, "p1": 5, "In.Tangent": 1, "In.Binormal": 1, "cross": 1, "view": 4, "vViewPosition.xyz": 1, "Out.Pos": 1, "Out.reflection": 1, "reflect": 2, "Out.refraction": 1, "Out.fresnel": 1, "dot": 1, "#define": 1, "PS_INPUT": 2, "#if": 1, "textureCUBE": 1, "reflectionMap": 4, "samplerCUBE": 2, "reflectionMapSampler": 4, "LINEAR": 9, "#else": 1, "<": 1, "string": 2, "type": 1, "name": 1, "#endif": 1, "color": 1, "texCUBE": 2, "In.reflection": 1, "In.refraction": 1, "In.fresnel": 1, "abs": 1, "In.normal": 1, ".z": 1, "Out.color": 1, "lerp": 1, "pow": 1, "blur_ps_vs_2_0": 2, "P0": 2, "vs_2_0": 2, "ps_2_0": 2, "alpha": 2, "tex": 5, "tex_sampler": 2, "WRAP": 2, "vertex": 2, "ipos": 2, "Out.pos": 1, "Out.tex": 1, "pixel": 2, "COLOR": 1, "In.tex": 1 }, "HTML": { "": 4, "HTML": 2, "PUBLIC": 3, "W3C": 3, "DTD": 5, "4": 1, "0": 3, "Frameset": 1, "EN": 3, "http": 4, "www": 3, "w3": 3, "org": 3, "TR": 3, "REC": 1, "html40": 1, "frameset": 1, "dtd": 3, "": 5, "": 5, "Common_meta": 1, "(": 157, ")": 157, "": 3, "Android": 5, "API": 7, "Differences": 2, "Report": 2, "": 3, "": 5, "
": 33, "class=": 59, "Header": 1, "

": 11, "

": 11, "

": 14, "This": 2, "document": 1, "details": 1, "the": 14, "changes": 2, "in": 4, "framework": 2, "API.": 3, "It": 2, "shows": 1, "additions": 1, "modifications": 1, "and": 6, "removals": 2, "for": 2, "packages": 1, "classes": 1, "methods": 1, "fields.": 1, "Each": 1, "reference": 1, "to": 3, "an": 3, "change": 2, "includes": 1, "a": 10, "brief": 1, "description": 1, "of": 5, "explanation": 1, "suggested": 1, "workaround": 1, "where": 1, "available.": 1, "

": 14, "The": 2, "differences": 2, "described": 1, "this": 2, "report": 1, "are": 3, "based": 1, "comparison": 1, "APIs": 1, "whose": 1, "versions": 1, "specified": 1, "upper": 1, "-": 158, "right": 1, "corner": 1, "page.": 2, "compares": 1, "newer": 1, "older": 2, "version": 1, "noting": 1, "any": 1, "relative": 1, "So": 1, "example": 2, "indicated": 1, "no": 1, "longer": 1, "present": 1, "For": 1, "more": 1, "information": 1, "about": 1, "SDK": 1, "see": 1, "": 8, "href=": 11, "target=": 3, "product": 1, "site": 1, "": 8, ".": 5, "if": 10, "no_delta": 1, "

": 1, "Congratulation": 1, "

": 1, "No": 1, "were": 1, "detected": 1, "between": 1, "two": 1, "provided": 1, "APIs.": 1, "endif": 4, "removed_packages": 2, "Table": 3, "name": 24, "rows": 3, "{": 9, "it.from": 1, "ModelElementRow": 1, "}": 9, "
": 3, "added_packages": 2, "it.to": 2, "PackageAddedLink": 1, "SimpleTableRow": 2, "changed_packages": 2, "PackageChangedLink": 1, "
": 34, "": 5, "": 4, "html": 3, "XHTML": 4, "1": 2, "Strict": 1, "xhtml1": 4, "strict": 1, "xmlns=": 2, "is": 2, "sample": 1, "file": 1, "": 1, "": 4, "id=": 47, "Just": 1, "simple": 1, "": 1, "": 1, "test": 1, "": 1, "": 3, "rel=": 3, "": 12, "": 14, "": 28, "": 6, "bindings=": 6, "": 6, "": 6, "": 6, "": 14, "
": 28, "": 14, "
": 12, "Button": 2, "A": 1, "B": 1, "Go": 2, "mousemove=": 2, "do": 9, "text=": 5, "Previous": 2, "Next": 2, "keydown=": 1, "Transitional": 1, "transitional": 1, "": 2, "equiv=": 1, "content=": 1, "Related": 2, "Pages": 2, "Main": 1, "Page": 1, "&": 3, "middot": 3, "Class": 2, "Overview": 2, "Hierarchy": 1, "All": 1, "Classes": 1, "Here": 1, "list": 1, "all": 1, "related": 1, "documentation": 1, "pages": 1, "": 2, "src=": 2, "alt=": 2, "width=": 1, "height=": 2, "16": 1, "Layout": 1, "System": 1, "Generated": 1, "with": 1, "Doxygen": 1, "charset=": 2, "": 1, "+": 2, "": 1, "": 1, "

": 1, "": 1, "HREF=": 1, "Supported": 1, "Targets": 1, "": 1, "

": 1, "": 1, "": 1 }, "HTML+Django": { "{": 8, "%": 12, "from": 1, "import": 1, "label": 1, "as": 2, "description": 1, "}": 9, "macro": 1, "field": 1, "(": 1, "name": 1, "value": 1, "type": 1, ")": 1, "
": 1, "class=": 1, "": 1, "type=": 1, "name=": 1, "value=": 1, "
": 1, "endmacro": 1, "": 1, "": 1, "extends": 1, "": 1, "": 1, "if": 1, "horse": 2, "Chuck": 2, "Norris": 2, "once": 2, "kicked": 1, "a": 2, "in": 2, "the": 1, "chin.": 1, "Its": 1, "descendants": 1, "are": 1, "known": 1, "today": 1, "Giraffes.": 1, "elif": 1, "optimus": 1, "urinated": 1, "semi": 1, "truck": 1, "Username": 1, "user": 1, "pass": 1, "password": 1, "item": 1, "t": 1, "escape": 1, "foo": 2, "#": 1, "|": 1, "safe": 1, "": 1, "": 1 }, "HTML+ECR": { "<%>": 3, "if": 1, "name": 2, "Greeting": 2, "<%=>": 1, "else": 1, "end": 1 }, "HTML+EEX": { "

": 1, "Listing": 1, "Books": 1, "

": 1, "": 1, "": 2, "": 5, "Summary": 1, "": 2, "<": 1, "%": 1, "for": 1, "book": 7, "<->": 1, "books": 1, "do": 1, "<%#>": 1, "comment": 1, "": 5, "content": 1, "link": 4, "Show": 1, "to": 4, "book_path": 4, "conn": 4, "show": 1, "Edit": 1, "edit": 1, "Delete": 1, "delete": 2, "method": 1, "data": 1, "confirm": 1, "Are": 1, "you": 1, "sure": 1, "<%>": 1, "end": 1, "
": 5, "Title": 1, "
": 5, "<%=>": 6, "title": 1, "
": 1, "
": 1, "New": 1, "new": 1 }, "HTML+ERB": { "<%>": 12, "if": 3, "Spree": 4, "Config": 4, "enable_fishbowl": 1, "
": 23, "class=": 24, "id=": 1, "
": 1, "": 1, "align=": 1, "<%=>": 12, "t": 4, "fishbowl_settings": 1, "": 1, "fishbowl_options": 1, "each": 1, "do": 2, "key": 5, "label_tag": 2, "to_s": 2, "gsub": 1, "fishbowl_": 1, "to_sym": 1, "tag": 2, "br": 2, "text_field_tag": 1, "preferences": 4, "size": 1, "class": 2, "}": 3, ")": 4, "%": 2, "
": 23, "end": 5, "hidden_field_tag": 1, "fishbowl_always_fetch_current_inventory": 3, "0": 1, "check_box_tag": 1, "1": 1, "always_fetch_current_inventory": 1, "location_groups": 2, "empty": 1, "fishbowl_location_group": 3, "location_group": 1, "select": 1, "selected": 1, "[": 2, "]": 2, "{": 1, "": 1, "": 1, "provide": 1, "title": 1, "header": 2, "present": 1, "users": 3, "user_presenter": 1, "

": 1, "

": 1, "will_paginate": 2, "Name": 1, "Email": 1, "Chords": 1, "Keys": 1, "Tunings": 1, "Credits": 1, "Prem": 1, "Since": 1, "No": 1, "Users": 1, "else": 1, "render": 1 }, "Hack": { "<": 25, "hh": 23, "//": 18, "strict": 23, "final": 21, "class": 27, "AssertException": 6, "extends": 18, "Exception": 5, "{": 176, "}": 182, "Assert": 1, "public": 36, "static": 6, "function": 106, "isNum": 1, "(": 290, "mixed": 18, "x": 30, ")": 295, "num": 1, "if": 20, "is_float": 2, "return": 86, ";": 203, "else": 2, "is_int": 3, "throw": 9, "new": 11, "isInt": 1, "int": 11, "isFloat": 1, "float": 1, "isString": 1, "string": 65, "is_string": 3, "isArrayOf": 1, "": 2, "T": 1, "fn": 2, "array": 13, "is_array": 2, "array_map": 2, "require_once": 24, "_SERVER": 19, "[": 28, "]": 28, ".": 28, "AssertRecipe": 1, "Recipe": 6, "implements": 5, "RecipeWithDemo": 7, "protected": 44, "getName": 8, "<<": 5, "Override": 5, "getDescription": 7, "getFilenames": 7, "Vector": 31, "": 12, "getDocs": 8, "<(string,>": 6, "tuple": 8, "getDemoFilename": 8, "getDemoResult": 7, "assert_main": 1, "getDemoXHP": 7, "xhp": 19, "null": 14, "abstract": 13, "Controller": 3, "__construct": 5, "startup": 2, "getCSS": 3, "Set": 10, "getJS": 3, "getTitle": 4, "render": 5, "getHead": 2, "css": 3, "this": 32, "-": 59, "toVector": 2, "map": 5, "": 1, "rel=": 1, "type=": 5, "href=": 16, "js": 3, "": 3, "block": 3, "#head": 1, "/block": 3, "": 1, "": 1, "class=": 12, "document.documentElement.className": 1, "+": 3, "#navbar": 1, "include": 3, "_navbar.latte": 1, "
": 6, "inner": 1, "foreach=": 3, "_flash.latte": 1, "
": 7, "#content": 1, "
": 1, "
": 1, "src=": 1, "#scripts": 1, "": 1, "": 1, "var": 3, "define": 1, "author": 7, "": 2, "Author": 2, "authorId": 2, "-": 71, "id": 3, "black": 2, "avatar": 2, "img": 2, "rounded": 2, "class": 2, "tooltip": 4, "Total": 1, "time": 4, "shortName": 1, "translated": 4, "on": 5, "all": 1, "videos.": 1, "amaraCallbackLink": 1, "row": 2, "col": 3, "md": 2, "outOf": 5, "done": 7, "threshold": 4, "alert": 2, "warning": 2, "<=>": 2, "Seems": 1, "complete": 1, "|": 6, "out": 1, "

": 2, "elseif": 2, "<": 1, "p": 1, "if": 7, "Although": 1, "is": 1, "there": 1, "are": 1, "no": 1, "English": 1, "subtitles": 1, "for": 1, "comparison.": 1, "/if": 8, "/cache": 1, "editor": 1, "ksid": 2, "new": 5, "video": 2, "siteId": 1, "Video": 1, "khanovaskola.cz": 1, "revision": 18, "rev": 4, "this": 3, "older": 1, "#": 2, "else": 2, "newer": 1, "
": 1, "

": 1, "diffs": 3, "noescape": 2, "

": 1, "description": 1, "text": 4, "as": 2, "line": 3, "context": 1, "splitter": 1, "template": 1, "bottom": 1, "Expand": 1, "fa": 16, "sort": 1, "ellipsis": 1, "h": 1, "success": 1, "amaraEdit": 1, "amaraId": 2, "editButton": 1, "btn": 17, "default": 6, "edit": 1, "khanAcademy": 1, "kaButton": 1, "link": 1, "info": 1, "group": 4, "approve": 1, "thumbs": 3, "up": 1, "markIncomplete": 2, "down": 2, "redirectToAdd": 1, "plus": 1, "square": 1, "table": 2, "condensed": 1, "revisions": 1, "revId": 1, "secondary": 2, "Percent": 1, "lines": 1, "&": 1, "thinsp": 1, "%": 1, "": 3, "": 3, "": 2, "incomplete": 3, "approved": 2, "": 1, "user": 1, "loggedIn": 1, "&&": 1, "comments": 2, "count": 1, "": 2, "": 2, "colspan=": 1, "": 1, "comment": 4, "left": 1, "createdAt": 1, "timeAgo": 1, "noborder": 1, "input": 3, "form": 1, "control": 1, "Comment": 1, "only": 1, "visible": 1, "other": 1, "editors": 1, "save": 1, "share": 1, "": 1, "": 1, "/form": 1, "/foreach": 1, "
": 1 }, "Lean": { "/": 6, "-": 6, "Copyright": 1, "(": 66, "c": 22, ")": 66, "Microsoft": 1, "Corporation.": 1, "All": 1, "rights": 1, "reserved.": 1, "Released": 1, "under": 1, "Apache": 1, "license": 1, "as": 1, "described": 1, "in": 1, "the": 1, "file": 1, "LICENSE.": 1, "Module": 1, "algebra.binary": 1, "Authors": 1, "Leonardo": 1, "de": 1, "Moura": 1, "Jeremy": 1, "Avigad": 1, "General": 1, "properties": 1, "of": 1, "binary": 3, "operations.": 1, "import": 2, "logic.eq": 1, "open": 3, "eq.ops": 1, "namespace": 3, "section": 1, "variable": 11, "{": 14, "A": 29, "Type": 3, "}": 14, "variables": 1, "op": 4, "inv": 2, "one": 2, "local": 5, "notation": 4, "a": 56, "*": 33, "b": 41, "definition": 17, "commutative": 2, "associative": 3, "left_identity": 1, "right_identity": 1, "left_inverse": 1, "right_inverse": 1, "left_cancelative": 1, "right_cancelative": 1, "inv_op_cancel_left": 1, "op_inv_cancel_left": 1, "inv_op_cancel_right": 1, "op_inv_cancel_right": 1, "+": 10, "left_distributive": 1, "right_distributive": 1, "end": 9, "context": 2, "f": 9, "H_comm": 3, "H_assoc": 8, "infixl": 2, "theorem": 3, "left_comm": 1, "a*": 7, "b*c": 5, "b*": 3, "a*c": 4, "take": 2, "calc": 3, "a*b": 5, "*c": 4, "...": 5, "b*a": 1, "right_comm": 1, "*b": 2, "c*b": 1, "assoc4helper": 1, "d": 1, "c*d": 3, "*d": 2, ".basic": 1, "types.pi": 1, "trunc": 1, "truncation": 1, "sigma": 1, "sigma.ops": 1, "pi": 1, "function": 1, "eq": 1, "morphism": 1, "precategory": 3, "equiv": 1, "universe": 2, "l": 16, "set_precategory": 1, "precategory.": 2, "Type.": 4, "is_hset": 4, "begin": 3, "fapply": 6, "precategory.mk.": 1, "intros": 15, "apply": 22, "a.1": 3, "a_1.1": 1, "trunc_pi": 1, "b.2": 1, "intro": 5, "x": 7, "exact": 7, "a_1": 2, "a_2": 1, "funext.path_pi": 3, "idp": 3, "category": 2, "attribute": 1, "precategory.set_precategory.": 1, "[": 1, "instance": 1, "]": 1, "set_category_equiv_iso": 2, "b.1": 1, "ua": 2, "equiv.mk": 3, "H": 3, "isomorphic.rec_on": 3, "H1": 3, "H2": 3, "is_iso.rec_on": 2, "H3": 2, "H4": 1, "H5": 1, "is_equiv.adjointify": 2, "sorry": 4, "set_category": 1, "category.": 1, "assert": 2, "C": 1, "precategory.set_precategory": 1, "category.mk": 1, "p": 5, "B": 3, "iso_of_path": 1, "@equiv_path": 1, "A.1": 1, "B.1": 1, "iso": 2, "is_iso": 1, "retr": 1, "sigma.path": 1, "sect": 1, "_": 1, "@is_hprop.elim": 1, "is_trunc_is_hprop": 1 }, "Less": { "@blue": 4, "#3bbfce": 1, ";": 7, "@margin": 3, "px": 1, ".content": 1, "-": 3, "navigation": 1, "{": 2, "border": 2, "color": 3, "darken": 1, "(": 1, "%": 1, ")": 1, "}": 2, ".border": 1, "padding": 1, "/": 2, "margin": 1 }, "Lex": { "#include": 6, "": 1, "": 1, "#if": 2, "#else": 2, "#endif": 3, "#define": 21, "YYCTYPE": 1, "unsigned": 3, "char": 8, "YYFILL": 1, "(": 107, "n": 3, ")": 109, "{": 34, "if": 10, "YYCURSOR": 9, "YYLIMIT": 4, "return": 14, ";": 66, "}": 32, "SCNG": 25, "yy_cursor": 1, "yy_limit": 1, "YYMARKER": 1, "yy_marker": 1, "YYGETCONDITION": 3, "yy_state": 2, "YYSETCONDITION": 4, "s": 6, "STATE": 2, "name": 1, "yyc##name": 1, "BEGIN": 4, "state": 2, "YYSTATE": 1, "yytext": 11, "char*": 2, "yy_text": 4, "yyleng": 12, "yy_leng": 1, "yyless": 1, "x": 3, "do": 1, "+": 17, "int": 13, "while": 5, "ZEND_MMAP_AHEAD": 1, "<": 3, "YYMAXFILL": 1, "INI_SCNG": 1, "#ifdef": 1, "ZTS": 1, "ZEND_API": 2, "ts_rsrc_id": 1, "ini_scanner_globals_id": 1, "zend_ini_scanner_globals": 1, "ini_scanner_globals": 1, "EAT_LEADING_WHITESPACE": 1, "[": 20, "]": 22, "||": 5, "-": 19, "else": 2, "break": 3, "EAT_TRAILING_WHITESPACE_EX": 2, "ch": 3, "&&": 3, "EAT_TRAILING_WHITESPACE": 1, "zend_ini_copy_value": 3, "retval": 4, "str": 8, "len": 10, "Z_STRVAL_P": 2, "zend_strndup": 2, "Z_STRLEN_P": 2, "Z_TYPE_P": 1, "IS_STRING": 1, "RETURN_TOKEN": 2, "type": 2, "ini_lval": 1, "static": 4, "void": 6, "_yy_push_state": 2, "new_state": 2, "TSRMLS_DC": 5, "zend_stack_push": 1, "&": 9, "state_stack": 4, "*": 2, "sizeof": 1, "yy_push_state": 1, "state_and_tsrm": 1, "yyc##state_and_tsrm": 1, "yy_pop_state": 1, "TSRMLS_D": 4, "*stack_state": 1, "zend_stack_top": 1, "**": 1, "stack_state": 1, "yy_start": 1, "ini_filename": 7, "filename": 3, "init_ini_scanner": 3, "scanner_mode": 9, "zend_file_handle": 2, "*fh": 2, "ZEND_INI_SCANNER_NORMAL": 1, "ZEND_INI_SCANNER_RAW": 1, "zend_error": 1, "E_WARNING": 1, "FAILURE": 7, "lineno": 6, "yy_in": 1, "fh": 7, "NULL": 3, "strlen": 2, "zend_stack_init": 1, "INITIAL": 3, "SUCCESS": 3, "shutdown_ini_scanner": 1, "zend_stack_destroy": 1, "free": 1, "zend_ini_scanner_get_lineno": 1, "*zend_ini_scanner_get_filename": 1, "zend_ini_open_file_for_scanning": 1, "*buf": 1, "size_t": 1, "size": 3, "zend_stream_fixup": 1, "buf": 2, "TSRMLS_CC": 6, "zend_file_handle_dtor": 1, "yy_scan_buffer": 2, "zend_ini_prepare_string_for_scanning": 1, "*str": 2, "zend_ini_escape_string": 1, "zval": 1, "*lval": 1, "quote_type": 1, "register": 1, "*s": 1, "*t": 1, "*end": 1, "lval": 3, "t": 5, "end": 2, "NUMBER": 1, "LNUM": 1, "|": 6, "DNUM": 1, "ANY_CHAR": 1, ".": 1, "NEWLINE": 1, "TABS_AND_SPACES": 1, "WHITESPACE": 1, "CONSTANT": 1, "a": 2, "zA": 2, "Z_": 1, "Z0": 1, "_": 1, "LABEL": 1, "r": 1, "RAW_VALUE_CHARS": 1, "true": 1, "on": 2, "yes": 1, "false": 1, "off": 1, "no": 1, "none": 1, "null": 1, "switch": 1, "case": 4, "TC_RAW": 1, "Comments": 1, "starting": 1, "with": 1, "are": 1, "deprecated": 1, "in": 1, "%": 2, "line": 1, "d": 1, "zend_ini_scanner_get_filename": 1, "TSRMLS_C": 1, "END_OF_LINE": 2, "": 1, "<*>": 1, "*/": 1 }, "Limbo": { "implement": 2, "Cat": 2, ";": 41, "include": 4, "sys": 14, "Sys": 8, "module": 2, "{": 14, "init": 4, "fn": 5, "(": 32, "ctxt": 1, "ref": 11, "Draw": 2, "-": 20, "Context": 2, "argv": 1, "list": 2, "of": 5, "string": 3, ")": 32, "}": 14, "stdout": 3, "FD": 2, "nil": 7, "args": 9, "load": 1, "PATH": 2, "fildes": 5, "tl": 2, "if": 5, "for": 1, "file": 7, "hd": 1, "fd": 5, "open": 1, "OREAD": 1, "fprint": 3, "raise": 3, "cat": 3, "else": 1, "buf": 4, "array": 1, "[": 2, "ATOMICIO": 1, "]": 2, "byte": 1, "while": 1, "n": 4, "read": 1, "len": 1, "write": 1, "<": 4, "Lock": 2, "Semaphore.obtain": 1, "l": 4, "self": 4, "Semaphore": 8, "l.c": 3, "Semaphore.release": 1, "Semaphore.new": 1, "chan": 2, "int": 2, "return": 1, "con": 1, "adt": 1, "c": 1, "obtain": 1, "release": 1, "new": 1 }, "Linker Script": { "OUTPUT_ARCH": 3, "(": 128, "mips": 1, ")": 128, "ENTRY": 4, "start": 2, "SECTIONS": 3, "{": 30, ".text": 6, "*": 30, ".rodata": 1, "}": 30, ".data": 6, "__image_begin": 1, ".": 62, ";": 74, ".image": 1, "__image_end": 1, "CONSTRUCTORS": 2, "ALIGN": 19, "_edata": 2, ".bss": 7, "_end": 4, "/DISCARD/": 2, ".MIPS.options": 1, ".options": 1, ".pdr": 1, ".reginfo": 1, ".comment": 1, ".note": 1, "OUTPUT_FORMAT": 2, "elf32": 1, "-": 24, "i386": 4, "#ifdef": 12, "CONFIG_X86_32": 5, "#define": 9, "LOAD_OFFSET": 24, "__PAGE_OFFSET": 1, "#else": 5, "__START_KERNEL_map": 1, "#endif": 16, "#include": 8, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "#undef": 3, "CONFIG_OUTPUT_FORMAT": 3, "phys_startup_32": 2, "jiffies": 2, "jiffies_64": 2, "x86": 1, "phys_startup_64": 2, "#if": 4, "defined": 7, "CONFIG_X86_64": 6, "&&": 2, "CONFIG_DEBUG_RODATA": 2, "X64_ALIGN_DEBUG_RODATA_BEGIN": 3, "HPAGE_SIZE": 2, "X64_ALIGN_DEBUG_RODATA_END": 3, "__end_rodata_hpage_align": 1, "PHDRS": 1, "text": 4, "PT_LOAD": 4, "FLAGS": 5, "data": 3, "CONFIG_SMP": 4, "percpu": 2, "init": 2, "note": 2, "PT_NOTE": 1, "+": 6, "LOAD_PHYSICAL_ADDR": 1, "startup_32": 1, "__START_KERNEL": 1, "startup_64": 1, "AT": 18, "ADDR": 18, "_text": 2, "HEAD_TEXT": 1, "_stext": 1, "TEXT_TEXT": 1, "SCHED_TEXT": 1, "LOCK_TEXT": 1, "KPROBES_TEXT": 1, "ENTRY_TEXT": 1, "IRQENTRY_TEXT": 1, ".fixup": 1, ".gnu.warning": 1, "_etext": 1, "NOTES": 1, "EXCEPTION_TABLE": 1, "PAGE_SIZE": 15, "RO_DATA": 1, "_sdata": 1, "INIT_TASK_DATA": 1, "THREAD_SIZE": 1, "NOSAVE_DATA": 2, "PAGE_ALIGNED_DATA": 1, "CACHELINE_ALIGNED_DATA": 1, "L1_CACHE_BYTES": 1, "DATA_DATA": 1, "READ_MOSTLY_DATA": 1, "INTERNODE_CACHE_BYTES": 3, "__vvar_page": 2, ".vvar": 2, "__vvar_beginning_hack": 3, "EMIT_VVAR": 2, "name": 2, "offset": 2, ".vvar_": 1, "##": 1, "__VVAR_KERNEL_LDS": 2, "": 1, ".init.begin": 2, "__init_begin": 1, "PERCPU_VADDR": 1, "ASSERT": 5, "SIZEOF": 1, ".data..percpu": 1, "<": 4, "CONFIG_PHYSICAL_START": 1, "INIT_TEXT_SECTION": 1, "INIT_DATA_SECTION": 1, ".x86_cpu_dev.init": 3, "__x86_cpu_dev_start": 1, "__x86_cpu_dev_end": 1, "CONFIG_X86_INTEL_MID": 1, ".x86_intel_mid_dev.init": 3, "__x86_intel_mid_dev_start": 1, "__x86_intel_mid_dev_end": 1, ".parainstructions": 3, "__parainstructions": 1, "__parainstructions_end": 1, ".altinstructions": 3, "__alt_instructions": 1, "__alt_instructions_end": 1, ".altinstr_replacement": 3, ".iommu_table": 3, "__iommu_table": 1, "__iommu_table_end": 1, ".apicdrivers": 3, "__apicdrivers": 1, "__apicdrivers_end": 1, ".exit.text": 2, "EXIT_TEXT": 1, ".exit.data": 2, "EXIT_DATA": 1, "||": 1, "PERCPU_SECTION": 1, ".init.end": 2, "__init_end": 1, ".smp_locks": 3, "__smp_locks": 1, "__smp_locks_end": 1, ".data_nosave": 2, "__bss_start": 1, ".bss..page_aligned": 1, "__bss_stop": 1, ".brk": 2, "__brk_base": 1, ".brk_reservation": 1, "__brk_limit": 1, "STABS_DEBUG": 1, "DWARF_DEBUG": 1, "DISCARDS": 1, ".eh_frame": 1, "KERNEL_IMAGE_SIZE": 2, "INIT_PER_CPU": 3, "x": 2, "init_per_cpu__##x": 1, "__per_cpu_load": 1, "gdt_page": 1, "irq_stack_union": 2, "CONFIG_KEXEC": 1, "": 1, "kexec_control_code_size": 1, "KEXEC_CONTROL_CODE_MAX_SIZE": 1 }, "Linux Kernel Module": { "/data/israel/edison/poky/meta": 31, "-": 62, "edison/recipes": 31, "kernel/bcm43340/driver_bcm43x/bcm4334x.ko": 1, "kernel/bcm43340/driver_bcm43x/dhd_pno.o": 1, "kernel/bcm43340/driver_bcm43x/dhd_common.o": 1, "kernel/bcm43340/driver_bcm43x/dhd_ip.o": 1, "kernel/bcm43340/driver_bcm43x/dhd_custom_gpio.o": 1, "kernel/bcm43340/driver_bcm43x/dhd_linux.o": 1, "kernel/bcm43340/driver_bcm43x/dhd_linux_sched.o": 1, "kernel/bcm43340/driver_bcm43x/dhd_cfg80211.o": 1, "kernel/bcm43340/driver_bcm43x/dhd_linux_wq.o": 1, "kernel/bcm43340/driver_bcm43x/aiutils.o": 1, "kernel/bcm43340/driver_bcm43x/bcmevent.o": 1, "kernel/bcm43340/driver_bcm43x/bcmutils.o": 1, "kernel/bcm43340/driver_bcm43x/bcmwifi_channels.o": 1, "kernel/bcm43340/driver_bcm43x/hndpmu.o": 1, "kernel/bcm43340/driver_bcm43x/linux_osl.o": 1, "kernel/bcm43340/driver_bcm43x/sbutils.o": 1, "kernel/bcm43340/driver_bcm43x/siutils.o": 1, "kernel/bcm43340/driver_bcm43x/wl_android.o": 1, "kernel/bcm43340/driver_bcm43x/wl_cfg80211.o": 1, "kernel/bcm43340/driver_bcm43x/wl_cfgp2p.o": 1, "kernel/bcm43340/driver_bcm43x/wl_cfg_btcoex.o": 1, "kernel/bcm43340/driver_bcm43x/wldev_common.o": 1, "kernel/bcm43340/driver_bcm43x/wl_linux_mon.o": 1, "kernel/bcm43340/driver_bcm43x/dhd_linux_platdev.o": 1, "kernel/bcm43340/driver_bcm43x/bcmsdh.o": 1, "kernel/bcm43340/driver_bcm43x/bcmsdh_linux.o": 1, "kernel/bcm43340/driver_bcm43x/bcmsdh_sdmmc.o": 1, "kernel/bcm43340/driver_bcm43x/bcmsdh_sdmmc_linux.o": 1, "kernel/bcm43340/driver_bcm43x/dhd_cdc.o": 1, "kernel/bcm43340/driver_bcm43x/dhd_wlfc.o": 1, "kernel/bcm43340/driver_bcm43x/dhd_sdio.o": 1, "fs/mbcache.ko": 1, "fs/mbcache.o": 1, "crypto/md5.ko": 1, "crypto/md5.o": 1 }, "Liquid": { "": 1, "html": 1, "PUBLIC": 1, "W3C": 1, "DTD": 2, "XHTML": 1, "1": 1, "0": 1, "Transitional": 1, "EN": 1, "http": 2, "www": 1, "w3": 1, "org": 1, "TR": 1, "xhtml1": 2, "transitional": 1, "dtd": 1, "": 1, "xmlns=": 1, "xml": 1, "lang=": 2, "": 1, "": 1, "equiv=": 1, "content=": 1, "": 1, "{": 89, "shop.name": 2, "}": 89, "-": 4, "page_title": 1, "": 1, "|": 31, "global_asset_url": 5, "stylesheet_tag": 3, "script_tag": 5, "shopify_asset_url": 1, "asset_url": 2, "content_for_header": 1, "": 1, "": 1, "id=": 28, "

": 1, "class=": 14, "": 9, "href=": 9, "Skip": 1, "to": 1, "navigation.": 1, "": 9, "

": 1, "%": 46, "if": 5, "cart.item_count": 7, "
": 23, "style=": 5, "

": 3, "There": 1, "pluralize": 3, "in": 8, "title=": 3, "your": 1, "cart": 1, "

": 3, "

": 1, "Your": 1, "subtotal": 1, "is": 1, "cart.total_price": 2, "money": 5, ".": 3, "

": 1, "for": 6, "item": 1, "cart.items": 1, "onMouseover=": 2, "onMouseout=": 2, "": 4, "src=": 5, "
": 23, "endfor": 6, "
": 2, "endif": 5, "

": 1, "

": 1, "onclick=": 1, "View": 1, "Mini": 1, "Cart": 1, "(": 1, ")": 1, "
": 3, "content_for_layout": 1, "
    ": 5, "link": 2, "linklists.main": 1, "menu.links": 1, "
  • ": 5, "link.title": 2, "link_to": 2, "link.url": 2, "
  • ": 5, "
": 5, "tags": 1, "tag": 4, "collection.tags": 1, "": 1, "link_to_add_tag": 1, "": 1, "highlight_active_tag": 1, "link_to_tag": 1, "linklists.footer.links": 1, "All": 1, "prices": 1, "are": 1, "shop.currency": 1, "Powered": 1, "by": 1, "Shopify": 1, "": 1, "": 1, "

": 1, "We": 1, "have": 1, "wonderful": 1, "products": 1, "

": 1, "image": 1, "product.images": 1, "forloop.first": 1, "rel=": 2, "alt=": 2, "else": 1, "product.title": 1, "Vendor": 1, "product.vendor": 1, "link_to_vendor": 1, "Type": 1, "product.type": 1, "link_to_type": 1, "": 1, "product.price_min": 1, "product.price_varies": 1, "product.price_max": 1, "": 1, "": 1, "action=": 1, "method=": 1, "": 1, "": 1, "type=": 2, "": 1, "product.description": 1, "": 1 }, "Literate Agda": { "documentclass": 1, "{": 35, "article": 1, "}": 35, "usepackage": 7, "amssymb": 1, "bbm": 1, "[": 2, "greek": 1, "english": 1, "]": 2, "babel": 1, "ucs": 1, "utf8x": 1, "inputenc": 1, "autofe": 1, "DeclareUnicodeCharacter": 3, "ensuremath": 3, "ulcorner": 1, "urcorner": 1, "overline": 1, "equiv": 1, "fancyvrb": 1, "DefineVerbatimEnvironment": 1, "code": 3, "Verbatim": 1, "%": 1, "Add": 1, "fancy": 1, "options": 1, "here": 1, "if": 1, "you": 1, "like.": 1, "begin": 2, "document": 2, "module": 3, "NatCat": 1, "where": 2, "open": 2, "import": 2, "Relation.Binary.PropositionalEquality": 1, "EasyCategory": 3, "(": 36, "obj": 4, "Set": 2, ")": 36, "_": 6, "x": 34, "y": 28, "z": 18, "id": 9, "single": 4, "-": 17, "inhabitant": 4, "r": 26, "s": 29, "assoc": 2, "w": 4, "t": 6, "Data.Nat": 1, "same": 5, ".0": 2, "n": 14, "refl": 6, ".": 5, "suc": 6, "m": 6, "cong": 1, "trans": 5, ".n": 1, "zero": 1, "Nat": 1, "end": 2 }, "Literate CoffeeScript": { "The": 2, "**Scope**": 2, "class": 2, "regulates": 1, "lexical": 1, "scoping": 1, "within": 2, "CoffeeScript.": 1, "As": 1, "you": 2, "generate": 1, "code": 1, "create": 1, "a": 8, "tree": 1, "of": 4, "scopes": 1, "in": 2, "the": 12, "same": 1, "shape": 1, "as": 3, "nested": 1, "function": 2, "bodies.": 1, "Each": 1, "scope": 2, "knows": 1, "about": 1, "variables": 3, "declared": 2, "it": 4, "and": 5, "has": 1, "reference": 3, "to": 8, "its": 3, "parent": 2, "enclosing": 1, "scope.": 2, "In": 1, "this": 3, "way": 1, "we": 4, "know": 1, "which": 3, "are": 3, "new": 2, "need": 2, "be": 2, "with": 3, "var": 4, "shared": 1, "external": 1, "scopes.": 1, "Import": 1, "helpers": 1, "plan": 1, "use.": 1, "{": 4, "extend": 1, "last": 1, "}": 4, "require": 1, "exports.Scope": 1, "Scope": 1, "root": 1, "is": 3, "top": 2, "-": 5, "level": 1, "object": 1, "for": 3, "given": 1, "file.": 1, "@root": 1, "null": 1, "Initialize": 1, "lookups": 1, "up": 1, "chain": 1, "well": 1, "**Block**": 1, "node": 1, "belongs": 2, "where": 1, "should": 1, "declare": 1, "that": 2, "to.": 1, "constructor": 1, "(": 5, "@parent": 2, "@expressions": 1, "@method": 1, ")": 6, "@variables": 3, "[": 4, "name": 8, "type": 5, "]": 4, "@positions": 4, "Scope.root": 1, "unless": 1, "Adds": 1, "variable": 1, "or": 1, "overrides": 1, "an": 1, "existing": 1, "one.": 1, "add": 1, "immediate": 3, "return": 1, "@parent.add": 1, "if": 2, "@shared": 1, "not": 1, "Object": 1, "hasOwnProperty.call": 1, ".type": 1, "else": 2, "@variables.push": 1, "When": 1, "super": 1, "called": 1, "find": 1, "current": 1, "method": 1, "param": 1, "_": 3, "then": 1, "tempVars": 1, "realVars": 1, ".push": 1, "v.name": 1, "realVars.sort": 1, ".concat": 1, "tempVars.sort": 1, "Return": 1, "list": 1, "assignments": 1, "supposed": 1, "made": 1, "at": 1, "assignedVariables": 1, "v": 1, "when": 1, "v.type.assigned": 1 }, "LiveScript": { "a": 8, "-": 25, "const": 1, "b": 3, "var": 1, "c": 3, "d": 3, "_000_000km": 1, "*": 1, "ms": 1, "e": 2, "(": 9, ")": 10, "dashes": 1, "identifiers": 1, "underscores_i": 1, "/regexp1/": 1, "and": 3, "//regexp2//g": 1, "strings": 1, "[": 2, "til": 1, "]": 2, "or": 2, "to": 2, "|": 3, "map": 1, "filter": 1, "fold": 1, "+": 1, "class": 1, "Class": 1, "extends": 1, "Anc": 1, "est": 1, "args": 1, "copy": 1, "from": 1, "callback": 4, "error": 6, "data": 2, "<": 1, "read": 1, "file": 2, "return": 2, "if": 2, "<~>": 1, "write": 1 }, "Logos": { "%": 15, "hook": 2, "ABC": 2, "-": 3, "(": 8, "id": 2, ")": 8, "a": 1, "B": 1, "b": 1, "{": 4, "log": 1, ";": 8, "return": 2, "orig": 2, "nil": 2, "}": 4, "end": 4, "subclass": 1, "DEF": 1, "NSObject": 1, "init": 3, "[": 2, "c": 1, "RuntimeAccessibleClass": 1, "alloc": 1, "]": 2, "group": 1, "OptionalHooks": 2, "void": 1, "release": 1, "self": 1, "retain": 1, "ctor": 1, "if": 1, "OptionalCondition": 1 }, "Logtalk": { "-": 3, "object": 2, "(": 4, "hello_world": 1, ")": 4, ".": 2, "%": 2, "the": 2, "initialization/1": 1, "directive": 1, "argument": 1, "is": 2, "automatically": 1, "executed": 1, "when": 1, "loaded": 1, "into": 1, "memory": 1, "initialization": 1, "nl": 2, "write": 1, "end_object.": 1 }, "LookML": { "-": 12, "view": 1, "comments": 1, "fields": 1, "dimension": 4, "id": 2, "primary_key": 1, "true": 3, "type": 6, "int": 3, "sql": 6, "{": 6, "TABLE": 6, "}": 6, ".id": 1, "body": 1, ".body": 1, "dimension_group": 2, "created": 1, "time": 4, "timeframes": 2, "[": 2, "date": 2, "week": 2, "month": 2, "]": 2, ".created_at": 1, "headline_id": 1, "hidden": 2, ".headline_id": 1, "updated": 1, ".updated_at": 1, "user_id": 1, ".user_id": 1, "measure": 1, "count": 2, "detail": 2, "detail*": 1, "sets": 1, "headlines.id": 1, "headlines.name": 1, "users.id": 1 }, "LoomScript": { "package": 2, "{": 26, "import": 4, "loom.Application": 2, ";": 78, "loom2d.display.StageScaleMode": 1, "loom2d.ui.SimpleLabel": 1, "public": 15, "class": 5, "HelloWorld": 1, "extends": 4, "Application": 2, "override": 2, "function": 11, "run": 2, "(": 56, ")": 56, "void": 7, "stage.scaleMode": 1, "StageScaleMode.LETTERBOX": 1, "centeredMessage": 2, "simpleLabel": 2, "this.getFullTypeName": 1, "trace": 13, "}": 26, "private": 8, "get": 2, "SimpleLabel": 4, "return": 4, "stage.addChild": 1, "new": 2, "as": 2, "label": 1, "msg": 2, "String": 12, "label.text": 1, "label.center": 1, "label.x": 1, "stage.stageWidth": 1, "/": 5, "label.y": 1, "stage.stageHeight": 1, "-": 8, "label.height": 1, "interface": 1, "I": 2, "C": 2, "B": 5, "implements": 1, "final": 1, "A": 6, "delegate": 1, "ToCompute": 2, "s": 3, "o": 1, "Object": 3, "Number": 11, "enum": 1, "Enumeration": 1, "foo": 1, "baz": 1, "cat": 1, "struct": 1, "P": 4, "var": 32, "x": 1, "y": 1, "static": 2, "operator": 1, "a": 13, "b": 5, "a.x": 1, "b.x": 1, "a.y": 1, "b.y": 1, "SyntaxExercise": 1, "classVar": 1, "const": 1, "CONST": 1, "_a": 4, "_d": 3, "set": 1, "value": 2, "variousTypes": 1, "defaultValue": 1, "nil": 1, "null": 2, "b1": 1, "Boolean": 5, "true": 2, "b2": 1, "false": 1, "n1": 1, "n2": 1, "n3": 1, "s1": 1, "s2": 1, "f1": 3, "Function": 1, "life": 1, "universe": 1, "...everything": 1, "v1": 1, "Vector.": 2, "": 1, "[": 2, "]": 2, "d1": 1, "Dictionary.": 2, "": 2, "+": 10, "variousOps": 1, "%": 2, "*": 3, "d": 3, "&&": 1, "e": 1, "|": 1, "castable1": 1, "is": 1, "castable2": 1, "cast": 1, ".toString": 1, "instanced": 1, "instanceof": 1, "variousFlow": 1, "n": 3, "Math.random": 3, "if": 3, "else": 2, "flip": 1, "for": 4, "i": 10, "<": 2, "v": 3, "": 1, "each": 1, "in": 3, "key1": 2, "key2": 2, "while": 2, "continue": 1, "do": 1, "switch": 1, "Math.floor": 1, "case": 2, "break": 3, "default": 1 }, "Lua": { "local": 16, "HelloCounter": 4, "pd.Class": 3, "new": 3, "(": 58, ")": 58, "register": 3, "function": 16, "initialize": 3, "sel": 3, "atoms": 3, "self.inlets": 3, "self.outlets": 3, "self.num": 5, "return": 3, "true": 4, "end": 26, "in_1_bang": 2, "self": 10, "outlet": 10, "{": 18, "}": 18, "+": 3, "in_2_float": 2, "f": 12, "FileListParser": 5, "-": 74, "Base": 1, "filename": 3, "File": 2, "extension": 2, "Number": 4, "of": 14, "files": 1, "in": 8, "batch": 2, "To": 3, "[": 17, "list": 1, "trim": 1, "]": 17, "binfile": 3, "vidya": 1, "file": 8, "modder": 1, "s": 5, "mechanisms": 1, "self.extension": 3, "the": 12, "last": 1, "self.batchlimit": 3, "in_1_symbol": 1, "for": 11, "i": 10, "do": 8, "..": 7, "in_2_list": 1, "d": 9, "in_3_float": 1, "FileModder": 10, "Object": 1, "triggering": 1, "bang": 2, "Incoming": 1, "single": 2, "data": 2, "bytes": 3, "from": 3, "Total": 1, "route": 1, "buflength": 1, "Glitch": 3, "type": 2, "point": 2, "times": 2, "to": 10, "glitch": 2, "a": 5, "Toggle": 1, "randomized": 1, "number": 2, "glitches": 3, "within": 2, "bounds": 2, "Active": 1, "inlet": 1, "get": 1, "next": 1, "byte": 2, "clear": 2, "buffer": 2, "FLOAT": 1, "write": 3, "Currently": 1, "active": 2, "namedata": 1, "self.filedata": 4, "pattern": 1, "random": 3, "or": 1, "splice": 1, "self.glitchtype": 5, "Minimum": 1, "image": 1, "self.glitchpoint": 6, "repeat": 1, "on": 2, "given": 1, "self.randrepeat": 5, "Toggles": 1, "whether": 1, "repeating": 1, "should": 1, "be": 1, "self.randtoggle": 3, "Hold": 1, "all": 1, "which": 1, "are": 1, "converted": 1, "ints": 1, "range": 1, "self.bytebuffer": 8, "Buffer": 1, "length": 1, "currently": 1, "self.buflength": 7, "if": 4, "then": 4, "plen": 2, "math.random": 8, "patbuffer": 3, "table.insert": 4, "%": 1, "#patbuffer": 1, "elseif": 2, "randlimit": 4, "else": 1, "sloc": 3, "schunksize": 2, "splicebuffer": 3, "table.remove": 1, "insertpoint": 2, "#self.bytebuffer": 1, "_": 2, "v": 4, "ipairs": 2, "outname": 3, "pd.post": 1, "in_3_list": 1, "Shift": 1, "indexed": 2, "in_4_list": 1, "in_5_float": 1, "in_6_float": 1, "in_7_list": 1, "in_8_list": 1, "SHEBANG#!lua": 1, "pcall": 1, "require": 3, "common": 1, "fastcgi": 1, "ONE_HOUR": 3, "*": 2, "ONE_DAY": 2, "wsapi_loader": 2, "common.make_loader": 1, "isolated": 1, "isolate": 1, "each": 1, "script": 4, "its": 1, "own": 1, "Lua": 3, "state": 2, "nil": 1, "you": 2, "want": 2, "force": 1, "launch": 1, "launcher": 1, "name": 1, "this": 1, "reload": 2, "false": 1, "application": 1, "every": 1, "request": 1, "period": 1, "frequency": 1, "staleness": 1, "checks": 1, "ttl": 1, "time": 1, "live": 1, "states": 1, "vars": 1, "order": 1, "checking": 1, "path": 1, "fastcgi.run": 1 }, "M": { "%": 207, "zewdAPI": 52, ";": 1309, "Enterprise": 5, "Web": 5, "Developer": 5, "run": 2, "-": 1605, "time": 9, "functions": 4, "and": 59, "user": 27, "APIs": 1, "Product": 2, "(": 2144, "Build": 6, ")": 2152, "Date": 2, "Fri": 1, "Nov": 1, "|": 171, "for": 77, "GT.M": 30, "m_apache": 3, "Copyright": 12, "c": 113, "M/Gateway": 4, "Developments": 4, "Ltd": 4, "Reigate": 4, "Surrey": 4, "UK.": 4, "All": 4, "rights": 4, "reserved.": 4, "http": 13, "//www.mgateway.com": 4, "Email": 4, "rtweed@mgateway.com": 4, "This": 26, "program": 19, "is": 88, "free": 15, "software": 12, "you": 17, "can": 20, "redistribute": 11, "it": 45, "and/or": 11, "modify": 11, "under": 14, "the": 223, "terms": 11, "of": 84, "GNU": 33, "Affero": 33, "General": 33, "Public": 33, "License": 48, "as": 23, "published": 11, "by": 35, "Free": 11, "Software": 11, "Foundation": 11, "either": 13, "version": 16, "or": 50, "at": 21, "your": 16, "option": 12, "any": 16, "later": 11, "version.": 11, "distributed": 13, "in": 80, "hope": 11, "that": 19, "will": 23, "be": 35, "useful": 11, "but": 19, "WITHOUT": 12, "ANY": 12, "WARRANTY": 11, "without": 11, "even": 12, "implied": 11, "warranty": 11, "MERCHANTABILITY": 11, "FITNESS": 11, "FOR": 15, "A": 12, "PARTICULAR": 11, "PURPOSE.": 11, "See": 15, "more": 13, "details.": 12, "You": 13, "should": 16, "have": 21, "received": 11, "a": 130, "copy": 13, "along": 11, "with": 45, "this": 39, "program.": 9, "If": 14, "not": 39, "see": 26, "": 11, ".": 815, "QUIT": 251, "_": 127, "getVersion": 1, "zewdCompiler": 6, "date": 1, "getDate": 1, "compilePage": 2, "app": 13, "page": 12, "mode": 12, "technology": 9, "outputPath": 4, "multilingual": 4, "maxLines": 4, "d": 381, "g": 228, "compileAll": 2, "templatePageName": 2, "autoTranslate": 2, "language": 6, "verbose": 2, "zewdMgr": 1, "startSession": 2, "requestArray": 2, "serverArray": 1, "sessionArray": 5, "filesArray": 1, "zewdPHP": 8, ".requestArray": 2, ".serverArray": 1, ".sessionArray": 3, ".filesArray": 1, "closeSession": 2, "saveSession": 2, "endOfPage": 2, "prePageScript": 2, "sessid": 146, "releaseLock": 2, "tokeniseURL": 2, "url": 2, "zewdCompiler16": 5, "getSessid": 1, "token": 21, "i": 465, "isTokenExpired": 2, "p": 84, "zewdSession": 39, "initialiseSession": 1, "k": 122, "deleteSession": 2, "changeApp": 1, "appName": 4, "setSessionValue": 6, "setRedirect": 1, "toPage": 1, "e": 210, "n": 197, "path": 4, "s": 775, "getRootURL": 1, "l": 84, "zewd": 17, "trace": 24, "_sessid_": 3, "_token_": 1, "_nextPage": 1, "zcvt": 11, "nextPage": 1, "isNextPageTokenValid": 2, "zewdCompiler13": 10, "isCSP": 1, "normaliseTextValue": 1, "text": 6, "replaceAll": 11, "writeLine": 2, "line": 14, "CacheTempBuffer": 2, "j": 67, "increment": 11, "w": 127, "displayOptions": 2, "fieldName": 5, "listName": 6, "escape": 7, "codeValue": 7, "name": 121, "nnvp": 1, "nvp": 1, "pos": 33, "textValue": 6, "value": 72, "getSessionValue": 3, "tr": 13, "+": 189, "f": 93, "o": 51, "q": 244, "codeValueEsc": 7, "textValueEsc": 7, "htmlOutputEncode": 2, "zewdAPI2": 5, "_codeValueEsc_": 1, "selected": 4, "translationMode": 1, "_appName": 1, "typex": 1, "type": 2, "avoid": 1, "Cache": 3, "bug": 2, "getPhraseIndex": 1, "zewdCompiler5": 1, "licensed": 1, "setWarning": 2, "isTemp": 11, "setWLDSymbol": 1, "Duplicate": 1, "performance": 1, "also": 4, "wldAppName": 1, "wldName": 1, "wldSessid": 1, "zzname": 1, "zv": 6, "[": 54, "extcErr": 1, "mess": 3, "namespace": 1, "zt": 20, "valueErr": 1, "exportCustomTags": 2, "tagList": 1, "filepath": 10, ".tagList": 1, "exportAllCustomTags": 2, "importCustomTags": 2, "filePath": 2, "zewdForm": 1, "stripSpaces": 6, "np": 17, "obj": 6, "prop": 6, "setSessionObject": 3, "allowJSONAccess": 1, "sessionName": 30, "access": 21, "disallowJSONAccess": 1, "JSONAccess": 1, "existsInSession": 2, "existsInSessionArray": 2, "p1": 5, "p2": 10, "p3": 3, "p4": 2, "p5": 2, "p6": 2, "p7": 2, "p8": 2, "p9": 2, "p10": 2, "p11": 2, "clearSessionArray": 1, "arrayName": 35, "setSessionArray": 1, "itemName": 16, "itemValue": 7, "getSessionArray": 1, "array": 22, "clearArray": 2, "set": 98, "m": 37, "getSessionArrayErr": 1, "Come": 1, "here": 4, "if": 44, "error": 62, "occurred": 2, "addToSession": 2, "@name": 4, "mergeToSession": 1, "mergeGlobalToSession": 2, "globalName": 7, "mergeGlobalFromSession": 2, "mergeArrayToSession": 1, "mergeArrayToSessionObject": 2, ".array": 1, "mergeArrayFromSession": 1, "mergeFromSession": 1, "deleteFromSession": 1, "deleteFromSessionObject": 1, "sessionNameExists": 1, "getSessionArrayValue": 2, "subscript": 7, "exists": 6, ".exists": 1, "sessionArrayValueExists": 2, "deleteSessionArrayValue": 2, "Objects": 1, "objectName": 13, "propertyName": 3, "propertyValue": 5, "comma": 3, "x": 96, "replace": 27, "objectName_": 2, "_propertyName": 2, "_propertyName_": 2, "_propertyValue_": 1, "_p": 1, "quoted": 1, "string": 50, "FromStr": 6, "S": 99, "ToStr": 4, "InText": 4, "old": 3, "new": 15, "ok": 14, "removeDocument": 1, "zewdDOM": 3, "instanceName": 2, "clearXMLIndex": 1, "zewdSchemaForm": 1, "closeDOM": 1, "makeTokenString": 1, "length": 7, "token_": 1, "r": 88, "makeString": 3, "char": 9, "len": 8, "create": 6, "characters": 8, "str": 15, "convertDateToSeconds": 1, "hdate": 7, "Q": 58, "hdate*86400": 1, "convertSecondsToDate": 1, "secs": 2, "secs#86400": 1, "getTokenExpiry": 2, "h*86400": 1, "h": 39, "randChar": 1, "R": 2, "lowerCase": 2, "stripLeadingSpaces": 2, "stripTrailingSpaces": 2, "d1": 7, "zd": 1, "yy": 19, "dd": 4, "I": 43, "<10>": 1, "dd=": 2, "mm=": 3, "1": 74, "d1=": 1, "2": 14, "p1=": 1, "mm": 7, "p2=": 1, "yy=": 1, "3": 6, "dd_": 1, "mm_": 1, "inetTime": 1, "Decode": 1, "Internet": 1, "Format": 1, "Time": 1, "from": 16, "H": 1, "format": 2, "Offset": 1, "relative": 1, "to": 74, "GMT": 1, "eg": 3, "hh": 4, "ss": 4, "<": 20, "_hh": 1, "time#3600": 1, "_mm": 1, "time#60": 1, "_ss": 2, "hh_": 1, "_mm_": 1, "openNewFile": 2, "openFile": 2, "openDOM": 2, "&": 28, "#39": 1, "<\",\"<\")>": 1, "string=": 1, "gt": 1, "amp": 1, "HTML": 1, "quot": 2, "stop": 20, "no": 54, "no2": 1, "p1_c_p2": 1, "getIP": 2, "Get": 2, "own": 2, "IP": 1, "address": 1, "ajaxErrorRedirect": 2, "classExport": 2, "className": 2, "methods": 2, ".methods": 1, "strx": 2, "disableEwdMgr": 1, "enableEwdMgr": 1, "enableWLDAccess": 1, "disableWLDAccess": 1, "isSSOValid": 2, "sso": 2, "username": 8, "password": 8, "zewdMgrAjax2": 1, "uniqueId": 1, "nodeOID": 2, "filename": 2, "linkToParentSession": 2, "zewdCompiler20": 1, "exportToGTM": 1, "routine": 6, "zewdDemo": 1, "Tutorial": 1, "Wed": 1, "Apr": 1, "getLanguage": 1, "getRequestValue": 1, "login": 1, "getTextValue": 4, "getPasswordValue": 2, "_username_": 1, "_password": 1, "logine": 1, "message": 8, "textid": 1, "errorMessage": 1, "ewdDemo": 8, "clearList": 2, "appendToList": 4, "addUsername": 1, "newUsername": 5, "newUsername_": 1, "setTextValue": 4, "testValue": 1, "pass": 24, "getSelectValue": 3, "_user": 1, "getPassword": 1, "setPassword": 1, "getObjDetails": 1, "data": 43, "_user_": 1, "_data": 2, "setRadioOn": 2, "initialiseCheckbox": 2, "setCheckboxOn": 3, "createLanguageList": 1, "setMultipleSelectOn": 2, "clearTextArea": 2, "textarea": 2, "createTextArea": 1, ".textarea": 1, "userType": 4, "setMultipleSelectValues": 1, ".selected": 1, "testField3": 3, ".value": 1, "testField2": 1, "field3": 1, "must": 8, "null": 6, "dateTime": 1, "start": 26, "student": 14, "zwrite": 1, "write": 59, "order": 11, "do": 15, "quit": 30, "file": 10, "part": 3, "DataBallet.": 4, "C": 9, "Laurent": 2, "Parenteau": 2, "": 2, "DataBallet": 4, "encode": 1, "Return": 1, "base64": 6, "URL": 2, "Filename": 1, "safe": 3, "alphabet": 2, "RFC": 1, "todrop": 2, "Populate": 1, "values": 4, "on": 17, "first": 10, "use": 5, "only.": 1, "zextract": 3, "zlength": 3, "Comment": 1, "comment": 4, "block": 1, "comments": 5, "always": 2, "semicolon": 1, "next": 1, "while": 4, "legal": 1, "blank": 1, "whitespace": 2, "alone": 1, "valid": 2, "**": 4, "Comments": 1, "graphic": 3, "character": 5, "such": 1, "@#": 1, "*": 6, "{": 5, "}": 5, "]": 15, "/": 3, "space": 1, "considered": 1, "though": 1, "t": 12, "it.": 2, "ASCII": 2, "whose": 1, "numeric": 8, "code": 29, "above": 3, "below": 1, "are": 14, "NOT": 2, "allowed": 18, "routine.": 1, "multiple": 1, "semicolons": 1, "okay": 1, "has": 7, "tag": 2, "after": 3, "does": 1, "command": 11, "Tag1": 1, "Tags": 2, "an": 14, "uppercase": 2, "lowercase": 1, "alphabetic": 2, "series": 2, "HELO": 1, "most": 1, "common": 1, "label": 5, "LABEL": 1, "followed": 1, "directly": 1, "open": 1, "parenthesis": 2, "formal": 1, "list": 1, "variables": 3, "close": 1, "ANOTHER": 1, "X": 19, "Normally": 1, "subroutine": 1, "would": 2, "ended": 1, "we": 1, "taking": 1, "advantage": 1, "rule": 1, "END": 1, "implicit": 1, "Digest": 2, "Extension": 9, "Piotr": 7, "Koper": 7, "": 7, "trademark": 2, "Fidelity": 2, "Information": 2, "Services": 2, "Inc.": 2, "//sourceforge.net/projects/fis": 2, "gtm/": 2, "simple": 2, "OpenSSL": 3, "based": 1, "digest": 19, "extension": 3, "rewrite": 1, "EVP_DigestInit": 1, "usage": 3, "example": 5, "additional": 5, "M": 24, "wrapper.": 1, "//www.openssl.org/docs/crypto/EVP_DigestInit.html": 1, "The": 11, "return": 7, "digest.init": 3, "usually": 1, "when": 11, "invalid": 4, "algorithm": 1, "was": 5, "specification.": 1, "Anyway": 1, "properly": 1, "used": 6, "never": 4, "fail.": 1, "Please": 2, "feel": 2, "contact": 2, "me": 2, "questions": 2, "returns": 7, "HEX": 1, "all": 8, "one": 5, "digest.update": 2, ".c": 2, ".m": 11, "digest.final": 2, ".d": 1, "init": 6, "alg": 3, "context": 1, "handler": 9, "try": 1, "etc": 1, "returned": 1, "occurs": 1, "e.g.": 2, "unknown": 1, "update": 1, "ctx": 4, "msg": 6, "updates": 1, ".ctx": 2, ".msg": 1, "final": 1, "hex": 1, "encoded": 8, "frees": 1, "memory": 1, "allocated": 1, ".digest": 1, "algorithms": 1, "availability": 1, "depends": 1, "libcrypto": 1, "configuration": 1, "md4": 1, "md5": 2, "sha": 1, "sha1": 1, "sha224": 1, "sha256": 1, "sha512": 1, "dss1": 1, "ripemd160": 1, "These": 2, "two": 2, "routines": 6, "illustrate": 1, "dynamic": 1, "scope": 1, "triangle1": 1, "sum": 15, "main2": 1, "y": 33, "triangle2": 1, "compute": 2, "Fibonacci": 1, "b": 64, "term": 10, "start1": 2, "entry": 5, "start2": 1, "function": 6, "computes": 1, "factorial": 3, "f*n": 1, "main": 1, "GMRGPNB0": 1, "CISC/JH/RM": 1, "NARRATIVE": 1, "BUILDER": 1, "TEXT": 5, "GENERATOR": 1, "cont.": 1, "/20/91": 1, "Text": 1, "Generator": 1, "Jan": 1, "ENTRY": 2, "WITH": 1, "GMRGA": 1, "SET": 3, "TO": 6, "POINT": 1, "AT": 1, "WHICH": 1, "WANT": 1, "START": 1, "BUILDING": 1, "GMRGE0": 11, "GMRGADD": 4, "D": 64, "GMR": 6, "GMRGA0": 11, "GMRGPDA": 9, "GMRGCSW": 2, "NOW": 1, "DTC": 1, "GMRGB0": 9, "O": 24, "GMRGST": 6, "GMRGPDT": 2, "STAT": 8, "GMRGRUT0": 3, "GMRGF0": 3, "GMRGSTAT": 8, "P": 68, "_GMRGB0_": 2, "GMRD": 6, "GMRGSSW": 3, "SNT": 1, "GMRGPNB1": 1, "GMRGNAR": 8, "GMRGPAR_": 2, "_GMRGSPC_": 3, "_GMRGRM": 2, "_GMRGE0": 1, "STORETXT": 1, "GMRGRUT1": 1, "GMRGSPC": 3, "F": 10, "GMRGD0": 7, "ALIST": 1, "G": 40, "TMP": 26, "J": 38, "GMRGPLVL": 6, "GMRGA0_": 1, "_GMRGD0_": 1, "_GMRGSSW_": 1, "_GMRGADD": 1, "GMRGI0": 6, "label1": 1, "if1": 2, "statement": 3, "if2": 2, "statements": 1, "contrasted": 1, "": 3, "variable": 8, "a=": 3, "smaller": 3, "than": 4, "b=": 4, "if3": 1, "else": 7, "clause": 2, "if4": 1, "bodies": 1, "exercise": 1, "car": 14, "@": 8, "MD5": 6, "Implementation": 1, "It": 2, "works": 1, "ZCHSET": 2, "please": 1, "don": 1, "only": 9, "joke.": 1, "Serves": 1, "well": 2, "reverse": 1, "engineering": 1, "obtaining": 1, "boolean": 2, "integer": 1, "addition": 1, "modulo": 1, "division.": 1, "//en.wikipedia.org/wiki/MD5": 1, "#64": 1, "msg_": 1, "_m_": 1, "n64": 2, "*8": 2, "read": 2, ".p": 1, "..": 28, "...": 6, "*i": 3, "#16": 3, "xor": 4, "rotate": 5, "#4294967296": 6, "n32h": 5, "bit": 5, "#2": 1, "*2147483648": 2, "a#2": 1, "b#2": 1, ".a": 1, ".b": 1, "rol": 1, "a*": 1, "**n": 1, "c#4294967296": 1, "*n": 1, "n#256": 1, "n#16": 2, "MDB": 60, "M/DB": 2, "Mumps": 1, "Emulation": 1, "Amazon": 1, "SimpleDB": 1, "buildDate": 1, "indexLength": 10, "Note": 2, "keyId": 108, "been": 4, "tested": 1, "these": 1, "called": 8, "To": 2, "Initialise": 2, "service": 1, "//192.168.1.xxx/mdb/test.mgwsi": 1, "Action": 2, "addUser": 2, "userKeyId": 6, "userSecretKey": 6, "requestId": 17, "boxUsage": 11, "startTime": 21, ".startTime": 5, "MDBUAF": 2, "end": 33, ".boxUsage": 22, "createDomain": 1, "domainName": 38, "dn": 4, "dnx": 3, "id": 33, "noOfDomains": 12, "MDBConfig": 1, "getDomainId": 3, "found": 7, "namex": 8, "buildItemNameIndex": 2, "domainId": 53, "itemId": 41, "itemValuex": 3, "countDomains": 2, "key": 22, "deleteDomain": 2, "listDomains": 1, "maxNoOfDomains": 2, "nextToken": 7, "domainList": 3, "fullName": 3, "decodeBase64": 1, "encodeBase64": 1, "itemExists": 1, "getItemId": 2, "getAttributeValueId": 3, "attribId": 36, "valuex": 13, "putAttributes": 2, "attributes": 32, "valueId": 16, "xvalue": 4, "add": 5, "Item": 1, "Domain": 1, "itemNamex": 4, "parseJSON": 1, "zmwire": 53, "attributesJSON": 1, ".attributes": 5, "attribute": 14, "getAttributeId": 2, "domain": 1, "Not": 1, "same": 2, "remove": 6, "existing": 2, "now": 1, "name/value": 2, "pair": 1, "getAttributes": 2, "suppressBoxUsage": 1, "attrNo": 9, "valueNo": 6, "delete": 2, "item": 2, "associated": 1, "queryIndex": 1, "records": 2, "specified": 4, "pairs": 2, "vno": 2, "left": 5, "completely": 3, "references": 1, "maxNoOfItems": 3, "itemList": 12, "session": 1, "identifier": 1, "stored": 1, "queryExpression": 16, "relink": 1, "zewdGTMRuntime": 1, "CGIEVAR": 1, "cgi": 1, "unescName": 5, "urlDecode": 2, "KEY": 36, "response": 29, "WebLink": 1, "point": 2, "action": 15, "AWSAcessKeyId": 1, "db": 9, "hash": 1, "itemsAndAttrs": 2, "secretKey": 1, "signatureMethod": 2, "signatureVersion": 3, "stringToSign": 2, "rltKey": 2, "_action_": 2, "h_": 3, "mdbKey": 2, "errorResponse": 9, "initialise": 3, ".requestId": 7, "createResponse": 4, "installMDBM": 1, "authenticate": 1, "MDBSession": 1, "createResponseStringToSign": 1, "Security": 1, "OK": 6, "_db": 1, "MDBAPI": 1, "lineNo": 19, "CacheTempEWD": 16, "_db_": 1, "db_": 1, "_action": 1, "resp": 5, "metaData": 1, "domainMetadata": 1, ".metaData": 1, "paramName": 8, "paramValue": 5, "_i_": 5, "Query": 1, "DomainName": 2, "QueryExpression": 2, "MaxNumberOfItems": 2, "NextToken": 3, "QueryWithAttributes": 1, "AttributeName.": 2, "Select": 2, "SelectExpression": 1, "entering": 1, "runSelect.": 1, "selectExpression": 3, "finished": 1, "runSelect": 3, "count": 18, "select": 3, "where": 6, "limit": 14, "asc": 1, "inValue": 6, "expr": 18, "rel": 2, "itemStack": 3, "between": 2, "<=\">": 1, "lastWord=": 7, "inAttr=": 5, "expr=": 10, "thisWord=": 7, "inAttr": 2, "c=": 28, "queryExpression=": 4, "_queryExpression": 2, "4": 5, "isNull": 1, "5": 1, "8": 1, "isNotNull": 1, "9": 1, "offset": 6, "prevName": 1, "np=": 1, "diffNames": 6, "_term": 3, "expr_": 1, "_orderBy": 1, "runQuery": 2, ".itemList": 4, "escVals": 1, "str_c": 2, "_x_": 1, "query": 4, "orderBy": 1, "_query": 1, "parseSelect": 1, ".domainName": 2, ".queryExpression": 1, ".orderBy": 1, ".limit": 1, "executeSelect": 1, ".itemStack": 1, "***": 2, "listCopy": 3, "N.N": 12, "N.N1": 4, "externalSelect": 2, "json": 9, "_keyId_": 1, "_selectExpression": 1, "spaces": 3, "string_spaces": 1, "test": 6, "miles": 4, "gallons": 4, "miles/gallons": 1, "computepesimist": 1, "miles/": 1, "computeoptimist": 1, "/gallons": 1, "Mumtris": 3, "tetris": 1, "game": 1, "MUMPS": 1, "fun.": 1, "Resize": 1, "terminal": 2, "maximize": 1, "PuTTY": 1, "window": 1, "restart": 3, "so": 4, "report": 1, "true": 2, "size": 3, "mumtris.": 1, "Try": 2, "setting": 3, "ansi": 2, "compatible": 1, "cursor": 1, "positioning.": 1, "NOTICE": 1, "uses": 1, "making": 1, "delays": 1, "lower": 1, "s.": 1, "That": 1, "means": 2, "CPU": 1, "fall": 5, "lock": 2, "clear": 6, "change": 6, "preview": 3, "over": 2, "exit": 3, "short": 1, "circuit": 1, "redraw": 3, "timeout": 1, "harddrop": 1, "other": 1, "ex": 5, "hd": 3, "*c": 1, "<0&'d>": 1, "i=": 14, "st": 6, "t10m": 1, "0": 23, "<0>": 2, "q=": 6, "d=": 1, "zb": 2, "right": 3, "fl=": 1, "gr=": 1, "hl": 2, "help": 2, "drop": 2, "hd=": 1, "matrix": 2, "stack": 8, "draw": 3, "ticks": 2, "h=": 2, "1000000000": 1, "e=": 1, "t10m=": 1, "100": 2, "n=": 1, "ne=": 1, "x=": 5, "y=": 3, "r=": 3, "collision": 6, "score": 5, "k=": 1, "j=": 4, "<1))))>": 1, "800": 1, "200": 1, "lv": 5, "lc=": 1, "10": 1, "lc": 3, "mt_": 2, "cls": 6, ".s": 5, "dh/2": 6, "dw/2": 6, "*s": 4, "u": 6, "echo": 1, "intro": 1, "workaround": 1, "ANSI": 1, "driver": 1, "NL": 1, "some": 1, "place": 9, "clearscreen": 1, "N": 19, "h/2": 3, "*w/2": 3, "fill": 3, "fl": 2, "*x": 1, "mx": 4, "my": 5, "step": 8, "**lv*sb": 1, "*lv": 1, "sc": 3, "ne": 2, "gr": 1, "w*3": 1, "dev": 1, "zsh": 1, "dw": 1, "dh": 1, "elements": 3, "elemId": 3, "rotateVersions": 1, "rotateVersion": 2, "bottom": 1, "coordinate": 1, "____": 1, "__": 2, "||": 1, "ax": 2, "bx": 2, "cx": 2, "ay": 2, "cy": 2, "sumx": 3, "sqrx": 3, "sumxy": 5, "x*x": 1, "x*y": 1, "PCRE": 23, "tries": 1, "deliver": 1, "best": 2, "possible": 5, "interface": 1, "world": 4, "providing": 1, "support": 3, "arrays": 1, "stringified": 2, "parameter": 1, "names": 3, "simplified": 1, "API": 7, "locales": 2, "exceptions": 1, "Perl5": 1, "Global": 8, "Match.": 1, "pcreexamples.m": 2, "comprehensive": 1, "examples": 4, "pcre": 59, "beginner": 1, "level": 5, "tips": 1, "match": 41, "limits": 6, "exception": 12, "handling": 2, "UTF": 17, "GT.M.": 1, "out": 2, "known": 2, "book": 1, "regular": 1, "expressions": 1, "//regex.info/": 1, "For": 3, "information": 1, "//pcre.org/": 1, "Initial": 2, "release": 2, "pkoper": 2, "pcre.version": 1, "config": 3, "case": 7, "insensitive": 7, "protect": 11, "erropt": 6, "isstring": 5, "pcre.config": 1, ".name": 1, ".erropt": 3, ".isstring": 1, ".n": 20, "ec": 10, "compile": 14, "pattern": 21, "options": 45, "locale": 24, "mlimit": 20, "reclimit": 19, "optional": 16, "joined": 3, "Unix": 1, "pcre_maketables": 2, "cases": 1, "undefined": 1, "environment": 7, "defined": 2, "LANG": 4, "LC_*": 1, "output": 49, "Debian": 2, "tip": 1, "dpkg": 1, "reconfigure": 1, "enable": 1, "system": 1, "wide": 1, "number": 5, "internal": 3, "matching": 4, "calls": 1, "pcre_exec": 4, "execution": 2, "manual": 2, "details": 5, "depth": 1, "recursion": 1, "calling": 2, "ref": 41, "err": 4, "erroffset": 3, "pcre.compile": 1, ".pattern": 3, ".ref": 13, ".err": 1, ".erroffset": 1, "exec": 4, "subject": 24, "startoffset": 3, "octets": 2, "starts": 1, "like": 4, "chars": 3, "pcre.exec": 2, ".subject": 3, "zl": 7, "ec=": 7, "ovector": 25, "element": 1, "code=": 4, "ovecsize": 5, "fullinfo": 3, "OPTIONS": 2, "SIZE": 1, "CAPTURECOUNT": 1, "BACKREFMAX": 1, "FIRSTBYTE": 1, "FIRSTTABLE": 1, "LASTLITERAL": 1, "NAMEENTRYSIZE": 1, "NAMECOUNT": 1, "STUDYSIZE": 1, "OKPARTIAL": 1, "JCHANGED": 1, "HASCRORLF": 1, "MINLENGTH": 1, "JIT": 1, "JITSIZE": 1, "NAME": 3, "nametable": 4, "index": 1, "indexed": 4, "substring": 1, "begin": 18, "begin=": 3, "end=": 4, "contains": 2, "octet": 4, "UNICODE": 1, "ze": 8, "begin_": 1, "_end": 1, "store": 6, "stores": 1, "captured": 6, "key=": 2, "gstore": 3, "round": 12, "byref": 5, "global": 26, "ref=": 3, "l=": 2, "capture": 10, "indexes": 1, "extended": 1, "NAMED_ONLY": 2, "named": 12, "groups": 5, "OVECTOR": 2, "namedonly": 9, "options=": 4, "o=": 12, "namedonly=": 2, "ovector=": 2, "NO_AUTO_CAPTURE": 2, "_capture_": 2, "matches": 10, "s=": 4, "_s_": 1, "GROUPED": 1, "group": 4, "result": 3, "patterns": 3, "pcredemo": 1, "pcreccp": 1, "cc": 1, "procedure": 2, "Perl": 1, "utf8": 2, "crlf": 6, "empty": 7, "skip": 6, "determine": 1, "them": 1, "before": 2, "byref=": 2, "check": 2, "UTF8": 2, "double": 1, "utf8=": 1, "crlf=": 3, "NL_CRLF": 1, "NL_ANY": 1, "NL_ANYCRLF": 1, "none": 1, "build": 2, "NEWLINE": 1, ".start": 1, "unwind": 1, "call": 1, "optimize": 1, "leave": 1, "advance": 1, "LF": 1, "CR": 1, "CRLF": 1, "middle": 1, ".i": 2, ".match": 2, ".round": 2, ".byref": 2, ".ovector": 2, "subst": 3, "last": 4, "occurrences": 1, "matched": 1, "back": 4, "th": 3, "replaced": 1, "substitution": 2, "begins": 1, "substituted": 2, "defaults": 3, "ends": 1, "backref": 1, "boffset": 1, "prepare": 1, "reference": 2, ".subst": 1, ".backref": 1, "silently": 1, "zco": 1, "": 1, "s/": 6, "b*": 7, "/Xy/g": 6, "print": 8, "aa": 9, "et": 4, "direct": 3, "take": 1, "default": 6, "setup": 3, "trap": 10, "source": 3, "location": 5, "argument": 1, "@ref": 2, "E": 12, "COMPILE": 2, "meaning": 1, "zs": 2, "re": 2, "raise": 3, "XC": 1, "specific": 3, "U16384": 1, "U16385": 1, "U16386": 1, "U16387": 1, "U16388": 2, "U16389": 1, "U16390": 1, "U16391": 1, "U16392": 2, "U16393": 1, "NOTES": 1, "U16401": 2, "raised": 2, "i.e.": 3, "NOMATCH": 2, "ever": 1, "uncommon": 1, "situation": 1, "too": 1, "small": 1, "considering": 1, "controlled": 1, "U16402": 1, "U16403": 1, "U16404": 1, "U16405": 1, "U16406": 1, "U16407": 1, "U16408": 1, "U16409": 1, "U16410": 1, "U16411": 1, "U16412": 1, "U16414": 1, "U16415": 1, "U16416": 1, "U16417": 1, "U16418": 1, "U16419": 1, "U16420": 1, "U16421": 1, "U16423": 1, "U16424": 1, "U16425": 1, "U16426": 1, "U16427": 1, "Examples": 4, "pcre.m": 1, "parameters": 1, "pcreexamples": 32, "shining": 1, "Test": 1, "Simple": 2, "zwr": 17, "Match": 4, "grouped": 2, "Just": 1, "Change": 2, "word": 3, "Escape": 1, "sequence": 1, "More": 1, "Low": 1, "api": 1, "Setup": 1, "myexception2": 2, "st_": 1, "zl_": 2, "Compile": 2, ".options": 1, "Run": 1, ".offset": 1, "used.": 2, "strings": 1, "submitted": 1, "exact": 1, "usable": 1, "integers": 1, "way": 1, "i*2": 3, "what": 2, "/mg": 2, "aaa": 1, "nbb": 1, ".*": 1, "discover": 1, "stackusage": 3, "Locale": 5, "Support": 1, "Polish": 1, "I18N": 2, "PCRE.": 1, "Polish.": 1, "second": 1, "letter": 1, "": 1, "which": 4, "ISO8859": 1, "//en.wikipedia.org/wiki/Polish_code_pages": 1, "complete": 1, "listing": 1, "CHAR": 1, "different": 3, "modes": 1, "In": 1, "probably": 1, "expected": 1, "working": 1, "single": 2, "ISO": 3, "chars.": 1, "Use": 1, "zch": 7, "prepared": 1, "GTM": 8, "BADCHAR": 1, "errors.": 1, "Also": 1, "others": 1, "might": 1, "expected.": 1, "POSIX": 1, "localization": 1, "nolocale": 2, "zchset": 2, "isolocale": 2, "utflocale": 2, "LC_CTYPE": 1, "Set": 2, "obtain": 2, "results.": 1, "envlocale": 2, "ztrnlnm": 2, "Notes": 1, "Enabling": 1, "native": 1, "requires": 1, "libicu": 2, "gtm_chset": 1, "gtm_icu_version": 1, "recompiled": 1, "object": 4, "files": 4, "Instructions": 1, "Install": 1, "libicu48": 2, "apt": 1, "get": 2, "install": 1, "append": 1, "chown": 1, "gtm": 1, "/opt/gtm": 1, "Startup": 1, "errors": 6, "INVOBJ": 1, "Cannot": 1, "ZLINK": 1, "due": 1, "unexpected": 1, "Object": 1, "compiled": 1, "CHSET": 1, "written": 3, "startup": 1, "correct": 1, "above.": 1, "Limits": 1, "built": 1, "recursion.": 1, "Those": 1, "prevent": 1, "engine": 1, "very": 2, "long": 2, "runs": 2, "especially": 1, "there": 2, "paths": 2, "tree": 1, "checked.": 1, "Functions": 1, "using": 4, "itself": 1, "allows": 1, "MATCH_LIMIT": 1, "MATCH_LIMIT_RECURSION": 1, "arguments": 1, "library": 1, "compilation": 2, "Example": 1, "longrun": 3, "Equal": 1, "corrected": 1, "shortrun": 2, "Enforced": 1, "enforcedlimit": 2, "Exception": 2, "Handling": 1, "Error": 1, "conditions": 1, "handled": 1, "zc": 1, "codes": 1, "labels": 1, "file.": 1, "When": 2, "neither": 1, "nor": 1, "within": 1, "mechanism.": 1, "depending": 1, "caller": 1, "exception.": 1, "lead": 1, "writing": 4, "prompt": 1, "terminating": 1, "image.": 1, "define": 2, "handlers.": 1, "Handler": 1, "No": 17, "nohandler": 4, "Pattern": 1, "failed": 1, "unmatched": 1, "parentheses": 1, "<-->": 1, "HERE": 1, "RTSLOC": 2, "At": 2, "SETECODE": 1, "Non": 1, "assigned": 1, "ECODE": 1, "32": 1, "GT": 1, "image": 1, "terminated": 1, "myexception1": 3, "zt=": 1, "mytrap1": 2, "zg": 2, "mytrap3": 1, "DETAILS": 1, "executed": 1, "frame": 1, "called.": 1, "deeper": 1, "frames": 1, "already": 1, "dropped": 1, "local": 1, "available": 1, "context.": 1, "Thats": 1, "why": 1, "doesn": 1, "unless": 1, "cleared.": 1, "Always": 1, "done.": 2, "Execute": 1, "p5global": 1, "p5replace": 1, "p5lf": 1, "p5nl": 1, "newline": 1, "utf8support": 1, "myexception3": 1, "contrasting": 1, "postconditionals": 1, "IF": 9, "commands": 1, "post1": 1, "postconditional": 3, "purposely": 4, "TEST": 16, "false": 5, "post2": 1, "special": 2, "post": 1, "condition": 1, "PRCAAPR": 1, "WASH": 1, "ISC@ALTOONA": 1, "PA/RGY": 1, "PATIENT": 5, "ACCOUNT": 1, "PROFILE": 1, "CONT": 1, "/9/94": 1, "AM": 1, "V": 2, "Accounts": 1, "Receivable": 1, "**198": 1, "Mar": 1, "Per": 1, "VHA": 1, "Directive": 1, "modified.": 1, "EN": 2, "PRCATY": 2, "NEW": 3, "DIC": 6, "Y": 26, "DEBT": 10, "PRCADB": 5, "DA": 4, "PRCA": 14, "COUNT": 2, "OUT": 2, "SEL": 1, "BILL": 11, "BAT": 8, "TRAN": 5, "DR": 4, "DXS": 1, "DTOUT": 2, "DIROUT": 1, "DIRUT": 1, "DUOUT": 1, "ASK": 3, "DPTNOFZY": 2, "DPTNOFZK": 2, "K": 5, "DTIME": 1, "UPPER": 1, "VALM1": 1, "RCD": 1, "DISV": 2, "DUZ": 3, "NAM": 1, "RCFN01": 1, "COMP": 2, "EN1": 1, "PRCAATR": 1, "Y_": 3, "PRCADB_": 1, "HDR": 1, "PRCAAPR1": 3, "HDR2": 1, "DIS": 1, "STAT1": 2, "_PRCATY_": 1, "COMP1": 2, "RCY": 5, "COMP2": 2, "_STAT_": 1, "_STAT": 1, "payments": 1, "_TRAN": 1, "Keith": 1, "Lynch": 1, "p#f": 1, "PXAI": 1, "ISL/JVS": 1, "ISA/KWP": 1, "ESW": 1, "PCE": 2, "DRIVING": 1, "RTN": 1, "/20/03": 1, "am": 1, "CARE": 1, "ENCOUNTER": 2, "**15": 1, "Aug": 1, "DATA2PCE": 1, "PXADATA": 7, "PXAPKG": 9, "PXASOURC": 10, "PXAVISIT": 8, "PXAUSER": 6, "PXANOT": 3, "ERRRET": 2, "PXAPREDT": 2, "PXAPROB": 15, "PXACCNT": 2, "add/edit/delete": 1, "PCE.": 1, "required": 4, "pointer": 4, "visit": 3, "related.": 1, "then": 2, "nodes": 1, "needed": 1, "lookup/create": 1, "visit.": 1, "adding": 1, "data.": 1, "displayed": 1, "screen": 1, "debugging": 1, "initial": 1, "code.": 1, "passed": 4, "reference.": 2, "present": 1, "PXKERROR": 2, "caller.": 1, "want": 1, "edit": 1, "Primary": 3, "Provider": 1, "moment": 1, "editing": 2, "being": 1, "dangerous": 1, "dotted": 1, "name.": 1, "warnings": 1, "occur": 1, "They": 1, "form": 1, "general": 1, "description": 1, "problem.": 1, "ERROR1": 1, "GENERAL": 2, "ERRORS": 4, "SUBSCRIPT": 5, "PASSED": 4, "IN": 4, "FIELD": 2, "FROM": 5, "WARNING2": 1, "WARNINGS": 2, "WARNING3": 1, "SERVICE": 1, "CONNECTION": 1, "REASON": 9, "ERROR4": 1, "PROBLEM": 1, "LIST": 1, "Returns": 2, "PFSS": 2, "Account": 2, "Reference": 2, "known.": 1, "Returned": 1, "located": 1, "Order": 1, "#100": 1, "process": 3, "processed": 1, "could": 1, "incorrectly": 1, "VARIABLES": 1, "NOVSIT": 1, "PXAK": 20, "DFN": 1, "PXAERRF": 3, "PXADEC": 1, "PXELAP": 1, "PXASUB": 2, "VALQUIET": 2, "PRIMFND": 7, "PXAERROR": 1, "PXAERR": 7, "PRVDR": 1, "needs": 1, "look": 1, "up": 1, "passed.": 1, "@PXADATA@": 8, "SOR": 1, "SOURCE": 2, "PKG2IEN": 1, "VSIT": 1, "PXAPIUTL": 2, "TMPSOURC": 1, "SAVES": 1, "CREATES": 1, "VST": 2, "VISIT": 3, "KILL": 1, "VPTR": 1, "PXAIVSTV": 1, "ERR": 2, "PXAIVST": 1, "PRV": 1, "PROVIDER": 1, "AUPNVSIT": 1, ".I": 4, "..S": 7, "status": 2, "Secondary": 2, ".S": 6, "..I": 2, "PXADI": 4, "NODE": 5, "SCREEN": 2, "VA": 1, "EXTERNAL": 2, "INTERNAL": 2, "ARRAY": 2, "PXAICPTV": 1, "SEND": 1, "W": 4, "BLD": 2, "DIALOG": 4, ".PXAERR": 3, "MSG": 2, "GLOBAL": 1, "NA": 1, "PROVDRST": 1, "Check": 1, "provider": 1, "PRVIEN": 14, "DETS": 7, "DIQ": 3, "PRI": 3, "PRVPRIM": 2, "AUPNVPRV": 2, "U": 14, ".04": 1, "DIQ1": 1, "POVPRM": 1, "POVARR": 1, "STOP": 1, "LPXAK": 4, "ORDX": 14, "NDX": 7, "ORDXP": 3, "DX": 2, "ICD9": 2, "AUPNVPOV": 2, "@POVARR@": 6, "force": 1, "originally": 1, "primary": 1, "diagnosis": 1, "flag": 1, ".F": 2, "..E": 1, "...S": 5, "decode": 1, "val": 5, "Decoded": 1, "Encoded": 1, "decoded": 3, "decoded_": 1, "safechar": 3, "zchar": 1, "encoded_c": 1, "encoded_": 2, "FUNC": 1, "DH": 1, "zascii": 1, "WVBRNOT": 1, "HCIOFO/FT": 1, "JR": 1, "IHS/ANMC/MWR": 1, "BROWSE": 1, "NOTIFICATIONS": 1, "/30/98": 1, "WOMEN": 1, "WVDATE": 8, "WVENDDT1": 2, "WVIEN": 13, "..F": 2, "WV": 8, "WVXREF": 1, "WVDFN": 6, "SELECTING": 1, "ONE": 2, "CASE": 1, "MANAGER": 1, "AND": 3, "THIS": 3, "DOESN": 1, "WVE": 2, "": 2, "STORE": 3, "WVA": 2, "WVBEGDT1": 1, "NOTIFICATION": 1, "IS": 3, "QUEUED.": 1, "WVB": 4, "OR": 2, "OPEN": 1, "ONLY": 1, "CLOSED.": 1, ".Q": 1, "EP": 4, "ALREADY": 1, "LL": 1, "SORT": 3, "ABOVE.": 1, "DATE": 1, "WVCHRT": 1, "SSN": 1, "WVUTL1": 2, "SSN#": 1, "WVNAME": 4, "WVACC": 4, "ACCESSION#": 1, "WVSTAT": 1, "STATUS": 2, "WVUTL4": 1, "WVPRIO": 5, "PRIORITY": 1, "WVCHRT_U_WVNAME_U_WVDATE_U_WVACC_U_WVSTAT_U_WVPRIO_U_WVIEN": 1, "WVC": 4, "COPYGBL": 3, "COPY": 1, "MAKE": 1, "IT": 1, "FLAT.": 1, "...F": 1, "....S": 1, "DEQUEUE": 1, "TASKMAN": 1, "QUEUE": 1, "OF": 2, "PRINTOUT.": 1, "SETVARS": 2, "WVUTL5": 2, "WVBRNOT1": 2, "EXIT": 1, "FOLLOW": 1, "CALLED": 1, "PROCEDURE": 1, "FOLLOWUP": 1, "MENU.": 1, "WVBEGDT": 1, "DT": 2, "WVENDDT": 1, "DEVICE": 1, "WVBRNOT2": 1, "WVPOP": 1, "WVLOOP": 1, "ZDIOUT1": 1, "Experimental": 1, "FileMan": 1, "host": 2, "Open": 1, "Source": 1, "Electronic": 1, "Health": 1, "Record": 1, "Agent": 1, "Licensed": 1, "Apache": 1, "Version": 1, "may": 3, "except": 1, "compliance": 1, "License.": 2, "//www.apache.org/licenses/LICENSE": 1, "Unless": 1, "applicable": 1, "law": 1, "agreed": 1, "BASIS": 1, "WARRANTIES": 1, "CONDITIONS": 1, "KIND": 1, "express": 1, "implied.": 1, "governing": 1, "permissions": 2, "limitations": 1, "ASKFILE": 1, "FILE": 5, "ASKDIR": 1, "DIR": 3, "SAVEFILE": 2, "Save": 1, "given": 1, "directory": 1, "CHECK": 1, "FGR": 4, "_FILE": 1, "IO": 4, "DIR_": 1, "L": 1, "FILENAME": 1, "_IO_": 1, "_P_": 1, "NM": 1, "non": 1, "printing": 1, "escaped": 1, "evaluation": 1, "RHS": 1, "SET.": 1, "TODO": 1, "Caller": 1, "indentation": 1, "tab": 1, "space.": 1, "M/Wire": 4, "Protocol": 2, "Systems": 1, "By": 1, "server": 1, "port": 4, "systems": 3, "invoked": 2, "via": 2, "xinetd": 2, "Edit": 1, "/etc/services": 1, "mwire": 2, "/tcp": 1, "#": 1, "Service": 1, "Copy": 2, "/etc/xinetd.d/mwire": 1, "/usr/local/gtm/zmwire": 1, "its": 1, "executable": 1, "edited": 1, "Restart": 1, "sudo": 1, "/etc/init.d/xinetd": 1, "On": 1, "installed": 1, "MGWSI": 1, "provide": 1, "hashing": 1, "passwords": 1, "Alternatively": 1, "substitute": 1, "callout": 1, "choice": 1, "Daemon": 2, "running": 1, "jobbed": 1, "job": 1, "zmwireDaemon": 2, "simply": 1, "Stop": 1, "RESJOB": 1, "mwireVersion": 4, "mwireDate": 2, "July": 1, "_crlf": 22, "_response_": 4, "_crlf_response_crlf": 4, "authNeeded": 6, "input": 41, "cleardown": 2, "zint": 1, "role": 3, "loop": 7, "log": 1, "halt": 3, "auth": 2, "ignore": 12, "pid": 36, "monitor": 1, "input_crlf": 1, "zsy": 2, "_pid_": 1, "_pid": 1, "monitoroutput": 1, "logger": 17, "tot": 2, "mwireLogger": 3, "info": 1, "response_": 1, "_count": 1, "setpassword": 1, "SETPASSWORD": 2, "secret": 2, "": 1, "role=": 1, "admin": 1, "newrole": 4, "getGloRef": 3, "gloName": 1, "gloRef": 15, "nb": 2, "subs": 8, "nsp": 1, "subs_": 2, "_data_": 3, "subscripts": 8, "_value_": 1, "_error_": 1, "kill": 3, "xx": 16, "method": 2, "Missing": 5, "JSON": 7, "transaction": 6, "document": 6, "setJSON": 4, "GlobalName": 3, "setGlobal": 1, "zmwire_null_value": 1, "Invalid": 1, "props": 1, "arr": 2, "getJSON": 2, "incr": 1, "incrbr": 1, "class": 1, "##": 2, "decr": 1, "decrby": 1, "direction": 1, "subscriptValue": 1, "dataStatus": 1, "dataValue": 1, "nextsubscript": 2, "reverseorder": 1, "*2": 1, "queryget": 1, "xxyy": 2, "zz": 2, "getallsubscripts": 1, "orderall": 1, "": 3, "note": 2, "escaping": 1, "foo": 2, "_gloRef": 1, "@x": 4, "_crlf_": 1, "j_": 1, "params": 10, "_crlf_resp_crlf": 2, "_crlf_data_crlf": 2, "mergeto": 1, "dataLength": 4, "keyLength": 6, "noOfRecs": 6, "MERGETO": 1, "myglobal": 1, "*6": 1, "hello": 1, "": 2, "put": 1, "top": 1, "noOfRecs#2": 1, "noOfRecs/2": 1, "gloRef1": 2, "gloRef1_": 2, "_gloRef1_key_": 1, "sub": 2, "literal": 2, "valquot_value_valquot": 1, "json_value_": 1, "subscripts1": 2, "subx": 3, "subNo": 1, "numsub": 1, "json_": 2, "removeControlChars": 2, "zobj1": 1, "buff": 10, "parseJSONObject": 2, ".buff": 2, "subs2": 6, "_name_": 1, "subs2_": 2, "value_c": 1, "newString": 4, "newString_c": 1, "utfConvert": 1, "Unescape": 1, "buf": 4, "c1": 4, "buf_c1_": 1 }, "M4": { "dnl": 11, "Took": 1, "from": 2, "https": 1, "//en.wikipedia.org/wiki/M4_": 1, "(": 10, "computer_language": 1, ")": 9, "divert": 5, "-": 1, "M4": 1, "has": 1, "multiple": 1, "output": 2, "queues": 2, "that": 3, "can": 1, "be": 2, "manipulated": 1, "with": 2, "the": 5, "macro": 2, "an": 1, "invalid": 1, "queue": 1, "causes": 2, "text": 1, "to": 3, "discarded": 2, "until": 1, "another": 1, "call.": 1, "Note": 1, "even": 1, "while": 1, "is": 2, "being": 2, "quotes": 1, "around": 1, "t": 1, "expanded": 1, "within": 1, "comments": 1, "meaning": 1, "keywords": 1, "such": 1, "define": 2, "H2_COUNT": 2, "The": 1, "m4": 1, "discard": 1, "rest": 1, "of": 2, "line": 1, "thus": 1, "preventing": 1, "unwanted": 1, "blank": 1, "lines": 1, "appearing": 1, "in": 1, "output.": 2, "H2": 3, "First": 1, "Section": 2, "Second": 1, "Conclusion": 1, "": 1, "undivert": 1, "One": 1, "pushed": 1, "": 1 }, "M4Sugar": { "#": 28, "#serial": 1, "AC_DEFUN": 1, "(": 118, "[": 166, "AX_RUBY_DEVEL": 1, "]": 166, "AC_REQUIRE": 1, "AX_WITH_RUBY": 1, ")": 117, "AS_IF": 6, "test": 17, "-": 43, "n": 2, "AX_PROG_RUBY_VERSION": 1, "AC_MSG_CHECKING": 6, "for": 8, "the": 11, "mkmf": 1, "Ruby": 8, "package": 3, "ac_mkmf_result": 2, "RUBY": 5, "rmkmf": 5, "e": 5, "&": 1, "if": 13, "z": 5, ";": 8, "then": 7, "AC_MSG_RESULT": 7, "yes": 3, "else": 1, "no": 3, "AC_MSG_ERROR": 4, "cannot": 1, "import": 1, "module": 1, ".": 1, "Please": 1, "check": 2, "your": 4, "installation.": 1, "The": 2, "error": 1, "was": 1, "fi": 7, "include": 1, "path": 4, "ruby_path": 3, "RUBY_CPPFLAGS": 3, "AC_SUBST": 6, "library": 5, "RUBY_LDFLAGS": 3, "site": 1, "packages": 1, "RUBY_SITE_PKG": 3, "ruby": 2, "extra": 1, "libraries": 1, "RUBY_EXTRA_LIBS": 3, "CFLAGS": 3, "consistency": 1, "of": 5, "all": 1, "components": 1, "development": 2, "environment": 2, "AC_LANG_PUSH": 1, "C": 1, "ac_save_LIBS": 1, "LIBS": 3, "ac_save_CPPFLAGS": 1, "CPPFLAGS": 2, "AC_TRY_LINK": 1, "#include": 1, "": 1, "ruby_init": 1, "rubyexists": 3, "Could": 1, "not": 2, "link": 1, "program": 1, "to": 11, "Ruby.": 1, "Maybe": 1, "main": 1, "has": 1, "been": 1, "installed": 2, "in": 2, "some": 1, "non": 1, "standard": 1, "path.": 1, "If": 3, "so": 1, "pass": 1, "it": 5, "configure": 1, "via": 1, "LDFLAGS": 2, "variable.": 1, "Example": 1, "./configure": 1, "ERROR": 1, "You": 2, "probably": 1, "have": 2, "install": 5, "version": 2, "distribution.": 1, "exact": 1, "name": 2, "this": 2, "varies": 1, "among": 1, "them.": 1, "RUBY_VERSION": 1, "AC_LANG_POP": 1, "AC_PREREQ": 1, "AC_INIT": 1, "GARDEN": 1, "bubla@users.sourceforge.net": 1, "AC_CONFIG_AUX_DIR": 1, "build": 1, "aux": 1, "AM_INIT_AUTOMAKE": 1, "Wall": 1, "AC_CONFIG_SRCDIR": 1, "src/input.h": 1, "AC_CONFIG_HEADERS": 1, "src/configure.h": 1, "AC_CONFIG_MACRO_DIR": 1, "m4": 1, "AC_ARG_ENABLE": 3, "debug": 3, "AS_HELP_STRING": 3, "enable": 4, "Builds": 1, "default": 1, "enable_debug": 1, "AC_PROG_CC": 1, "AC_PROG_LIBTOOL": 1, "LT_PROG_RC": 1, "AC_CANONICAL_HOST": 1, "dnl": 9, "Check": 1, "whether": 1, "makes": 2, "sense": 2, "a": 3, "garden.desktop": 2, "file": 2, "AC_CHECK_PROG": 1, "have_freedesktop": 1, "update": 1, "desktop": 3, "database": 1, "AM_CONDITIONAL": 3, "HAVE_FREEDESKTOP": 1, "WANT_FREEDESKTOP": 1, "Whether": 1, "you": 6, "want": 4, "applicable.": 1, "DO": 1, "NOT": 1, "USE": 1, "are": 1, "PACKAGER": 1, "AS_CASE": 1, "host": 1, "*mingw*": 1, "|": 1, "*cygwin*": 1, "AC_DEFINE": 1, "WINDOWS_VERSION": 2, "Define": 1, "when": 2, "building": 1, "Windows": 1, "windows_version": 1, "now": 1, "datadir": 4, "specification": 1, "that": 1, "is": 2, "useful": 1, "one": 1, "does": 1, "play": 2, "without": 2, "installing": 2, "garden": 2, "datafiles": 1, "Normally": 1, "dont": 1, "use": 4, "but": 1, "handy": 1, "game": 2, "or": 2, "already": 1, "data.": 1, "In": 1, "first": 1, "case": 1, "instance": 1, "pwd": 1, "/data": 1, "DATADIR_NAME": 3, "AC_CHECK_HEADER": 1, "allegro.h": 1, "have_allegro": 3, "don": 1, "official": 1, "allegro": 1, "s/.*": 1, "l": 1, "blank": 1, "*": 1, ".*/": 1, "/": 1, "ALLEGRO_RELEASE_LIBS": 1, "ALLEGRO_DEBUG_LIBS": 1, "ALLEGRO_LIBS": 3, "lib": 1, "do": 1, "ldflag": 2, "break": 1, "try_link_allegro": 1, "ALLEGRO_LIB": 2, "done": 1, "Unable": 1, "find": 1, "Allegro": 1, "programming": 1, "out": 1, "www.allegro.cc": 1, "distro": 1, "repositories": 1, "unix": 1, "like": 1, "system": 1, "AC_CHECK_HEADERS": 1, "string.h": 1, "sys/stat.h": 1, "AC_C_INLINE": 1, "AC_HEADER_STDBOOL": 1, "AC_CONFIG_FILES": 1, "Makefile": 1, "src/Makefile": 1, "data/Makefile": 1, "resources/Makefile": 1, "docs/garden.doxyfile": 1, "pkgs/w32/winstaller.nsi": 1, "AC_OUTPUT": 1, "m4_define": 14, "m4_list_declare": 1, "m4_do": 6, "_GET": 1, "m4_expand": 1, "m4_list_nth": 2, "_FOREACH": 1, "m4_foreach": 2, "item": 3, "m4_dquote_elt": 1, "m4_list_contents": 5, "m4_quote": 2, "m4_list_add": 1, "m4_pushdef": 4, "_LIST_NAME": 20, "_LIST_": 4, "m4_ifndef": 2, "m4_dquote": 4, "m4_escape": 2, "m4_popdef": 4, "m4_argn": 1, "m4_list_pop_front": 2, "m4_car": 1, "m4_unquote": 4, "m4_cdr": 1, "m4_list_pop_back": 1, "m4_reverse": 2, "List": 1, "What": 1, "contains": 1, "m4_list_contains": 1, "m4_if": 1 }, "MAXScript": { "macroscript": 2, "MoveToSurface": 1, "category": 2, "(": 47, "fn": 7, "g_filter": 2, "o": 6, "superclassof": 1, "Geometryclass": 1, "find_intersection": 2, "z_node": 2, "node_to_z": 1, "local": 34, "testRay": 2, "ray": 1, "node_to_z.pos": 1, "[": 3, "-": 30, "]": 3, "nodeMaxZ": 3, "z_node.max.z": 1, "testRay.pos.z": 1, "+": 8, "*": 2, "abs": 1, "intersectRay": 1, ")": 47, "on": 4, "isEnabled": 1, "return": 1, "selection.count": 1, "Execute": 1, "do": 7, "target_mesh": 3, "pickObject": 1, "message": 1, "filter": 2, "if": 12, "isValidNode": 1, "then": 8, "undo": 4, "for": 5, "i": 7, "in": 3, "selection": 1, "int_point": 2, "undefined": 2, "i.pos": 1, "int_point.pos": 1, "end": 13, "loop": 3, "execute": 1, "script": 2, "FreeSpline": 1, "tooltip": 1, "old_pos": 5, "new_spline": 13, "second_knot_set": 4, "get_mouse_pos": 2, "pen_pos": 5, "old_pen_pos": 10, "distance": 1, "addKnot": 3, "#smooth": 3, "#curve": 3, "else": 4, "setKnotPoint": 1, "true": 2, "updateShape": 1, "draw_new_line": 2, "pickPoint": 2, "mouseMoveCallback": 1, "#": 3, "splineShape": 1, "#RightClick": 1, "delete": 2, "select": 2, "new_spline.pos": 1, "addNewSpline": 1, "false": 1, "q": 2, "querybox": 1, "title": 1, "close": 2, "updateshape": 1, "ColourToHex": 3, "col": 1, "theComponents": 2, "bit.intAsHex": 3, "col.r": 1, "col.g": 1, "col.b": 1, "theValue": 3, "i.count": 1, "st": 2, "timestamp": 2, "theFileName": 3, "getDir": 1, "#userscripts": 1, "theSVGfile": 7, "createFile": 1, "format": 6, "to": 7, "theViewTM": 1, "viewport.getTM": 2, "theViewTM.row4": 1, "theViewTM2": 1, "theViewSize": 1, "getViewSize": 2, "theViewScale": 1, "theViewScale.x": 4, "/": 11, "theViewScale.y": 4, "theStrokeThickness": 2, "gw.setTransform": 1, "matrix3": 1, "Geometry": 1, "where": 1, "not": 1, "o.isHiddenInVpt": 1, "and": 1, "classof": 1, "TargetObject": 1, "theStrokeColour": 2, "white": 1, "theFillColour": 2, "o.wirecolor": 1, "theMesh": 12, "snapshotAsMesh": 1, "f": 4, "theMesh.numfaces": 2, "theNormal": 1, "normalize": 1, "getFaceNormal": 1, "theNormal*theViewTM": 1, ".z": 1, "theFace": 1, "getFace": 2, "v1": 1, "gw.transPoint": 3, "getVert": 6, "theFace.x": 1, "v2": 1, "theFace.y": 1, "v3": 1, "theFace.z": 1, "v1.x": 2, "v1.y": 2, "v2.x": 2, "v2.y": 2, "v3.x": 2, "v3.y": 2, "normal": 1, "positive": 1, "theSVGMap": 2, "VectorMap": 1, "vectorFile": 1, "alphasource": 1, "theBitmap": 3, "bitmap": 1, "theViewSize.x": 1, "theViewSize.y": 1, "renderMap": 1, "into": 1, "display": 1, "/1000.0": 1, "CalculateVolumeAndCentreOfMass": 1, "obj": 2, "Volume": 5, "Centre": 5, "snapshotasmesh": 1, "numFaces": 2, "Face": 1, "vert2": 3, "Face.z": 1, "vert1": 3, "Face.y": 1, "vert0": 5, "Face.x": 1, "dV": 3, "Dot": 1, "Cross": 1 }, "MQL4": { "//": 111, "+": 41, "-": 1336, "|": 170, "header": 1, "sample.mqh": 1, "Copyright": 3, "Andrey": 3, "Osorgin": 3, "The": 6, "MIT": 12, "License": 6, "(": 32, ")": 32, "Permission": 3, "is": 9, "hereby": 3, "granted": 3, "free": 3, "of": 15, "charge": 3, "to": 21, "any": 3, "person": 3, "obtaining": 3, "a": 3, "copy": 9, "this": 6, "software": 3, "and": 9, "associated": 3, "documentation": 3, "files": 3, "the": 24, "deal": 3, "in": 6, "Software": 9, "without": 6, "restriction": 3, "including": 3, "limitation": 3, "rights": 3, "use": 3, "modify": 3, "merge": 3, "publish": 3, "distribute": 3, "sublicense": 3, "and/or": 3, "sell": 3, "copies": 6, "permit": 3, "persons": 3, "whom": 3, "furnished": 3, "do": 3, "so": 3, "subject": 3, "following": 3, "conditions": 3, "above": 3, "copyright": 3, "notice": 6, "permission": 3, "shall": 3, "be": 3, "included": 3, "all": 3, "or": 3, "substantial": 3, "portions": 3, "Software.": 3, "THE": 18, "SOFTWARE": 6, "IS": 3, "PROVIDED": 3, "WITHOUT": 3, "WARRANTY": 3, "OF": 12, "ANY": 6, "KIND": 3, "EXPRESS": 3, "OR": 21, "IMPLIED": 3, "INCLUDING": 3, "BUT": 3, "NOT": 3, "LIMITED": 3, "TO": 3, "WARRANTIES": 3, "MERCHANTABILITY": 3, "FITNESS": 3, "FOR": 6, "A": 6, "PARTICULAR": 3, "PURPOSE": 3, "AND": 3, "NONINFRINGEMENT.": 3, "IN": 12, "NO": 3, "EVENT": 3, "SHALL": 3, "AUTHORS": 3, "COPYRIGHT": 3, "HOLDERS": 3, "BE": 3, "LIABLE": 3, "CLAIM": 3, "DAMAGES": 3, "OTHER": 6, "LIABILITY": 3, "WHETHER": 3, "AN": 3, "ACTION": 3, "CONTRACT": 3, "TORT": 3, "OTHERWISE": 3, "ARISING": 3, "FROM": 3, "OUT": 3, "CONNECTION": 3, "WITH": 3, "USE": 3, "DEALINGS": 3, "SOFTWARE.": 3, "available": 3, "at": 3, "https": 3, "//opensource.org/licenses/MIT": 3, "#property": 8, "strict": 3, "class": 1, "CSomeObject": 3, "{": 9, "protected": 1, "int": 10, "m_someproperty": 4, ";": 15, "private": 1, "bool": 1, "SomeFunction": 1, "return": 3, "true": 1, "}": 9, "public": 1, "void": 6, "SetName": 1, "n": 2, "sets": 1, "somepropery": 1, "GetName": 1, "returns": 1, "someproperty": 1, "indicator": 2, "sample.mq4": 2, "version": 2, "indicator_chart_window": 1, "indicator_plots": 1, "Custom": 1, "initialization": 1, "function": 2, "OnInit": 1, "Bears": 1, "Power": 1, "OnCalculate": 1, "const": 10, "rates_total": 2, "prev_calculated": 1, "datetime": 1, "&": 8, "time": 1, "[": 8, "]": 8, "double": 7, "open": 1, "high": 1, "low": 1, "close": 1, "long": 2, "tick_volume": 1, "volume": 1, "spread": 1, "Print": 3, "iBars": 1, "Symbol": 3, "Period": 1, "script": 1, "script_show_inputs": 1, "input": 2, "StopLoss": 1, "//Stop": 1, "Loss": 1, "TakeProfit": 1, "//Take": 1, "Profit": 1, "Script": 1, "program": 1, "start": 1, "OnStart": 1, "minstoplevel": 2, "MarketInfo": 1, "MODE_STOPLEVEL": 1, "sl": 2, "NormalizeDouble": 2, "Bid": 1, "StopLoss*Point": 1, "Digits": 2, "tp": 2, "Ask": 2, "TakeProfit*Point": 1, "result": 2, "OrderSend": 1, "OP_BUY": 1, "clrNONE": 1 }, "MQL5": { "//": 494, "+": 334, "-": 11062, "|": 451, "indicator": 3, "sample.mq5": 2, "Copyright": 3, "Andrey": 2, "Osorgin": 2, "The": 8, "MIT": 12, "License": 6, "(": 392, ")": 393, "Permission": 3, "is": 18, "hereby": 3, "granted": 3, "free": 3, "of": 47, "charge": 3, "to": 32, "any": 4, "person": 3, "obtaining": 3, "a": 32, "copy": 9, "this": 19, "software": 3, "and": 20, "associated": 3, "documentation": 3, "files": 3, "the": 152, "deal": 3, "in": 138, "Software": 10, "without": 11, "restriction": 3, "including": 3, "limitation": 3, "rights": 3, "use": 4, "modify": 5, "merge": 3, "publish": 3, "distribute": 3, "sublicense": 3, "and/or": 3, "sell": 3, "copies": 6, "permit": 3, "persons": 3, "whom": 3, "furnished": 3, "do": 4, "so": 3, "subject": 3, "following": 3, "conditions": 3, "above": 3, "copyright": 3, "notice": 6, "permission": 3, "shall": 3, "be": 4, "included": 3, "all": 22, "or": 14, "substantial": 3, "portions": 3, "Software.": 3, "THE": 18, "SOFTWARE": 6, "IS": 3, "PROVIDED": 3, "WITHOUT": 3, "WARRANTY": 3, "OF": 12, "ANY": 6, "KIND": 3, "EXPRESS": 3, "OR": 21, "IMPLIED": 3, "INCLUDING": 3, "BUT": 3, "NOT": 3, "LIMITED": 3, "TO": 3, "WARRANTIES": 3, "MERCHANTABILITY": 3, "FITNESS": 3, "FOR": 6, "A": 7, "PARTICULAR": 3, "PURPOSE": 3, "AND": 3, "NONINFRINGEMENT.": 3, "IN": 12, "NO": 3, "EVENT": 3, "SHALL": 3, "AUTHORS": 3, "COPYRIGHT": 3, "HOLDERS": 3, "BE": 3, "LIABLE": 3, "CLAIM": 3, "DAMAGES": 3, "OTHER": 6, "LIABILITY": 3, "WHETHER": 3, "AN": 3, "ACTION": 3, "CONTRACT": 3, "TORT": 3, "OTHERWISE": 3, "ARISING": 3, "FROM": 3, "OUT": 3, "CONNECTION": 3, "WITH": 3, "USE": 3, "DEALINGS": 3, "SOFTWARE.": 3, "available": 3, "at": 24, "https": 5, "//opensource.org/licenses/MIT": 3, "#property": 5, "version": 2, "indicator_chart_window": 1, "indicator_plots": 1, "Custom": 2, "initialization": 1, "function": 3, "int": 35, "OnInit": 1, "{": 132, "return": 139, "INIT_SUCCEEDED": 1, ";": 252, "}": 132, "iteration": 1, "OnCalculate": 1, "const": 129, "rates_total": 4, "prev_calculated": 3, "datetime": 1, "&": 29, "time": 3, "[": 20, "]": 20, "double": 8, "open": 1, "high": 1, "low": 1, "close": 1, "long": 4, "tick_volume": 1, "volume": 1, "spread": 1, "bars": 2, "Bars": 1, "Symbol": 5, "Print": 27, "value": 3, "for": 20, "next": 1, "call": 1, "Regular": 5, "Expression": 5, "MetaQuotes": 2, "Corp.": 1, "//www.mql5.com": 1, "Library": 4, "from": 2, ".NET": 2, "Framework": 3, "implemented": 1, "Language": 1, "MQL5": 3, "Original": 1, "sources": 1, "//github.com/Microsoft/referencesource": 1, "capabilities": 1, "include": 1, "Lazy": 1, "quantifiers": 1, "Positive": 1, "negative": 1, "lookbehind": 1, "Conditional": 1, "evaluation": 1, "Balancing": 1, "group": 1, "definitions": 1, "Nonbacktracking": 1, "subexpressions": 1, "Right": 1, "left": 1, "matching": 2, "If": 2, "you": 1, "find": 2, "functional": 1, "differences": 1, "between": 1, "original": 1, "project": 2, "please": 1, "contact": 1, "developers": 1, "on": 2, "Forum": 1, "www.mql5.com.": 1, "You": 1, "can": 1, "report": 1, "bugs": 1, "found": 1, "computational": 1, "algorithms": 1, ".Net": 1, "by": 8, "notifying": 1, "coordinators.": 1, "class": 12, "Match": 18, "MatchCollection": 7, "CachedCodeEntry": 9, "ReplacementReference": 7, "RunnerReference": 8, "RegexRunner": 7, "Callback": 1, "class.": 2, "typedef": 1, "string": 115, "#include": 13, "": 1, "": 1, "": 1, "Purpose": 2, "Regex": 35, "represents": 1, "single": 1, "compiled": 5, "instance": 4, "regular": 11, "expression.": 3, "Represents": 1, "an": 4, "immutable": 1, "Also": 1, "contains": 1, "static": 37, "methods": 1, "that": 5, "allow": 1, "expressions": 1, "instantiating": 1, "explicitly.": 1, "protected": 4, "m_pattern": 1, "RegexOptions": 17, "m_roptions": 5, "private": 6, "TimeSpan": 19, "MaximumMatchTimeout": 2, "public": 9, "InfiniteMatchTimeout": 3, "m_internalMatchTimeout": 2, "timeout": 1, "execution": 1, "regex": 7, "DefaultMatchTimeout_ConfigKeyName": 2, "FallbackDefaultMatchTimeout": 2, "DefaultMatchTimeout": 17, "Dictionary": 8, "": 4, "*m_caps": 2, "if": 70, "captures": 4, "are": 5, "sparse": 2, "hashtable": 1, "capnum": 1, "index": 2, "": 4, "*m_capnames": 2, "named": 2, "used": 2, "maps": 1, "names": 2, "m_capslist": 5, "sorted": 1, "list": 1, "m_capsize": 7, "size": 1, "capture": 1, "array": 3, "RegexTree": 2, "*m_tree": 1, "*m_runnerref": 2, "cached": 5, "runner": 9, "ReplacementReference*m_replref": 1, "parsed": 2, "replacement": 15, "pattern": 70, "RegexCode": 4, "*m_code": 2, "interpreted": 1, "code": 8, "RegexIntepreter": 1, "bool": 19, "m_refsInitialized": 8, "Default": 2, "false": 12, "LinkedList": 2, "": 6, "m_livecode": 2, "currently": 1, "loaded": 1, "m_cacheSize": 4, "MaxOptionShift": 3, "Constructors": 2, "Initializes": 2, "new": 12, "this.m_internalMatchTimeout": 1, "Creates": 2, "compiles": 2, "expression": 7, "object": 3, "specified": 3, "Initialize": 5, "None": 7, "with": 22, "options": 40, "pattern.": 2, "specifies": 1, "how": 1, "method": 1, "should": 1, "attempt": 1, "match": 4, "before": 1, "it": 6, "times": 1, "out.": 1, "matchTimeout": 19, "Destructors": 4, "Destructor": 3, "parameters.": 6, "CheckPointer": 18, "m_tree": 2, "POINTER_DYNAMIC": 18, "delete": 20, "m_caps": 8, "deleteRun": 3, "true": 13, "deleteRepl": 3, "deleteCode": 3, "LinkedListNode": 3, "*current": 3, "m_livecode.First": 3, "current": 11, "NULL": 63, "current.Next": 3, "current.Value": 8, ".RunnerRef": 3, "m_runnerref": 11, ".ReplRef": 1, "m_replref": 9, ".Code": 1, "m_code": 9, "&&": 7, "General": 1, "constructor": 1, "useCache": 4, "Methods": 4, "Initialize.": 1, "void": 13, "*tree": 1, "*cached": 1, "": 1, "ECMAScript": 2, "IgnoreCase": 1, "Multiline": 1, "#ifdef": 3, "_DEBUG": 3, "Debug": 4, "#endif": 3, "ValidateMatchTimeout": 1, "Try": 1, "look": 2, "up": 1, "cache.": 3, "We": 1, "regardless": 1, "whether": 1, "since": 1, "there": 1, "str": 2, "name": 1, "s": 1, "range": 1, "result": 62, "<": 1, "Searches": 8, "input": 3, "one": 9, "more": 8, "occurrences": 18, "text": 6, "supplied": 6, "parameter.": 6, "IsMatch": 8, "regex.IsMatch": 1, "matches": 7, "using": 3, "previous": 6, "starting": 14, "position.": 2, "UseOptionR": 11, "StringLen": 14, "startat": 16, "*run": 1, "Run": 3, "run": 3, "*Match": 6, "Matching": 2, "modified": 2, "option": 4, "string.": 6, "*regex": 3, "regex.Match": 1, "Matches": 6, "returns": 3, "precise": 3, "as": 8, "RegexMatch": 3, "object.": 3, "beginning": 7, "length": 7, "Returns": 5, "successful": 5, "was": 8, "called": 6, "iteratively": 5, "numerous": 5, "times.": 5, "*Matches": 5, "regex.Matches": 1, "GetPointer": 6, "Replaces": 12, "first": 10, "character": 11, "Replace": 21, "regex.Replace": 2, "patten.": 1, "previously": 1, "defined": 8, "count": 12, "recent": 6, "position": 11, ".": 12, "little": 1, "grab": 2, "RegexReplacement": 7, "*repl": 2, "m_replref.Get": 3, "repl": 4, "||": 1, "repl.Pattern": 1, "RegexParser": 1, "ParseReplacement": 1, "m_capnames": 6, "this.m_roptions": 1, "m_replref.Set": 1, "repl.Replace": 1, "MatchEvaluator": 6, "evaluator": 12, "previouly": 1, "Splits": 6, "Split": 11, "regex.Split": 1, "InitializeReferences.": 1, "InitializeReferences": 1, "__FILE__": 1, "__FUNCTION__": 1, "Internal": 1, "worker": 1, "APIs.": 1, "*Run": 1, "quick": 2, "prevlen": 2, "*match": 1, "*runner": 2, "<0>": 2, "fromCache": 5, "There": 1, "may": 1, "ownership": 1, "we": 3, "can.": 1, "m_runnerref.Get": 3, "Create": 1, "need": 1, "Use": 1, "factory": 1, "MSIL": 1, "RegexInterpreter": 1, "Do": 1, "scan": 1, "requested": 1, "runner.Scan": 1, "Release": 1, "fill": 1, "cache": 7, "slot": 1, "m_runnerref.Set": 1, "else": 1, "match.Dump": 1, "Find": 1, "based": 1, "*LookupCachedAndUpdate": 1, "key": 8, ".Key": 2, "entry": 1, "move": 2, "head": 2, "same": 1, "time.": 1, "m_livecode.Remove": 2, "m_livecode.AddFirst": 3, "retrun": 2, "Add": 1, "*CacheCode": 1, "*newcached": 1, "wasn": 1, "ll": 1, "add": 1, "one.": 1, "Shortcut": 1, "out": 1, "case": 1, "where": 1, "cacheSize": 1, "zero.": 1, "newcached": 3, "m_livecode.Count": 1, "m_livecode.RemoveLast": 1, "Delete": 1, "objects": 1, "ClearCache": 1, "IEnumerator": 1, "*en": 1, "m_livecode.GetEnumerator": 1, "while": 1, "en.MoveNext": 1, "en.Current": 4, ".Get": 2, ".RunRegex": 2, "en": 1, "True": 3, "O": 1, "set.": 2, "UseOptionC": 1, "L": 1, "RightToLeft": 1, "UseOptionInvariant.": 1, "UseOptionInvariant": 1, "has": 1, "debugging": 1, "enabled.": 1, "FromMilliseconds": 1, "Int32": 1, "MaxValue": 1, "InitDefaultMatchTimeout": 1, "Used": 3, "byte": 1, "codes": 1, "factories.": 1, "IComparable": 1, "m_key": 3, "*m_replref": 1, "Constructor": 1, "*capnames": 1, "capslist": 2, "*code": 1, "*caps": 1, "capsize": 3, "capnames": 2, "ArrayCopy": 2, "caps": 2, "destructor": 1, "Gets": 8, "runnerref.": 1, "*RunnerRef": 1, "reurn": 1, "runnerref": 1, "replref.": 1, "*ReplRef": 1, "replref": 1, "key.": 1, "Key": 1, "caps.": 1, "*Caps": 1, "capnames.": 1, "*CapNames": 1, "capsize.": 1, "CapSize": 1, "code.": 1, "*Code": 1, "caplist.": 1, "GetCapList": 1, "weak": 1, "reference": 1, "threadsafe": 1, "way.": 1, "*m_obj": 2, "m_obj": 8, "Get": 2, "RegexReplacement.": 2, "*Get": 2, "pointer": 2, "Set": 4, "*obj": 2, "obj": 2, "exclusive": 1, "reference.": 1, "RegexRunner.": 2, "script": 1, "script_show_inputs": 1, "": 1, "StopLoss": 1, "Stop": 1, "Loss": 1, "TakeProfit": 1, "Take": 1, "Profit": 1, "Script": 1, "program": 1, "start": 1, "OnStart": 1, "CTrade": 1, "trade": 1, "stoplevel": 2, "SymbolInfoInteger": 1, "SYMBOL_TRADE_STOPS_LEVEL": 1, "ask": 3, "SymbolInfoDouble": 2, "SYMBOL_ASK": 1, "bid": 2, "SYMBOL_BID": 1, "sl": 2, "NormalizeDouble": 2, "StopLoss*Point": 1, "Digits": 2, "tp": 2, "TakeProfit*Point": 1, "trade.Buy": 1 }, "MTML": { "<$mt:Var>": 15, "name=": 19, "value=": 9, "": 1, "op=": 8, "setvar=": 9, "": 1, "<": 2, "a": 1, "href": 1, "<$mt:CategoryLabel>": 1, "remove_html=": 1, "": 1, "": 1, "": 1, "function=": 1, "": 1, "gt=": 2, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 2, "from=": 2, "to=": 2, "div": 1, "class": 1, "col_num": 1, "": 2, "": 1 }, "MUF": { "include": 5, "lib/strings": 2, "lib/match": 2, "lvar": 7, "check": 24, "-": 133, "obj": 5, "addr": 3, "next": 5, "loop": 4, "(": 71, "d": 18, ")": 69, "dup": 44, "not": 33, "if": 45, "pop": 42, "exit": 21, "then": 45, "over": 11, "thing": 1, "or": 1, "me": 18, "@": 26, "pick": 9, ".controls": 2, "and": 3, "execute": 2, ";": 29, "contents": 2, "exits": 2, "exec": 13, "err": 20, "mtypestr": 1, "warnstr": 1, "rotate": 2, "unparseobj": 5, "strcat": 24, "rot": 2, "swap": 17, ".tell": 3, "can": 3, "linkto": 3, "player": 1, "object": 1, "i": 4, "flag": 1, "mtype": 1, "execstr": 1, "strncmp": 5, "strcut": 1, "match": 3, "ok": 5, "program": 2, "owner": 2, "else": 20, "number": 1, "atoi": 4, "dbref": 3, "missing": 8, "s": 18, "colon": 4, "desc": 3, "succ": 3, "fail": 3, "drop": 3, "osucc": 3, "ofail": 3, "odrop": 3, "define": 2, "islocked": 2, "getlockstr": 2, "stringcmp": 4, "enddef": 1, "islocked_always": 1, "STRsplit": 1, "intostr": 1, "lockstr": 1, "link": 1, "getlink": 3, "location": 1, "dbcmp": 2, "is": 1, "linked": 1, "to": 1, "it": 1, ".strip": 1, ".match_controlled": 1, "#": 1, "notify": 1, "@program": 1, "cmd": 2, "say.muf": 2, "by": 1, "Natasha@HLM": 1, "Copyright": 2, "Natasha": 2, "Snunkmeox.": 1, "Here": 1, "Lie": 1, "Monsters.": 1, "for": 2, "license": 1, "information.": 1, "author": 1, "Snunkmeox": 1, "": 1, "note": 1, "Say": 1, "Fuzzball": 1, "version": 1, "lib/ignore": 1, "def": 8, "str_program": 1, "prop_third": 3, "prop_quotes": 2, "prop_overb": 2, "prop_verb": 2, "prop_split": 1, "prop_color": 3, "prop_meow": 6, "randomWord": 2, "verb": 3, "overb": 5, "lquo": 3, "rquo": 3, "splitsay": 2, "rtn": 3, "getThirdVerb": 1, "[": 7, "var": 7, "]": 5, "Get": 3, "the": 3, "third": 3, "person": 3, "verb.": 2, "getpropstr": 4, "str": 13, "strOverb": 2, "strip": 2, "instr": 3, "fmtstring": 11, "getFirstVerb": 1, ".yes": 1, "first": 1, "strVerb": 3, "getQuotes": 1, "strQuotes": 1, "split": 2, "strLquo": 2, "strRquo": 2, "do": 13, "say": 5, "who": 1, "exclude": 1, "Ignoring": 1, "REG_ALL": 1, "regsub": 1, "arrMeow": 2, "%": 22, "n": 3, "N": 2, "D": 1, "*": 2, ".": 6, "{": 2, "n*": 1, "|": 1, "}": 1, "yes": 1, "You": 2, "will": 1, "see": 1, "your": 1, "own": 1, "says": 3, "in": 1, ".tellgood": 7, "unthird": 1, "strY": 13, "strZ": 11, "remove_prop": 2, "grey": 2, "setprop": 1, "ungrey": 2, "meow": 2, ".noisy_pmatch": 2, "db": 8, "reflist_find": 2, ".tellbad": 3, "reflist_add": 1, "array_get_reflist": 1, "arr": 1, "foreach": 1, "repeat": 1, "unmeow": 1, "reflist_del": 1, "dict_commands": 2, "ignore": 1, "int": 1, "strX": 4, "array_getitem": 1, "address": 1, "adr": 2, "c": 1, "q": 1, "lsedit": 1, "#257": 1, "_help": 1, ".del": 1, "": 1, "meow.": 1, "Puck": 1, "Hello": 2, "how": 2, "are": 2, "you": 2, "CobaltBlue": 1, ".format": 2, ".end": 1 }, "Makefile": { "charmap": 7, "charmap.md": 1, "font": 21, "-": 303, "name": 7, "file": 3, "icons": 2, "folder": 15, "dist": 1, "config": 26, "icomoon.json": 1, "icon": 14, "size": 3, "svg": 3, "repo": 2, "Alhadis/FileIcons": 1, "(": 360, "wildcard": 2, ")": 359, ".svg": 3, "last": 1, "commit": 1, "shell": 1, "git": 1, "log": 1, "oneline": 1, "no": 3, "abbrev": 1, "|": 20, "cut": 1, "d": 10, "f1": 1, "all": 6, "unpack": 2, "/": 55, ".woff2": 3, ".ttf": 3, "%": 6, ".zip": 1, "@rm": 3, "rf": 6, "tmp": 3, "@unzip": 1, "qd": 1, "@mv": 2, "tmp/fonts": 1, "tmp/selection.json": 1, "@perl": 2, "pi": 3, "e": 10, "@echo": 34, "#": 15, "Ensure": 1, "trailing": 1, "newline": 1, "@": 29, "[": 15, "f": 7, "]": 15, "&&": 7, "{": 59, "hash": 1, "woff2_compress": 2, "/dev/null": 4, "||": 4, "echo": 12, "&": 5, ";": 51, "exit": 3, "}": 58, "lint": 1, "@./create": 1, "map.pl": 1, "r": 1, "i": 3, "relink": 2, "call": 4, "need": 6, "var": 4, "ATOM_FILE_ICONS": 4, "ERROR_NO_PKG": 2, "@ln": 1, "/fonts/file": 1, "*.woff2": 1, "cachebust": 6, "ERROR_NO_ICON": 2, "@base": 1, "perl": 1, "ERROR_UNDEF_ICON": 2, "clean": 5, "@git": 2, "fd": 1, "checkout": 1, "true": 1, "distclean": 3, ".PHONY": 2, ".ONESHELL": 1, "Environment": 1, "variable": 1, "not": 1, "found.": 1, "Try": 1, "this": 2, "instead": 1, "make": 11, "/path/to/your/file": 1, "icons/installation": 1, "No": 2, "specified.": 1, "Task": 1, "aborted.": 1, "Usage": 1, "Examples": 1, "Manpage": 1, "APL.svg": 1, "task": 1, "named": 1, ".": 5, "Did": 1, "you": 1, "mean": 1, "NAME": 1, "if": 1, "subst": 1, "FLAGS": 1, ".MAKEFLAGS": 1, "C/": 1, "J": 1, "+": 57, "//W": 1, ".DEFAULT": 2, "@which": 1, "gmake": 1, "@gmake": 1, ".FLAGS": 1, ".TARGETS": 1, "test": 4, "subdir": 1, "ccflags": 1, "y": 7, "Werror": 1, "include": 1, "arch/mips/Kbuild.platforms": 1, "obj": 7, "platform": 2, "kernel/": 1, "mm/": 1, "net/": 1, "ifdef": 1, "CONFIG_KVM": 1, "kvm/": 1, "endif": 1, "hello": 5, "main.o": 3, "factorial.o": 3, "hello.o": 3, "g": 4, "o": 8, "main.cpp": 2, "c": 5, "factorial.cpp": 2, "hello.cpp": 2, "rm": 3, "*o": 1, "S": 9, ".CURDIR": 10, "/../../../../..": 1, "NOMAN": 1, "PROG": 9, "boot": 1, "NEWVERSWHAT": 2, "VERSIONFILE": 3, "/../version": 1, "AFLAGS.biosboot.S": 1, "ACTIVE_CC": 1, "integrated": 1, "as": 1, "SOURCES": 3, "biosboot.S": 1, "boot2.c": 1, "conf.c": 1, "devopen.c": 1, "exec.c": 1, "SRCS": 2, ".if": 4, "depend": 1, "vers.c": 3, ".endif": 4, "PIE_CFLAGS": 1, "PIE_AFLAGS": 1, "PIE_LDFLAGS": 1, ".include": 7, "": 1, "STRIPFLAG": 1, "nothing": 6, "LIBCRT0": 1, "LIBCRTI": 1, "LIBCRTBEGIN": 1, "LIBCRTEND": 1, "LIBC": 1, "BINDIR": 1, "/usr/mdec": 1, "BINMODE": 1, ".PATH": 1, "/..": 3, "/../../lib": 2, "LDFLAGS": 6, "nostdlib": 1, "Wl": 7, "N": 2, "boot_start": 1, "CPPFLAGS": 24, "I": 13, "/lib/libsa": 2, ".OBJDIR": 2, "COPTS": 2, "Os": 1, "MACHINE_ARCH": 1, "m": 1, "elf_i386": 1, "AFLAGS": 1, "m32": 2, "CPUFLAGS": 2, "LIBKERN_ARCH": 1, "i386": 4, "KERNMISCMAKEFLAGS": 1, ".else": 1, "march": 1, "mtune": 1, "CFLAGS": 9, "mno": 3, "sse": 1, "sse2": 1, "sse3": 1, "ffreestanding": 1, "Wall": 1, "Wmissing": 1, "prototypes": 2, "Wstrict": 1, "nostdinc": 1, "D_STANDALONE": 1, "DSUPPORT_PS2": 1, "DDIRECT_SERIAL": 1, "DSUPPORT_SERIAL": 1, "boot_params.bp_consdev": 1, "DCONSPEED": 1, "boot_params.bp_conspeed": 1, "DCONSADDR": 1, "boot_params.bp_consaddr": 1, "DCONSOLE_KEYMAP": 1, "boot_params.bp_keymap": 1, "DSUPPORT_CD9660": 1, "DSUPPORT_USTARFS": 1, "DSUPPORT_DOSFS": 1, "DSUPPORT_EXT2FS": 1, "#CPPFLAGS": 4, "DSUPPORT_MINIXFS3": 1, "DPASS_BIOSGEOM": 1, "DPASS_MEMMAP": 1, "DBOOTPASSWD": 1, "DEPIA_HACK": 1, "DDEBUG_MEMSIZE": 1, "DBOOT_MSG_COM0": 1, "DLIBSA_ENABLE_LS_OP": 1, "SAMISCCPPFLAGS": 2, "DHEAP_START": 1, "DHEAP_LIMIT": 1, "DLIBSA_PRINTF_LONGLONG_SUPPORT": 1, "SAMISCMAKEFLAGS": 4, "SA_USE_CREAD": 1, "yes": 1, "Read": 1, "compressed": 1, "kernels": 1, "SA_INCLUDE_NET": 1, "Netboot": 1, "via": 1, "TFTP": 1, "NFS": 1, "Wno": 1, "pointer": 1, "sign": 1, "I386_STAND_DIR": 2, "S/arch/i386/stand": 1, "###": 4, "find": 4, "out": 4, "what": 4, "to": 4, "use": 4, "for": 5, "libi386": 1, "I386DIR": 1, "/lib": 2, "LIBI386": 3, "I386LIB": 1, "libsa": 1, "SA_AS": 1, "library": 5, "LIBSA": 3, "SALIB": 1, "libkern": 1, "KERN_AS": 2, "LIBKERN": 2, "KERNLIB": 1, "libz": 1, "Z_AS": 1, "LIBZ": 2, "ZLIB": 1, "LDSCRIPT": 2, "S/arch/i386/conf/stand.ldscript": 1, "cleandir": 2, ".WAIT": 1, "cleanlibdir": 2, "lib": 2, "LIBLIST": 4, "CLEANFILES": 1, ".tmp": 1, ".map": 2, ".sym": 3, "/../Makefile.boot": 2, "HOST_SH": 1, "/conf/newvers_stand.sh": 1, "x86": 1, "OBJS": 6, "_MKTARGET_LINK": 1, "bb": 2, "symbol": 1, "IFS": 1, "oifs": 1, "I386DST": 1, "rest": 1, "CC": 8, "Ttext": 2, "T": 1, "Map": 1, "cref": 1, "OBJCOPY": 1, "O": 1, "binary": 1, "": 1, "KLINK_MACHINE": 1, "": 1, "link": 1, "php": 3, "objects": 3, "index": 3, "all_targets": 1, "generate": 1, "@for": 1, "in": 3, "ls": 2, "PHP_DIR": 29, "extern": 2, "char": 2, "_binary_": 4, "_start": 3, "static": 7, "inline": 4, "char*": 4, "php_index_": 7, "PHP_LIB": 36, "_": 7, "return": 3, "_end": 4, "size_t": 2, "_size": 2, "php_": 1, "_init": 1, "HashTable": 2, "*index": 1, "*includes": 1, "zval": 1, "val": 2, "zend_hash_init": 2, "NULL": 3, "ZVAL_PTR_DTOR": 1, "includes": 1, "ZVAL_NEW_STR": 1, "zend_string_init": 1, "zend_hash_str_add": 1, ".h": 28, "done": 1, "OpenBSD": 1, "Makefile.inc": 2, "v": 3, "/11/14": 1, "drahn": 1, "Exp": 2, "NetBSD": 1, "/09/30": 1, "ws": 1, "defined": 2, "__stand_makefile_inc": 2, "/../../../": 1, "R": 1, "libdep": 1, "sadep": 1, "salibdir": 1, "kernlibdir": 1, "NOMACHINE": 1, ".BEGIN": 1, "h": 2, "machine": 3, "ln": 2, "s": 7, "/arch/": 1, "MACHINE": 1, "/include": 2, "EXTRACFLAGS": 2, "msoft": 1, "float": 1, "REAL_VIRT": 1, "ENTRY": 2, "INCLUDES": 3, "I.": 1, "/arch": 1, "DEFS": 2, "DSTANDALONE": 1, "fno": 1, "stack": 1, "protector": 1, "X": 1, "RELOC": 1, "LIBNAME": 27, "libpng16": 1, "PNGMAJ": 2, "LIBSO": 9, ".so": 1, "LIBSOMAJ": 10, ".so.": 1, "LIBSOREL": 5, "RELEASE": 1, "OLDSO": 3, "libpng.so": 1, "cc": 1, "AR_RC": 2, "ar": 1, "rc": 1, "MKDIR_P": 10, "mkdir": 1, "LN_SF": 9, "RANLIB": 2, "CP": 2, "cp": 9, "RM_F": 18, "/bin/rm": 1, "prefix": 7, "/usr/local": 1, "exec_prefix": 4, "#ZLIBLIB": 1, "/usr/local/lib": 1, "#ZLIBINC": 1, "/usr/local/include": 1, "ZLIBLIB": 5, "../zlib": 2, "ZLIBINC": 2, "dy": 1, "belf": 2, "O3": 1, "L.": 1, "L": 5, "lpng16": 4, "lz": 3, "lm": 3, "INCPATH": 4, "LIBPATH": 4, "MANPATH": 2, "/man": 1, "BINPATH": 6, "/bin": 1, "DESTDIR": 5, "DB": 8, "DI": 18, "DL": 24, "DM": 13, "PNGLIBCONF_H_PREBUILT": 3, "scripts/pnglibconf.h.prebuilt": 1, "png.o": 2, "pngset.o": 2, "pngget.o": 2, "pngrutil.o": 2, "pngtrans.o": 2, "pngwutil.o": 2, "pngread.o": 2, "pngrio.o": 2, "pngwio.o": 2, "pngwrite.o": 2, "pngrtran.o": 2, "pngwtran.o": 2, "pngmem.o": 2, "pngerror.o": 2, "pngpread.o": 2, "OBJSDLL": 3, ".o": 2, ".pic.o": 2, ".SUFFIXES": 1, ".c": 1, ".c.o": 1, "<": 1, ".c.pic.o": 1, "KPIC": 1, "*.c": 1, "libpng.a": 6, "pngtest": 6, "libpng.pc": 7, "libpng": 9, "pnglibconf.h": 20, "cat": 3, "scripts/libpng.pc.in": 1, "sed": 1, "@prefix@": 1, "@exec_prefix@": 1, "@libdir@": 1, "@includedir@": 1, "scripts/libpng": 2, "head.in": 1, "I_opts": 1, "ccopts": 1, "L_opts": 1, "libs": 1, "body.in": 1, "chmod": 7, "x": 1, "G": 1, "pngtest.o": 3, "LD_RUN_PATH": 1, "./pngtest": 1, "install": 12, "headers": 3, "png.h": 18, "pngconf.h": 18, "@if": 9, "then": 9, "fi": 9, "/png.h": 3, "/pngconf.h": 3, "/pnglibconf.h": 3, "/libpng": 2, "cd": 5, ".a": 3, "/libpng.a": 1, "shared": 3, "/pkgconfig": 3, "/pkgconfig/": 3, ".pc": 4, "/pkgconfig/libpng.pc": 1, "man": 2, "libpng.3": 2, "libpngpf.3": 2, "png.5": 2, "/man3": 4, "/man3/libpng.3": 1, "/man3/libpngpf.3": 1, "/man5": 3, "/man5/png.5": 1, "dd": 1, "Testing": 1, "installed": 2, "dynamic": 1, "cflags": 2, "pngtest.c": 2, "pngtestd": 1, "ldflags": 2, "./pngtestd": 1, "pngtest.png": 2, "pngtesti": 2, "./pngtesti": 1, "*.o": 1, "pngout.png": 1, "*": 1, "DOCS": 2, "ANNOUNCE": 1, "CHANGES": 1, "INSTALL": 1, "KNOWNBUG": 1, "LICENSE": 1, "README": 1, "TODO": 1, "Y2KINFO": 1, "writelock": 1, "a": 1, "w": 1, "*.": 1, "ch35": 1, "scripts/*": 1, "png.pic.o": 1, "pngpriv.h": 15, "pngstruct.h": 15, "pnginfo.h": 15, "pngdebug.h": 15, "pngerror.pic.o": 1, "pngrio.pic.o": 1, "pngwio.pic.o": 1, "pngmem.pic.o": 1, "pngset.pic.o": 1, "pngget.pic.o": 1, "pngread.pic.o": 1, "pngrtran.pic.o": 1, "pngrutil.pic.o": 1, "pngtrans.pic.o": 1, "pngwrite.pic.o": 1, "pngwtran.pic.o": 1, "pngwutil.pic.o": 1, "pngpread.pic.o": 1, "GREETINGS": 3, "gday": 1, "bonjour": 1, "hola": 1, "ola": 1, "kaixo": 1, "tag": 1, "hoi": 1, "konnichiwa": 1, "nihao": 1, "dobredan": 1, "namaste": 1, "salaam": 1, "V": 1, "mk": 2, "greet.": 2, "text": 1, "/n/": 1, "printer": 1, "stem": 1, "bar/foo.o": 1, "bar/foo.c": 1, "bar/baz.h": 2, "SHEBANG#!make": 1, "l": 1 }, "Markdown": { "Tender": 1 }, "Mask": { "header": 1, "{": 10, "img": 1, ".logo": 1, "src": 1, "alt": 1, "logo": 1, ";": 3, "h4": 1, "if": 1, "(": 3, "currentUser": 1, ")": 3, ".account": 1, "a": 1, "href": 1, "}": 10, ".view": 1, "ul": 1, "for": 1, "user": 1, "index": 1, "of": 1, "users": 1, "li.user": 1, "data": 1, "-": 3, "id": 1, ".name": 1, ".count": 1, ".date": 1, "countdownComponent": 1, "input": 1, "type": 1, "text": 1, "dualbind": 1, "value": 1, "button": 1, "x": 2, "signal": 1, "h5": 1, "animation": 1, "slot": 1, "@model": 1, "@next": 1, "footer": 1, "bazCompo": 1 }, "Mathematica": { "BeginPackage": 3, "[": 564, "]": 542, "HeyexEyePosition": 2, "usage": 45, ";": 158, "HeyexImport": 2, "wrongHdr": 2, "Begin": 5, "ImportExport": 1, "RegisterImport": 1, "{": 322, "importHeader": 3, "n_Integer": 7, "}": 317, "(": 27, "importData": 7, "n": 29, "##": 3, "&": 12, ")": 26, "importImages": 4, "importSLOImage": 2, "importSegmentation": 4, "importDataSize": 2, "Image3D": 1, "/.": 32, "#1": 1, "-": 184, "If": 4, "Quiet": 2, "Check": 2, "TrueQ": 10, "Compile": 2, "CompilationTarget": 3, "False": 25, "compileTarget": 5, "read": 10, "id_String": 3, "type_String": 3, "str_": 4, "id": 3, "BinaryRead": 2, "str": 52, "type": 3, "BinaryReadList": 3, "StringJoin": 1, "FromCharacterCode": 1, "/@": 11, "Rest": 1, "NestList": 1, "Null": 1, "chars___Integer": 1, "Longest": 1, "...": 1, "chars": 1, "With": 3, "i": 22, "f": 4, "d": 18, "b": 14, "fileHeaderInfo": 2, "Transpose": 5, "bScanHeaderInfo": 1, "isHeyexRawFormat": 3, "version_String": 1, "_Integer": 2, "_Rule..": 1, "/": 3, "StringMatchQ": 1, "version": 1, "__": 1, "True": 17, "___": 10, "readFileHeader": 8, "str_InputStream": 8, "hdr": 3, "#": 7, "Message": 1, "Throw": 1, "Failed": 3, "readSLOImage": 2, "fileHdr": 17, "_String": 7, "_": 8, "..": 7, "Image": 3, "Partition": 6, "*": 33, "skipSLOImage": 5, "Skip": 5, "readBScanHeader": 2, "Module": 13, "bScanHdr": 6, "AppendTo": 2, "None": 9, "skipBScanHeader": 3, "readBScanData": 1, "Developer": 3, "ToPackedArray": 3, "skipBScanData": 2, "skipBScanBlocks": 3, "+": 5, "filename_String": 9, "header": 35, "OpenRead": 6, "filename": 9, "BinaryFormat": 6, "Close": 6, "r___": 1, "slo": 3, "nx": 10, "data": 15, "Table": 2, "num_Integer": 2, "Max": 3, "Min": 3, "num": 4, "adjustGraylevelFunc": 4, "values": 2, "_Real": 1, "Map": 1, "Floor": 1, "RuntimeAttributes": 1, "Listable": 1, "Parallelization": 1, "RuntimeOptions": 1, "imageNumber_Integer": 1, "imageNumber": 3, "@@": 3, "bScanHeader": 3, "t": 2, "Timing@readBScanHeader": 1, "Function": 1, "bhdr": 9, "Block": 2, "numVecs": 6, "vecNames": 6, "Take": 2, "vec_": 2, "Sequence": 2, "Rule": 2, "@@@": 2, "vec": 2, "file_String": 1, "FileExistsQ": 1, "file": 2, "position": 3, "Import": 1, "Switch": 1, "Right": 1, "Left": 2, "End": 5, "EndPackage": 3, "Get": 1, "Notebook": 2, "Cell": 28, "CellGroupData": 8, "BoxData": 19, "RowBox": 34, "CellChangeTimes": 13, "SuperscriptBox": 1, "MultilineFunction": 1, "Open": 7, "NumberMarks": 3, "GraphicsBox": 2, "Hue": 5, "LineBox": 5, "CompressedData": 9, "AspectRatio": 1, "NCache": 1, "GoldenRatio": 1, "Axes": 1, "AxesLabel": 1, "AxesOrigin": 1, "Method": 2, "PlotRange": 1, "PlotRangeClipping": 1, "PlotRangePadding": 1, "Scaled": 10, "WindowSize": 1, "WindowMargins": 1, "Automatic": 9, "FrontEndVersion": 1, "StyleDefinitions": 1, "NamespaceBox": 1, "DynamicModuleBox": 1, "Typeset": 7, "q": 1, "opts": 1, "AppearanceElements": 1, "Asynchronous": 1, "All": 1, "TimeConstraint": 1, "elements": 1, "pod1": 1, "XMLElement": 13, "FormBox": 4, "TagBox": 9, "GridBox": 2, "PaneBox": 1, "StyleBox": 4, "CellContext": 5, "TagBoxWrapper": 4, "AstronomicalData": 1, "Identity": 2, "LineIndent": 4, "LineSpacing": 2, "GridBoxBackground": 1, "GrayLevel": 17, "GridBoxItemSize": 2, "ColumnsEqual": 2, "RowsEqual": 2, "GridBoxDividers": 1, "GridBoxSpacings": 2, "GridBoxAlignment": 1, "Baseline": 1, "AllowScriptLevelChange": 2, "BaselinePosition": 2, "Center": 1, "AbsoluteThickness": 3, "TraditionalForm": 3, "PolynomialForm": 1, "TraditionalOrder": 1, "pod2": 1, "LinebreakAdjustments": 2, "FontFamily": 1, "UnitFontFamily": 1, "FontSize": 1, "Smaller": 1, "StripOnInput": 1, "SyntaxForm": 2, "Dot": 2, "ZeroWidthTimes": 1, "pod3": 1, "TemplateBox": 1, "GraphicsComplexBox": 1, "EdgeForm": 2, "Directive": 5, "Opacity": 2, "GraphicsGroupBox": 2, "PolygonBox": 3, "RGBColor": 3, "Dashing": 1, "Small": 1, "GridLines": 1, "Dynamic": 1, "Join": 1, "Replace": 1, "MousePosition": 1, "Graphics": 1, "Pattern": 2, "CalculateUtilities": 5, "GraphicsUtilities": 5, "Private": 5, "x": 2, "Blank": 2, "y": 2, "Epilog": 1, "CapForm": 1, "Offset": 8, "DynamicBox": 1, "ToBoxes": 1, "DynamicModule": 1, "pt": 1, "NearestFunction": 1, "Paclet": 1, "Name": 1, "Version": 1, "MathematicaVersion": 1, "Description": 1, "Creator": 1, "Extensions": 1, "Language": 1, "MainPage": 1, "PossiblyTrueQ": 6, "PossiblyFalseQ": 4, "PossiblyNonzeroQ": 6, "expr_": 8, "Not": 12, "expr": 8, "AnyQ": 6, "AnyElementQ": 8, "AllQ": 4, "AllElementQ": 4, "AnyNonzeroQ": 4, "AnyPossiblyNonzeroQ": 4, "RealQ": 6, "PositiveQ": 6, "NonnegativeQ": 6, "PositiveIntegerQ": 6, "NonnegativeIntegerQ": 8, "IntegerListQ": 10, "PositiveIntegerListQ": 6, "NonnegativeIntegerListQ": 6, "IntegerOrListQ": 4, "PositiveIntegerOrListQ": 4, "NonnegativeIntegerOrListQ": 4, "SymbolQ": 4, "SymbolOrNumberQ": 4, "cond_": 8, "L_": 10, "Fold": 6, "Or": 2, "cond": 8, "L": 8, "Flatten": 2, "And": 8, "SHEBANG#!#!=": 2, "n_": 10, "Im": 2, "Positive": 4, "IntegerQ": 6, "&&": 8, "input_": 12, "ListQ": 2, "input": 22, "MemberQ": 6, "IntegerQ/@input": 2, "||": 8, "a_": 4, "Head": 4, "a": 8, "Symbol": 4, "NumericQ": 2, "Do": 1, "Length": 1, "Divisors": 1, "Binomial": 2, "Print": 1, "Break": 1, "Test": 2, "TestID": 2, "<": 1, "TestSuite": 1, "BeginTestSection": 1, "VerificationTest": 2, "RotationMatrix": 1, "phi": 5, "List": 3, "Cos": 2, "Times": 3, "Sin": 2, "Power": 2, "Plus": 1, "ComplexInfinity": 1, "infy": 1, "EndTestSection": 1 }, "Matlab": { "function": 34, "[": 311, "dx": 6, "y": 25, "]": 311, "adapting_structural_model": 2, "(": 1379, "t": 32, "x": 46, "u": 3, "varargin": 25, ")": 1380, "%": 554, "size": 11, "aux": 3, "{": 157, "end": 150, "}": 157, ";": 909, "m": 44, "zeros": 61, "b": 12, "for": 78, "i": 338, "if": 52, "+": 169, "elseif": 14, "else": 23, "display": 10, "aux.pars": 3, ".*": 2, "Yp": 2, "human": 1, "aux.timeDelay": 2, "c1": 5, "aux.m": 3, "*": 46, "aux.b": 3, "c2": 5, "Yc": 5, "parallel": 2, "plant": 4, "aux.plantFirst": 2, "aux.plantSecond": 2, "Ys": 1, "feedback": 1, "A": 11, "B": 9, "C": 13, "D": 7, "tf2ss": 1, "Ys.num": 1, "Ys.den": 1, "average": 1, "n": 102, "|": 2, "&": 4, "error": 16, "sum": 2, "/length": 1, "bicycle": 7, "bicycle_state_space": 1, "speed": 20, "S": 5, "dbstack": 1, "CURRENT_DIRECTORY": 2, "fileparts": 1, ".file": 1, "par": 7, "par_text_to_struct": 4, "filesep": 14, "...": 162, "whipple_pull_force_abcd": 2, "states": 7, "outputs": 10, "inputs": 14, "defaultSettings.states": 1, "defaultSettings.inputs": 1, "defaultSettings.outputs": 1, "userSettings": 3, "varargin_to_structure": 2, "struct": 1, "settings": 3, "overwrite_settings": 2, "defaultSettings": 3, "minStates": 2, "ismember": 15, "settings.states": 3, "<": 9, "keepStates": 2, "find": 24, "removeStates": 1, "row": 6, "abs": 12, "col": 5, "s": 13, "sprintf": 11, "removeInputs": 2, "settings.inputs": 1, "keepOutputs": 2, "settings.outputs": 1, "It": 1, "is": 7, "not": 3, "possible": 1, "to": 9, "keep": 1, "output": 7, "because": 1, "it": 1, "depends": 1, "on": 13, "input": 14, "StateName": 1, "OutputName": 1, "InputName": 1, "x_0": 45, "linspace": 14, "vx_0": 37, "z": 3, "j": 242, "*vx_0": 1, "figure": 17, "pcolor": 2, "shading": 3, "flat": 3, "name": 4, "order": 11, "convert_variable": 1, "variable": 10, "coordinates": 6, "speeds": 21, "get_variables": 2, "columns": 4, "create_ieee_paper_plots": 2, "data": 27, "rollData": 8, "global": 6, "goldenRatio": 12, "sqrt": 14, "/": 59, "exist": 1, "mkdir": 1, "linestyles": 15, "colors": 13, "loop_shape_example": 3, "data.Benchmark.Medium": 2, "plot_io_roll": 3, "open_loop_all_bikes": 1, "handling_all_bikes": 1, "path_plots": 1, "var": 3, "io": 7, "typ": 3, "length": 49, "plot_io": 1, "phase_portraits": 2, "eigenvalues": 2, "bikeData": 2, "figWidth": 24, "figHeight": 19, "set": 43, "gcf": 17, "-": 660, "freq": 12, "hold": 23, "all": 15, "closedLoops": 1, "bikeData.closedLoops": 1, "bops": 7, "bodeoptions": 1, "bops.FreqUnits": 1, "strcmp": 24, "gray": 7, "deltaNum": 2, "closedLoops.Delta.num": 1, "deltaDen": 2, "closedLoops.Delta.den": 1, "bodeplot": 6, "tf": 18, "neuroNum": 2, "neuroDen": 2, "whichLines": 3, "phiDotNum": 2, "closedLoops.PhiDot.num": 1, "phiDotDen": 2, "closedLoops.PhiDot.den": 1, "closedBode": 3, "off": 10, "opts": 4, "getoptions": 2, "opts.YLim": 3, "opts.PhaseMatching": 2, "opts.PhaseMatchingValue": 2, "opts.Title.String": 2, "setoptions": 2, "lines": 17, "findobj": 5, "raise": 19, "plotAxes": 22, "curPos1": 4, "get": 11, "curPos2": 4, "xLab": 8, "legWords": 3, "closeLeg": 2, "legend": 7, "axes": 9, "db1": 4, "text": 11, "db2": 2, "dArrow1": 2, "annotation": 13, "dArrow2": 2, "dArrow": 2, "filename": 21, "pathToFile": 11, "print": 6, "fix_ps_linestyle": 6, "openLoops": 1, "bikeData.openLoops": 1, "num": 24, "openLoops.Phi.num": 1, "den": 15, "openLoops.Phi.den": 1, "openLoops.Psi.num": 1, "openLoops.Psi.den": 1, "openLoops.Y.num": 1, "openLoops.Y.den": 1, "openBode": 3, "line": 15, "wc": 14, "wShift": 5, "num2str": 10, "bikeData.handlingMetric.num": 1, "bikeData.handlingMetric.den": 1, "w": 6, "mag": 4, "phase": 2, "bode": 5, "metricLine": 1, "plot": 26, "k": 75, "Linewidth": 7, "Color": 13, "Linestyle": 6, "Handling": 2, "Quality": 2, "Metric": 2, "Frequency": 2, "rad/s": 4, "Level": 6, "benchmark": 1, "Handling.eps": 1, "plots": 4, "deps2": 1, "loose": 4, "PaperOrientation": 3, "portrait": 3, "PaperUnits": 3, "inches": 3, "PaperPositionMode": 3, "manual": 3, "PaperPosition": 3, "PaperSize": 3, "rad/sec": 1, "phi": 13, "Open": 1, "Loop": 1, "Bode": 1, "Diagrams": 1, "at": 3, "m/s": 6, "Latex": 1, "type": 4, "LineStyle": 2, "LineWidth": 2, "Location": 2, "Southwest": 1, "Fontsize": 4, "YColor": 2, "XColor": 1, "Position": 6, "Xlabel": 1, "Units": 1, "normalized": 1, "openBode.eps": 1, "deps2c": 3, "maxMag": 2, "max": 9, "magnitudes": 1, "area": 1, "fillColors": 1, "gca": 8, "speedNames": 12, "metricLines": 2, "bikes": 24, "data.": 6, ".": 13, ".handlingMetric.num": 1, ".handlingMetric.den": 1, "chil": 2, "legLines": 1, "Hands": 1, "free": 1, "@": 1, "handling.eps": 1, "YTick": 1, "YTickLabel": 1, "Path": 1, "Southeast": 1, "Distance": 1, "Lateral": 1, "Deviation": 1, "paths.eps": 1, "d": 12, "like": 1, "plot.": 1, "names": 6, "prettyNames": 3, "units": 3, "index": 6, "fieldnames": 5, "data.Browser": 1, "maxValue": 4, "oneSpeed": 3, "history": 7, "oneSpeed.": 3, "round": 1, "pad": 10, "yShift": 16, "xShift": 3, "time": 21, "oneSpeed.time": 2, "oneSpeed.speed": 2, "distance": 6, "xAxis": 12, "xData": 3, "textX": 3, "ylim": 2, "ticks": 4, "xlabel": 8, "xLimits": 6, "xlim": 8, "loc": 3, "l1": 2, "l2": 2, "first": 3, "ylabel": 4, "box": 4, "&&": 13, "x_r": 6, "y_r": 6, "w_r": 5, "h_r": 5, "rectangle": 2, "w_r/2": 4, "h_r/2": 4, "x_a": 10, "y_a": 10, "w_a": 7, "h_a": 5, "ax": 15, "axis": 5, "rollData.speed": 1, "rollData.time": 1, "path": 3, "rollData.path": 1, "frontWheel": 3, "rollData.outputs": 3, "rollAngle": 4, "steerAngle": 4, "rollTorque": 4, "rollData.inputs": 1, "subplot": 3, "h1": 5, "h2": 5, "plotyy": 3, "inset": 3, "gainChanges": 2, "loopNames": 4, "xy": 7, "xySource": 7, "xlabels": 2, "ylabels": 2, "legends": 3, "floatSpec": 3, "twentyPercent": 1, "generate_data": 5, "nominalData": 1, "nominalData.": 2, "bikeData.": 2, "twentyPercent.": 2, "equal": 2, "leg1": 2, "bikeData.modelPar.": 1, "leg2": 2, "twentyPercent.modelPar.": 1, "eVals": 5, "pathToParFile": 2, "str": 2, "eigenValues": 1, "eig": 6, "real": 3, "zeroIndices": 3, "ones": 6, "maxEvals": 4, "maxLine": 7, "minLine": 4, "min": 1, "speedInd": 12, "cross_validation": 1, "hyper_parameter": 3, "num_data": 2, "K": 4, "indices": 2, "crossvalind": 1, "errors": 4, "test_idx": 4, "train_idx": 3, "x_train": 2, "y_train": 2, "train": 1, "x_test": 3, "y_test": 3, "calc_cost": 1, "calc_error": 2, "mean": 2, "value": 2, "isterminal": 2, "direction": 2, "mu": 73, "FIXME": 1, "from": 2, "the": 14, "largest": 1, "primary": 1, "clear": 13, "tic": 7, "T": 22, "x_min": 3, "x_max": 3, "y_min": 3, "y_max": 3, "how": 1, "many": 1, "points": 11, "per": 5, "one": 3, "measure": 1, "unit": 1, "both": 1, "in": 8, "and": 7, "ds": 1, "x_res": 7, "*n": 2, "y_res": 7, "grid_x": 3, "grid_y": 3, "advected_x": 12, "advected_y": 12, "parfor": 5, "X": 6, "ode45": 6, "@dg": 1, "store": 4, "advected": 2, "positions": 2, "as": 4, "they": 2, "would": 2, "appear": 2, "coords": 2, "Compute": 3, "FTLE": 14, "sigma": 6, "compute": 2, "Jacobian": 3, "*ds": 4, "eigenvalue": 2, "of": 35, "*phi": 2, "log": 2, "lambda_max": 2, "/abs": 3, "*T": 3, "toc": 5, "field": 2, "contourf": 2, "location": 1, "EastOutside": 1, "f_x_t": 2, "inline": 1, "grid_min": 3, "grid_max": 3, "grid_width": 1, "grid_spacing": 5, "grid_width/": 1, "*grid_width/": 4, "colorbar": 1, "load_data": 4, "t0": 6, "t1": 6, "t2": 6, "t3": 1, "dataPlantOne": 3, "data.Ts": 6, "dataAdapting": 3, "dataPlantTwo": 3, "guessPlantOne": 4, "resultPlantOne": 1, "find_structural_gains": 2, "yh": 2, "fit": 6, "x0": 4, "compare": 3, "resultPlantOne.fit": 1, "guessPlantTwo": 3, "resultPlantTwo": 1, "resultPlantTwo.fit": 1, "kP1": 4, "resultPlantOne.fit.par": 1, "kP2": 3, "resultPlantTwo.fit.par": 1, "gainSlopeOffset": 6, "eye": 9, "this": 2, "only": 7, "uses": 1, "tau": 1, "through": 1, "wfs": 1, "true": 2, "plantOneSlopeOffset": 3, "plantTwoSlopeOffset": 3, "mod": 3, "idnlgrey": 1, "pem": 1, "guess.plantOne": 3, "guess.plantTwo": 2, "plantNum.plantOne": 2, "plantNum.plantTwo": 2, "sections": 13, "secData.": 1, "||": 3, "guess.": 2, "result.": 2, ".fit.par": 1, "currentGuess": 2, "warning": 1, "randomGuess": 1, "The": 6, "self": 2, "validation": 2, "VAF": 2, "f.": 2, "data/": 1, "results.mat": 1, "guess": 1, "plantNum": 1, "result": 5, "plots/": 1, ".png": 1, "task": 1, "closed": 1, "loop": 1, "system": 2, "u.": 1, "gain": 1, "guesses": 1, "k1": 4, "f": 12, "k2": 3, "k3": 3, "k4": 4, "identified": 1, "gains": 12, ".vaf": 1, "Elements": 1, "grid": 1, "definition": 2, "Dimensionless": 1, "integrating": 1, "Choice": 2, "mass": 2, "parameter": 2, "Computation": 9, "Lagrangian": 3, "Points": 2, "xl1": 13, "yl1": 12, "xl2": 9, "yl2": 8, "xl3": 8, "yl3": 8, "xl4": 10, "yl4": 9, "xl5": 8, "yl5": 8, "Lagr": 6, "initial": 5, "total": 6, "energy": 8, "E_L1": 4, "Omega": 7, "C_L1": 3, "*E_L1": 1, "Szebehely": 1, "E": 8, "Offset": 2, "Initial": 3, "conditions": 3, "range": 2, "x_0_min": 8, "x_0_max": 8, "vx_0_min": 8, "vx_0_max": 8, "y_0": 29, "ndgrid": 2, "vy_0": 22, "*E": 2, "*Omega": 5, "vx_0.": 2, "E_cin": 4, "x_T": 25, "y_T": 17, "vx_T": 22, "vy_T": 12, "filtro": 15, "E_T": 11, "delta_E": 7, "a": 17, "matrix": 3, "numbers": 2, "integration": 9, "steps": 2, "each": 2, "np": 8, "number": 2, "integrated": 5, "fprintf": 18, "Energy": 4, "tolerance": 2, "setting": 4, "energy_tol": 6, "Setting": 1, "options": 14, "integrator": 2, "RelTol": 2, "AbsTol": 2, "From": 1, "Short": 1, "odeset": 4, "Parallel": 2, "equations": 2, "motion": 2, "h": 19, "waitbar": 6, "r1": 3, "r2": 3, "g": 5, "i/n": 1, "y_0.": 2, "./": 1, "mu./": 1, "isreal": 8, "Check": 6, "velocity": 2, "positive": 2, "Kinetic": 2, "Y": 19, "@f_reg": 1, "Saving": 4, "solutions": 2, "final": 2, "difference": 2, "with": 2, "conservation": 2, "position": 2, "point": 14, "interesting": 4, "non": 2, "sense": 2, "bad": 4, "close": 4, "t_integrazione": 3, "filtro_1": 12, "dphi": 12, "ftle": 10, "ftle_norm": 1, "ds_x": 1, "ds_vx": 1, "La": 1, "direzione": 1, "dello": 1, "spostamento": 1, "la": 2, "decide": 1, "il": 1, "denominatore": 1, "TODO": 1, "spiegarsi": 1, "teoricamente": 1, "come": 1, "mai": 1, "matrice": 1, "pu": 1, "essere": 1, "ridotta": 1, "x2": 1, "*ds_x": 2, "*ds_vx": 2, "Manual": 2, "visualize": 2, "*log": 2, "dphi*dphi": 1, "tempo": 4, "integrare": 2, ".2f": 5, "calcolare": 2, "var_": 2, "_": 2, "var_xvx_": 2, "ode00": 2, "_n": 2, "save": 2, "nome": 2, "Transforming": 1, "into": 1, "Hamiltonian": 1, "variables": 2, "px_0": 2, "py_0": 2, "px_T": 4, "py_T": 4, "inf": 1, "@cr3bp_jac": 1, "@fH": 1, "EnergyH": 1, "t_integr": 1, "Back": 1, "Inf": 1, "_e": 1, "_H": 1, "Range": 1, "E_0": 4, "C_L1/2": 1, "Y_0": 4, "nx": 32, "nvx": 32, "dvx": 3, "ny": 29, "dy": 5, "/2": 3, "ne": 29, "de": 4, "e_0": 7, "Definition": 1, "arrays": 1, "In": 1, "approach": 1, "useful": 9, "pints": 1, "are": 1, "stored": 1, "filter": 14, "l": 64, "v_y": 3, "*e_0": 3, "vx": 2, "e": 1, "vy": 2, "Selection": 1, "Data": 2, "transfer": 1, "GPU": 3, "x_gpu": 3, "gpuArray": 4, "y_gpu": 3, "vx_gpu": 3, "vy_gpu": 3, "Integration": 2, "N": 9, "x_f": 3, "y_f": 3, "vx_f": 3, "vy_f": 3, "arrayfun": 2, "@RKF45_FILE_gpu": 1, "back": 1, "CPU": 1, "memory": 1, "cleaning": 1, "gather": 4, "Construction": 1, "computation": 2, "X_T": 4, "Y_T": 4, "VX_T": 4, "VY_T": 3, "filter_ftle": 11, "Compute_FILE_gpu": 1, "Plot": 1, "results": 1, "squeeze": 1, "clc": 1, "load_bikes": 2, "e_T": 7, "Integrate_FILE": 1, "Integrate": 6, "Look": 2, "phisically": 2, "meaningful": 6, "meaningless": 2, "i/nx": 2, "*Potential": 5, "ci": 9, "te": 2, "ye": 9, "ie": 2, "@f": 6, "Potential": 1, "delta_e": 3, "Integrate_FTLE_Gawlick_ell": 1, "ecc": 2, "nu": 2, "ecc*cos": 1, "@f_ell": 1, "Consider": 1, "also": 1, "negative": 1, "goodness": 1, "roots": 3, "*mu": 6, "c3": 3, "lane_change": 1, "start": 4, "width": 3, "slope": 3, "pathLength": 3, "single": 1, "double": 1, "Double": 1, "lane": 4, "change": 1, "needs": 1, "lane.": 1, "laneLength": 4, "startOfSlope": 3, "endOfSlope": 1, "<=>": 1, "1": 1, "downSlope": 3, "gains.Benchmark.Slow": 1, "place": 2, "holder": 2, "gains.Browserins.Slow": 1, "gains.Browser.Slow": 1, "gains.Pista.Slow": 1, "gains.Fisher.Slow": 1, "gains.Yellow.Slow": 1, "gains.Yellowrev.Slow": 1, "gains.Benchmark.Medium": 1, "gains.Browserins.Medium": 1, "gains.Browser.Medium": 1, "gains.Pista.Medium": 1, "gains.Fisher.Medium": 1, "gains.Yellow.Medium": 1, "gains.Yellowrev.Medium": 1, "gains.Benchmark.Fast": 1, "gains.Browserins.Fast": 1, "gains.Browser.Fast": 1, "gains.Pista.Fast": 1, "gains.Fisher.Fast": 1, "gains.Yellow.Fast": 1, "gains.Yellowrev.Fast": 1, "gains.": 1, "parser": 1, "inputParser": 1, "parser.addRequired": 1, "parser.addParamValue": 3, "parser.parse": 1, "args": 1, "parser.Results": 1, "raw": 1, "load": 1, "args.directory": 1, "iddata": 1, "raw.theta": 1, "raw.theta_c": 1, "args.sampleTime": 1, "args.detrend": 1, "detrend": 1, "filtfcn": 2, "statefcn": 2, "makeFilter": 1, "v": 12, "@iirFilter": 1, "@getState": 1, "yn": 2, "iirFilter": 1, "xn": 4, "vOut": 2, "getState": 1, "classdef": 1, "matlab_class": 2, "properties": 1, "R": 1, "G": 1, "methods": 1, "obj": 2, "r": 2, "obj.R": 2, "obj.G": 2, "obj.B": 2, "disp": 8, "enumeration": 1, "red": 1, "green": 1, "blue": 1, "cyan": 1, "magenta": 1, "yellow": 1, "black": 1, "white": 1, "ret": 3, "matlab_function": 5, "Call": 2, "which": 2, "resides": 2, "same": 2, "directory": 2, "value1": 4, "semicolon": 2, "mandatory": 2, "suppresses": 2, "command": 2, "line.": 2, "value2": 4, "d_mean": 3, "d_std": 3, "normalize": 1, "repmat": 2, "std": 1, "d./": 1, "overrideSettings": 3, "overrideNames": 2, "defaultNames": 2, "notGiven": 5, "setxor": 1, "settings.": 1, "defaultSettings.": 1, "fid": 7, "fopen": 2, "textscan": 1, "fclose": 2, "strtrim": 2, "vals": 2, "regexp": 1, "par.": 1, "str2num": 1, "choose_plant": 4, "p": 7, "Conditions": 1, "@cross_y": 1, "ode113": 2, "RK4": 3, "fun": 5, "tspan": 7, "th": 1, "Runge": 1, "Kutta": 1, "dim": 2, "while": 1, "h/2": 2, "k1*h/2": 1, "k2*h/2": 1, "h*k3": 1, "h/6*": 1, "*k2": 1, "*k3": 1, "arg1": 1, "arg": 2, "RK4_par": 1, "wnm": 11, "zetanm": 5, "ss": 3, "data.modelPar.A": 1, "data.modelPar.B": 1, "data.modelPar.C": 1, "data.modelPar.D": 1, "bicycle.StateName": 2, "bicycle.OutputName": 4, "bicycle.InputName": 2, "analytic": 3, "system_state_space": 2, "numeric": 2, "data.system.A": 1, "data.system.B": 1, "data.system.C": 1, "data.system.D": 1, "numeric.StateName": 1, "data.bicycle.states": 1, "numeric.InputName": 1, "data.bicycle.inputs": 1, "numeric.OutputName": 1, "data.bicycle.outputs": 1, "pzplot": 1, "ss2tf": 2, "analytic.A": 3, "analytic.B": 1, "analytic.C": 1, "analytic.D": 1, "mine": 1, "data.forceTF.PhiDot.num": 1, "data.forceTF.PhiDot.den": 1, "numeric.A": 2, "numeric.B": 1, "numeric.C": 1, "numeric.D": 1, "whipple_pull_force_ABCD": 1, "bottomRow": 1, "prod": 3, "Earth": 2, "Moon": 2, "C_star": 1, "C/2": 1, "orbit": 1, "Y0": 6, "y0": 2, "vx0": 2, "vy0": 2, "l0": 1, "delta_E0": 1, "Hill": 1, "Edgecolor": 1, "none": 1, "ok": 2, "sg": 1, "sr": 1, "arguments": 7, "ischar": 1, "options.": 1, "write_gains": 1, "contents": 1, "importdata": 1, "speedsInFile": 5, "contents.data": 2, "gainsInFile": 3, "sameSpeedIndices": 5, "allGains": 4, "allSpeeds": 4, "sort": 1, "contents.colheaders": 1 }, "Maven POM": { "": 1, "version=": 1, "encoding=": 1, "": 1, "xmlns=": 1, "xmlns": 1, "xsi=": 1, "xsi": 1, "schemaLocation=": 1, "": 1, "": 1, "": 28, "renpengben": 1, "": 28, "": 28, "spring4mvc": 3, "-": 36, "jpa": 4, "": 28, "": 1, "war": 1, "": 1, "": 26, "SNAPSHOT": 1, "": 26, "": 1, "Maven": 1, "Webapp": 1, "": 1, "": 1, "https": 1, "//renpengben.github.io": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "UTF": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "RELEASE": 2, "": 1, "": 1, "": 1, "": 1, "_3": 1, "": 1, "": 1, "": 1, "": 1, "inal": 2, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 24, "junit": 4, "{": 24, "junit.version": 1, "}": 24, "": 4, "test": 3, "": 4, "": 24, "org.slf4j": 2, "slf4j": 2, "api": 1, "slf4j.version": 2, "log4j12": 1, "log4j": 2, "log4j.version": 1, "org.springframework": 13, "spring": 14, "core": 2, "spring.version": 13, "": 2, "": 2, "commons": 2, "logging": 2, "": 2, "": 2, "beans": 1, "context": 2, "aop": 1, "expression": 1, "tx": 1, "aspects": 1, "support": 1, "jdbc": 1, "orm": 1, "web": 1, "webmvc": 1, "org.springframework.data": 1, "data": 1, "spring.data.jpa.version": 1, "dep": 1, "cglib": 2, "nodep": 1, "cglib.version": 1, "org.hibernate": 3, "hibernate": 4, "hibernate.version": 2, "entitymanager": 1, "validator": 1, "validator.version": 1, "compile": 1, "mysql": 2, "connector": 1, "java": 1, "mysql.version": 1, "runtime": 1, "com.alibaba": 1, "druid": 2, "version": 1, "": 1, "": 1, "": 1, "": 1, "org.apache.maven.plugins": 1, "maven": 1, "compiler": 1, "plugin": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1 }, "Max": { "{": 126, "}": 126, "[": 163, "]": 163, "max": 1, "v2": 1, ";": 39, "#N": 2, "vpatcher": 1, "#P": 33, "toggle": 1, "button": 4, "window": 2, "setfont": 1, "Verdana": 1, "linecount": 1, "newex": 8, "r": 1, "jojo": 2, "#B": 2, "color": 2, "s": 1, "route": 1, "append": 1, "toto": 1, "%": 1, "counter": 2, "#X": 1, "flags": 1, "newobj": 1, "metro": 1, "t": 2, "message": 2, "Goodbye": 1, "World": 2, "Hello": 1, "connect": 13, "fasten": 1, "pop": 1 }, "MediaWiki": { "Overview": 1, "The": 21, "GDB": 15, "Tracepoint": 4, "Analysis": 1, "feature": 3, "is": 15, "an": 3, "extension": 1, "to": 13, "the": 105, "Tracing": 3, "and": 28, "Monitoring": 1, "Framework": 1, "that": 6, "allows": 2, "visualization": 1, "analysis": 1, "of": 19, "C/C": 10, "+": 21, "tracepoint": 5, "data": 5, "collected": 2, "by": 12, "stored": 2, "a": 13, "log": 2, "file.": 1, "Getting": 1, "Started": 1, "can": 12, "be": 18, "installed": 2, "from": 13, "Eclipse": 1, "update": 2, "site": 1, "selecting": 1, ".": 11, "requires": 1, "version": 3, "or": 9, "later": 1, "on": 3, "local": 1, "host.": 1, "executable": 3, "program": 1, "must": 5, "found": 1, "in": 21, "path.": 1, "Trace": 9, "Perspective": 1, "To": 1, "open": 1, "perspective": 2, "select": 5, "includes": 1, "following": 4, "views": 2, "default": 47, "*": 19, "This": 12, "view": 7, "shows": 7, "projects": 1, "workspace": 2, "used": 1, "create": 1, "manage": 1, "projects.": 1, "running": 1, "Postmortem": 5, "Debugger": 4, "instances": 1, "displays": 2, "thread": 1, "stack": 2, "trace": 17, "associated": 1, "with": 12, "tracepoint.": 3, "status": 2, "debugger": 1, "navigation": 1, "records.": 1, "console": 1, "output": 1, "Debugger.": 1, "editor": 7, "area": 2, "contains": 1, "editors": 1, "when": 1, "opened.": 1, "[": 19, "Image": 2, "images/GDBTracePerspective.png": 1, "]": 19, "Collecting": 2, "Data": 4, "outside": 2, "scope": 1, "this": 11, "feature.": 1, "It": 1, "done": 2, "command": 1, "line": 2, "using": 3, "CDT": 3, "debug": 1, "component": 1, "within": 1, "Eclipse.": 1, "See": 1, "FAQ": 2, "entry": 2, "#References": 2, "|": 5, "References": 3, "section.": 2, "Importing": 2, "Some": 1, "information": 1, "section": 1, "redundant": 1, "LTTng": 3, "User": 3, "Guide.": 1, "For": 1, "further": 1, "details": 1, "see": 2, "Guide": 2, "Creating": 1, "Project": 1, "In": 5, "right": 3, "-": 20, "click": 8, "context": 46, "menu.": 4, "dialog": 1, "name": 2, "your": 2, "project": 2, "tracing": 1, "folder": 5, "Browse": 2, "enter": 2, "source": 6, "directory.": 1, "Select": 1, "file": 7, "tree.": 1, "Optionally": 1, "set": 1, "type": 4, "Click": 1, "Alternatively": 1, "drag": 1, "&": 2, "dropped": 1, "any": 2, "external": 1, "manager.": 1, "Selecting": 2, "Type": 1, "Right": 2, "imported": 1, "choose": 2, "step": 1, "omitted": 1, "if": 2, "was": 2, "selected": 3, "at": 4, "import.": 1, "will": 6, "updated": 2, "icon": 1, "images/gdb_icon16.png": 1, "Executable": 1, "created": 1, "identified": 1, "so": 2, "launched": 1, "properly.": 1, "path": 2, "press": 1, "recognized": 1, "as": 2, "executable.": 1, "Visualizing": 1, "Opening": 1, "double": 1, "it": 5, "opened": 2, "Events": 5, "instance": 1, "launched.": 1, "If": 2, "available": 1, "code": 5, "corresponding": 1, "first": 2, "record": 3, "also": 4, "editor.": 2, "At": 1, "point": 1, "recommended": 1, "relocate": 1, "not": 1, "hidden": 1, "Viewing": 1, "table": 1, "shown": 1, "one": 1, "row": 1, "for": 4, "each": 1, "record.": 2, "column": 6, "sequential": 1, "number.": 1, "number": 2, "assigned": 1, "collection": 1, "time": 3, "method": 1, "where": 1, "set.": 1, "run": 1, "Searching": 1, "filtering": 1, "entering": 1, "regular": 1, "expression": 1, "header.": 1, "Navigating": 1, "records": 1, "keyboard": 1, "mouse.": 1, "show": 1, "current": 1, "navigated": 1, "clicking": 1, "buttons.": 1, "updated.": 1, "http": 13, "//wiki.eclipse.org/index.php/Linux_Tools_Project/LTTng2/User_Guide": 1, "//wiki.eclipse.org/CDT/User/FAQ#How_can_I_trace_my_application_using_C.2FC.2B.2B_Tracepoints.3F": 1, "How": 1, "I": 3, "my": 1, "application": 1, "Tracepoints": 1, "Updating": 1, "Document": 1, "document": 2, "maintained": 1, "collaborative": 1, "wiki.": 1, "you": 3, "wish": 1, "modify": 1, "please": 1, "visit": 1, "//wiki.eclipse.org/index.php/Linux_Tools_Project/GDB_Tracepoint_Analysis/User_Guide": 1, "//wiki.eclipse.org/Linux_Tools_Project/GDB_Tracepoint_Analysis/User_Guide": 1, "Name": 1, "support": 2, "TCP": 2, "proxy": 4, "Nginx": 2, "Installation": 1, "Download": 1, "latest": 1, "stable": 1, "release": 2, "tarball": 1, "module": 13, "//github.com/yaoweibin/nginx_tcp_proxy_module": 1, "github": 1, "Grab": 1, "nginx": 5, "//nginx.org/": 1, "nginx.org": 1, "example": 1, "(": 5, "compatibility": 1, ")": 5, "then": 1, "build": 1, "": 4, "lang=": 4, "wget": 1, "tar": 1, "xzvf": 1, "tar.gz": 1, "cd": 1, "/": 1, "patch": 1, "p1": 1, "<": 1, "/path/to/nginx_tcp_proxy_module/tcp.patch": 1, "./configure": 1, "add": 6, "/path/to/nginx_tcp_proxy_module": 1, "make": 3, "install": 1, "": 4, "Synopsis": 1, "{": 8, "server": 15, "listen": 5, ";": 15, "location": 1, "/status": 1, "tcp_check_status": 1, "}": 8, "#You": 1, "include": 2, "tcp_proxy.conf": 1, "individually": 1, "#include": 1, "/path/to/tcp_proxy.conf": 1, "tcp": 9, "upstream": 5, "cluster": 2, "check": 4, "interval": 3, "rise": 3, "fall": 3, "timeout": 3, "#check": 2, "ssl_hello": 1, "#check_http_send": 1, "#check_http_expect_alive": 1, "http_2xx": 1, "http_3xx": 1, "proxy_pass": 1, "Description": 1, "actually": 1, "many": 2, "modules": 4, "ngx_tcp_module": 1, "ngx_tcp_core_module": 1, "ngx_tcp_upstream_module": 1, "ngx_tcp_proxy_module": 1, "ngx_tcp_websocket_module": 1, "ngx_tcp_ssl_module": 1, "ngx_tcp_upstream_ip_hash_module.": 1, "All": 4, "these": 2, "work": 1, "together": 1, "Nginx.": 1, "added": 1, "other": 2, "features": 1, "ip_hash": 1, "health": 2, "monitor.": 1, "motivation": 1, "writing": 1, "t": 2, "use": 4, "same": 4, "listening": 2, "port": 3, "HTTP": 2, "modules.": 1, "Directives": 1, "ngx_tcp_moodule": 1, "...": 2, "none": 3, "main": 1, "related": 1, "directives": 2, "are": 5, "contained": 2, "block.": 2, "specific": 1, "address": 1, "bind": 1, "ssl": 2, "//wiki.nginx.org/NginxMailCoreModule#listen": 1, "parameter": 1, "means": 1, "have": 1, "several": 1, "blocks": 1, "port.": 1, "access_log": 3, "buffer": 1, "size": 1, "off": 1, "logs/tcp_access.log": 1, "Set": 1, "access.log.": 1, "Each": 1, "s": 2, "connection": 1, "upstream_ip": 1, "syntax": 42, "description": 29, "ngx_tcp_upstream_busyness_module": 1, "ngx_tcp_upstream_ip_hash_module": 1, "directive": 1, "defines": 1, "maximum": 1, "during": 1, "which": 1, "client": 1, "re": 1, "previously": 1, "negotiated": 1, "cryptographic": 1, "parameters": 1, "secure": 1, "session": 1, "SSL": 1, "cache.": 1, "Compatibility": 1, "My": 1, "test": 1, "bed": 1, "Notes": 1, "http_response_parse.rl": 2, "smtp_response_parse.rl": 2, "//www.complang.org/ragel/": 1, "ragel": 3, "scripts": 1, "edit": 1, "script": 1, "compile": 1, "like": 2, "G2": 2, "TODO": 1, "refact": 1, "more": 1, "extendable": 1, "adding": 1, "third": 1, "party": 1, "manipulate": 1, "header": 1, "module.": 1, "Changelogs": 1, "v0.2.0": 1, "websocket": 1, "busyness": 1, "access": 1, "v0.19": 1, "methods": 1, "v0.1": 1, "Authors": 1, "Weibin": 2, "Yao": 2, "yaoweibin": 1, "gmail": 1, "dot": 1, "com": 1, "Copyright": 2, "License": 1, "README": 1, "template": 1, "copy": 1, "//github.com/agentzh": 1, "agentzh": 1, "borrowed": 2, "lot": 1, "mail": 1, "core.": 1, "part": 2, "copyrighted": 1, "Igor": 1, "Sysoev.": 1, "And": 1, "design": 1, "Jack": 1, "Lindamood": 1, "healthcheck": 1, "//github.com/cep21/healthcheck_nginx_upstreams": 1, "healthcheck_nginx_upstreams": 1, "licensed": 1, "under": 1, "BSD": 1, "license.": 1, "C": 1, "": 1, "rights": 1, "reserved.": 1, "Redistribution": 1, "binary": 2, "forms": 1, "without": 1, "modification": 1, "permitted": 1, "provided": 2, "conditions": 3, "met": 1, "Redistributions": 2, "retain": 1, "above": 2, "copyright": 2, "notice": 2, "list": 2, "disclaimer.": 1, "form": 1, "reproduce": 1, "disclaimer": 1, "documentation": 1, "and/or": 1, "materials": 1, "distribution.": 1, "THIS": 2, "SOFTWARE": 2, "IS": 1, "PROVIDED": 1, "BY": 1, "THE": 5, "COPYRIGHT": 2, "HOLDERS": 1, "AND": 4, "CONTRIBUTORS": 2, "ANY": 4, "EXPRESS": 1, "OR": 8, "IMPLIED": 2, "WARRANTIES": 2, "INCLUDING": 3, "BUT": 2, "NOT": 2, "LIMITED": 2, "TO": 2, "OF": 8, "MERCHANTABILITY": 1, "FITNESS": 1, "FOR": 2, "A": 1, "PARTICULAR": 1, "PURPOSE": 1, "ARE": 1, "DISCLAIMED.": 1, "IN": 3, "NO": 1, "EVENT": 1, "SHALL": 1, "HOLDER": 1, "BE": 1, "LIABLE": 1, "DIRECT": 1, "INDIRECT": 1, "INCIDENTAL": 1, "SPECIAL": 1, "EXEMPLARY": 1, "CONSEQUENTIAL": 1, "DAMAGES": 1, "PROCUREMENT": 1, "SUBSTITUTE": 1, "GOODS": 1, "SERVICES": 1, "LOSS": 1, "USE": 2, "DATA": 1, "PROFITS": 1, "BUSINESS": 1, "INTERRUPTION": 1, "HOWEVER": 1, "CAUSED": 1, "ON": 1, "THEORY": 1, "LIABILITY": 2, "WHETHER": 1, "CONTRACT": 1, "STRICT": 1, "TORT": 1, "NEGLIGENCE": 1, "OTHERWISE": 1, "ARISING": 1, "WAY": 1, "OUT": 1, "EVEN": 1, "IF": 1, "ADVISED": 1, "POSSIBILITY": 1, "SUCH": 1, "DAMAGE.": 1 }, "Mercury": { "%": 422, "-": 7223, "module": 47, "ll_backend.code_info.": 1, "interface.": 14, "import_module": 126, "check_hlds.type_util.": 2, "hlds.code_model.": 1, "hlds.hlds_data.": 2, "hlds.hlds_goal.": 2, "hlds.hlds_llds.": 1, "hlds.hlds_module.": 2, "hlds.hlds_pred.": 2, "hlds.instmap.": 2, "libs.globals.": 2, "ll_backend.continuation_info.": 1, "ll_backend.global_data.": 1, "ll_backend.layout.": 1, "ll_backend.llds.": 1, "ll_backend.trace_gen.": 1, "mdbcomp.prim_data.": 3, "mdbcomp.goal_path.": 2, "parse_tree.prog_data.": 2, "parse_tree.set_of_var.": 2, "assoc_list.": 3, "bool.": 4, "counter.": 1, "io.": 8, "list.": 4, "map.": 3, "maybe.": 3, "set.": 4, "set_tree234.": 1, "term.": 3, "implementation.": 13, "backend_libs.builtin_ops.": 1, "backend_libs.proc_label.": 1, "hlds.arg_info.": 1, "hlds.hlds_desc.": 1, "hlds.hlds_rtti.": 2, "libs.options.": 3, "libs.trace_params.": 1, "ll_backend.code_util.": 1, "ll_backend.opt_debug.": 1, "ll_backend.var_locn.": 1, "parse_tree.builtin_lib_types.": 2, "parse_tree.prog_type.": 2, "parse_tree.mercury_to_mercury.": 1, "cord.": 1, "int.": 5, "pair.": 3, "require.": 6, "stack.": 1, "string.": 7, "varset.": 2, "type": 62, "code_info.": 1, "pred": 256, "code_info_init": 2, "(": 3402, "bool": 406, "in": 512, "globals": 5, "pred_id": 15, "proc_id": 12, "pred_info": 20, "proc_info": 11, "abs_follow_vars": 3, "module_info": 26, "static_cell_info": 4, "const_struct_map": 3, "resume_point_info": 11, "out": 338, "trace_slot_info": 3, "maybe": 20, "containing_goal_map": 4, ")": 3402, "list": 82, "string": 115, "int": 129, "code_info": 208, "is": 247, "det.": 184, "get_globals": 5, "get_exprn_opts": 2, "exprn_opts": 3, "get_module_info": 7, "get_pred_id": 6, "get_proc_id": 5, "get_pred_info": 2, "get_proc_info": 4, "get_varset": 3, "prog_varset": 14, "func": 24, "get_var_types": 3, "vartypes.": 1, "get_maybe_trace_info": 2, "trace_info": 3, "get_emit_trail_ops": 2, "add_trail_ops": 5, "get_emit_region_ops": 2, "add_region_ops": 6, "get_forward_live_vars": 2, "set_of_progvar": 10, "set_forward_live_vars": 2, "get_instmap": 4, "instmap": 3, "set_instmap": 3, "get_par_conj_depth": 2, "set_par_conj_depth": 2, "get_label_counter": 3, "counter": 6, "get_succip_used": 2, "get_layout_info": 4, "proc_label_layout_info": 3, "get_proc_trace_events": 2, "set_proc_trace_events": 2, "get_closure_layouts": 3, "closure_proc_id_data": 4, "get_max_reg_in_use_at_trace": 2, "set_max_reg_in_use_at_trace": 2, "get_created_temp_frame": 2, "get_static_cell_info": 5, "set_static_cell_info": 5, "get_alloc_sites": 3, "set_tree234": 3, "alloc_site_info": 4, "set_alloc_sites": 3, "get_used_env_vars": 2, "set": 16, "set_used_env_vars": 2, "get_opt_trail_ops": 2, "get_opt_region_ops": 2, "get_auto_comments": 2, "get_lcmc_null": 2, "get_containing_goal_map": 3, "get_containing_goal_map_det": 2, "get_const_struct_map": 2, "add_out_of_line_code": 2, "llds_code": 21, "get_out_of_line_code": 2, "get_var_slot_count": 2, "set_maybe_trace_info": 3, "get_opt_no_return_calls": 2, "get_zombies": 2, "set_zombies": 2, "get_var_locn_info": 7, "var_locn_info": 3, "set_var_locn_info": 4, "get_temps_in_use": 6, "lval": 114, "set_temps_in_use": 4, "get_fail_info": 13, "fail_info": 24, "set_fail_info": 9, "set_label_counter": 3, "set_succip_used": 3, "set_layout_info": 4, "get_max_temp_slot_count": 2, "set_max_temp_slot_count": 2, "get_temp_content_map": 3, "map": 7, "slot_contents": 4, "set_temp_content_map": 2, "get_persistent_temps": 3, "set_persistent_temps": 2, "set_closure_layouts": 3, "get_closure_seq_counter": 3, "set_closure_seq_counter": 3, "set_created_temp_frame": 2, "code_info_static": 26, "code_info_loc_dep": 22, "code_info_persistent": 44, ".": 631, "cis_globals": 2, "cis_exprn_opts": 2, "cis_module_info": 2, "cis_pred_id": 2, "cis_proc_id": 2, "cis_pred_info": 2, "cis_proc_info": 2, "cis_proc_label": 1, "proc_label": 2, "cis_varset": 2, "cis_var_slot_count": 2, "cis_maybe_trace_info": 3, "cis_opt_no_resume_calls": 2, "cis_emit_trail_ops": 2, "cis_opt_trail_ops": 2, "cis_emit_region_ops": 2, "cis_opt_region_ops": 2, "cis_auto_comments": 2, "cis_lcmc_null": 2, "cis_containing_goal_map": 2, "cis_const_struct_map": 2, "cild_forward_live_vars": 3, "cild_instmap": 3, "cild_zombies": 3, "cild_var_locn_info": 3, "cild_temps_in_use": 3, "cild_fail_info": 3, "cild_par_conj_depth": 3, "cip_label_num_src": 3, "cip_store_succip": 3, "cip_label_info": 3, "cip_proc_trace_events": 3, "cip_stackslot_max": 3, "cip_temp_contents": 3, "cip_persistent_temps": 3, "cip_closure_layout_seq": 3, "cip_closure_layouts": 3, "cip_max_reg_r_used": 3, "cip_max_reg_f_used": 2, "cip_created_temp_frame": 3, "cip_static_cell_info": 3, "cip_alloc_sites": 3, "cip_used_env_vars": 3, "cip_ts_string_table_size": 3, "cip_ts_rev_string_table": 4, "cip_out_of_line_code": 4, "SaveSuccip": 2, "Globals": 32, "PredId": 50, "ProcId": 31, "PredInfo": 64, "ProcInfo": 43, "FollowVars": 6, "ModuleInfo": 49, "StaticCellInfo": 8, "ConstStructMap": 2, "ResumePoint": 13, "TraceSlotInfo": 5, "MaybeContainingGoalMap": 5, "TSRevStringTable": 2, "TSStringTableSize": 2, "CodeInfo": 2, "ProcLabel": 8, "make_proc_label": 1, "proc_info_get_initial_instmap": 1, "InstMap": 6, "proc_info_get_liveness_info": 1, "Liveness": 4, "CodeModel": 8, "proc_info_interface_code_model": 2, "build_input_arg_list": 1, "ArgList": 2, "proc_info_get_varset": 1, "VarSet": 15, "proc_info_get_vartypes": 2, "VarTypes": 22, "proc_info_get_stack_slots": 1, "StackSlots": 5, "ExprnOpts": 4, "init_exprn_opts": 3, "globals.lookup_bool_option": 18, "use_float_registers": 5, "UseFloatRegs": 6, "yes": 144, "FloatRegType": 3, "reg_f": 1, ";": 922, "no": 365, "reg_r": 2, "globals.get_trace_level": 1, "TraceLevel": 5, "eff_trace_level_is_none": 2, "trace_fail_vars": 1, "FailVars": 3, "MaybeFailVars": 3, "set_of_var.union": 3, "EffLiveness": 3, "init_var_locn_state": 1, "VarLocnInfo": 12, "stack.init": 1, "ResumePoints": 14, "allow_hijacks": 3, "AllowHijack": 3, "Hijack": 6, "allowed": 6, "not_allowed": 5, "DummyFailInfo": 2, "resume_point_unknown": 9, "may_be_different": 7, "not_inside_non_condition": 2, "map.init": 7, "TempContentMap": 4, "set.init": 7, "PersistentTemps": 4, "TempsInUse": 8, "Zombies": 2, "set_of_var.init": 1, "LayoutMap": 2, "max_var_slot": 1, "VarSlotMax": 2, "trace_reserved_slots": 1, "FixedSlots": 2, "_": 171, "int.max": 1, "SlotMax": 2, "opt_no_return_calls": 3, "OptNoReturnCalls": 2, "use_trail": 3, "UseTrail": 2, "disable_trail_ops": 3, "DisableTrailOps": 2, "EmitTrailOps": 3, "do_not_add_trail_ops": 1, "optimize_trail_usage": 3, "OptTrailOps": 2, "optimize_region_ops": 3, "OptRegionOps": 2, "region_analysis": 3, "UseRegions": 3, "EmitRegionOps": 3, "do_not_add_region_ops": 1, "auto_comments": 4, "AutoComments": 2, "optimize_constructor_last_call_null": 3, "LCMCNull": 2, "CodeInfo0": 2, "init_fail_info": 2, "will": 1, "override": 1, "this": 4, "dummy": 2, "value": 16, "nested": 1, "parallel": 3, "conjunction": 1, "depth": 1, "counter.init": 2, "[": 203, "]": 203, "set_tree234.init": 1, "cord.empty": 1, "init_maybe_trace_info": 3, "CodeInfo1": 2, "exprn_opts.": 1, "gcc_non_local_gotos": 3, "OptNLG": 3, "NLG": 3, "have_non_local_gotos": 1, "do_not_have_non_local_gotos": 1, "asm_labels": 3, "OptASM": 3, "ASM": 3, "have_asm_labels": 1, "do_not_have_asm_labels": 1, "static_ground_cells": 3, "OptSGCell": 3, "SGCell": 3, "have_static_ground_cells": 1, "do_not_have_static_ground_cells": 1, "unboxed_float": 3, "OptUBF": 3, "UBF": 3, "have_unboxed_floats": 1, "do_not_have_unboxed_floats": 1, "OptFloatRegs": 3, "do_not_use_float_registers": 1, "static_ground_floats": 3, "OptSGFloat": 3, "SGFloat": 3, "have_static_ground_floats": 1, "do_not_have_static_ground_floats": 1, "static_code_addresses": 3, "OptStaticCodeAddr": 3, "StaticCodeAddrs": 3, "have_static_code_addresses": 1, "do_not_have_static_code_addresses": 1, "trace_level": 4, "CI": 294, "proc_info_get_has_tail_call_events": 1, "HasTailCallEvents": 3, "tail_call_events": 1, "get_next_label": 5, "TailRecLabel": 2, "MaybeTailRecLabel": 3, "no_tail_call_events": 1, "trace_setup": 1, "TraceInfo": 2, "MaxRegR": 4, "MaxRegF": 4, "cip_max_reg_f_used.": 1, "TI": 4, "LV": 2, "IM": 2, "Zs": 2, "EI": 2, "FI": 2, "N": 6, "LC": 2, "SU": 2, "LI": 2, "PTE": 2, "TM": 2, "CM": 2, "PT": 2, "CLS": 2, "CG": 2, "MR": 4, "MF": 1, "MF.": 1, "SCI": 2, "ASI": 2, "UEV": 2, "ContainingGoalMap": 2, "unexpected": 21, "NewCode": 2, "Code0": 2, ".CI": 29, "Code": 36, "+": 127, "Code.": 1, "get_stack_slots": 2, "stack_slots": 1, "get_follow_var_map": 2, "abs_follow_vars_map": 1, "get_next_non_reserved": 2, "reg_type": 1, "set_follow_vars": 4, "pre_goal_update": 3, "hlds_goal_info": 22, "has_subgoals": 2, "post_goal_update": 3, "body_typeinfo_liveness": 4, "variable_type": 3, "prog_var": 58, "mer_type.": 1, "variable_is_of_dummy_type": 2, "is_dummy_type.": 1, "search_type_defn": 4, "mer_type": 21, "hlds_type_defn": 1, "semidet.": 10, "lookup_type_defn": 2, "hlds_type_defn.": 1, "lookup_cheaper_tag_test": 2, "maybe_cheaper_tag_test.": 1, "filter_region_vars": 2, "set_of_progvar.": 2, "get_proc_model": 2, "code_model.": 1, "get_headvars": 2, "get_arginfo": 2, "arg_info": 2, "get_pred_proc_arginfo": 3, "current_resume_point_vars": 2, "variable_name": 2, "make_proc_entry_label": 2, "code_addr.": 1, "label": 5, "succip_is_used": 2, "add_trace_layout_for_label": 2, "term.context": 3, "trace_port": 1, "forward_goal_path": 1, "user_event_info": 1, "layout_label_info": 2, "get_cur_proc_label": 4, "get_next_closure_seq_no": 2, "add_closure_layout": 2, "add_threadscope_string": 2, "get_threadscope_rev_string_table": 2, "add_scalar_static_cell": 2, "typed_rval": 1, "data_id": 3, "add_scalar_static_cell_natural_types": 2, "rval": 3, "add_vector_static_cell": 2, "llds_type": 1, "add_alloc_site_info": 2, "prog_context": 1, "alloc_site_id": 2, "add_resume_layout_for_label": 2, "var_locn_get_stack_slots": 1, "FollowVarMap": 2, "var_locn_get_follow_var_map": 1, "RegType": 2, "NextNonReserved": 2, "var_locn_get_next_non_reserved": 1, "VarLocnInfo0": 4, "var_locn_set_follow_vars": 1, "GoalInfo": 44, "HasSubGoals": 3, "goal_info_get_resume_point": 1, "no_resume_point": 1, "resume_point": 1, "goal_info_get_follow_vars": 1, "MaybeFollowVars": 3, "goal_info_get_pre_deaths": 1, "PreDeaths": 3, "rem_forward_live_vars": 3, "maybe_make_vars_forward_dead": 2, "goal_info_get_pre_births": 1, "PreBirths": 2, "add_forward_live_vars": 2, "does_not_have_subgoals": 2, "goal_info_get_post_deaths": 2, "PostDeaths": 5, "goal_info_get_post_births": 1, "PostBirths": 3, "make_vars_forward_live": 1, "InstMapDelta": 2, "goal_info_get_instmap_delta": 1, "InstMap0": 2, "instmap.apply_instmap_delta": 1, "TypeInfoLiveness": 2, "module_info_pred_info": 6, "body_should_use_typeinfo_liveness": 1, "Var": 13, "Type": 18, "lookup_var_type": 3, "IsDummy": 2, "VarType": 2, "check_dummy_type": 1, "TypeDefn": 6, "type_to_ctor_det": 1, "TypeCtor": 2, "module_info_get_type_table": 1, "TypeTable": 2, "search_type_ctor_defn": 1, "TypeDefnPrime": 2, "CheaperTagTest": 3, "get_type_defn_body": 1, "TypeBody": 2, "hlds_du_type": 1, "CheaperTagTestPrime": 2, "no_cheaper_tag_test": 1, "ForwardLiveVarsBeforeGoal": 6, "RegionVars": 2, "code_info.get_var_types": 1, "set_of_var.filter": 1, "is_region_var": 1, "HeadVars": 20, "module_info_pred_proc_info": 4, "proc_info_get_headvars": 2, "ArgInfo": 4, "proc_info_arg_info": 1, "ResumeVars": 4, "FailInfo": 19, "ResumePointStack": 2, "stack.det_top": 5, "ResumePointInfo": 2, "pick_first_resume_point": 1, "ResumeMap": 8, "map.keys": 3, "ResumeMapVarList": 2, "set_of_var.list_to_set": 3, "Name": 4, "Varset": 2, "varset.lookup_name": 2, "Immed0": 3, "CodeAddr": 2, "Immed": 3, "globals.lookup_int_option": 1, "procs_per_c_function": 3, "ProcsPerFunc": 2, "CurPredId": 2, "CurProcId": 2, "proc": 2, "make_entry_label": 1, "Label": 8, "C0": 4, "counter.allocate": 2, "C": 34, "internal_label": 3, "Context": 20, "Port": 2, "IsHidden": 2, "GoalPath": 2, "MaybeSolverEventInfo": 2, "Layout": 2, "Internals0": 8, "Exec": 5, "trace_port_layout_info": 1, "LabelNum": 8, "entry_label": 2, "map.search": 2, "Internal0": 4, "internal_layout_info": 6, "Exec0": 3, "Resume": 5, "Return": 6, "Internal": 8, "map.det_update": 4, "Internals": 6, "map.det_insert": 3, "LayoutInfo": 2, "Resume0": 3, "get_active_temps_data": 2, "assoc_list": 1, "Temps": 2, "map.select": 1, "TempsInUseContentMap": 2, "map.to_assoc_list": 3, "cis_proc_label.": 1, "SeqNo": 2, "ClosureLayout": 2, "ClosureLayouts": 2, "|": 38, "String": 2, "SlotNum": 2, "Size0": 3, "RevTable0": 2, "Size": 4, "RevTable": 3, "RevTable.": 1, "TableSize": 2, "cip_ts_string_table_size.": 1, "RvalsTypes": 2, "DataAddr": 6, "StaticCellInfo0": 6, "global_data.add_scalar_static_cell": 1, "Rvals": 2, "global_data.add_scalar_static_cell_natural_types": 1, "Types": 6, "Vector": 2, "global_data.add_vector_static_cell": 1, "AllocId": 2, "AllocSite": 3, "AllocSites0": 2, "set_tree234.insert": 1, "AllocSites": 2, "position_info.": 1, "branch_end_info.": 1, "branch_end": 4, "branch_end_info": 7, "remember_position": 3, "position_info": 14, "reset_to_position": 4, "reset_resume_known": 2, "generate_branch_end": 2, "abs_store_map": 3, "after_all_branches": 2, "save_hp_in_branch": 2, "pos_get_fail_info": 3, "fail_info.": 2, "LocDep": 6, "cild_fail_info.": 1, "CurCI": 2, "NextCI": 2, "Static": 2, "Persistent": 2, "NextCI0": 4, "TempsInUse0": 4, "set.union": 2, "BranchStart": 2, "BranchStartFailInfo": 2, "BSResumeKnown": 2, "CurFailInfo": 2, "CurFailStack": 2, "CurCurfMaxfr": 2, "CurCondEnv": 2, "CurHijack": 2, "NewFailInfo": 2, "StoreMap": 8, "MaybeEnd0": 3, "MaybeEnd": 6, "AbsVarLocs": 3, "assoc_list.values": 1, "AbsLocs": 2, "code_util.max_mentioned_abs_regs": 1, "instmap_is_reachable": 1, "VarLocs": 2, "assoc_list.map_values_only": 2, "abs_locn_to_lval": 2, "place_vars": 1, "remake_with_store_map": 4, "empty": 9, "EndCodeInfo1": 5, "EndCodeInfo0": 3, "FailInfo0": 13, "FailInfo1": 2, "ResumeKnown0": 5, "CurfrMaxfr0": 2, "CondEnv0": 3, "Hijack0": 2, "R": 2, "ResumeKnown1": 2, "CurfrMaxfr1": 2, "CondEnv1": 2, "Hijack1": 2, "resume_point_known": 15, "Redoip0": 3, "Redoip1": 2, "ResumeKnown": 21, "expect": 15, "unify": 21, "must_be_equal": 11, "CurfrMaxfr": 24, "EndCodeInfoA": 2, "TempsInUse1": 2, "EndCodeInfo": 2, "BranchEnd": 2, "BranchEndCodeInfo": 2, "BranchEndLocDep": 2, "VarLocns": 2, "VarLvals": 2, "reinit_var_locn_state": 1, "Slot": 2, "Pos0": 2, "Pos": 2, "CI0": 2, "CIStatic0": 2, "CILocDep0": 2, "CIPersistent0": 2, "LocDep0": 2, "CI1": 2, "save_hp": 1, "CI2": 2, "CIStatic": 2, "CIPersistent": 2, "resume_map.": 1, "resume_point_info.": 1, "disj_hijack_info.": 1, "prepare_for_disj_hijack": 2, "code_model": 3, "disj_hijack_info": 3, "undo_disj_hijack": 2, "ite_hijack_info.": 1, "prepare_for_ite_hijack": 2, "embedded_stack_frame_id": 3, "ite_hijack_info": 3, "ite_enter_then": 2, "simple_neg_info.": 1, "enter_simple_neg": 2, "simple_neg_info": 3, "leave_simple_neg": 2, "det_commit_info.": 1, "prepare_for_det_commit": 2, "det_commit_info": 6, "generate_det_commit": 2, "semi_commit_info.": 1, "prepare_for_semi_commit": 2, "semi_commit_info": 6, "generate_semi_commit": 2, "effect_resume_point": 2, "pop_resume_point": 1, "top_resume_point": 1, "set_resume_point_to_unknown": 1, "set_resume_point_and_frame_to_unknown": 1, "generate_failure": 2, "fail_if_rval_is_false": 1, "failure_is_direct_branch": 1, "code_addr": 8, "may_use_nondet_tailcall": 1, "nondet_tail_call": 1, "produce_vars": 1, "resume_map": 9, "flush_resume_vars_to_stack": 1, "make_resume_point": 1, "resume_locs": 1, "generate_resume_point": 2, "resume_point_vars": 1, "resume_point_stack_addr": 2, "stack": 1, "curfr_vs_maxfr": 2, "condition_env": 3, "hijack_allowed": 2, "orig_only": 2, "stack_only": 2, "orig_and_stack": 1, "stack_and_orig": 1, "redoip_update": 2, "has_been_done": 5, "wont_be_done.": 1, "resume_point_unknown.": 1, "may_be_different.": 1, "inside_non_condition": 6, "not_inside_non_condition.": 1, "not_allowed.": 1, "disj_no_hijack": 4, "disj_temp_frame": 4, "disj_quarter_hijack": 4, "disj_half_hijack": 3, "disj_full_hijack": 3, "HijackInfo": 29, "CondEnv": 12, "Allow": 12, "model_det": 2, "model_semi": 3, "singleton": 28, "llds_instr": 64, "comment": 5, "model_non": 2, "create_temp_frame": 4, "do_fail": 6, "stack.pop": 1, "TopResumePoint": 6, "RestResumePoints": 2, "stack.is_empty": 1, "wont_be_done": 2, "acquire_temp_slot": 15, "slot_lval": 14, "redoip_slot": 30, "curfr": 18, "non_persistent_temp_slot": 15, "RedoipSlot": 33, "assign": 46, "maxfr": 42, "redofr_slot": 14, "RedofrSlot": 17, "from_list": 13, "prevfr_slot": 3, "pick_stack_resume_point": 3, "StackLabel": 9, "LabelConst": 4, "const": 10, "llconst_code_addr": 6, "true": 3, "ite_region_info": 5, "ite_info": 3, "ite_hijack_type": 2, "ite_no_hijack": 3, "ite_temp_frame": 3, "ite_quarter_hijack": 3, "ite_half_hijack": 3, "ite_full_hijack": 3, "CondCodeModel": 4, "MaybeEmbeddedFrameId": 5, "HijackType": 12, "MaybeRegionInfo": 12, "MaxfrSlot": 30, "TempFrameCode": 4, "MaxfrCode": 7, "EmbeddedFrameId": 2, "slot_success_record": 1, "persistent_temp_slot": 1, "SuccessRecordSlot": 6, "InitSuccessCode": 3, "llconst_false": 1, "ITEResumePoint": 2, "ThenCode": 10, "ElseCode": 7, "ResumePoints0": 5, "stack.det_pop": 1, "HijackResumeKnown": 2, "OldCondEnv": 2, "RegionInfo": 2, "EmbeddedStackFrameId": 2, "ITEStackResumeCodeAddr": 2, "llconst_true": 1, "AfterRegionOp": 3, "if_val": 1, "unop": 1, "logical_not": 1, "code_label": 2, "use_and_maybe_pop_region_frame": 1, "region_ite_nondet_cond_fail": 1, "goto": 2, "maybe_pick_stack_resume_point": 1, "ResumeMap0": 2, "make_fake_resume_map": 5, "do_redo": 1, "is_empty": 1, "Vars": 10, "Locns": 2, "set.make_singleton_set": 1, "reg": 1, "pair": 7, "region_commit_stack_frame": 5, "AddTrailOps": 4, "AddRegionOps": 5, "CommitGoalInfo": 4, "DetCommitInfo": 4, "SaveMaxfrCode": 3, "save_maxfr": 3, "MaybeMaxfrSlot": 6, "maybe_save_trail_info": 2, "MaybeTrailSlots": 8, "SaveTrailCode": 4, "maybe_save_region_commit_frame": 4, "MaybeRegionCommitFrameInfo": 8, "SaveRegionCommitFrameCode": 2, "SaveRegionCommitFrameCode.": 2, "RestoreMaxfrCode": 3, "restore_maxfr": 3, "release_temp_slot": 1, "maybe_restore_trail_info": 2, "CommitTrailCode": 4, "maybe_restore_region_commit_frame": 2, "SuccessRegionCode": 3, "_FailureRegionCode": 1, "SuccessRegionCode.": 1, "commit_hijack_info": 2, "commit_temp_frame": 3, "commit_quarter_hijack": 3, "commit_half_hijack": 3, "commit_full_hijack": 3, "SemiCommitInfo": 4, "clone_resume_point": 1, "NewResumePoint": 4, "stack.push": 1, "StackLabelConst": 7, "use_minimal_model_stack_copy_cut": 3, "UseMinimalModelStackCopyCut": 4, "Components": 4, "foreign_proc_raw_code": 4, "cannot_branch_away": 4, "proc_affects_liveness": 2, "live_lvals_info": 4, "proc_does_not_affect_liveness": 2, "MD": 4, "proc_may_duplicate": 2, "MarkCode": 3, "foreign_proc_code": 2, "proc_will_not_call_mercury": 2, "HijackCode": 5, "UseMinimalModel": 3, "CutCode": 4, "SuccessUndoCode": 5, "FailureUndoCode": 5, "AfterCommit": 2, "ResumePointCode": 2, "FailCode": 2, "RestoreTrailCode": 2, "FailureRegionCode": 2, "SuccLabel": 3, "GotoSuccLabel": 2, "SuccLabelCode": 1, "SuccessCode": 2, "FailureCode": 2, "SuccLabelCode.": 1, "_ForwardLiveVarsBeforeGoal": 1, "expr.": 1, "char": 10, "token": 5, "num": 11, "eof": 6, "parse": 1, "exprn/1": 1, "xx": 1, "scan": 16, "mode": 9, "rule": 3, "exprn": 7, "Num": 18, "A": 14, "term": 10, "B": 8, "{": 27, "}": 28, "*": 20, "factor": 6, "/": 1, "//": 2, "Chars": 2, "Toks": 13, "Toks0": 11, "list__reverse": 1, "Cs": 9, "char__is_whitespace": 1, "char__is_digit": 2, "takewhile": 1, "Digits": 2, "Rest": 2, "string__from_char_list": 1, "NumStr": 2, "string__det_to_int": 1, "error": 7, "hello.": 1, "main": 15, "io": 6, "di": 54, "uo": 58, "IO": 4, "io.write_string": 1, "char.": 1, "getopt_io.": 1, "short_option": 36, "option": 9, "long_option": 241, "option_defaults": 2, "option_data": 2, "nondet.": 1, "special_handler": 1, "special_data": 1, "option_table": 5, "maybe_option_table": 3, "inconsequential_options": 1, "options_help": 1, "option_table_add_mercury_library_directory": 1, "option_table.": 2, "option_table_add_search_library_files_directory": 1, "quote_arg": 1, "inhibit_warnings": 4, "inhibit_accumulator_warnings": 3, "halt_at_warn": 3, "halt_at_syntax_errors": 3, "halt_at_auto_parallel_failure": 3, "warn_singleton_vars": 3, "warn_overlapping_scopes": 3, "warn_det_decls_too_lax": 3, "warn_inferred_erroneous": 3, "warn_nothing_exported": 3, "warn_unused_args": 3, "warn_interface_imports": 3, "warn_missing_opt_files": 3, "warn_missing_trans_opt_files": 3, "warn_missing_trans_opt_deps": 3, "warn_non_contiguous_clauses": 3, "warn_non_contiguous_foreign_procs": 3, "warn_non_stratification": 3, "warn_unification_cannot_succeed": 3, "warn_simple_code": 3, "warn_duplicate_calls": 3, "warn_missing_module_name": 3, "warn_wrong_module_name": 3, "warn_smart_recompilation": 3, "warn_undefined_options_variables": 3, "warn_non_tail_recursion": 3, "warn_target_code": 3, "warn_up_to_date": 3, "warn_stubs": 3, "warn_dead_procs": 3, "warn_table_with_inline": 3, "warn_non_term_special_preds": 3, "warn_known_bad_format_calls": 3, "warn_unknown_format_calls": 3, "warn_obsolete": 3, "warn_insts_without_matching_type": 3, "warn_unused_imports": 3, "inform_ite_instead_of_switch": 3, "warn_unresolved_polymorphism": 3, "warn_suspicious_foreign_procs": 3, "warn_state_var_shadowing": 3, "inform_inferred": 3, "inform_inferred_types": 3, "inform_inferred_modes": 3, "verbose": 4, "very_verbose": 4, "verbose_errors": 4, "verbose_recompilation": 3, "find_all_recompilation_reasons": 3, "verbose_make": 3, "verbose_commands": 3, "output_compile_error_lines": 3, "report_cmd_line_args": 3, "report_cmd_line_args_in_doterr": 3, "statistics": 4, "detailed_statistics": 3, "proc_size_statistics": 3, "debug_types": 4, "debug_modes": 4, "debug_modes_statistics": 3, "debug_modes_minimal": 3, "debug_modes_verbose": 3, "debug_modes_pred_id": 3, "debug_dep_par_conj": 3, "debug_det": 4, "debug_code_gen_pred_id": 3, "debug_opt": 3, "debug_term": 4, "constraint": 2, "termination": 3, "analysis": 1, "debug_opt_pred_id": 3, "debug_opt_pred_name": 3, "debug_pd": 3, "pd": 1, "partial": 1, "deduction/deforestation": 1, "debug_il_asm": 3, "il_asm": 1, "IL": 2, "generation": 1, "via": 1, "asm": 1, "debug_liveness": 3, "debug_stack_opt": 3, "debug_make": 3, "debug_closure": 3, "debug_trail_usage": 3, "debug_mode_constraints": 3, "debug_intermodule_analysis": 3, "debug_mm_tabling_analysis": 3, "debug_indirect_reuse": 3, "debug_type_rep": 3, "make_short_interface": 4, "make_interface": 5, "make_private_interface": 4, "make_optimization_interface": 5, "make_transitive_opt_interface": 5, "make_analysis_registry": 3, "make_xml_documentation": 5, "generate_source_file_mapping": 4, "generate_dependency_file": 3, "generate_dependencies": 4, "generate_module_order": 3, "generate_standalone_interface": 3, "convert_to_mercury": 6, "typecheck_only": 4, "errorcheck_only": 4, "target_code_only": 10, "compile_only": 4, "compile_to_shared_lib": 3, "output_grade_string": 3, "output_link_command": 3, "output_shared_lib_link_command": 3, "output_libgrades": 3, "output_cc": 3, "output_c_compiler_type": 4, "output_csharp_compiler_type": 3, "output_cflags": 3, "output_library_link_flags": 3, "output_grade_defines": 3, "output_c_include_directory_flags": 4, "smart_recompilation": 3, "generate_item_version_numbers": 2, "generate_mmc_make_module_dependencies": 4, "assume_gmake": 3, "trace_optimized": 4, "trace_prof": 3, "trace_table_io": 3, "trace_table_io_only_retry": 3, "trace_table_io_states": 3, "trace_table_io_require": 3, "trace_table_io_all": 3, "trace_goal_flags": 3, "prof_optimized": 4, "exec_trace_tail_rec": 3, "suppress_trace": 3, "force_disable_tracing": 3, "delay_death": 3, "delay_death_max_vars": 3, "stack_trace_higher_order": 3, "force_disable_ssdebug": 3, "generate_bytecode": 3, "line_numbers": 4, "frameopt_comments": 3, "max_error_line_width": 3, "show_dependency_graph": 3, "imports_graph": 3, "dump_trace_counts": 3, "dump_hlds": 5, "dump_hlds_pred_id": 3, "dump_hlds_pred_name": 3, "dump_hlds_alias": 4, "dump_hlds_options": 3, "dump_hlds_inst_limit": 3, "dump_hlds_file_suffix": 3, "dump_same_hlds": 3, "dump_mlds": 4, "verbose_dump_mlds": 4, "mode_constraints": 3, "simple_mode_constraints": 3, "prop_mode_constraints": 4, "benchmark_modes": 3, "benchmark_modes_repeat": 3, "sign_assembly": 3, "separate_assemblies": 3, "reorder_conj": 3, "reorder_disj": 3, "fully_strict": 3, "strict_sequential": 3, "allow_stubs": 3, "infer_types": 3, "infer_modes": 3, "infer_det": 4, "infer_all": 3, "type_inference_iteration_limit": 3, "mode_inference_iteration_limit": 3, "event_set_file_name": 3, "grade": 4, "target": 14, "il": 5, "il_only": 4, "compile_to_c": 4, "c": 4, "java": 35, "java_only": 4, "csharp": 6, "csharp_only": 4, "x86_64": 6, "x86_64_only": 4, "erlang": 6, "erlang_only": 4, "exec_trace": 3, "decl_debug": 3, "profiling": 5, "profile_time": 5, "profile_calls": 6, "time_profiling": 3, "memory_profiling": 3, "profile_mem": 1, "deep_profiling": 3, "profile_deep": 4, "profile_memory": 3, "use_activation_counts": 3, "pre_prof_transforms_simplify": 3, "pre_implicit_parallelism_simplify": 3, "coverage_profiling": 3, "coverage_profiling_via_calls": 3, "coverage_profiling_static": 3, "profile_deep_coverage_after_goal": 3, "profile_deep_coverage_branch_ite": 3, "profile_deep_coverage_branch_switch": 3, "profile_deep_coverage_branch_disj": 3, "profile_deep_coverage_use_portcounts": 3, "profile_deep_coverage_use_trivial": 2, "profile_for_feedback": 2, "use_zeroing_for_ho_cycles": 2, "use_lots_of_ho_specialization": 2, "deep_profile_tail_recursion": 2, "record_term_sizes_as_words": 2, "record_term_sizes_as_cells": 2, "experimental_complexity": 2, "gc": 2, "threadscope": 2, "trail_segments": 2, "use_minimal_model_stack_copy": 2, "use_minimal_model_own_stacks": 2, "minimal_model_debug": 2, "single_prec_float": 2, "type_layout": 2, "maybe_thread_safe_opt": 2, "extend_stacks_when_needed": 2, "stack_segments": 2, "use_regions": 2, "use_alloc_regions": 2, "use_regions_debug": 2, "use_regions_profiling": 2, "source_to_source_debug": 5, "ssdb_trace_level": 3, "link_ssdb_libs": 4, "tags": 2, "num_tag_bits": 2, "num_reserved_addresses": 2, "num_reserved_objects": 2, "bits_per_word": 2, "bytes_per_word": 2, "conf_low_tag_bits": 2, "unboxed_enums": 2, "unboxed_no_tag_types": 2, "sync_term_size": 2, "words": 1, "gcc_global_registers": 2, "pic_reg": 2, "highlevel_code": 3, "highlevel_data": 2, "gcc_nested_functions": 2, "det_copy_out": 2, "nondet_copy_out": 2, "put_commit_in_own_func": 2, "put_nondet_env_on_heap": 2, "verifiable_code": 2, "il_refany_fields": 2, "il_funcptr_types": 2, "il_byref_tailcalls": 2, "backend_foreign_languages": 2, "stack_trace": 2, "basic_stack_layout": 2, "agc_stack_layout": 2, "procid_stack_layout": 2, "trace_stack_layout": 2, "can_compare_constants_as_ints": 2, "pretest_equality_cast_pointers": 2, "can_compare_compound_values": 2, "lexically_order_constructors": 2, "mutable_always_boxed": 2, "delay_partial_instantiations": 2, "allow_defn_of_builtins": 2, "special_preds": 2, "type_ctor_info": 2, "type_ctor_layout": 2, "type_ctor_functors": 2, "new_type_class_rtti": 2, "rtti_line_numbers": 2, "disable_minimal_model_stack_copy_pneg": 2, "disable_minimal_model_stack_copy_cut": 2, "use_minimal_model_stack_copy_pneg": 2, "size_region_ite_fixed": 2, "size_region_disj_fixed": 2, "size_region_semi_disj_fixed": 1, "size_region_commit_fixed": 2, "size_region_ite_protect": 2, "size_region_ite_snapshot": 2, "size_region_semi_disj_protect": 2, "size_region_disj_snapshot": 2, "size_region_commit_entry": 2, "solver_type_auto_init": 2, "allow_multi_arm_switches": 2, "type_check_constraints": 2, "allow_argument_packing": 2, "low_level_debug": 2, "table_debug": 2, "trad_passes": 2, "parallel_liveness": 2, "parallel_code_gen": 2, "polymorphism": 2, "reclaim_heap_on_failure": 2, "reclaim_heap_on_semidet_failure": 2, "reclaim_heap_on_nondet_failure": 2, "have_delay_slot": 2, "num_real_r_regs": 2, "num_real_f_regs": 2, "num_real_r_temps": 2, "num_real_f_temps": 2, "max_jump_table_size": 2, "max_specialized_do_call_closure": 2, "max_specialized_do_call_class_method": 2, "compare_specialization": 2, "should_pretest_equality": 2, "fact_table_max_array_size": 2, "fact_table_hash_percent_full": 2, "gcc_local_labels": 2, "prefer_switch": 2, "opt_level": 3, "opt_level_number": 2, "opt_space": 2, "Default": 3, "to": 16, "optimize": 3, "time.": 1, "intermodule_optimization": 2, "read_opt_files_transitively": 2, "use_opt_files": 2, "use_trans_opt_files": 2, "transitive_optimization": 2, "intermodule_analysis": 2, "analysis_repeat": 2, "analysis_file_cache": 2, "allow_inlining": 2, "inlining": 2, "inline_simple": 2, "inline_builtins": 2, "inline_single_use": 2, "inline_call_cost": 2, "inline_compound_threshold": 2, "inline_simple_threshold": 2, "inline_vars_threshold": 2, "intermod_inline_simple_threshold": 2, "from_ground_term_threshold": 2, "enable_const_struct": 2, "common_struct": 2, "common_struct_preds": 2, "common_goal": 2, "constraint_propagation": 2, "local_constraint_propagation": 2, "optimize_unused_args": 2, "intermod_unused_args": 2, "optimize_higher_order": 2, "higher_order_size_limit": 2, "higher_order_arg_limit": 2, "unneeded_code": 2, "unneeded_code_copy_limit": 2, "unneeded_code_debug": 2, "unneeded_code_debug_pred_name": 2, "type_specialization": 2, "user_guided_type_specialization": 2, "introduce_accumulators": 2, "optimize_constructor_last_call_accumulator": 2, "optimize_constructor_last_call": 2, "optimize_duplicate_calls": 2, "constant_propagation": 2, "excess_assign": 2, "optimize_format_calls": 2, "optimize_saved_vars_const": 2, "optimize_saved_vars_cell": 2, "optimize_saved_vars_cell_loop": 2, "optimize_saved_vars_cell_full_path": 2, "optimize_saved_vars_cell_on_stack": 2, "optimize_saved_vars_cell_candidate_headvars": 2, "optimize_saved_vars_cell_cv_store_cost": 2, "optimize_saved_vars_cell_cv_load_cost": 2, "optimize_saved_vars_cell_fv_store_cost": 2, "optimize_saved_vars_cell_fv_load_cost": 2, "optimize_saved_vars_cell_op_ratio": 2, "optimize_saved_vars_cell_node_ratio": 2, "optimize_saved_vars_cell_all_path_node_ratio": 2, "optimize_saved_vars_cell_include_all_candidates": 2, "optimize_saved_vars": 2, "loop_invariants": 2, "delay_construct": 2, "follow_code": 2, "optimize_dead_procs": 2, "deforestation": 2, "deforestation_depth_limit": 2, "deforestation_cost_factor": 2, "deforestation_vars_threshold": 2, "deforestation_size_threshold": 2, "analyse_trail_usage": 2, "analyse_mm_tabling": 2, "untuple": 2, "tuple": 2, "tuple_trace_counts_file": 2, "tuple_costs_ratio": 2, "tuple_min_args": 2, "inline_par_builtins": 2, "always_specialize_in_dep_par_conjs": 2, "allow_some_paths_only_waits": 2, "structure_sharing_analysis": 2, "structure_sharing_widening": 2, "structure_reuse_analysis": 2, "structure_reuse_constraint": 2, "structure_reuse_constraint_arg": 2, "structure_reuse_max_conditions": 2, "structure_reuse_repeat": 2, "structure_reuse_free_cells": 2, "termination_check": 2, "verbose_check_termination": 2, "termination_single_args": 2, "termination_norm": 2, "termination_error_limit": 2, "termination_path_limit": 2, "termination2": 2, "check_termination2": 2, "verbose_check_termination2": 2, "termination2_norm": 2, "widening_limit": 2, "arg_size_analysis_only": 2, "propagate_failure_constrs": 2, "term2_maximum_matrix_size": 2, "analyse_exceptions": 2, "analyse_closures": 2, "smart_indexing": 2, "dense_switch_req_density": 2, "lookup_switch_req_density": 2, "dense_switch_size": 2, "lookup_switch_size": 2, "string_hash_switch_size": 2, "string_binary_switch_size": 2, "tag_switch_size": 2, "try_switch_size": 2, "binary_switch_size": 2, "switch_single_rec_base_first": 2, "switch_multi_rec_base_first": 2, "use_atomic_cells": 2, "middle_rec": 2, "simple_neg": 2, "optimize_tailcalls": 2, "optimize_initializations": 2, "eliminate_local_vars": 2, "generate_trail_ops_inline": 2, "common_data": 2, "common_layout_data": 2, "Also": 1, "used": 2, "for": 8, "MLDS": 2, "optimizations.": 1, "optimize_peep": 2, "optimize_peep_mkword": 2, "optimize_jumps": 2, "optimize_fulljumps": 2, "pessimize_tailcalls": 2, "checked_nondet_tailcalls": 2, "use_local_vars": 2, "local_var_access_threshold": 2, "standardize_labels": 2, "optimize_labels": 2, "optimize_dups": 2, "optimize_proc_dups": 2, "optimize_frames": 2, "optimize_delay_slot": 2, "optimize_reassign": 2, "optimize_repeat": 2, "layout_compression_limit": 2, "use_macro_for_redo_fail": 2, "emit_c_loops": 2, "everything_in_one_c_function": 2, "local_thread_engine_base": 2, "erlang_switch_on_strings_as_atoms": 2, "target_debug": 2, "cc": 2, "cflags": 2, "quoted_cflag": 2, "c_include_directory": 2, "c_optimize": 2, "ansi_c": 2, "inline_alloc": 2, "gcc_flags": 2, "quoted_gcc_flag": 2, "clang_flags": 2, "quoted_clang_flag": 2, "msvc_flags": 2, "quoted_msvc_flag": 2, "cflags_for_warnings": 2, "cflags_for_optimization": 2, "cflags_for_ansi": 2, "cflags_for_regs": 2, "cflags_for_gotos": 2, "cflags_for_threads": 2, "cflags_for_debug": 2, "cflags_for_pic": 2, "c_flag_to_name_object_file": 2, "object_file_extension": 2, "pic_object_file_extension": 2, "link_with_pic_object_file_extension": 2, "c_compiler_type": 2, "csharp_compiler_type": 2, "java_compiler": 2, "java_interpreter": 2, "java_flags": 2, "quoted_java_flag": 2, "java_classpath": 2, "java_object_file_extension": 2, "il_assembler": 2, "ilasm_flags": 2, "quoted_ilasm_flag": 2, "dotnet_library_version": 2, "support_ms_clr": 2, "support_rotor_clr": 2, "csharp_compiler": 2, "csharp_flags": 2, "quoted_csharp_flag": 2, "cli_interpreter": 2, "erlang_compiler": 2, "erlang_interpreter": 2, "erlang_flags": 2, "quoted_erlang_flag": 2, "erlang_include_directory": 2, "erlang_object_file_extension": 2, "erlang_native_code": 2, "erlang_inhibit_trivial_warnings": 2, "output_file_name": 3, "ld_flags": 2, "quoted_ld_flag": 2, "ld_libflags": 2, "quoted_ld_libflag": 2, "link_library_directories": 3, "runtime_link_library_directories": 3, "link_libraries": 3, "link_objects": 2, "mercury_library_directories": 2, "mercury_library_directory_special": 2, "search_library_files_directories": 2, "search_library_files_directory_special": 2, "mercury_libraries": 2, "mercury_library_special": 2, "mercury_standard_library_directory": 2, "mercury_standard_library_directory_special": 2, "init_file_directories": 2, "init_files": 2, "trace_init_files": 2, "linkage": 2, "linkage_special": 2, "mercury_linkage": 2, "mercury_linkage_special": 2, "strip": 2, "demangle": 2, "allow_undefined": 2, "use_readline": 2, "runtime_flags": 2, "extra_initialization_functions": 2, "frameworks": 2, "framework_directories": 3, "shared_library_extension": 2, "library_extension": 2, "executable_file_extension": 2, "link_executable_command": 2, "link_shared_lib_command": 2, "create_archive_command": 2, "create_archive_command_output_flag": 2, "create_archive_command_flags": 2, "ranlib_command": 2, "ranlib_flags": 2, "mkinit_command": 2, "mkinit_erl_command": 2, "demangle_command": 2, "filtercc_command": 2, "trace_libs": 2, "thread_libs": 2, "hwloc_libs": 2, "hwloc_static_libs": 2, "shared_libs": 2, "math_lib": 2, "readline_libs": 2, "linker_opt_separator": 2, "linker_thread_flags": 2, "shlib_linker_thread_flags": 2, "linker_static_flags": 2, "linker_strip_flag": 2, "linker_link_lib_flag": 2, "linker_link_lib_suffix": 2, "shlib_linker_link_lib_flag": 2, "shlib_linker_link_lib_suffix": 2, "linker_debug_flags": 2, "shlib_linker_debug_flags": 2, "linker_trace_flags": 2, "shlib_linker_trace_flags": 2, "linker_path_flag": 2, "linker_rpath_flag": 2, "linker_rpath_separator": 2, "shlib_linker_rpath_flag": 2, "shlib_linker_rpath_separator": 2, "linker_allow_undefined_flag": 2, "linker_error_undefined_flag": 2, "shlib_linker_use_install_name": 2, "shlib_linker_install_name_flag": 2, "shlib_linker_install_name_path": 2, "java_archive_command": 2, "make": 3, "keep_going": 3, "rebuild": 3, "jobs": 3, "track_flags": 2, "invoked_by_mmc_make": 2, "extra_init_command": 2, "pre_link_command": 2, "install_prefix": 2, "use_symlinks": 2, "mercury_configuration_directory": 2, "mercury_configuration_directory_special": 2, "install_command": 2, "install_command_dir_option": 2, "libgrades": 2, "libgrades_include_components": 2, "libgrades_exclude_components": 2, "lib_linkages": 2, "flags_file": 2, "options_files": 2, "config_file": 2, "options_search_directories": 2, "use_subdirs": 2, "use_grade_subdirs": 2, "search_directories": 3, "intermod_directories": 2, "use_search_directories_for_intermod": 2, "libgrade_install_check": 2, "order_make_by_timestamp": 2, "show_make_times": 2, "extra_library_header": 2, "restricted_command_line": 2, "env_type": 2, "host_env_type": 2, "target_env_type": 2, "filenames_from_stdin": 2, "typecheck_ambiguity_warn_limit": 2, "typecheck_ambiguity_error_limit": 2, "help": 4, "version": 3, "fullarch": 2, "cross_compiling": 2, "local_module_id": 2, "analysis_file_cache_dir": 2, "compiler_sufficiently_recent": 2, "experiment": 2, "ignore_par_conjunctions": 2, "control_granularity": 2, "distance_granularity": 2, "implicit_parallelism": 2, "feedback_file": 2, "par_loop_control": 2, "par_loop_control_preserve_tail_recursion.": 1, "libs.handle_options.": 1, "dir.": 1, "option_category": 2, "warning_option": 2, "verbosity_option": 2, "output_option": 2, "aux_output_option": 2, "language_semantics_option": 2, "compilation_model_option": 2, "internal_use_option": 2, "code_gen_option": 2, "special_optimization_option": 2, "optimization_option": 2, "target_code_compilation_option": 2, "link_option": 2, "build_system_option": 2, "miscellaneous_option.": 1, "Option": 2, "option_defaults_2": 18, "_Category": 1, "OptionsList": 2, "list.member": 2, "multi.": 2, "bool_special": 7, "XXX": 3, "should": 1, "be": 1, "accumulating": 49, "maybe_string": 6, "special": 17, "string_special": 18, "int_special": 1, "maybe_string_special": 1, "file_special": 1, "miscellaneous_option": 1, "par_loop_control_preserve_tail_recursion": 1, "check_hlds.polymorphism.": 1, "hlds.": 1, "mdbcomp.": 1, "parse_tree.": 1, "polymorphism_process_module": 2, "polymorphism_process_generated_pred": 2, "unification_typeinfos_rtti_varmaps": 2, "rtti_varmaps": 9, "unification": 8, "polymorphism_process_new_call": 2, "builtin_state": 1, "call_unify_context": 2, "sym_name": 3, "hlds_goal": 45, "poly_info": 45, "polymorphism_make_type_info_vars": 1, "polymorphism_make_type_info_var": 1, "int_or_var": 2, "iov_int": 1, "iov_var": 1, "gen_extract_type_info": 1, "tvar": 10, "kind": 1, "vartypes": 12, "poly_info.": 1, "create_poly_info": 1, "poly_info_extract": 1, "build_typeclass_info_type": 3, "prog_constraint": 4, "type_is_typeclass_info": 1, "type_is_type_info_or_ctor_type": 1, "build_type_info_type": 1, "get_special_proc": 1, "special_pred_id": 2, "get_special_proc_det": 1, "convert_pred_to_lambda_goal": 3, "purity": 1, "lambda_eval_method": 1, "unify_context": 3, "context": 1, "unify_rhs": 4, "fix_undetermined_mode_lambda_goal": 2, "rhs_lambda_goal": 7, "init_type_info_var": 1, "init_const_type_ctor_info_var": 1, "type_ctor": 1, "cons_id": 2, "type_info_kind": 2, "type_info": 8, "type_ctor_info.": 1, "new_type_info_var_raw": 1, "check_hlds.clause_to_proc.": 1, "check_hlds.mode_util.": 1, "hlds.from_ground_term_util.": 1, "hlds.const_struct.": 1, "hlds.goal_util.": 1, "hlds.hlds_args.": 1, "hlds.hlds_clauses.": 1, "hlds.hlds_code_util.": 1, "hlds.passes_aux.": 1, "hlds.pred_table.": 1, "hlds.quantification.": 1, "hlds.special_pred.": 1, "libs.": 1, "mdbcomp.program_representation.": 1, "parse_tree.prog_mode.": 1, "parse_tree.prog_type_subst.": 1, "solutions.": 1, "module_info_get_preds": 3, ".ModuleInfo": 8, "Preds0": 2, "PredIds0": 2, "list.foldl": 6, "maybe_polymorphism_process_pred": 3, "Preds1": 2, "PredIds1": 2, "fixup_pred_polymorphism": 4, "expand_class_method_bodies": 1, "PredModule": 8, "pred_info_module": 4, "PredName": 8, "pred_info_name": 4, "PredArity": 6, "pred_info_orig_arity": 3, "no_type_info_builtin": 3, "copy_module_clauses_to_procs": 1, "polymorphism_process_pred_msg": 3, "PredTable0": 3, "map.lookup": 2, "PredInfo0": 16, "pred_info_get_clauses_info": 2, "ClausesInfo0": 5, "clauses_info_get_vartypes": 2, "VarTypes0": 12, "clauses_info_get_headvars": 2, "pred_info_get_arg_types": 7, "TypeVarSet": 15, "ExistQVars": 13, "ArgTypes0": 3, "proc_arg_vector_partition_poly_args": 1, "ExtraHeadVarList": 2, "OldHeadVarList": 2, "lookup_var_types": 6, "ExtraArgTypes": 2, "ArgTypes": 6, "pred_info_set_arg_types": 1, "PredInfo1": 5, "OldHeadVarTypes": 2, "type_list_subsumes": 2, "Subn": 3, "map.is_empty": 1, "pred_info_set_existq_tvar_binding": 1, "PredInfo2": 7, "polymorphism_introduce_exists_casts_pred": 3, "PredTable": 2, "module_info_set_preds": 1, "pred_info_get_procedures": 2, ".PredInfo": 2, "Procs0": 4, "map.map_values_only": 1, ".ProcInfo": 2, "det": 21, "introduce_exists_casts_proc": 1, "Procs": 4, "pred_info_set_procedures": 2, "trace": 4, "compiletime": 4, "flag": 4, "write_pred_progress_message": 1, "polymorphism_process_pred": 4, "mutable": 3, "selected_pred": 1, "ground": 9, "untrailed": 2, "level": 1, "promise_pure": 30, "pred_id_to_int": 1, "impure": 2, "set_selected_pred": 2, "polymorphism_process_clause_info": 3, "ClausesInfo": 13, "Info": 134, "ExtraArgModes": 20, "poly_info_get_module_info": 4, "poly_info_get_const_struct_db": 1, "ConstStructDb": 2, "module_info_set_const_struct_db": 1, "poly_info_get_typevarset": 4, "pred_info_set_typevarset": 1, "pred_info_set_clauses_info": 1, "ProcIds": 5, "pred_info_procids": 2, "polymorphism_process_proc_in_table": 3, "module_info_set_pred_info": 1, "clauses_info": 6, "poly_arg_vector": 9, "mer_mode": 14, "ModuleInfo0": 8, "init_poly_info": 1, ".ClausesInfo": 2, "_VarSet": 1, "ExplicitVarTypes": 2, "_TVarNameMap": 1, "_VarTypes": 1, "HeadVars0": 5, "ClausesRep0": 2, "ItemNumbers": 2, "_RttiVarMaps": 1, "HaveForeignClauses": 2, "setup_headvars": 3, "UnconstrainedTVars": 15, "ExtraTypeInfoHeadVars": 4, "ExistTypeClassInfoHeadVars": 6, "get_clause_list": 1, "Clauses0": 2, "list.map_foldl": 2, "polymorphism_process_clause": 3, "Clauses": 2, "poly_info_get_varset": 4, ".Info": 25, "poly_info_get_var_types": 6, "poly_info_get_rtti_varmaps": 4, "RttiVarMaps": 16, "set_clause_list": 1, "ClausesRep": 2, "TVarNameMap": 2, "This": 2, "only": 4, "while": 1, "adding": 1, "the": 27, "clauses.": 1, "proc_arg_vector": 9, "clause": 2, "OldHeadVars": 2, "NewHeadVars": 2, "Clause": 2, "pred_info_is_imported": 2, "Goal0": 21, ".Clause": 1, "clause_body": 2, "empty_cache_maps": 4, "poly_info_set_num_reuses": 1, "polymorphism_process_goal": 20, "Goal1": 2, "produce_existq_tvars": 3, "Goal2": 2, "pred_info_get_exist_quant_tvars": 1, "fixup_quantification": 1, "Goal": 40, "proc_table": 2, "ProcTable": 2, ".ProcTable": 1, "ProcInfo0": 2, "polymorphism_process_proc": 3, "pred_info_is_pseudo_imported": 1, "hlds_pred.in_in_unification_proc_id": 1, "HeadVarList": 4, "proc_arg_vector_to_list": 2, "clauses_info_get_rtti_varmaps": 1, "clauses_info_get_varset": 1, "proc_info_set_headvars": 1, "proc_info_set_rtti_varmaps": 1, "proc_info_set_varset": 1, "proc_info_set_vartypes": 1, "copy_clauses_to_proc": 1, "proc_info_get_argmodes": 2, "ArgModes1": 2, "ExtraArgModesList": 2, "poly_arg_vector_to_list": 1, "ArgModes": 5, "proc_info_set_argmodes": 1, "ExtraHeadTypeInfoVars": 7, "ExistHeadTypeClassInfoVars": 9, "pred_info_get_origin": 1, "Origin": 8, "ExtraArgModes0": 3, "poly_arg_vector_init": 1, "origin_instance_method": 1, "InstanceMethodConstraints": 4, "setup_headvars_instance_method": 3, "origin_special_pred": 1, "origin_transformed": 1, "origin_created": 1, "origin_assertion": 1, "origin_lambda": 1, "origin_user": 1, "pred_info_get_class_context": 4, "ClassContext": 6, "InstanceTVars": 7, "InstanceUnconstrainedTVars": 2, "InstanceUnconstrainedTypeInfoVars": 2, "setup_headvars_2": 4, "instance_method_constraints": 2, "InstanceTypes": 2, "InstanceConstraints": 3, "type_vars_list": 5, "get_unconstrained_tvars": 1, "UnconstrainedInstanceTVars": 6, "ArgTypeVarSet": 5, "make_head_vars": 3, "UnconstrainedInstanceTypeInfoVars": 7, "make_typeclass_info_head_vars": 3, "do_record_type_info_locns": 3, "InstanceHeadTypeClassInfoVars": 4, "proc_arg_vector_set_instance_type_infos": 1, "proc_arg_vector_set_instance_typeclass_infos": 1, "RttiVarMaps0": 4, "rtti_reuse_typeclass_info_var": 3, "poly_info_set_rtti_varmaps": 3, "in_mode": 3, "InMode": 3, "list.duplicate": 6, "list.length": 16, "UnconstrainedInstanceTypeInfoModes": 2, "InstanceHeadTypeClassInfoModes": 2, "poly_arg_vector_set_instance_type_infos": 1, "poly_arg_vector_set_instance_typeclass_infos": 1, "prog_constraints": 1, "AllUnconstrainedTVars": 2, "AllExtraHeadTypeInfoVars": 2, "constraints": 4, "UnivConstraints": 3, "ExistConstraints": 6, "prog_type.constraint_list_get_tvars": 2, "UnivConstrainedTVars": 2, "ExistConstrainedTVars": 2, "poly_info_get_constraint_map": 4, "ConstraintMap": 12, "get_improved_exists_head_constraints": 4, "ActualExistConstraints": 9, "pred_info_get_markers": 1, "PredMarkers": 2, "check_marker": 1, "marker_class_method": 1, "RecordExistQLocns": 3, "do_not_record_type_info_locns": 1, "UnivHeadTypeClassInfoVars": 4, "HeadTypeVars": 2, "list.delete_elems": 12, "UnconstrainedTVars0": 2, "UnconstrainedTVars1": 2, "UnconstrainedTVars2": 2, "list.remove_dups": 4, "UnconstrainedUnivTVars": 7, "UnconstrainedExistTVars": 6, "ExistHeadTypeInfoVars": 5, "UnivHeadTypeInfoVars": 4, "list.condense": 4, "proc_arg_vector_set_univ_type_infos": 1, "HeadVars1": 2, "proc_arg_vector_set_exist_type_infos": 1, "HeadVars2": 2, "proc_arg_vector_set_univ_typeclass_infos": 1, "HeadVars3": 2, "proc_arg_vector_set_exist_typeclass_infos": 1, "In": 6, "out_mode": 2, "Out": 6, "NumUnconstrainedUnivTVars": 2, "NumUnconstrainedExistTVars": 2, "NumUnivClassInfoVars": 2, "NumExistClassInfoVars": 2, "UnivTypeInfoModes": 2, "ExistTypeInfoModes": 2, "UnivTypeClassInfoModes": 2, "ExistTypeClassInfoModes": 2, "poly_arg_vector_set_univ_type_infos": 1, "poly_arg_vector_set_exist_type_infos": 1, "poly_arg_vector_set_univ_typeclass_infos": 1, "poly_arg_vector_set_exist_typeclass_infos": 1, "some": 4, "ToLocn": 4, "TheVar": 2, "TheLocn": 2, "list.map": 17, "UnivTypeLocns": 2, "list.foldl_corresponding": 3, "rtti_det_insert_type_info_locn": 3, "ExistTypeLocns": 2, "UnconstrainedInstanceTypeLocns": 2, ".RttiVarMaps": 1, "TypeInfoHeadVars": 2, "pred_info_get_tvar_kinds": 2, "KindMap": 2, "PredClassContext": 5, "PredExistConstraints": 2, "exist_constraints": 1, "ExistQVarsForCall": 2, "goal_info_get_context": 4, "make_typeclass_info_vars": 3, "ExistTypeClassVarsMCAs": 2, "ExtraTypeClassGoals": 5, "assoc_list.keys": 8, "ExistTypeClassVars": 3, "assign_var_list": 8, "ExtraTypeClassUnifyGoals": 2, "vartypes_is_empty": 1, "PredToActualTypeSubst": 4, "ActualArgTypes": 8, "ArgTypeSubst": 2, "apply_subst_to_tvar_list": 1, "ActualTypes": 2, "polymorphism_do_make_type_info_vars": 5, "TypeInfoVarsMCAs": 2, "ExtraTypeInfoGoals": 4, "TypeInfoVars": 5, "ExtraTypeInfoUnifyGoals": 2, "GoalList": 8, "conj_list_to_goal": 6, "Var1": 5, "Vars1": 2, "Var2": 5, "Vars2": 2, "Goals": 13, "assign_var": 3, "true_goal": 1, "term.context_init": 2, "create_pure_atomic_complicated_unification": 1, "rhs_var": 2, "umc_explicit": 1, "constraint_map": 1, "NumExistConstraints": 4, "search_hlds_constraint_list": 1, "unproven": 3, "goal_id": 1, "ActualExistConstraints0": 2, "GoalExpr0": 18, "GoalInfo0": 41, "generic_call": 1, "plain_call": 5, "ArgVars0": 23, "polymorphism_process_call": 4, "ExtraVars": 13, "ExtraGoals": 13, "ArgVars": 6, "CallExpr": 4, "call_args": 1, "Call": 4, "call_foreign_proc": 4, "polymorphism_process_foreign_proc": 3, "XVar": 11, "Y": 9, "Mode": 12, "Unification": 16, "UnifyContext": 15, "polymorphism_process_unify": 4, "conj": 5, "ConjType": 4, "Goals0": 13, "plain_conj": 4, "polymorphism_process_plain_conj": 5, "parallel_conj": 1, "get_cache_maps_snapshot": 11, "InitialSnapshot": 36, "polymorphism_process_par_conj": 5, "GoalExpr": 19, "disj": 2, "polymorphism_process_disj": 6, "set_cache_maps_snapshot": 15, "if_then_else": 2, "Cond0": 2, "Then0": 2, "Else0": 2, "Cond": 2, "Then": 2, "Else": 2, "negation": 2, "SubGoal0": 14, "SubGoal": 16, "switch": 2, "CanFail": 4, "Cases0": 4, "polymorphism_process_cases": 5, "Cases": 4, "scope": 7, "Reason0": 16, "from_ground_term": 2, "TermVar": 4, "Kind": 5, "from_ground_term_initial": 2, "polymorphism_process_from_ground_term_initial": 3, "from_ground_term_construct": 1, "from_ground_term_deconstruct": 1, "from_ground_term_other": 1, "promise_solutions": 1, "promise_purity": 1, "require_detism": 1, "require_complete_switch": 1, "commit": 1, "barrier": 1, "loop_control": 1, "exist_quant": 1, "trace_goal": 1, "shorthand": 2, "ShortHand0": 4, "atomic_goal": 2, "GoalType": 2, "Outer": 2, "Inner": 2, "MainGoal0": 2, "OrElseGoals0": 2, "OrElseInners": 2, "MainGoal": 2, "OrElseGoals": 2, "ShortHand": 3, "try_goal": 2, "MaybeIO": 2, "ResultVar": 2, "SubGoalExpr0": 4, "SubGoalInfo": 2, "Conjuncts0": 2, "ConjunctA0": 2, "ConjunctB0": 2, "ConjunctA": 2, "ConjunctB": 2, "Conjuncts": 2, "SubGoalExpr": 2, "bi_implication": 1, "hlds_goal_expr": 2, "SubGoalInfo0": 2, "SubGoals0Prime": 2, "SubGoals0": 2, "polymorphism_process_fgti_goals": 5, "RevMarkedSubGoals": 2, "fgt_invariants_kept": 2, "InvariantsStatus": 7, "Reason": 2, "fgt_invariants_broken": 2, "introduce_partial_fgt_scopes": 1, "deconstruct_top_down": 1, "fgt_marked_goal": 2, "fgt_invariants_status": 2, "RevMarkedGoals": 4, "OldInfo": 3, "XVarPrime": 2, "ModePrime": 2, "UnificationPrime": 2, "UnifyContextPrime": 2, "rhs_functor": 5, "ConsIdPrime": 2, "YVarsPrime": 2, "ConsId": 10, "YVars": 4, "polymorphism_process_unify_functor": 4, "Changed": 10, "VarSetBefore": 2, "MaxVarBefore": 2, "varset.max_var": 2, "poly_info_get_num_reuses": 2, "NumReusesBefore": 2, "VarSetAfter": 2, "MaxVarAfter": 2, "NumReusesAfter": 2, "MarkedGoal": 3, "fgt_kept_goal": 1, "fgt_broken_goal": 1, ".RevMarkedGoals": 1, "unify_mode": 2, "Unification0": 8, "_YVar": 1, "unification_typeinfos": 5, "_Changed": 3, "Args": 11, "Purity": 9, "Groundness": 6, "PredOrFunc": 6, "EvalMethod": 8, "LambdaVars": 13, "Modes": 4, "Det": 4, "LambdaGoal0": 5, "LambdaGoal1": 2, "fixup_lambda_quantification": 1, "LambdaGoal": 6, "NonLocalTypeInfos": 3, "set_of_var.to_sorted_list": 1, "NonLocalTypeInfosList": 2, "Y1": 2, "NonLocals0": 10, "goal_info_get_nonlocals": 6, "NonLocals": 12, "goal_info_set_nonlocals": 6, "type_vars": 2, "TypeVars": 8, "get_type_info_locn": 1, "TypeInfoLocns": 6, "add_unification_typeinfos": 4, "rtti_lookup_type_info_locn": 1, "type_info_locn": 1, "type_info_locn_var": 1, "TypeInfoVars0": 2, ".GoalInfo": 1, "set_of_var.insert_list": 4, ".Unification": 5, "complicated_unify": 2, "construct": 1, "deconstruct": 2, "simple_test": 1, "X0": 8, "ConsId0": 5, "Mode0": 4, "TypeOfX": 6, "Arity": 5, "closure_cons": 1, "ShroudedPredProcId": 2, "ProcId0": 3, "unshroud_pred_proc_id": 1, "type_is_higher_order_details": 1, "_PredOrFunc": 1, "CalleeArgTypes": 2, "invalid_proc_id": 1, "goal_info_add_feature": 1, "feature_lambda_undetermined_mode": 1, "GoalInfo1": 6, "VarSet0": 2, "Functor0": 6, "poly_info_set_varset_and_types": 1, "cons": 3, "ConsTypeCtor": 2, "remove_new_prefix": 1, "OrigFunctor": 2, "IsConstruction": 7, "type_util.get_existq_cons_defn": 1, "ConsDefn": 2, "polymorphism_process_existq_unify_functor": 3, "UnifyExpr": 2, "Unify": 2, "PredArgTypes": 10, "Functor": 6, "create_fresh_vars": 5, "QualifiedPName": 5, "qualified": 1, "cons_id_dummy_type_ctor": 1, "RHS": 2, "CallUnifyContext": 2, "LambdaGoalExpr": 2, "not_builtin": 3, "OutsideVars": 2, "InsideVars": 2, "set_of_var.intersect": 1, "LambdaNonLocals": 2, "GoalId": 8, "goal_info_get_goal_id": 3, "goal_info_init": 1, "LambdaGoalInfo0": 2, "goal_info_set_context": 1, "LambdaGoalInfo1": 2, "LambdaGoalInfo2": 2, "goal_info_set_purity": 1, "LambdaGoalInfo3": 2, "goal_info_set_goal_id": 1, "LambdaGoalInfo": 4, "lambda_modes_and_det": 4, "LambdaModes": 6, "LambdaDet": 6, "pred_info_is_pred_or_func": 1, "ho_ground": 1, "_LambdaModes0": 1, "_LambdaDet0": 1, "goal_to_conj_list": 1, "LambdaGoalList0": 2, "list.split_last": 1, "LambdaGoalButLast0": 2, "LastGoal0": 2, "LastGoalExpr0": 2, "LastGoalInfo0": 2, "PredId0": 2, "_DummyProcId": 1, "Args0": 5, "MaybeCallUnifyContext0": 2, "QualifiedPName0": 2, "LambdaGoalButLast": 2, "LastGoalInfo": 2, "MaybeCallUnifyContext": 4, "LastGoalExpr": 2, "LastGoal": 2, "prog_vars": 1, "determinism": 1, "NumArgModes": 2, "NumLambdaVars": 2, "list.drop": 2, "LambdaModesPrime": 2, "proc_info_get_declared_determinism": 1, "MaybeDet": 3, "sorry": 1, "varset.new_var": 1, "add_var_type": 1, "ctor_defn": 2, "CtorDefn": 2, "ActualRetType": 2, "CtorTypeVarSet": 2, "CtorExistQVars": 2, "CtorKindMap": 2, "CtorExistentialConstraints": 2, "CtorArgTypes": 2, "CtorRetType": 2, "TypeVarSet0": 5, "tvarset_merge_renaming": 3, "CtorToParentRenaming": 6, "apply_variable_renaming_to_tvar_list": 2, "ParentExistQVars": 6, "apply_variable_renaming_to_tvar_kind_map": 2, "ParentKindMap": 7, "apply_variable_renaming_to_prog_constraint_list": 1, "ParentExistentialConstraints": 3, "apply_variable_renaming_to_type_list": 4, "ParentArgTypes": 6, "apply_variable_renaming_to_type": 1, "ParentRetType": 2, "poly_info_set_typevarset": 3, "type_list_subsumes_det": 3, "ParentToActualTypeSubst": 6, "NumExistentialConstraints": 3, "lookup_hlds_constraint_list": 4, "ActualExistentialConstraints": 4, "ExtraTypeClassVarsMCAs": 2, "ExtraTypeClassVars": 2, "assumed": 2, "make_existq_typeclass_info_vars": 2, "constraint_list_get_tvars": 3, "ParentExistConstrainedTVars": 4, "ParentUnconstrainedExistQVars": 2, "apply_rec_subst_to_tvar_list": 4, "ActualExistentialTypes": 2, "ExtraTypeInfoVarsMCAs": 2, "ExtraTypeInfoVars": 2, "ExtraTypeClassVars.": 1, "bound": 1, "Attributes": 2, "ProcExtraArgs": 2, "MaybeTraceRuntimeCond": 2, "Impl": 14, "foreign_arg_var": 1, "CanOptAwayUnnamed": 11, "polymorphism_process_foreign_proc_args": 3, "ExtraArgs": 5, "pragma_foreign_code_impl": 4, "foreign_arg": 1, "PredTypeVarSet": 8, "UnivCs": 4, "ExistCs": 4, "UnivVars0": 2, "get_constrained_vars": 2, "UnivConstrainedVars": 2, "ExistVars0": 2, "ExistConstrainedVars": 2, "PredTypeVars0": 2, "PredTypeVars1": 2, "PredTypeVars2": 2, "PredTypeVars": 3, "foreign_proc_add_typeclass_info": 4, "ExistTypeClassArgInfos": 2, "UnivTypeClassArgInfos": 2, "TypeClassArgInfos": 2, "list.filter": 1, "X": 9, "semidet": 2, "ExistUnconstrainedVars": 2, "UnivUnconstrainedVars": 2, "foreign_proc_add_typeinfo": 4, "ExistTypeArgInfos": 2, "UnivTypeArgInfos": 2, "TypeInfoArgInfos": 2, "ArgInfos": 2, "TypeInfoTypes": 2, "type_info_type": 1, "UnivTypes": 2, "ExistTypes": 2, "OrigArgTypes": 2, "make_foreign_args": 1, "tvarset": 3, "box_policy": 2, "Constraint": 2, "MaybeArgName": 7, "native_if_possible": 2, "SymName": 4, "sym_name_to_string_sep": 1, "TypeVarNames": 2, "underscore_and_tvar_name": 3, "string.append_list": 1, "ConstraintVarName": 3, "foreign_code_does_not_use_variable": 4, "TVar": 4, "varset.search_name": 1, "TypeVarName": 2, "C_VarName": 3, "VarName": 2, "foreign_code_uses_variable": 1, "TVarName": 2, "TVarName0": 1, "TVarName0.": 1, "cache_maps": 3, "case": 4, "Case0": 2, "Case": 2, "MainConsId": 2, "OtherConsIds": 2, "PredExistQVars": 2, "PredKindMap": 3, "varset.is_empty": 1, "PredToParentTypeRenaming": 6, "ParentTVars": 4, "apply_variable_renaming_to_prog_constraints": 1, "ParentClassContext": 2, "ParentUnivConstraints": 3, "ParentExistConstraints": 3, "ParentUnivConstrainedTVars": 2, "ParentUnconstrainedTVars0": 2, "ParentUnconstrainedTVars1": 2, "ParentUnconstrainedTVars": 3, "ParentUnconstrainedUnivTVars": 3, "ParentUnconstrainedExistTVars": 2, "NumUnivConstraints": 2, "ActualUnivConstraints": 2, "ActualExistQVarTypes": 2, "prog_type.type_list_to_var_list": 1, "ActualExistQVars0": 2, "ActualExistQVars": 2, "ExtraUnivClassVarsMCAs": 2, "ExtraUnivClassGoals": 2, "ExtraUnivClassVars": 2, "ExtraExistClassVars": 2, "ExtraExistClassGoals": 2, "ActualUnconstrainedUnivTypes": 2, "ExtraUnivTypeInfoVarsMCAs": 2, "ExtraUnivTypeInfoGoals": 2, "ExtraUnivTypeInfoVars": 2, "ActualUnconstrainedExistTypes": 2, "ExtraExistTypeInfoVarsMCAs": 2, "ExtraExistTypeInfoGoals": 2, "ExtraExistTypeInfoVars": 2, "CalleePredInfo": 2, "CalleeProcInfo": 3, "CallArgs0": 3, "BuiltinState": 2, "TVarSet0": 2, "ActualArgTypes0": 3, "PredTVarSet": 2, "_PredExistQVars": 1, "CalleeHeadVars": 2, "proc_info_get_rtti_varmaps": 1, "CalleeRttiVarMaps": 2, "NCallArgs0": 2, "NPredArgs": 2, "NExtraArgs": 3, "OrigPredArgTypes0": 2, "list.take": 1, "CalleeExtraHeadVars0": 2, "OrigPredArgTypes": 2, "CalleeExtraHeadVars": 2, "TVarSet": 2, "PredToParentRenaming": 3, "OrigParentArgTypes": 2, "ParentToActualTSubst": 2, "GetTypeInfoTypes": 2, "ProgVar": 2, "TypeInfoType": 2, "rtti_varmaps_var_info": 1, "VarInfo": 4, "type_info_var": 1, "typeclass_info_var": 1, "non_rtti_var": 1, "PredTypeInfoTypes": 2, "ParentTypeInfoTypes": 2, "apply_rec_subst_to_type_list": 1, "ActualTypeInfoTypes": 2, "Ctxt": 2, "ExtraArgsConstArgs": 2, "CallArgs": 2, "NonLocals1": 2, "CallGoalExpr": 2, "CallGoal": 2, "rot13_concise.": 1, "state": 3, "alphabet": 3, "cycle": 4, "rot_n": 2, "Char": 12, "RotChar": 8, "char_to_string": 1, "CharString": 2, "if": 15, "sub_string_search": 1, "Index": 3, "then": 3, "NewIndex": 2, "mod": 1, "index_det": 1, "else": 8, "rot13": 11, "read_char": 1, "Res": 8, "ok": 3, "print": 3, "ErrorCode": 4, "error_message": 1, "ErrorMessage": 4, "stderr_stream": 1, "StdErr": 8, "nl": 1, "rot13_ralph.": 1, "io__state": 4, "io__read_byte": 1, "Result": 4, "io__write_byte": 1, "ErrNo": 2, "io__error_message": 2, "z": 1, "Rot13": 2, "<": 14, "rem": 1, "rot13_verbose.": 1, "rot13a/2": 1, "table": 1, "alphabetic": 2, "characters": 1, "their": 1, "equivalents": 1, "fails": 1, "input": 1, "not": 7, "rot13a": 55, "rot13/2": 1, "Applies": 1, "algorithm": 1, "a": 18, "character.": 1, "TmpChar": 2, "io__read_char": 1, "io__write_char": 1, "io__stderr_stream": 1, "io__write_string": 2, "io__nl": 1, "store.": 1, "typeclass": 1, "store": 52, "T": 52, "where": 8, "S": 133, "instance": 4, "io.state": 3, "store.init": 2, "generic_mutvar": 15, "io_mutvar": 1, "store_mutvar": 1, "store.new_mutvar": 1, "store.copy_mutvar": 1, "store.get_mutvar": 1, "store.set_mutvar": 1, "<=>": 5, "new_cyclic_mutvar": 2, "Func": 4, "Mutvar": 23, "Create": 1, "new": 25, "variable": 1, "whose": 2, "initialized": 2, "with": 5, "returned": 1, "from": 1, "specified": 1, "function": 3, "The": 2, "argument": 6, "passed": 2, "mutvar": 6, "itself": 4, "has": 4, "yet": 1, "been": 1, "safe": 2, "because": 1, "does": 3, "get": 2, "so": 3, "it": 1, "can": 1, "t": 5, "examine": 1, "uninitialized": 1, "predicate": 1, "useful": 1, "creating": 1, "self": 1, "referential": 1, "values": 1, "such": 2, "as": 5, "circular": 1, "linked": 1, "lists": 1, "For": 1, "example": 1, "clist": 2, "node": 1, "store.new_cyclic_mutvar": 1, "generic_ref": 20, "io_ref": 1, "store_ref": 1, "store.new_ref": 1, "store.ref_functor": 1, "store.arg_ref": 1, "ArgT": 4, "store.new_arg_ref": 3, "store.set_ref": 1, "store.set_ref_value": 1, "store.copy_ref_value": 1, "store.extract_ref_value": 1, "Nasty": 1, "performance": 2, "hacks": 1, "WARNING": 1, "use": 1, "of": 10, "these": 1, "procedures": 2, "dangerous": 1, "Use": 1, "them": 1, "last": 1, "resort": 1, "critical": 1, "and": 6, "shows": 1, "that": 2, "using": 1, "versions": 1, "bottleneck": 1, "These": 1, "may": 1, "vanish": 1, "future": 1, "Mercury": 1, "unsafe_arg_ref": 1, "same": 2, "arg_ref": 12, "unsafe_new_arg_ref": 1, "new_arg_ref": 1, "except": 1, "they": 4, "doesn": 1, "check": 1, "errors": 1, "don": 3, "work": 3, "no_tag": 1, "types": 3, "exactly": 2, "one": 2, "functor": 2, "which": 2, "arguments": 2, "occupy": 1, "word": 2, "other": 1, "functors.": 1, "store.unsafe_arg_ref": 1, "store.unsafe_new_arg_ref": 1, "implementation": 1, "require": 1, "just": 1, "real": 1, "representation": 1, "pragma": 41, "foreign_type": 10, "MR_Word": 24, "can_pass_as_mercury_type": 5, "equality": 5, "store_equal": 7, "comparison": 5, "store_compare": 7, "int32": 1, "Java": 12, "Erlang": 3, "attempt": 2, "two": 2, "stores": 2, "comparison_result": 1, "compare": 1, "Mutvars": 1, "references": 1, "are": 1, "each": 1, "represented": 1, "pointer": 1, "single": 1, "on": 1, "heap": 1, "private_builtin.ref": 2, "ref": 2, "store.do_init": 6, "foreign_proc": 28, "_S0": 16, "will_not_call_mercury": 28, "will_not_modify_trail": 7, "new_mutvar": 5, "Val": 45, "S0": 23, "get_mutvar": 5, "set_mutvar": 5, "_S": 12, "copy_mutvar": 1, "Copy": 2, "Value": 4, "store.unsafe_new_uninitialized_mutvar": 1, "unsafe_new_uninitialized_mutvar": 4, "MR_offset_incr_hp_msg": 5, "MR_SIZE_SLOT_SIZE": 10, "1": 5, "MR_ALLOC_ID": 5, "2": 2, "MR_define_size_slot": 5, "0": 2, "object": 21, "MutVar": 4, "Store": 5, "apply": 1, "Ref": 41, "foreign_code": 2, "public": 17, "class": 4, "Object": 9, "referenced": 4, "obj": 7, "Specific": 2, "field": 20, "or": 2, "null": 8, "specify": 2, "GetFields": 2, "return": 6, "fields": 3, "any": 2, "particular": 2, "order": 2, "really": 2, "usable": 2, "System": 1, "Reflection": 1, "FieldInfo": 1, "Constructors": 2, "init": 8, "setField": 4, "Set": 2, "according": 2, "given": 2, "index": 2, "void": 4, "GetType": 1, "reference": 4, "getValue": 4, "GetValue": 1, "Update": 2, "setValue": 2, "SetValue": 1, "static": 1, "lang": 28, "getDeclaredFields": 2, "reflect": 1, "Field": 5, "try": 3, "getClass": 1, "catch": 11, "SecurityException": 1, "se": 1, "throw": 11, "RuntimeException": 11, "Security": 1, "manager": 1, "denied": 1, "access": 3, "ArrayIndexOutOfBoundsException": 1, "e": 20, "No": 1, "Exception": 3, "Unable": 3, "getMessage": 3, "IllegalAccessException": 2, "inaccessible": 2, "IllegalArgumentException": 2, "mismatch": 2, "NullPointerException": 2, "new_ref": 4, "ets": 3, "insert": 1, "copy_ref_value": 1, "unsafe_ref_value": 6, "store.unsafe_ref_value": 1, "lookup": 1, "ref_functor": 1, "canonicalize": 1, "foreign_decl": 1, "include": 4, "mercury_type_info": 1, "h": 4, "mercury_heap": 1, "mercury_misc": 1, "MR_fatal_error": 5, "mercury_deconstruct": 1, "MR_arg": 3, "ArgNum": 7, "ArgRef": 22, "may_not_duplicate": 1, "MR_TypeInfo": 10, "arg_type_info": 6, "exp_arg_type_info": 6, "MR_DuArgLocn": 2, "arg_locn": 9, "TypeInfo_for_T": 2, "TypeInfo_for_ArgT": 2, "MR_save_transient_registers": 2, "MR_NONCANON_ABORT": 2, "number": 2, "range": 2, "MR_compare_type_info": 2, "MR_COMPARE_EQUAL": 2, "wrong": 2, "MR_restore_transient_registers": 2, "NULL": 2, "MR_arg_bits": 2, "store.ref/2": 3, "MR_arg_value": 2, "C#": 6, "store.Ref": 8, "Ref.getValue": 6, "*arg_ref": 1, "*arg_locn": 1, "&": 7, "&&": 1, "ValRef": 1, "Ref.setValue": 3, "ValRef.getValue": 2, "*Ptr": 2, "Ptr": 4, "MR_strip_tag": 2, "Arg": 6, "switch_detection_bug.": 1, "note": 36, "rank": 2, "modifier": 2, "octave": 2, "d": 6, "f": 5, "g": 5, "b": 5, "natural": 12, "sharp": 1, "flat": 6, "qualifier": 2, "maj": 6, "min": 6, "next_topnote": 18, "Oct": 32 }, "Metal": { "#include": 4, "": 1, "using": 1, "namespace": 1, "metal": 1, ";": 24, "kernel": 5, "void": 5, "genericRaycastVH_device": 1, "(": 76, "DEVICEPTR": 7, "Vector4f": 9, ")": 76, "*pointsRay": 4, "[": 81, "buffer": 22, "]": 81, "const": 15, "CONSTPTR": 15, "ITMVoxel": 2, "*voxelData": 2, "typename": 2, "ITMVoxelIndex": 4, "IndexData": 2, "*voxelIndex": 2, "Vector2f": 2, "*minmaxdata": 2, "CreateICPMaps_Params": 5, "*params": 5, "uint2": 15, "threadIdx": 5, "thread_position_in_threadgroup": 5, "blockIdx": 5, "threadgroup_position_in_grid": 5, "blockDim": 5, "threads_per_threadgroup": 5, "{": 5, "int": 17, "x": 17, "threadIdx.x": 5, "+": 13, "blockIdx.x": 5, "*": 15, "blockDim.x": 5, "y": 18, "threadIdx.y": 4, "blockIdx.y": 4, "blockDim.y": 4, "if": 6, "params": 33, "-": 34, "imgSize.x": 10, "||": 4, "imgSize.y": 4, "return": 5, "locId": 8, "locId2": 4, "floor": 4, "float": 4, "/": 5, "minmaximg_subsample": 4, "castRay": 2, "": 2, "pointsRay": 4, "voxelData": 2, "voxelIndex": 2, "invM": 2, "invProjParams": 2, "voxelSizes.y": 2, "lightSource.w": 2, "minmaxdata": 2, "}": 5, "genericRaycastVGMissingPoints_device": 1, "*forwardProjection": 2, "*fwdProjMissingPoints": 1, "pointId": 3, "imgSize.z": 1, "fwdProjMissingPoints": 1, "forwardProjection": 2, "renderICP_device": 1, "*pointsMap": 1, "*normalsMap": 1, "Vector4u": 2, "*outRendering": 2, "processPixelICP": 1, "": 2, "outRendering": 2, "pointsMap": 1, "normalsMap": 1, "imgSize.xy": 3, "voxelSizes.x": 3, "TO_VECTOR3": 2, "lightSource": 2, "renderForward_device": 1, "processPixelForwardRender": 1, "forwardProject_device": 1, "pixel": 3, "locId_new": 3, "forwardProjectPixel": 1, "M": 1, "projParams": 1 }, "Modelica": { "within": 12, "Modelica.Electrical.Analog": 1, ";": 578, "package": 11, "Sensors": 4, "extends": 36, "Modelica.Icons.SensorsPackage": 1, "model": 31, "PotentialSensor": 2, "Modelica.Icons.RotationalSensor": 3, "Interfaces.PositivePin": 3, "p": 3, "annotation": 310, "(": 1438, "Placement": 150, "transformation": 150, "extent": 244, "{": 1601, "-": 607, "}": 2176, "rotation": 111, ")": 1436, "Modelica.Blocks.Interfaces.RealOutput": 4, "phi": 6, "equation": 32, "p.i": 3, "p.v": 3, "Icon": 13, "coordinateSystem": 28, "preserveAspectRatio": 28, "true": 94, "grid": 8, "graphics": 27, "Text": 44, "lineColor": 89, "textString": 44, "Line": 256, "points": 279, "color": 256, "Diagram": 15, "Documentation": 29, "revisions": 5, "info": 29, "end": 41, "VoltageSensor": 2, "Interfaces.NegativePin": 2, "n": 12, "v": 49, "origin": 14, "n.i": 2, "n.v": 2, "CurrentSensor": 2, "i": 11, "PowerSensor": 2, "Modelica.Electrical.Analog.Interfaces.PositivePin": 2, "pc": 2, "Modelica.Electrical.Analog.Interfaces.NegativePin": 2, "nc": 2, "pv": 2, "nv": 2, "power": 2, "Modelica.Electrical.Analog.Sensors.VoltageSensor": 1, "voltageSensor": 1, "Modelica.Electrical.Analog.Sensors.CurrentSensor": 1, "currentSensor": 1, "Modelica.Blocks.Math.Product": 1, "product": 1, "connect": 128, "voltageSensor.p": 1, "voltageSensor.n": 1, "currentSensor.p": 1, "currentSensor.n": 1, "currentSensor.i": 1, "product.u2": 1, "voltageSensor.v": 1, "product.u1": 1, "product.y": 1, "Ellipse": 8, "fillColor": 45, "fillPattern": 45, "FillPattern.Solid": 37, "Polygon": 24, "ModelicaByExample.PackageExamples": 4, "NestedPackages": 2, "Types": 2, "type": 6, "Rabbits": 1, "Real": 17, "quantity": 6, "min": 21, "Wolves": 1, "RabbitReproduction": 1, "RabbitFatalities": 1, "WolfReproduction": 1, "WolfFatalities": 1, "LotkaVolterra": 2, "parameter": 57, "Types.RabbitReproduction": 1, "alpha": 2, "Types.RabbitFatalities": 1, "beta": 1, "Types.WolfReproduction": 1, "gamma": 2, "Types.WolfFatalities": 1, "delta": 1, "Types.Rabbits": 2, "x0": 2, "Types.Wolves": 2, "y0": 2, "x": 7, "start": 41, "y": 2, "der": 10, "x*": 1, "beta*y": 1, "y*": 1, "delta*x": 1, "NewtonCooling": 2, "import": 12, "Modelica.SIunits.Temperature": 1, "Modelica.SIunits.Mass": 2, "Modelica.SIunits.Area": 1, "ConvectionCoefficient": 2, "Modelica.SIunits.CoefficientOfHeatTransfer": 1, "SpecificHeat": 2, "Modelica.SIunits.SpecificHeatCapacity": 1, "Temperature": 3, "T_inf": 2, "T0": 2, "h": 1, "Area": 1, "A": 1, "Mass": 3, "m": 36, "c_p": 1, "T": 6, "initial": 2, "m*c_p*der": 1, "h*A*": 1, "ModelicaByExample": 3, "uses": 1, "Modelica": 2, "version": 1, "PackageExamples": 2, "ModelicaByExample.Subsystems": 2, "GearSubsystemModel": 2, "Pendula": 2, "ModelicaByExample.Subsystems.Pendula": 2, "Pendulum": 3, "Modelica.Mechanics.MultiBody.Parts": 1, "Modelica.Mechanics.MultiBody.Joints": 1, "Modelica.SIunits.Position": 2, "Modelica.SIunits.Angle": 2, "Modelica.SIunits.Length": 2, "L": 43, "Modelica.SIunits.Diameter": 1, "d": 25, "Parts.Fixed": 1, "ground": 1, "r": 2, "animation": 2, "false": 13, "Parts.PointMass": 1, "ball": 1, "sphereDiameter": 1, "*d": 1, "Parts.BodyCylinder": 1, "string": 1, "density": 1, "diameter": 1, "Joints.Revolute": 1, "revolute": 1, "fixed": 70, "cylinderDiameter": 1, "d/2": 1, "string.frame_a": 1, "ball.frame_a": 1, "thickness": 9, "smooth": 96, "Smooth.None": 94, "revolute.frame_b": 1, "ground.frame_b": 1, "revolute.frame_a": 1, "string.frame_b": 1, "RLC": 2, "Modelica.SIunits.Voltage": 2, "Vb": 2, "Modelica.SIunits.Inductance": 1, "Modelica.SIunits.Resistance": 1, "R": 1, "Modelica.SIunits.Capacitance": 1, "C": 1, "V": 3, "Modelica.SIunits.Current": 3, "i_L": 3, "i_R": 3, "i_C": 3, "V/R": 1, "C*der": 1, "+": 12, "L*der": 1, "SecondOrderSystem": 2, "Modelica.SIunits.*": 1, "Angle": 4, "phi1_init": 2, "phi2_init": 2, "AngularVelocity": 4, "omega1_init": 2, "omega2_init": 2, "Inertia": 2, "J1": 1, "J2": 1, "RotationalSpringConstant": 2, "k1": 1, "k2": 1, "RotationalDampingConstant": 2, "d1": 1, "d2": 1, "phi1": 7, "phi2": 8, "omega1": 4, "omega2": 4, "J1*der": 1, "k1*": 2, "d1*der": 2, "J2*der": 1, "k2*phi2": 1, "d2*der": 1, "System": 2, "Modelica.Constants.g_n": 1, "Modelica.Constants.pi": 1, "Integer": 2, "[": 12, "]": 12, "linspace": 1, "*0.05": 1, "Modelica.SIunits.Time": 2, "X": 2, "lengths": 2, "g_n*": 1, "T/": 1, "*pi*": 1, "for": 3, "in": 2, "phi0": 2, "pendulum": 1, "each": 2, "inner": 1, "Modelica.Mechanics.MultiBody.World": 1, "world": 1, "experiment": 13, "StopTime": 13, "Interval": 13, "Tolerance": 1, "Modelica.Mechanics": 1, "Translational": 1, "Modelica.Icons.Package": 2, "SI": 1, "Modelica.SIunits": 1, "Examples": 2, "Modelica.Icons.ExamplesPackage": 1, "SignConvention": 2, "Modelica.Icons.Example": 12, "Translational.Components.Mass": 19, "mass1": 7, "s": 35, "Translational.Sources.Force": 9, "force1": 2, "Modelica.Blocks.Sources.Constant": 4, "constant1": 1, "k": 5, "mass2": 6, "force2": 3, "constant2": 1, "mass3": 3, "force3": 1, "useSupport": 3, "constant3": 1, "Translational.Components.Fixed": 13, "constant1.y": 1, "force1.": 2, "f": 15, "constant2.y": 1, "force2.": 2, "constant3.y": 1, "force3.": 1, "force1.flange": 2, "mass1.flange_a": 6, "force2.flange": 3, "mass2.flange_b": 6, "mass3.flange_b": 3, "force3.flange": 1, "fixed.flange": 7, "force3.support": 1, "InitialConditions": 2, "fixed2": 6, "s0": 13, "Translational.Components.Spring": 9, "s2": 1, "s_rel0": 28, "c": 27, "e3": 7, "m3": 1, "Translational.Components.SpringDamper": 3, "sd2": 1, "m4": 1, "fixed1": 5, "s1": 1, "s_rel": 13, "m1": 1, "sd1": 1, "v_rel": 2, "m2": 1, "s2.flange_a": 1, "fixed2.flange": 6, "s1.flange_a": 1, "fixed1.flange": 5, "m1.flange_a": 1, "s1.flange_b": 1, "sd1.flange_a": 1, "m1.flange_b": 1, "m2.flange_a": 1, "sd1.flange_b": 1, "m4.flange_a": 1, "sd2.flange_b": 1, "sd2.flange_a": 1, "m3.flange_b": 1, "m3.flange_a": 1, "s2.flange_b": 1, "WhyArrows": 2, "Translational.Components.Rod": 8, "rod1": 3, "rod2": 3, "rod3": 2, "Translational.Sensors.PositionSensor": 5, "positionSensor2": 2, "positionSensor1": 2, "positionSensor3": 1, "spring1": 2, "spring2": 3, "inertia2": 1, "spring1.flange_b": 2, "mass1.flange_b": 6, "spring2.flange_b": 2, "inertia2.flange_b": 1, "rod3.flange_b": 2, "positionSensor3.": 1, "flange": 4, "rod1.flange_a": 3, "positionSensor1.": 1, "rod1.flange_b": 2, "rod3.flange_a": 1, "rod2.flange_a": 3, "rod2.flange_b": 4, "positionSensor2.": 1, "spring1.": 1, "flange_a": 15, "spring2.": 4, "Accelerate": 2, "Translational.Sources.Accelerate": 1, "accelerate": 1, "mass": 3, "constantAcc": 1, "accelerate.flange": 1, "mass.flange_a": 6, "constantAcc.y": 1, "accelerate.a_ref": 1, "Damper": 4, "Translational.Components.Damper": 4, "damper1": 2, "damper2": 1, "fixed3": 1, "springDamper3": 1, "damper1.flange_a": 1, "damper2.flange_a": 2, "damper2.flange_b": 2, "flange_b": 5, "springDamper3.flange_a": 1, "damper1.flange_b": 2, "springDamper3.flange_b": 1, "fixed3.flange": 1, "Oscillator": 2, "Modelica.Blocks.Sources.Sine": 5, "sine1": 2, "freqHz": 7, "sine2": 2, "spring1.flange_a": 1, "spring2.flange_a": 2, "damper1.": 1, "sine1.y": 2, "sine2.y": 2, "mass2.flange_a": 3, "Translational.Sensors.ForceSensor": 1, "forceSensor": 1, "Translational.Sensors.SpeedSensor": 1, "speedSensor1": 1, "Translational.Sensors.AccSensor": 1, "accSensor1": 1, "force": 4, "sineForce": 3, "amplitude": 5, "Modelica.Mechanics.Translational.Sensors.MultiSensor": 1, "multiSensor": 1, "sineForce.y": 4, "force.f": 4, "forceSensor.flange_a": 1, "force.flange": 4, "positionSensor1.flange": 1, "speedSensor1.flange": 1, "accSensor1.flange": 1, "mass.flange_b": 2, "positionSensor2.flange": 1, "forceSensor.flange_b": 1, "multiSensor.flange_a": 1, "multiSensor.flange_b": 1, "Friction": 2, "Modelica.Mechanics.Translational.Components.MassWithStopAndFriction": 2, "stop1": 1, "smax": 3, "smin": 3, "F_prop": 5, "F_Coulomb": 6, "F_Stribeck": 5, "fexp": 5, "stop2": 1, "spring": 3, "Components.Mass": 6, "Components.SupportFriction": 2, "supportFriction": 2, "f_pos": 7, "Examples.Utilities.GenerateStribeckFrictionTable": 1, "v_max": 2, "nTable": 5, "spring.flange_b": 3, "stop2.flange_a": 1, "spring.flange_a": 2, "stop1.flange_a": 1, "supportFriction.flange_a": 2, "force2.f": 1, "PreLoad": 2, "Translational.Components.ElastoGap": 4, "innerContactA": 1, "innerContactB": 1, "spool": 1, "fixedLe": 1, "springPlateA": 1, "springPlateB": 1, "outerContactA": 1, "outerContactB": 1, "friction": 1, "housing": 1, "rod4": 1, "outerContactA.flange_b": 1, "springPlateA.": 1, "springPlateA.flange_b": 2, "spring.": 1, "springPlateB.": 2, "springPlateB.flange_b": 1, "outerContactB.": 1, "outerContactB.flange_b": 1, "housing.": 1, "rod1.": 2, "innerContactA.flange_a": 1, "rod3.": 2, "innerContactA.flange_b": 1, "innerContactB.": 2, "rod4.flange_b": 1, "friction.flange_b": 1, "rod4.": 2, "spool.flange_a": 2, "outerContactA.flange_a": 1, "fixedLe.flange": 3, "housing.flange_a": 1, "friction.flange_a": 1, "ElastoGap": 4, "Components.Fixed": 3, "Components.Rod": 2, "Components.SpringDamper": 4, "springDamper1": 2, "springDamper2": 1, "Components.ElastoGap": 3, "elastoGap1": 1, "elastoGap2": 1, "SI.TranslationalDampingConstant": 4, "springDamper1.flange_a": 2, "springDamper2.flange_b": 1, "springDamper1.flange_b": 2, "springDamper2.flange_a": 1, "elastoGap1.flange_a": 1, "elastoGap2.flange_b": 1, "elastoGap1.flange_b": 1, "elastoGap2.flange_a": 1, "Brake": 3, "Modelica.Mechanics.Translational.Components.Brake": 2, "brake": 2, "fn_max": 4, "Modelica.Mechanics.Translational.Components.Mass": 2, "Modelica.Blocks.Sources.Step": 1, "step": 1, "startTime": 1, "height": 1, "brake1": 1, "Modelica.Mechanics.Translational.Components.Fixed": 1, "brake.flange_a": 2, "step.y": 2, "brake.f_normalized": 2, "brake1.flange_a": 1, "brake1.f_normalized": 1, "brake1.support": 1, "HeatLosses": 2, "springDamper": 1, "useHeatPort": 11, "Components.Damper": 1, "damper": 1, "elastoGap": 1, "Sources.Force": 1, "Blocks.Sources.Sine": 2, "Components.Spring": 1, "Components.Brake": 1, "Components.MassWithStopAndFriction": 1, "massWithStopAndFriction": 1, "Thermal.HeatTransfer.Components.Convection": 1, "convection": 1, "Blocks.Sources.Constant": 1, "const": 1, "Thermal.HeatTransfer.Celsius.FixedTemperature": 1, "TAmbient": 1, "springDamper.flange_a": 1, "damper.flange_a": 1, "damper.flange_b": 1, "springDamper.flange_b": 1, "supportFriction.flange_b": 1, "mass3.flange_a": 1, "elastoGap.flange_b": 1, "const.y": 1, "convection.": 2, "Gc": 1, "TAmbient.port": 1, "fluid": 1, "elastoGap.flange_a": 1, "elastoGap.heatPort": 1, "convection.solid": 7, "damper.heatPort": 1, "springDamper.heatPort": 1, "supportFriction.heatPort": 1, "brake.heatPort": 1, "massWithStopAndFriction.heatPort": 1, "brake.flange_b": 1, "massWithStopAndFriction.flange_a": 1, "springDamper1.heatPort": 1, "Utilities": 2, "Modelica.Icons.UtilitiesPackage": 1, "function": 1, "GenerateStribeckFrictionTable": 2, "Modelica.Icons.Function": 1, "input": 6, "final": 15, "unit": 2, "Modelica.SIunits.Force": 7, "output": 1, "table": 3, "algorithm": 1, "loop": 1, "v_max*": 1, "/": 1, "F_prop*table": 1, "F_Stribeck*exp": 1, "fexp*table": 1, "Components": 1, "Fixed": 2, "SI.Position": 5, "Interfaces.Flange_b": 1, "flange.s": 1, "SI.Mass": 1, "StateSelect": 1, "stateSelect": 5, "StateSelect.default": 1, "Dialog": 1, "tab": 1, "Translational.Interfaces.PartialRigid": 2, "SI.Velocity": 3, "SI.Acceleration": 3, "a": 8, "m*a": 1, "flange_a.f": 4, "flange_b.f": 4, "Rectangle": 14, "FillPattern.Sphere": 8, "Rod": 2, "Spring": 2, "Translational.Interfaces.PartialCompliant": 1, "SI.TranslationalSpringConstant": 3, "SI.Distance": 1, "c*": 2, "Translational.Interfaces.PartialCompliantWithRelativeStates": 2, "Modelica.Thermal.HeatTransfer.Interfaces.PartialElementaryConditionalHeatPortWithoutT": 5, "d*v_rel": 3, "lossPower": 5, "f*v_rel": 1, "visible": 4, "pattern": 5, "LinePattern.Dot": 5, "SpringDamper": 2, "protected": 2, "f_c": 10, "f_d": 6, "f_d*v_rel": 2, "Modelica.Mechanics.Translational.Interfaces.PartialCompliantWithRelativeStates": 1, "Boolean": 1, "contact": 5, "f_d2": 5, "<": 3, "noEvent": 2, "if": 14, "then": 14, "c*abs": 1, "else": 14, "SupportFriction": 2, "Modelica.Mechanics.Translational.Interfaces.PartialElementaryTwoFlangesAndSupport2": 2, "peak": 2, "Translational.Interfaces.PartialFriction": 2, "SI.Force": 4, "f0": 2, "Modelica.Math.tempInterpol1": 10, "f0_max": 2, "peak*f0": 2, "free": 3, "flange_a.s": 2, "s_support": 1, "flange_b.s": 1, "v_relfric": 2, "a_relfric": 2, "locked": 2, "sa*unitForce": 2, "startForward": 2, "startBackward": 2, "pre": 2, "mode": 2, "Forward": 2, "f*v_relfric": 2, "mue_pos": 6, "cgeo": 1, "mue0": 2, "fn": 3, "Modelica.Blocks.Interfaces.RealInput": 1, "f_normalized": 1, "s_a": 1, "s_b": 1, "fn_max*f_normalized": 1, "mue0*cgeo*fn": 1, "cgeo*fn*": 1 }, "Modula-2": { "IMPLEMENTATION": 1, "MODULE": 1, "HuffChan": 1, ";": 254, "IMPORT": 2, "IOChan": 1, "IOLink": 1, "ChanConsts": 1, "IOConsts": 1, "SYSTEM": 1, "Strings": 1, "FROM": 1, "Storage": 1, "ALLOCATE": 1, "DEALLOCATE": 1, "CONST": 1, "rbldFrq": 3, "TYPE": 1, "charTap": 5, "POINTER": 4, "TO": 9, "ARRAY": 3, "[": 20, "MAX": 1, "(": 88, "INTEGER": 6, ")": 88, "-": 15, "]": 20, "OF": 3, "CHAR": 7, "smbTp": 8, "smbT": 2, "RECORD": 3, "ch": 19, "n": 5, "CARDINAL": 20, "left": 1, "right": 1, "next": 1, "END": 56, "tblT": 2, "vl": 6, "cnt": 1, "lclDataT": 2, "tRoot": 12, "htbl": 9, "ftbl": 7, "wBf": 15, "rb1": 9, "rb2": 10, "wbc": 11, "rbc": 11, "smc": 10, "chid": 1, "IOChan.ChanId": 1, "lclDataTp": 4, "charp": 1, "VAR": 16, "did": 7, "IOLink.DeviceId": 1, "ldt": 23, "PROCEDURE": 15, "Shf": 13, "a": 8, "b": 12, "BEGIN": 16, "RETURN": 11, "SYSTEM.CAST": 6, "SYSTEM.SHIFT": 1, "BITSET": 1, "wrDword": 5, "IOChan.RawWrite": 1, ".chid": 4, "SYSTEM.ADR": 2, "rdDword": 3, "z": 2, "IOChan.RawRead": 1, "wrSmb": 6, "v": 5, "h": 4, "c": 6, "WITH": 10, "DO": 17, "ORD": 8, ".vl": 3, ".cnt": 5, "IF": 19, "+": 17, "<": 7, "THEN": 20, "flush": 3, "getSym": 4, "t": 8, "i": 22, "FOR": 5, "CHR": 2, "Insert": 5, "s": 17, "cr": 30, "NIL": 13, ".next": 15, "ELSIF": 1, ".n": 8, "WHILE": 2, "&": 1, "BuildTree": 3, "ocr": 5, "ncr": 7, "LOOP": 1, "NEW": 3, ".left": 4, ".right": 3, "ELSE": 2, "EXIT": 1, "BuildTable": 5, ".ch": 3, "DISPOSE": 3, "vl*2": 1, "clcTab": 5, "iniHuf": 3, "RawWrite": 3, "x": 16, "IOLink.DeviceTablePtr": 4, "buf": 4, "SYSTEM.ADDRESS": 2, "len": 7, "cht": 7, ".cd": 4, "C": 6, ".result": 4, "IOChan.ReadResult": 1, "RawRead": 3, "blen": 4, "OR": 1, "IOConsts.allRight": 2, "IOConsts.endOfInput": 1, "CreateAlias": 2, "cid": 8, "ChanId": 3, "io": 2, "res": 4, "OpenResults": 1, "IOLink.MakeChan": 1, "IOChan.InvalidChan": 1, "ChanConsts.outOfChans": 2, "IOLink.UnMakeChan": 2, "IOLink.DeviceTablePtrValue": 2, "IOChan.notAvailable": 2, ".doRawWrite": 1, ".doRawRead": 1, "ChanConsts.opened": 1, "DeleteAlias": 2, ".rbc": 1, "IOLink.AllocateDeviceId": 1, "HuffChan.": 1 }, "Module Management System": { "#": 186, "Norman": 2, "Lastovica": 2, "/": 2, "norman.lastovica@oracle.com": 2, "CC_DEBUG": 4, "/DEBUG": 2, ".IFDEF": 16, "DEBUG": 7, "LINK_DEBUG": 4, "/DEBUG/TRACEBACK": 2, "CC_OPTIMIZE": 10, "/NOOPTIMIZE": 2, "MMSALPHA": 6, "ALPHA_OR_IA64": 18, "CC_FLAGS": 18, "/PREF": 8, "ALL": 12, "ARCH": 76, "AXP": 4, "-": 174, "DBG": 6, "CC_DEFS": 68, ".ENDIF": 22, "MMSIA64": 4, "I64": 4, "MMSVAX": 4, "(": 1573, ")": 1572, "VAX": 16, ".ELSE": 8, "/NODEBUG/NOTRACEBACK": 2, "/OPT": 4, "LEV": 4, "/ARCH": 2, "HOST": 2, "LINK_SECTION_BINDING": 2, "/SECTION_BINDING": 2, "/OPTIMIZE": 2, "OUR_CC_FLAGS": 4, "/NEST": 2, "PRIMARY/NAME": 2, "AS_IS": 2, "SHORT": 2, "CC": 14, "CC/DECC": 2, "BIN_DIR": 9, "SYS": 80, "DISK": 64, "[": 105, ".BIN": 2, "]": 105, "LIB_DIR": 66, ".LIB": 2, "BLD_DIR": 30, ".LIB.BLD": 2, ".FIRST": 2, "@": 59, "IF": 28, "F": 29, "SEARCH": 26, ".EQS.": 14, "THEN": 28, "CREATE/DIRECTORY": 6, ".NES.": 14, "DELETE/NOLOG/NOCONFIRM": 22, "*.*": 3, ";": 33, "*": 32, "DELETE/SYMBOL/GLOBAL": 2, "SIMH_DIR": 70, "SIMH_LIB": 6, "SIMH": 2, ".OLB": 60, "SIMH_SOURCE": 4, "SIM_CONSOLE.C": 2, "SIM_SOCK.C": 2, "SIM_TMXR.C": 2, "SIM_ETHER.C": 2, "SIM_TAPE.C": 2, "SIM_FIO.C": 2, "SIM_TIMER.C": 2, "PCAP_DIR": 40, ".PCAP": 6, "VMS.PCAP": 2, "VCI": 6, "PCAP_LIB": 6, "PCAP": 8, "PCAP_SOURCE": 2, "PCAPVCI.C": 2, "VCMUTIL.C": 4, "BPF_DUMP.C": 2, "BPF_FILTER.C": 2, "BPF_IMAGE.C": 2, "ETHERENT.C": 2, "FAD": 2, "GIFC.C": 2, "GENCODE.C": 2, "GRAMMAR.C": 2, "INET.C": 2, "NAMETOADDR.C": 2, "OPTIMIZE.C": 2, "PCAP.C": 2, "SAVEFILE.C": 2, "SCANNER.C": 2, "SNPRINTF.C": 2, "VMS.C": 2, "PCAP_VCMDIR": 20, "VMS.PCAPVCM": 4, "PCAP_VCM_SOURCES": 4, "PCAPVCM.C": 2, "PCAPVCM_INIT.MAR": 2, "VCI_JACKET.MAR": 2, "PCAP_VCI": 6, "COMMON": 7, "LDR": 4, "PCAPVCM.EXE": 10, "PCAP_EXECLET": 2, "PCAP_INC": 8, "PCAP_LIBD": 2, "PCAP_LIBR": 2, "/LIB/SYSEXE": 2, "PCAP_DEFS": 12, "PCAP_SIMH_INC": 4, "/INCL": 56, "ALTAIR_DIR": 12, ".ALTAIR": 2, "ALTAIR_LIB": 6, "ALTAIR": 6, "ALTAIR_SOURCE": 4, "ALTAIR_SIO.C": 2, "ALTAIR_CPU.C": 2, "ALTAIR_DSK.C": 2, "ALTAIR_SYS.C": 2, "ALTAIR_OPTIONS": 4, "/DEF": 56, "ALTAIRZ80_DIR": 62, ".ALTAIRZ80": 2, "ALTAIRZ80_LIB": 6, "ALTAIRZ80": 6, "ALTAIRZ80_SOURCE": 4, "/ALTAIRZ80_CPU.C": 2, "/ALTAIRZ80_CPU_NOMMU.C": 2, "/ALTAIRZ80_DSK.C": 2, "/DISASM.C": 2, "/ALTAIRZ80_SIO.C": 2, "/ALTAIRZ80_SYS.C": 2, "/ALTAIRZ80_HDSK.C": 2, "/ALTAIRZ80_NET.C": 2, "/FLASHWRITER2.C": 2, "/I86_DECODE.C": 2, "/I86_OPS.C": 2, "/I86_PRIM_OPS.C": 2, "/I8272.C": 2, "/INSNSA.C": 2, "/INSNSD.C": 2, "/MFDC.C": 2, "/N8VEM.C": 2, "/VFDHD.C": 2, "/S100_DISK1A.C": 2, "/S100_DISK2.C": 2, "/S100_FIF.C": 2, "/S100_MDRIVEH.C": 2, "/S100_MDSAD.C": 2, "/S100_SELCHAN.C": 2, "/S100_SS1.C": 2, "/S100_64FDC.C": 2, "/S100_SCP300F.C": 2, "/SIM_IMD.C": 2, "/WD179X.C": 2, "ALTAIRZ80_OPTIONS": 4, "NOVA_DIR": 54, ".NOVA": 2, "NOVA_LIB": 2, "NOVA": 6, "NOVA_SOURCE": 2, "NOVA_SYS.C": 4, "NOVA_CPU.C": 2, "NOVA_DKP.C": 4, "NOVA_DSK.C": 4, "NOVA_LP.C": 4, "NOVA_MTA.C": 4, "NOVA_PLT.C": 4, "NOVA_PT.C": 4, "NOVA_CLK.C": 4, "NOVA_TT.C": 2, "NOVA_TT1.C": 4, "NOVA_QTY.C": 4, "NOVA_OPTIONS": 2, "ECLIPSE_LIB": 8, "ECLIPSE": 6, "ECLIPSE_SOURCE": 4, "ECLIPSE_CPU.C": 2, "ECLIPSE_TT.C": 2, "ECLIPSE_OPTIONS": 4, "GRI_DIR": 10, ".GRI": 2, "GRI_LIB": 2, "GRI": 6, "GRI_SOURCE": 2, "GRI_CPU.C": 2, "GRI_STDDEV.C": 2, "GRI_SYS.C": 2, "GRI_OPTIONS": 2, "LGP_DIR": 10, ".LGP": 2, "LGP_LIB": 2, "LGP": 4, "LGP_SOURCE": 2, "LGP_CPU.C": 2, "LGP_STDDEV.C": 2, "LGP_SYS.C": 2, "LGP_OPTIONS": 2, "H316_DIR": 18, ".H316": 2, "H316_LIB": 2, "H316": 6, "H316_SOURCE": 2, "H316_STDDEV.C": 2, "H316_LP.C": 2, "H316_CPU.C": 2, "H316_SYS.C": 2, "H316_FHD.C": 2, "H316_MT.C": 2, "H316_DP.C": 2, "H316_OPTIONS": 2, "HP2100_DIR": 58, ".HP2100": 2, "HP2100_LIB": 2, "HP2100": 6, "HP2100_SOURCE": 2, "HP2100_STDDEV.C": 2, "HP2100_DP.C": 2, "HP2100_DQ.C": 2, "HP2100_DR.C": 2, "HP2100_LPS.C": 2, "HP2100_MS.C": 2, "HP2100_MT.C": 2, "HP2100_MUX.C": 2, "HP2100_CPU.C": 2, "HP2100_FP.C": 2, "HP2100_SYS.C": 2, "HP2100_LPT.C": 2, "HP2100_IPL.C": 2, "HP2100_DS.C": 2, "HP2100_CPU0.C": 2, "HP2100_CPU1.C": 2, "HP2100_CPU2.C": 2, "HP2100_CPU3.C": 2, "HP2100_CPU4.C": 2, "HP2100_CPU5.C": 2, "HP2100_CPU6.C": 2, "HP2100_CPU7.C": 2, "HP2100_FP1.C": 2, "HP2100_BACI.C": 2, "HP2100_MPX.C": 2, "HP2100_PIF.C": 2, ".IF": 6, "HP2100_OPTIONS": 4, "ID16_DIR": 34, ".INTERDATA": 4, "ID16_LIB": 2, "ID16": 6, "ID16_SOURCE": 2, "ID16_CPU.C": 2, "ID16_SYS.C": 2, "ID_DP.C": 4, "ID_FD.C": 4, "ID_FP.C": 4, "ID_IDC.C": 4, "ID_IO.C": 4, "ID_LP.C": 4, "ID_MT.C": 4, "ID_PAS.C": 4, "ID_PT.C": 4, "ID_TT.C": 4, "ID_UVC.C": 4, "ID16_DBOOT.C": 2, "ID_TTP.C": 4, "ID16_OPTIONS": 2, "ID32_DIR": 34, "ID32_LIB": 2, "ID32": 6, "ID32_SOURCE": 2, "ID32_CPU.C": 2, "ID32_SYS.C": 2, "ID32_DBOOT.C": 2, "ID32_OPTIONS": 2, "IBM1130_DIR": 30, ".IBM1130": 2, "IBM1130_LIB": 2, "IBM1130": 6, "IBM1130_SOURCE": 2, "IBM1130_CPU.C": 2, "IBM1130_CR.C": 2, "IBM1130_DISK.C": 2, "IBM1130_STDDEV.C": 2, "IBM1130_SYS.C": 2, "IBM1130_GDU.C": 2, "IBM1130_GUI.C": 2, "IBM1130_PRT.C": 2, "IBM1130_FMT.C": 2, "IBM1130_PTRP.C": 2, "IBM1130_PLOT.C": 2, "IBM1130_SCA.C": 2, "IBM1130_T2741.C": 2, "IBM1130_OPTIONS": 2, "I1401_DIR": 18, ".I1401": 2, "I1401_LIB": 2, "I1401": 6, "I1401_SOURCE": 2, "I1401_LP.C": 2, "I1401_CPU.C": 2, "I1401_IQ.C": 2, "I1401_CD.C": 2, "I1401_MT.C": 2, "I1401_DP.C": 2, "I1401_SYS.C": 2, "I1401_OPTIONS": 2, "I1620_DIR": 20, ".I1620": 2, "I1620_LIB": 2, "I1620": 6, "I1620_SOURCE": 2, "I1620_CD.C": 2, "I1620_DP.C": 2, "I1620_PT.C": 2, "I1620_TTY.C": 2, "I1620_CPU.C": 2, "I1620_LP.C": 2, "I1620_FP.C": 2, "I1620_SYS.C": 2, "I1620_OPTIONS": 2, "PDP1_DIR": 20, ".PDP1": 2, "PDP1_LIB": 2, "PDP1": 6, "PDP1_SOURCE": 2, "PDP1_LP.C": 2, "PDP1_CPU.C": 2, "PDP1_STDDEV.C": 2, "PDP1_SYS.C": 2, "PDP1_DT.C": 2, "PDP1_DRM.C": 2, "PDP1_CLK.C": 2, "PDP1_DCS.C": 2, "PDP1_OPTIONS": 2, "PDP8_DIR": 38, ".PDP8": 2, "PDP8_LIB": 2, "PDP8": 6, "PDP8_SOURCE": 2, "PDP8_CPU.C": 2, "PDP8_CLK.C": 2, "PDP8_DF.C": 2, "PDP8_DT.C": 2, "PDP8_LP.C": 2, "PDP8_MT.C": 2, "PDP8_PT.C": 2, "PDP8_RF.C": 2, "PDP8_RK.C": 2, "PDP8_RX.C": 2, "PDP8_SYS.C": 2, "PDP8_TT.C": 2, "PDP8_TTX.C": 2, "PDP8_RL.C": 2, "PDP8_TSC.C": 2, "PDP8_TD.C": 2, "PDP8_CT.C": 2, "PDP8_OPTIONS": 2, "PDP18B_DIR": 34, ".PDP18B": 2, "PDP4_LIB": 2, "PDP4": 6, "PDP7_LIB": 2, "PDP7": 6, "PDP9_LIB": 2, "PDP9": 6, "PDP15_LIB": 2, "PDP15": 6, "PDP18B_SOURCE": 2, "PDP18B_DT.C": 2, "PDP18B_DRM.C": 2, "PDP18B_CPU.C": 2, "PDP18B_LP.C": 2, "PDP18B_MT.C": 2, "PDP18B_RF.C": 2, "PDP18B_RP.C": 2, "PDP18B_STDDEV.C": 2, "PDP18B_SYS.C": 2, "PDP18B_TT1.C": 2, "PDP18B_RB.C": 2, "PDP18B_FPP.C": 2, "PDP4_OPTIONS": 2, "PDP7_OPTIONS": 2, "PDP9_OPTIONS": 2, "PDP15_OPTIONS": 2, "PDP11_DIR": 140, ".PDP11": 2, "PDP11_LIB1": 2, "PDP11L1": 2, "PDP11_SOURCE1": 2, "PDP11_FP.C": 2, "PDP11_CPU.C": 2, "PDP11_DZ.C": 8, "PDP11_CIS.C": 2, "PDP11_LP.C": 6, "PDP11_RK.C": 2, "PDP11_RL.C": 6, "PDP11_RP.C": 4, "PDP11_RX.C": 2, "PDP11_STDDEV.C": 2, "PDP11_SYS.C": 2, "PDP11_TC.C": 2, "PDP11_CPUMOD.C": 2, "PDP11_CR.C": 8, "PDP11_TA.C": 2, "PDP11_IO_LIB.C": 6, "PDP11_LIB2": 2, "PDP11L2": 2, "PDP11_SOURCE2": 2, "PDP11_TM.C": 2, "PDP11_TS.C": 6, "PDP11_IO.C": 2, "PDP11_RQ.C": 6, "PDP11_TQ.C": 6, "PDP11_PCLK.C": 2, "PDP11_RY.C": 8, "PDP11_PT.C": 4, "PDP11_HK.C": 4, "PDP11_XQ.C": 4, "PDP11_VH.C": 4, "PDP11_RH.C": 2, "PDP11_XU.C": 6, "PDP11_TU.C": 4, "PDP11_DL.C": 2, "PDP11_RF.C": 2, "PDP11_RC.C": 2, "PDP11_KG.C": 2, "PDP11_KE.C": 2, "PDP11_DC.C": 2, "PDP11_OPTIONS": 2, "PDP10_DIR": 26, ".PDP10": 2, "PDP10_LIB": 4, "PDP10": 6, "PDP10_SOURCE": 2, "PDP10_FE.C": 2, "PDP10_CPU.C": 2, "PDP10_KSIO.C": 2, "PDP10_LP20.C": 2, "PDP10_MDFP.C": 2, "PDP10_PAG.C": 2, "PDP10_XTND.C": 2, "PDP10_RP.C": 2, "PDP10_SYS.C": 2, "PDP10_TIM.C": 2, "PDP10_TU.C": 2, "PDP10_OPTIONS": 2, "S3_DIR": 16, ".S3": 2, "S3_LIB": 2, "S3": 6, "S3_SOURCE": 2, "S3_CD.C": 2, "S3_CPU.C": 2, "S3_DISK.C": 2, "S3_LP.C": 2, "S3_PKB.C": 2, "S3_SYS.C": 2, "S3_OPTIONS": 2, "SDS_DIR": 24, ".SDS": 2, "SDS_LIB": 2, "SDS": 6, "SDS_SOURCE": 2, "SDS_CPU.C": 2, "SDS_DRM.C": 2, "SDS_DSK.C": 2, "SDS_IO.C": 2, "SDS_LP.C": 2, "SDS_MT.C": 2, "SDS_MUX.C": 2, "SDS_RAD.C": 2, "SDS_STDDEV.C": 2, "SDS_SYS.C": 2, "SDS_OPTIONS": 2, "VAX_DIR": 30, ".VAX": 4, "VAX_LIB": 2, "VAX_SOURCE": 2, "VAX_CIS.C": 4, "VAX_CMODE.C": 4, "VAX_CPU.C": 4, "VAX_CPU1.C": 4, "VAX_FPA.C": 4, "VAX_MMU.C": 4, "VAX_OCTA.C": 4, "VAX_SYS.C": 4, "VAX_SYSCM.C": 4, "VAX_SYSDEV.C": 2, "VAX_SYSLIST.C": 2, "VAX_IO.C": 2, "VAX_STDDEV.C": 2, "VAX_OPTIONS": 2, "VAX780_DIR": 36, "VAX780_LIB1": 2, "VAX780L1": 2, "VAX780_SOURCE1": 2, "VAX780_STDDEV.C": 2, "VAX780_SBI.C": 2, "VAX780_MEM.C": 2, "VAX780_UBA.C": 2, "VAX780_MBA.C": 2, "VAX780_FLOAD.C": 2, "VAX780_SYSLIST.C": 2, "VAX780_LIB2": 2, "VAX780L2": 2, "VAX780_SOURCE2": 2, "VAX780_OPTIONS": 2, "I7094_DIR": 28, ".I7094": 2, "I7094_LIB": 4, "I7094": 8, "I7094_SOURCE": 2, "I7094_CPU.C": 2, "I7094_CPU1.C": 2, "I7094_IO.C": 2, "I7094_CD.C": 2, "I7094_CLK.C": 2, "I7094_COM.C": 2, "I7094_DRM.C": 2, "I7094_DSK.C": 2, "I7094_SYS.C": 2, "I7094_LP.C": 2, "I7094_MT.C": 2, "I7094_BINLOADER.C": 2, "I7094_OPTIONS": 2, "PDP11": 4, "VAX780": 4, "@CONTINUE": 4, "CLEAN": 2, "Clean": 2, "out": 2, "all": 3, "targets": 2, "and": 4, "building": 2, "Remnants": 2, "*.EXE": 2, "*.OLB": 2, "...": 6, "*.OBJ": 20, "*.LIS": 2, "*.MAP": 4, "Building": 10, "The": 19, "Library.": 8, "/OBJ": 8, "MMS": 32, "CHANGED_LIST": 8, "LIBRARY/CREATE": 8, "TARGET": 16, "LIBRARY/REPLACE": 8, "Due": 6, "To": 6, "Use": 8, "Of": 8, "INT64": 6, "We": 6, "Can": 12, "t": 12, "Build": 13, "It.": 4, "On": 6, "Sorry": 6, ".EXE": 2, "Simulator": 2, "Because": 2, "It": 3, "Requires": 2, "INT64.": 2, "Installing": 2, "the": 10, "Execlet": 4, "in": 5, "LOADABLE_IMAGES": 2, "COPY": 2, "@SYS": 2, "BUILD_PCAPVCM": 2, "######": 1, "This": 1, "section": 1, "is": 3, "only": 1, "part": 1, "of": 7, "file": 3, "you": 1, "should": 1, "need": 1, "to": 3, "edit.": 1, "mmk/descrip": 1, ".src": 3, "openvms.mmk/macro": 1, "BINDIR": 5, ".bin": 2, "GLSRCDIR": 11, "GLGENDIR": 3, ".obj": 8, "GLOBJDIR": 2, "PSSRCDIR": 1, "PSGENDIR": 2, "PSOBJDIR": 1, "PSLIBDIR": 2, ".lib": 1, "BIN.DIR": 1, "OBJ_DIR": 1, "OBJ.DIR": 1, ".first": 2, "if": 2, "f": 2, "search": 2, ".eqs.": 3, "then": 2, "create/directory/log": 2, "#.include": 3, "COMMONDIR": 3, "vmscdefs.mak": 1, "vmsdefs.mak": 1, "generic.mak": 1, ".include": 1, "version.mak": 1, "DD": 79, "GLD": 1, "PSD": 8, "GS_DOCDIR": 1, "GS_DOC": 1, "#GS_DOCDIR": 1, "GS": 6, "GS_LIB_DEFAULT": 1, "GS_LIB": 2, "#GS_LIB_DEFAULT": 1, "GS.FONT": 1, "SEARCH_HERE_FIRST": 1, "GS_INIT": 1, "GS_INIT.PS": 1, "TDEBUG": 2, "CDEBUG": 1, "BUILD_TIME_GS": 1, "#BUILD_TIME_GS": 1, "I": 1, ".ifdef": 18, "SYSLIB": 5, "JSRCDIR": 2, "sys": 4, "library": 4, ".else": 17, ".jpeg": 1, "b": 1, ".endif": 17, "JVERSION": 1, "PSRCDIR": 2, ".libpng": 1, "_2_8": 1, "PVERSION": 1, "ZSRCDIR": 2, ".zlib": 1, "_2_1": 1, "JBIG2SRCDIR": 2, ".jbig2dec": 1, "_7": 1, "ICCSRCDIR": 1, ".icclib": 1, "#IJSSRCDIR": 1, ".ijs": 1, "#IJSEXECTYPE": 1, "unix": 1, "SHARE_JPEG": 1, "SHARE_LIBPNG": 1, "SHARE_ZLIB": 1, "SHARE_JBIG2": 1, "X_INCLUDE": 2, "DECW": 8, "INCLUDE": 2, "SW_DEBUG": 3, "/DEBUG/NOOPTIMIZE": 1, "#SW_DEBUG": 1, "/NODEBUG/OPTIMIZE": 1, "/NODEBUG/NOOPTIMIZE": 1, "SW_PLATFORM": 2, "/DECC/PREFIX": 1, "ALL/NESTED_INCLUDE": 1, "PRIMARY/name": 1, "as_is": 1, "short": 1, "/nowarn": 1, "A4_PAPER": 2, "SW_PAPER": 3, "/DEFINE": 3, "IEEE": 3, "SW_IEEE": 3, "/float": 1, "ieee": 1, "COMP": 1, "LINKER": 2, "LINK/DEBUG/TRACEBACK": 1, "LINK/NODEBUG/NOTRACEBACK": 1, "INCDIR": 1, "LIBDIR": 1, "SYNC": 1, "posync": 1, "DEVICE_DEVS": 1, "x11.dev": 1, "x11alpha.dev": 1, "x11cmyk.dev": 1, "x11gray2.dev": 1, "x11gray4.dev": 1, "x11mono.dev": 1, "DEVICE_DEVS1": 1, "DEVICE_DEVS2": 1, "DEVICE_DEVS3": 1, "deskjet.dev": 1, "djet500.dev": 1, "laserjet.dev": 1, "ljetplus.dev": 1, "ljet2p.dev": 1, "ljet3.dev": 1, "ljet3d.dev": 1, "ljet4.dev": 1, "ljet4d.dev": 1, "DEVICE_DEVS4": 1, "cdeskjet.dev": 1, "cdjcolor.dev": 1, "cdjmono.dev": 1, "cdj550.dev": 1, "pj.dev": 1, "pjxl.dev": 1, "pjxl300.dev": 1, "DEVICE_DEVS5": 1, "uniprint.dev": 1, "DEVICE_DEVS6": 1, "bj10e.dev": 1, "bj200.dev": 1, "bjc600.dev": 1, "bjc800.dev": 1, "DEVICE_DEVS7": 1, "faxg3.dev": 1, "faxg32d.dev": 1, "faxg4.dev": 1, "DEVICE_DEVS8": 1, "pcxmono.dev": 1, "pcxgray.dev": 1, "pcx16.dev": 1, "pcx256.dev": 1, "pcx24b.dev": 1, "pcxcmyk.dev": 1, "DEVICE_DEVS9": 1, "pbm.dev": 1, "pbmraw.dev": 1, "pgm.dev": 1, "pgmraw.dev": 1, "pgnm.dev": 1, "pgnmraw.dev": 1, "DEVICE_DEVS10": 1, "tiffcrle.dev": 1, "tiffg3.dev": 1, "tiffg32d.dev": 1, "tiffg4.dev": 1, "tifflzw.dev": 1, "tiffpack.dev": 1, "DEVICE_DEVS11": 1, "tiff12nc.dev": 1, "tiff24nc.dev": 1, "DEVICE_DEVS12": 1, "psmono.dev": 1, "psgray.dev": 1, "psrgb.dev": 1, "bit.dev": 1, "bitrgb.dev": 1, "bitcmyk.dev": 1, "DEVICE_DEVS13": 1, "pngmono.dev": 1, "pnggray.dev": 1, "png16.dev": 1, "png256.dev": 1, "png16m.dev": 1, "pngalpha.dev": 1, "DEVICE_DEVS14": 1, "jpeg.dev": 1, "jpeggray.dev": 1, "DEVICE_DEVS15": 1, "pdfwrite.dev": 1, "pswrite.dev": 1, "epswrite.dev": 1, "pxlmono.dev": 1, "pxlcolor.dev": 1, "DEVICE_DEVS16": 1, "bbox.dev": 1, "DEVICE_DEVS17": 1, "pnm.dev": 1, "pnmraw.dev": 1, "ppm.dev": 1, "ppmraw.dev": 1, "pkm.dev": 1, "pkmraw.dev": 1, "pksm.dev": 1, "pksmraw.dev": 1, "DEVICE_DEVS18": 1, "DEVICE_DEVS19": 1, "DEVICE_DEVS20": 1, "DEVICE_DEVS21": 2, "FEATURE_DEVS": 1, "psl3.dev": 1, "pdf.dev": 1, "dpsnext.dev": 1, "ttfont.dev": 1, "epsf.dev": 1, "fapi.dev": 1, "jbig2.dev": 1, "COMPILE_INITS": 1, "BAND_LIST_STORAGE": 1, "BAND_LIST_COMPRESSOR": 1, "zlib": 1, "FILE_IMPLEMENTATION": 1, "stdio": 1, "STDIO_IMPLEMENTATION": 1, "c": 1, "EXTEND_NAMES": 2, "SYSTEM_CONSTANTS_ARE_WRITABLE": 2, "PLATFORM": 1, "openvms_": 1, "MAKEFILE": 2, "openvms.mmk": 1, "TOP_MAKEFILES": 3, "PLATOPT": 1, "PCFBASM": 1, "CMD": 1, "D": 1, "NULL": 1, "D_": 1, "I_": 1, "/INCLUDE": 1, "II": 1, "_I": 1, "O_": 1, "/OBJECT": 1, "Q": 1, "SYSTEM": 1, "DECC": 8, "COMPILER.EXE": 1, "SHARE": 1, "XTLIBSHRR5.EXE": 1, "/MACRO": 1, "DECWINDOWS1_2": 2, "GhostScript": 1, "complete": 1, "DEFINE/JOB": 4, "X11": 2, "ENVIRONMENT": 2, "DEFAULT": 2, "USER_INCLUDE": 1, "LIBRARY_INCLUDE": 1, "LIBRARY": 4, "openvms.opt": 1, "APPEND_L": 7, "Ident": 1, "gconfig_.h": 1, "this": 2, "indicates": 2, "presence": 1, "or": 1, "absence": 1, "certain": 2, "system": 1, "header": 1, "files": 1, "that": 1, "are": 1, "located": 1, "different": 2, "places": 1, "on": 1, "systems.": 1, "could": 1, "be": 1, "generated": 1, "by": 2, "GNU": 1, "configure": 1, "program.": 1, "gconfigv.h": 1, "status": 1, "machine": 1, "configuration": 1, "specific": 2, "features": 1, "derived": 1, "from": 1, "definitions": 1, "platform": 1, "makefile.": 1, "gconfig__h": 2, "ECHOGS_XE": 7, "EXP": 5, "w": 2, "x": 5, "define": 5, "gconfigv_h": 5, "a": 3, "Id": 1, "descrip.mms": 1, "Z": 1, "tmr": 2, "Project": 1, "LISP": 3, "Interpreter": 1, "Created": 1, "DEC": 4, "Author": 1, "cc": 3, "cflags": 1, "/define": 1, "/WARN": 1, "DISABLE": 1, "ZERODIV": 1, "FLOATOVERFL": 1, "NOMAINUFLO": 1, "/IEEE_MODE": 1, "UNDERFLOW_TO_ZERO/FLOAT": 1, "core": 4, "LISP_CORE": 2, "main": 4, "LISP_MAIN": 1, "exec": 3, "clib": 2, "VAXCRTL": 1, "head": 3, "objs": 3, "DEFINE/NOLOG": 1, "LNK": 2, "LINK/EXEC": 1, "DEASSIGN": 1, ".c": 2, ".h": 2, "clean": 4, "del": 2, "*.obj": 3, "*.exe": 3, "Description": 1, "for": 8, "xv": 4, "Written": 1, "Rick": 1, "Dyson": 1, "dyson@iowasp.physics.uiowa.edu": 1, "Last": 1, "Modified": 1, "APR": 2, "v2.21": 2, "OCT": 1, "export.lcs.mit.edu": 1, "version": 2, "seemed": 1, "change": 1, "about": 1, "Sep": 1, "without": 1, "number": 1, "changing.": 1, "FEB": 1, "v2.21b": 1, "ALPHA": 5, "support": 1, "ALPHA.MMS": 2, "MAR": 1, "v3.00": 2, "C": 2, "changes": 1, "MAY": 1, "merged": 1, "MAKEFILE.MMS": 8, "v3.10": 3, "Most": 1, "Unix": 1, "comments": 1, "have": 1, "been": 1, "left": 1, "intact": 1, "help": 3, "debug": 1, "any": 1, "problems.": 1, "Sys": 16, "Disk": 8, "################": 1, "CONFIGURATION": 1, "OPTIONS": 1, "#################": 1, "JPEG": 2, "HAVE_JPEG": 1, "JPEGDIR": 4, ".JPEG": 3, "JPEGLIB": 5, "LIBJPEG.OLB": 3, "JPEGINCLUDE": 2, "TIFF": 2, "HAVE_TIFF": 1, "TIFFDIR": 4, ".TIFF": 3, "TIFFLIB": 5, "LIBTIFF.OLB": 4, "TIFFINCLUDE": 2, "PDS": 2, "HAVE_PDS": 1, "DEC_XUI": 2, "XUI": 2, "HAVE_XUI": 1, "DEFS": 2, "/Define": 1, "VMS": 3, "TIMERS": 1, "INCS": 2, "/Include": 1, "OPTIMIZE": 4, "/Optimize": 3, "/Standard": 2, "VAXC": 2, "OPTS": 12, "DECC_OPTIONS.OPT": 2, "/Warnings": 1, "NoInformationals": 1, "VAXC_OPTIONS.OPT": 1, "/NoDebug": 1, "CFLAGS": 2, "LINKFLAGS": 8, "XVLIB": 12, "LIBXV.OLB": 1, "OBJS": 4, "xv.obj": 3, "xvevent.obj": 1, "xvroot.obj": 1, "xvmisc.obj": 1, "xvimage.obj": 1, "xvcolor.obj": 1, "xvsmooth.obj": 1, "xv24to8.obj": 1, "xvgif.obj": 1, "xvpm.obj": 1, "xvinfo.obj": 1, "xvctrl.obj": 1, "xvscrl.obj": 1, "xvalg.obj": 1, "xvgifwr.obj": 1, "xvdir.obj": 1, "xvbutt.obj": 1, "xvpbm.obj": 1, "xvxbm.obj": 1, "xvgam.obj": 1, "xvbmp.obj": 1, "xvdial.obj": 1, "xvgraf.obj": 1, "xvsunras.obj": 1, "xvjpeg.obj": 1, "xvps.obj": 1, "xvpopup.obj": 1, "xvdflt.obj": 1, "xvtiff.obj": 1, "xvtiffwr.obj": 1, "xvpds.obj": 1, "xvrle.obj": 1, "xviris.obj": 1, "xvgrab.obj": 1, "xvbrowse.obj": 1, "xviff.obj": 1, "xvtext.obj": 1, "xvpcx.obj": 1, "xvtarga.obj": 1, "xvxpm.obj": 1, "xvcut.obj": 1, "xvxwd.obj": 1, "xvfits.obj": 1, "vms.obj": 2, "BITS": 2, ".Bits": 3, "annot.h": 2, "MISC": 1, "readme.": 1, "changelog.": 1, "ideas.": 1, "Define": 4, "/NoLog": 7, "Library_Include": 2, "Library": 7, "Include": 1, "XVDIR": 1, "Environment": 1, "lib": 2, "bggen": 2, "decompress": 2, "xcmap": 2, "xvpictoppm": 2, "All": 1, "Finished": 1, "with": 1, "build": 1, "XV": 2, "Continue": 7, "xv.exe": 3, "bggen.exe": 3, "xcmap.exe": 2, "xvpictoppm.exe": 2, "xv.hlb": 2, "decompress.exe": 3, "vdcomp.exe": 3, "bggen.obj": 2, "LINK": 6, "/Library": 9, "/Option": 6, "xcmap.obj": 2, "xvpictoppm.obj": 2, "Set": 12, "Default": 9, "MMSDEFAULTS": 5, "/Description": 7, "/Macro": 3, "If": 1, "Then": 1, "/Create": 1, "/Replace": 1, "decompress.obj": 2, "vdcomp.obj": 2, "Protection": 3, "Owner": 3, "RWED": 2, "*.": 2, "Rename": 1, "*.H": 2, "RWE": 1, "various": 1, "dependencies": 1, "xv.h": 1, "config.h": 1, "xv.hlp": 1, "includes.h": 1, "dirent.h": 1, "VAXC_Options.opt": 2, "Open": 1, "/Write": 1, "TMP": 22, "Write": 20, "XLibShr.exe": 2, "/Share": 4, "XMLibShr12.exe": 1, "Linker": 1, "Options": 1, "list": 1, "LibXV.olb": 1, "LibJPEG.olb": 1, "LibTIFF.olb": 1, "XTShr.exe": 1, "Close": 1, "install": 1, "Copy": 1, "Delete": 2, "/NoConfirm": 3, "*.log": 1, "*.olb": 2, "*.hlb": 1, "Purge": 1 }, "Monkey": { "Strict": 1, "sample": 1, "class": 1, "from": 1, "the": 1, "documentation": 1, "Class": 3, "Game": 1, "Extends": 2, "App": 1, "Function": 2, "New": 1, "(": 12, ")": 12, "End": 8, "DrawSpiral": 3, "clock": 3, "Local": 3, "w": 3, "DeviceWidth/2": 1, "For": 1, "i#": 1, "Until": 1, "w*1.5": 1, "Step": 1, ".2": 1, "x#": 1, "y#": 1, "x": 2, "+": 5, "i*Sin": 1, "i*3": 1, "y": 2, "i*Cos": 1, "i*2": 1, "DrawRect": 1, "Next": 1, "hitbox.Collide": 1, "event.pos": 1, "Field": 2, "updateCount": 3, "Method": 4, "OnCreate": 1, "Print": 2, "SetUpdateRate": 1, "OnUpdate": 1, "OnRender": 1, "Cls": 1, "updateCount*1.1": 1, "Enemy": 1, "Die": 1, "Abstract": 1, "field": 1, "testField": 1, "Bool": 2, "True": 2, "oss": 1, "he": 2, "-": 2, "killed": 1, "me": 1, "b": 6, "extending": 1, "with": 1, "generics": 1, "VectorNode": 1, "Node": 1, "": 1, "array": 1, "syntax": 1, "Global": 14, "listOfStuff": 3, "String": 4, "[": 6, "]": 6, "lessStuff": 1, "oneStuff": 1, "a": 3, "comma": 1, "separated": 1, "sequence": 1, "text": 1, "worstCase": 1, "worst.List": 1, "": 1, "escape": 1, "characers": 1, "in": 1, "strings": 1, "string3": 1, "string4": 1, "string5": 1, "string6": 1, "prints": 1, ".ToUpper": 1, "Boolean": 1, "shorttype": 1, "boolVariable1": 1, "boolVariable2": 1, "False": 1, "preprocessor": 1, "keywords": 1, "#If": 1, "TARGET": 2, "DoStuff": 1, "#ElseIf": 1, "DoOtherStuff": 1, "#End": 1, "operators": 1, "|": 2, "&": 1, "c": 1 }, "Moocode": { "@program": 29, "toy": 3, "wind": 1, "this.wound": 8, "+": 39, ";": 505, "player": 2, "tell": 1, "(": 600, "this.name": 4, ")": 593, "player.location": 1, "announce": 1, "player.name": 1, ".": 30, "while": 15, "read": 1, "endwhile": 14, "I": 1, "M": 1, "P": 1, "O": 1, "R": 1, "T": 2, "A": 1, "N": 1, "The": 2, "following": 2, "code": 43, "cannot": 1, "be": 1, "used": 1, "as": 28, "is.": 1, "You": 1, "will": 1, "need": 1, "to": 1, "rewrite": 1, "functionality": 1, "that": 3, "is": 6, "not": 2, "present": 1, "in": 43, "your": 1, "server/core.": 1, "most": 1, "straight": 1, "-": 98, "forward": 1, "target": 7, "other": 1, "than": 1, "Stunt/Improvise": 1, "a": 12, "server/core": 1, "provides": 1, "map": 5, "datatype": 1, "and": 1, "anonymous": 1, "objects.": 1, "Installation": 1, "my": 1, "server": 1, "uses": 1, "the": 4, "object": 1, "numbers": 1, "#36819": 1, "MOOcode": 4, "Experimental": 2, "Language": 2, "Package": 2, "#36820": 1, "Changelog": 1, "#36821": 1, "Dictionary": 1, "#36822": 1, "Compiler": 2, "#38128": 1, "Syntax": 4, "Tree": 1, "Pretty": 1, "Printer": 1, "#37644": 1, "Tokenizer": 2, "Prototype": 25, "#37645": 1, "Parser": 2, "#37648": 1, "Symbol": 2, "#37649": 1, "Literal": 1, "#37650": 1, "Statement": 8, "#37651": 1, "Operator": 11, "#37652": 1, "Control": 1, "Flow": 1, "#37653": 1, "Assignment": 2, "#38140": 1, "Compound": 1, "#38123": 1, "Prefix": 1, "#37654": 1, "Infix": 1, "#37655": 1, "Name": 1, "#37656": 1, "Bracket": 1, "#37657": 1, "Brace": 1, "#37658": 1, "If": 1, "#38119": 1, "For": 1, "#38120": 1, "Loop": 1, "#38126": 1, "Fork": 1, "#38127": 1, "Try": 1, "#37659": 1, "Invocation": 1, "#37660": 1, "Verb": 1, "Selector": 2, "#37661": 1, "Property": 1, "#38124": 1, "Error": 1, "Catching": 1, "#38122": 1, "Positional": 1, "#38141": 1, "From": 1, "#37662": 1, "Utilities": 1, "#36823": 1, "Tests": 4, "#36824": 1, "#37646": 1, "#37647": 1, "parent": 1, "plastic.tokenizer_proto": 4, "_": 4, "_ensure_prototype": 4, "application/x": 27, "moocode": 27, "typeof": 11, "this": 114, "OBJ": 3, "||": 19, "raise": 23, "E_INVARG": 3, "_ensure_instance": 7, "ANON": 2, "plastic.compiler": 3, "_lookup": 2, "private": 1, "{": 112, "name": 9, "}": 112, "args": 26, "if": 90, "value": 73, "this.variable_map": 3, "[": 99, "]": 102, "E_RANGE": 17, "return": 61, "else": 45, "tostr": 51, "random": 3, "this.reserved_names": 1, "endif": 93, "compile": 1, "source": 32, "options": 3, "tokenizer": 6, "this.plastic.tokenizer_proto": 2, "create": 16, "parser": 89, "this.plastic.parser_proto": 2, "compiler": 2, "try": 2, "statements": 13, "except": 2, "ex": 4, "ANY": 3, ".tokenizer.row": 1, "endtry": 2, "for": 31, "statement": 29, "statement.type": 10, "@source": 3, "p": 82, "@compiler": 1, "endfor": 31, "ticks_left": 4, "<": 13, "seconds_left": 4, "&&": 39, "suspend": 4, "statement.value": 20, "elseif": 41, "_generate": 1, "isa": 21, "this.plastic.sign_operator_proto": 1, "|": 9, "statement.first": 18, "statement.second": 13, "this.plastic.control_flow_statement_proto": 1, "first": 22, "statement.id": 3, "this.plastic.if_statement_proto": 1, "s": 47, "respond_to": 9, "@code": 28, "@this": 13, "i": 29, "length": 11, "LIST": 6, "this.plastic.for_statement_proto": 1, "statement.subtype": 2, "this.plastic.loop_statement_proto": 1, "prefix": 4, "this.plastic.fork_statement_proto": 1, "this.plastic.try_statement_proto": 1, "x": 9, "@x": 3, "join": 6, "this.plastic.assignment_operator_proto": 1, "statement.first.type": 1, "res": 19, "rest": 3, "v": 17, "statement.first.value": 1, "v.type": 2, "v.first": 2, "v.second": 1, "this.plastic.bracket_operator_proto": 1, "statement.third": 4, "this.plastic.brace_operator_proto": 1, "this.plastic.invocation_operator_proto": 1, "@a": 2, "statement.second.type": 2, "this.plastic.property_selector_operator_proto": 1, "this.plastic.error_catching_operator_proto": 1, "second": 18, "this.plastic.literal_proto": 1, "toliteral": 1, "this.plastic.positional_symbol_proto": 1, "this.plastic.prefix_operator_proto": 3, "this.plastic.infix_operator_proto": 1, "this.plastic.traditional_ternary_operator_proto": 1, "this.plastic.name_proto": 1, "plastic.printer": 2, "_print": 4, "indent": 4, "result": 7, "item": 2, "@result": 2, "E_PROPNF": 1, "print": 1, "instance": 59, "instance.row": 1, "instance.column": 1, "instance.source": 1, "advance": 16, "this.token": 21, "this.source": 3, "row": 23, "this.row": 2, "column": 63, "this.column": 2, "eol": 5, "block_comment": 6, "inline_comment": 4, "loop": 14, "len": 3, "continue": 16, "next_two": 4, "column..column": 1, "c": 44, "break": 6, "re": 1, "not.": 1, "Worse": 1, "*": 4, "valid": 2, "error": 6, "like": 4, "E_PERM": 4, "treated": 2, "literal": 2, "an": 2, "invalid": 2, "E_FOO": 1, "variable.": 1, "Any": 1, "starts": 1, "with": 1, "characters": 1, "*now*": 1, "but": 1, "errors": 1, "are": 1, "errors.": 1, "*/": 1, "<=>": 8, "z": 4, "col1": 6, "mark": 2, "start": 2, "1": 13, "9": 4, "col2": 4, "chars": 21, "index": 2, "E_": 1, "token": 24, "type": 9, "this.errors": 1, "col1..col2": 2, "toobj": 1, "float": 4, "0": 1, "cc": 1, "e": 1, "tofloat": 1, "toint": 1, "esc": 1, "q": 1, "col1..column": 1, "plastic.parser_proto": 3, "@options": 1, "instance.tokenizer": 1, "instance.symbols": 1, "plastic": 1, "this.plastic": 1, "symbol": 65, "plastic.name_proto": 1, "plastic.literal_proto": 1, "plastic.operator_proto": 10, "plastic.prefix_operator_proto": 1, "plastic.error_catching_operator_proto": 3, "plastic.assignment_operator_proto": 1, "plastic.compound_assignment_operator_proto": 5, "plastic.traditional_ternary_operator_proto": 2, "plastic.infix_operator_proto": 13, "plastic.sign_operator_proto": 2, "plastic.bracket_operator_proto": 1, "plastic.brace_operator_proto": 1, "plastic.control_flow_statement_proto": 3, "plastic.if_statement_proto": 1, "plastic.for_statement_proto": 1, "plastic.loop_statement_proto": 2, "plastic.fork_statement_proto": 1, "plastic.try_statement_proto": 1, "plastic.from_statement_proto": 2, "plastic.verb_selector_operator_proto": 2, "plastic.property_selector_operator_proto": 2, "plastic.invocation_operator_proto": 1, "id": 14, "bp": 3, "proto": 4, "nothing": 1, "this.plastic.symbol_proto": 2, "this.symbols": 4, "clone": 2, "this.token.type": 1, "this.token.value": 1, "this.token.eol": 1, "operator": 1, "variable": 1, "identifier": 1, "keyword": 1, "Unexpected": 1, "end": 2, "Expected": 1, "t": 1, "call": 1, "nud": 2, "on": 1, "@definition": 1, "new": 4, "pop": 4, "delete": 1, "plastic.utilities": 6, "suspend_if_necessary": 4, "parse_map_sequence": 1, "separator": 6, "infix": 3, "terminator": 6, "symbols": 7, "ids": 6, "@ids": 2, "push": 3, "@symbol": 2, ".id": 13, "key": 7, "expression": 19, "@map": 1, "parse_list_sequence": 2, "list": 3, "@list": 1, "validate_scattering_pattern": 1, "pattern": 5, "state": 8, "element": 1, "element.type": 3, "element.id": 2, "element.first.type": 2, "children": 4, "node": 3, "node.value": 1, "@children": 1, "match": 1, "root": 2, "keys": 3, "matches": 3, "stack": 4, "next": 2, "top": 5, "@stack": 2, "top.": 1, "@matches": 1, "plastic.symbol_proto": 2, "opts": 2, "instance.id": 1, "instance.value": 1, "instance.bp": 1, "k": 3, "instance.": 1, "parents": 3, "ancestor": 2, "ancestors": 1, "property": 1, "properties": 1, "this.type": 8, "this.first": 8, "import": 8, "this.second": 7, "left": 2, "this.third": 3, "sequence": 2, "led": 4, "this.bp": 2, "second.type": 2, "make_identifier": 4, "first.id": 1, "parser.symbols": 2, "reserve_keyword": 2, "this.plastic.utilities": 1, "third": 4, "third.id": 2, "second.id": 1, "std": 1, "reserve_statement": 1, "types": 7, ".type": 1, "target.type": 3, "target.value": 3, "target.id": 4, "temp": 4, "temp.id": 1, "temp.first.id": 1, "temp.first.type": 2, "temp.second.type": 1, "temp.first": 2, "imports": 5, "import.type": 2, "@imports": 2, "parser.plastic.invocation_operator_proto": 1, "temp.type": 1, "parser.plastic.name_proto": 2, "temp.first.value": 1, "temp.second": 1, "first.type": 1, "parser.imports": 2, "import.id": 2, "parser.plastic.assignment_operator_proto": 1, "result.type": 1, "result.first": 1, "result.second": 1, "@verb": 1, "do_the_work": 3, "none": 1, "object_utils": 1, "this.location": 3, "room": 1, "announce_all": 2, "continue_msg": 1, "fork": 1, "endfork": 1, "wind_down_msg": 1 }, "MoonScript": { "types": 2, "require": 5, "util": 2, "data": 1, "import": 5, "reversed": 2, "unpack": 29, "from": 4, "ntype": 23, "mtype": 3, "build": 8, "smart_node": 9, "is_slice": 2, "value_is_singular": 3, "insert": 25, "table": 1, "NameProxy": 22, "LocalName": 3, "destructure": 1, "local": 1, "implicitly_return": 4, "class": 5, "Run": 10, "new": 3, "(": 82, "@fn": 1, ")": 82, "self": 2, "[": 113, "]": 113, "call": 3, "state": 2, "self.fn": 1, "apply_to_last": 8, "stms": 3, "fn": 8, "-": 29, "last_exp_id": 3, "for": 26, "i": 19, "#stms": 1, "stm": 27, "if": 63, "and": 15, "break": 1, "return": 12, "in": 18, "ipairs": 3, "else": 33, "is_singular": 3, "body": 38, "false": 4, "#body": 1, "true": 6, "find_assigns": 2, "out": 9, "{": 218, "}": 218, "thing": 4, "*body": 2, "switch": 8, "when": 14, "table.insert": 5, "extract": 1, "names": 20, "hoist_declarations": 2, "assigns": 3, "*find_assigns": 1, "name": 36, "*names": 3, "type": 8, "idx": 4, "while": 5, "do": 3, "+": 2, "expand_elseif_assign": 2, "ifstm": 5, "#ifstm": 1, "case": 13, "split": 3, "constructor_name": 2, "with_continue_listener": 4, "continue_name": 13, "nil": 12, "@listen": 3, "unless": 7, "@put_name": 3, "build.group": 16, "@splice": 1, "lines": 2, "Transformer": 3, "@transformers": 3, "@seen_nodes": 3, "setmetatable": 1, "__mode": 1, "transform": 1, "scope": 5, "node": 120, "...": 6, "transformer": 3, "res": 3, "or": 11, "bind": 1, "@transform": 2, "__call": 1, "can_transform": 1, "construct_comprehension": 3, "inner": 4, "clauses": 6, "current_stms": 7, "_": 12, "clause": 4, "t": 17, "iter": 2, "elseif": 3, "cond": 13, "error": 4, "..t": 1, "Statement": 2, "root_stms": 1, "@": 1, "assign": 7, "values": 12, "transformed": 2, "#values": 1, "value": 9, "@transform.statement": 4, "types.cascading": 2, "ret": 18, "types.is_value": 3, "destructure.has_destructure": 2, "destructure.split_assign": 1, "continue": 1, "@send": 1, "build.assign_one": 18, "export": 1, "#node": 7, "cls": 6, "cls.name": 1, "build.assign": 6, "update": 4, "op": 2, "exp": 19, "op_final": 3, "match": 1, "..op": 1, "not": 5, "source": 7, "stubs": 1, "real_names": 4, "build.chain": 13, "base": 15, "stub": 8, "*stubs": 2, "source_name": 3, "comprehension": 2, "action": 4, "decorated": 2, "dec": 6, "wrapped": 4, "fail": 5, "..": 1, "build.declare": 1, "*stm": 1, "destructure.build_assign": 2, "build.do": 2, "body_idx": 4, "with": 5, "block": 4, "scope_name": 5, "named_assign": 2, "assign_name": 1, "@set": 2, "foreach": 3, "node.iter": 1, "destructures": 5, "node.names": 3, "proxy": 2, "next": 1, "node.body": 13, "list": 5, "index_name": 3, "list_name": 6, "slice_var": 3, "bounds": 3, "slice": 11, "#list": 1, "table.remove": 3, "max_tmp_name": 5, "index": 6, "conds": 1, "exp_name": 3, "convert_cond": 2, "case_exps": 3, "cond_exp": 5, "first": 3, "if_stm": 5, "*conds": 1, "if_cond": 4, "parent_assign": 3, "parent_val": 3, "statements": 4, "properties": 4, "item": 7, "tuple": 8, "*item": 1, "constructor": 6, "*properties": 1, "key": 3, "parent_cls_name": 15, "base_name": 13, "self_name": 4, "cls_name": 7, "build.fndef": 5, "args": 4, "arrow": 1, "then": 8, "constructor.arrow": 1, "real_name": 6, "last": 4, "#real_name": 1, "build.table": 4, "class_lookup": 3, "cls_mt": 2, "out_body": 3, "chain": 7, "*chain": 1, "new_chain": 6, "head": 6, "calling_name": 4, "get": 1, "*slice": 1, ".assign_one": 7, ".if": 2, ".chain": 2, ".group": 5, "#statements": 1, ".declare": 1, ".do": 1, "Accumulator": 3, "@accum_name": 4, "@value_name": 5, "@len_name": 4, "convert": 2, "@body_idx": 1, "@mutate_body": 1, "@wrap": 1, "wrap": 2, "build.block_exp": 9, "mutate_body": 2, "skip_nil": 3, "val": 2, "n": 4, "default_accumulator": 4, "is_top": 3, "scope.transform.statement": 2, "types.manual_return": 1, "types.comprehension_has_value": 1, "Value": 2, "string": 2, "delim": 2, "convert_part": 4, "part": 9, "<=>": 1, "3": 4, "e": 4, "i=": 1, "a": 3, "tblcomprehension": 1, "explist": 2, "key_exp": 3, "value_exp": 3, "accum": 5, "dest": 4, "key_name": 3, "val_name": 3, "fndef": 1, "capture": 1, "event": 1, "data.lua_keywords": 1, "fn_name": 3, "is_super": 2, "@transform.value": 1, "block_exp": 1, "arg_list": 3, "fn.args": 1, "@unlisten": 1 }, "NCL": { ";": 806, "*****************************************************": 4, "cru_8.ncl": 1, "Concepts": 7, "illustrated": 7, "-": 1274, "Plotting": 2, "CRU": 1, "(": 717, "Climate": 1, "Research": 1, "Unit": 1, ")": 716, "/": 106, "BADC": 1, "data": 47, "Selecting": 1, "a": 59, "sub": 1, "period": 1, "calculating": 1, "climatology": 2, "Drawing": 8, "raster": 6, "contours": 5, "very": 2, "basic": 1, "graphics": 2, "load": 33, "not": 12, "needed": 5, "onward": 3, "create": 21, "references": 1, "pointers": 1, "to": 48, "the": 64, "files": 3, "diri": 16, "fcld": 3, "addfile": 17, "+": 84, "fdtr": 2, "ffrs": 2, "fpet": 2, "fpre": 2, "ftmn": 2, "ftmp": 2, "ftmx": 2, "fvap": 2, "fwet": 2, "specify": 3, "start": 3, "&": 34, "last": 3, "dates": 2, "arbitrary": 1, "ymStrt": 1, "ymLast": 1, "get": 4, "index": 6, "values": 7, "of": 31, "start/lat": 1, "time": 26, "yyyymm": 1, "cd_calendar": 1, "ntStrt": 11, "ind": 3, "yyyymm.eq.ymStrt": 1, "ntLast": 11, "yyyymm.eq.ymLast": 1, "read": 8, "segment": 1, "cld": 4, "dtr": 3, "frs": 3, "pet": 3, "pre": 3, "tmn": 3, "tmp": 5, "tmx": 3, "vap": 3, "wet": 3, "printVarSummary": 10, "[": 23, "|": 6, "]": 23, "x": 24, "lat": 29, "lon": 29, "calculate": 3, "monthly": 1, "climatologies": 1, "cldclm": 3, "clmMonTLL": 10, "dtrclm": 2, "frsclm": 2, "petclm": 2, "preclm": 2, "tmnclm": 2, "tmpclm": 2, "tmxclm": 2, "vapclm": 2, "wetclm": 2, "month": 4, "************************************": 5, "plots": 17, "...": 4, "simple": 1, "nt": 11, "yrStrt": 2, "ymStrt/100": 1, "yrLast": 2, "ymLast/100": 1, "title": 13, "wks": 96, "gsn_open_wks": 12, "open": 6, "ps": 4, "file": 15, "gsn_define_colormap": 7, "choose": 4, "colormap": 6, "plot": 78, "new": 41, "graphic": 8, "array": 9, "res": 39, "True": 50, "res@cnFillOn": 7, "turn": 9, "on": 19, "color": 17, "fill": 6, "res@cnFillMode": 6, "Raster": 3, "Mode": 2, "res@cnLinesOn": 7, "False": 52, "Turn": 11, "off": 14, "contour": 18, "lines": 9, "res@gsnDraw": 8, "do": 20, "draw": 26, "picture": 1, "res@gsnFrame": 6, "advance": 6, "frame": 19, "res@lbOrientation": 2, "vertical": 1, "label": 3, "bar": 1, "resp": 6, "resp@gsnMaximize": 1, "make": 4, "eps": 2, "pdf": 2, "large": 3, "resp@txString": 5, "gsn_csm_contour_map_ce": 13, "gsn_panel": 8, "/2": 5, "colors": 7, "res@cnFillPalette": 1, "optional": 1, "distinct": 1, "for": 32, "categories": 1, "res@cnLevelSelectionMode": 5, "use": 13, "unequal": 1, "spacing": 2, "res@cnLevels": 2, "/2.0": 1, "********************": 1, "Inputs": 3, "Regarding": 3, "Input": 3, "and": 23, "Output": 1, "Data": 2, "*************************************": 1, "netCDFFilePath": 1, "outputFilePath": 1, "*******************": 2, "Structure": 1, "***********************************************": 2, "lPlotVariablesList": 1, "rPlotVariablesList": 1, "xDimName": 1, "xDimSize": 1, "View": 1, "Annotations": 1, "****************************************": 1, "yLAxisLabel": 1, "yRAxisLabel": 1, "*******************END": 1, "INPUTS": 1, "********************************************************************": 1, "**************************************************************": 1, "User": 2, "***************************************************************": 12, "INPUT": 1, "input": 1, "directory": 2, "fili": 11, "pltDir": 2, "output": 2, "sfx": 3, "get_file_suffix": 2, "pltName": 5, "sfx@fBase": 2, "name": 4, "pltType": 6, "End": 1, "Open": 4, "SEVIRI": 1, "L3": 1, "HDF": 1, "Note": 1, "rather": 2, "unusual": 1, "format": 4, "flag": 11, "*prepended*": 1, "value": 3, "integer": 8, "twc_lv3": 2, "fakeDim0": 1, "fakeDim1": 1, "long_name": 2, "total": 1, "water": 4, "vapour": 3, "column": 3, "units": 3, "fmmmm": 2, "I4": 1, "valid_range": 1, "_FillValue": 2, "legend_01": 1, "f": 20, "legend_02": 1, "averaged": 2, "level": 4, "legend_03": 1, "interpolated": 1, "from": 11, "legend_04": 1, "gaps": 1, "filled": 2, "with": 9, "NVAP": 1, "legend_05": 1, "mmmm": 2, "in": 16, "mm": 2, "*": 12, "as": 12, "legend_06": 1, "Example": 2, "means": 1, "min_lat": 1, "max_lat": 1, "min_lon": 1, "max_lon": 1, "dlat": 1, "dlon": 1, "ifx": 3, "ifx/10000": 1, "extract": 2, "ix": 7, "flag*10000": 1, "ix*0.01": 1, "scale": 2, "meta": 5, "dimx": 3, "dimsizes": 12, "nlat": 11, "grid": 4, "size": 4, "mlon": 10, "fspan": 5, "ifx@min_lat": 1, "ifx@max_lat": 1, "lat@units": 3, "ifx@min_lon": 1, "ifx@max_lon": 1, "lon@units": 3, "x@long_name": 1, "x@units": 1, "delete": 14, "/ifx": 1, "ix/": 1, "no": 1, "longer": 1, "Create": 5, "mods": 3, "desired": 4, "res@gsnAddCyclic": 5, "noty": 1, "global": 2, "res@cnLineLabelsOn": 4, "res@cnMissingValFillColor": 1, "res@mpCenterLonF": 2, "min": 7, "max": 6, "res@mpMinLatF": 2, "res@mpMaxLatF": 2, "res@mpMinLonF": 2, "res@mpMaxLonF": 2, "copy_VarCoords": 1, "flag@long_name": 1, "flag@units": 1, "print": 13, "{": 5, "}": 5, "set": 9, "manual": 1, "levels": 2, "res@cnMinLevelValF": 2, "res@cnMaxLevelValF": 2, "one": 5, "less": 1, "than": 2, "res@cnLevelSpacingF": 3, "res@lbLabelStrings": 1, "ispan": 3, "res@lbLabelPosition": 1, "position": 1, "res@lbLabelAlignment": 1, "res@gsnLeftString": 5, "res@gsnRightString": 5, "res@gsnCenterString": 3, "resP": 4, "modify": 2, "panel": 6, "resP@txString": 2, "resP@gsnMaximize": 2, "/1": 3, "now": 3, "mask_12.ncl": 1, "Using": 7, "worldwide": 1, "shapefile": 4, "land/ocean": 1, "mask": 7, "Masking": 1, "based": 2, "geographical": 1, "area": 5, "Attaching": 4, "polylines": 4, "map": 24, "lat/lon": 4, "points": 2, "using": 8, "gsn_coordinates": 4, "Downloaded": 1, "GSHHS": 1, "shapefiles": 1, "http": 1, "//www.ngdc.noaa.gov/mgg/shorelines/data/gshhg/latest/": 1, "Used": 1, ".": 4, "Main": 3, "code": 3, "begin": 11, "WRITE_MASK": 2, "DEBUG": 2, "Read": 3, "dir": 2, "cdf_prefix": 3, "cdf_file": 3, "fin": 3, "u": 14, "U": 1, "same": 4, "shapefile.": 1, "shpfile": 5, "opt": 2, "opt@return_mask": 1, "land_mask": 3, "shapefile_mask_data": 1, "Mask": 1, "against": 1, "land": 3, "ocean.": 1, "u_land_mask": 4, "where": 2, "land_mask.eq.1": 1, "u@_FillValue": 2, "u_ocean_mask": 4, "land_mask.eq.0": 1, "copy_VarMeta": 2, "Start": 1, "res@gsnMaximize": 5, "maximize": 3, "don": 9, "t": 10, "yet": 2, "Make": 3, "sure": 2, "both": 1, "have": 2, "mnmxint": 4, "nice_mnmxintvl": 1, "res@lbLabelBarOn": 2, "res@mpFillOn": 4, "res@mpOutlineOn": 1, "original": 2, "attach": 2, "outlines": 2, "res@tiMainString": 9, "map_data": 3, "gsn_csm_contour_map": 8, "dum1": 1, "gsn_add_shapefile_polylines": 3, "masked": 1, "map_land_mask": 4, "map_ocean_mask": 3, "if": 45, "then": 25, "mkres": 4, "mkres@gsMarkerSizeF": 1, "mkres@gsnCoordsAttach": 1, "mkres@gsnCoordsNonMissingColor": 1, "mkres@gsnCoordsMissingColor": 1, "end": 43, "Add": 2, "dum2": 1, "dum3": 1, "Draw": 14, "all": 5, "three": 1, "page": 4, "pres": 2, "pres@gsnMaximize": 1, "pres@gsnPanelLabelBar": 1, "/map_data": 1, "map_ocean_mask/": 1, "/3": 1, "Close": 1, "before": 1, "we": 4, "again.": 1, "copy": 1, "so": 2, "s": 6, "safer.": 1, "new_cdf_file": 3, "system": 1, "finout": 3, "filevardef": 1, "typeof": 1, "/land_mask/": 1, "mcsst_1.ncl": 1, "NAVO": 1, "MCSST": 1, "fbindirread": 2, "fortran": 1, "binary": 4, "Converting": 1, "Adding": 2, "attributes": 2, "coordinates": 2, "variable": 5, "gray": 2, "an": 8, "existing": 2, "Spanning": 1, "but": 2, "two": 6, "***************************************": 15, "type": 3, "available": 1, "ipar": 7, "Weekly": 2, "Binned": 2, "Sea": 5, "Surface": 4, "Temperature": 4, "Number": 1, "Points": 1, "Bin": 1, "Anomaly": 2, "Interpolated": 2, "fname": 3, "/1024": 2, "convert": 7, "float": 24, "change": 3, "true": 1, "SST": 1, "xslope": 1, "ipar.eq.4.or.ipar.eq.2": 1, "anom": 1, "has": 1, "different": 3, "intercept": 1, "yint": 3, "ipar.eq.3.or.ipar.eq.0": 2, "sst": 9, "var": 1, "tmp*xslope": 1, "unecessary": 1, "assign": 6, "missing": 4, "values.": 1, "The": 5, "was": 5, "zero": 1, "since": 1, "it": 3, "assigned": 2, "NCL": 6, "recognized.": 1, "are": 8, "listed": 1, "below.": 2, "These": 1, "will": 8, "be": 9, "changed": 1, "later.": 3, "ipar.eq.4": 1, "sst@_FillValue": 3, "coordinate": 2, "variables": 5, "dy": 1, "/nlat": 1, "*dy": 1, "dy/2": 1, "nlon": 1, "dx": 1, "/nlon": 1, "*dx": 1, "dx/2": 1, "note": 1, "added": 1, "by": 4, "sjm": 1, "align": 1, "out": 2, "netCDF": 2, "model": 7, "dimensions": 1, "ditto": 1, "reverse": 1, "orientation": 1, "sst@long_name": 1, "sst@units": 1, "cv": 2, "year": 19, "day": 7, "filename": 1, "stringtochar": 1, "parse": 1, "date": 13, "jday": 2, "center": 2, "string": 8, "workstation": 1, "destination": 1, "This": 8, "necessary": 1, "V6.1.0": 2, "Named": 1, "can": 3, "used": 2, "without": 1, "having": 1, "first": 3, "add": 9, "them": 2, "map.": 5, "d": 1, "NhlNewColor": 1, "res@gsnSpreadColors": 2, "full": 2, "range": 4, "res@gsnSpreadColorStart": 1, "at": 4, "res@gsnSpreadColorEnd": 1, "mb": 1, "default": 2, "size.": 1, "mode": 2, "val": 1, "val/4.": 1, "undef": 1, "function": 4, "PrnOscPat_driver": 1, "eof": 5, "numeric": 4, "eof_ts": 10, "kPOP": 4, "compute": 2, "Principal": 1, "Oscillation": 1, "Patterns": 1, "POPs": 2, "local": 2, "dim_ts": 3, "dim_eof": 5, "neof": 8, "ntim": 13, "dnam_ts": 5, "dnam_eof": 8, "j": 6, "cov0": 5, "cov1": 4, "cov0_inverse": 2, "A": 4, "z": 15, "Z": 9, "pr": 4, "pi": 4, "zr": 4, "zi": 4, "mean": 4, "stdev": 5, "evlr": 7, "eigi": 2, "eigr": 2, "getvardims": 2, "dimension": 1, "names": 2, "lag": 5, "matrices": 1, "get_ncl_version": 1, ".eq.": 1, "bug": 1, "covcorm": 2, "covariance": 2, "matrix": 3, "else": 1, "/0": 5, "n": 2, "either": 1, "covcorm_xy": 2, "alternative": 1, "brute": 1, "force": 1, "contains": 2, "information": 2, "evolution": 1, "POP": 6, "system.": 1, "eigenvectors": 2, "A.": 1, "inverse_matrix": 2, "cov1#inverse_matrix": 1, "dgeevx": 1, "N": 2, "left": 3, "/right": 1, "real": 4, "/imag": 1, "Eigenvalues": 1, "returned": 2, "evlr@eigi": 1, "evlr@eigr": 1, "dgeevx_lapack": 1, "series": 5, "eigenvalues": 1, "right": 5, "PR": 1, "ev": 4, "part": 5, "PI": 1, "imag": 3, "is": 4, "what": 1, "want": 2, "righteigenvector": 1, "row": 3, "/sum": 2, "pr*pr": 1, "sum": 2, "pr*pi": 2, "pi*pi": 1, "#": 3, "/pr": 1, "pi/": 1, "#eof_ts": 1, "complex": 1, "conjugate": 1, "/z": 2, "dim_rmvmean_n": 1, "dim_avg_n": 1, "dim_stddev_n": 1, "dim_standardize_n": 1, "standardize": 1, "nPOP": 2, "z@stdev": 1, "z@mean": 1, "z@long_name": 1, "spatial": 3, "patterns": 3, "*eof": 4, "construct": 1, "domain": 1, "/zr*stdev": 1, "zi*stdev": 1, "Z@long_name": 1, "return": 3, "which": 1, "Z/": 1, "this": 1, "topo_9.ncl": 1, "Recreating": 2, "jpeg": 3, "topographic": 1, "image": 4, "object": 2, "Zooming": 1, "box": 8, "around": 2, "interest": 2, "overlay": 6, "multiple": 4, "more": 2, "per": 2, "functions": 1, "cleaner": 1, "NOTE": 1, "example": 2, "only": 3, "work": 1, "script": 2, "recreates": 1, "JPEG": 2, "that": 3, "converted": 1, "NetCDF": 1, "separated": 1, "bands": 1, "source": 1, "tool": 1, "gdal_translate": 1, "ot": 1, "Int16": 1, "EarthMap_2500x1250.jpg": 1, "EarthMap_2500x1250.nc": 1, "imports": 1, "or": 3, "yet.": 1, "faster": 1, "res@cnMaxLevelCount": 1, "res@cnFillBackgroundColor": 1, "labels": 2, "res@cnInfoLabelOn": 1, "info": 1, "labelbar": 3, "subtitles": 1, "res@pmTickMarkDisplayMode": 3, "Construct": 1, "RGBA": 1, "colormaps...": 1, "ramp": 4, "reds": 5, "/255": 3, "greens": 5, "blues": 5, "red": 5, "plotted": 2, "fully": 1, "opaque": 1, "green": 1, "blue": 1, "completely": 1, "transparent.": 1, "When": 1, "overlain": 1, "combine": 1, "magically": 1, "res@cnFillColors": 3, "greenMap": 2, "gsn_csm_contour": 3, "Band2": 1, "blueMap": 2, "Band3": 1, "our": 1, "base": 1, "plot.": 4, "Zoom": 1, "minlat": 3, "maxlat": 3, "minlon": 3, "maxlon": 3, "redMap": 4, "Band1": 1, "Overlay": 2, "everything": 1, "topo": 2, "images": 1, "works": 1, "X11": 1, "PNG.": 1, "Southern": 1, "Africa": 1, "recreate_jpeg_image": 1, "lonbox": 2, "latbox": 2, "lnres": 2, "lnres@gsLineColor": 1, "lnres@gsLineThicknessF": 1, "thicker": 1, "gsn_add_polyline": 2, "*************************************************": 6, "traj_3.ncl": 1, "external": 1, "TRAJ": 2, "path": 3, "asciiread": 1, "/500": 1, "some": 2, "parameters": 1, "np": 2, "nq": 2, "ncor": 4, "xrot": 4, "/np": 2, "nq/": 2, "yrot": 4, "xaxis": 11, "yaxis": 11, "**************************************************": 4, "into": 4, "rotated": 1, "particle": 1, "xyres": 9, "xyres@gsnFrame": 1, "indivdual": 1, "xyres@tmXTBorderOn": 1, "bottom": 5, "axis": 6, "xyres@tmYRBorderOn": 1, "xyres@tmXTOn": 1, "tick": 2, "marks": 2, "xyres@tmYROn": 1, "xyres@xyLineColors": 3, "line": 9, "xyres@xyLineThicknessF": 3, "times": 1, "thickness": 2, "xyres@trXMaxF": 1, "even": 1, "though": 1, "xyres@trXMinF": 1, "see": 1, "xyres@trYMaxF": 1, "xyres@trYMinF": 1, "gsn_xy": 8, "trajectory": 1, "**********************************************": 4, "arrays": 2, "bounding": 5, "a1": 4, "b1": 4, "a2": 4, "b2": 4, "a3": 3, "b3": 3, "a4": 3, "b4": 3, "a5": 3, "b5": 3, "a6": 3, "b6": 3, "a0": 4, "b0": 4, "determine": 1, "each": 8, "particle.f": 1, "drawing": 1, "xy": 1, "top": 5, "other.": 1, "their": 2, "individual": 2, "turned": 1, "off.": 1, "regular": 1, "box.": 2, "side1": 1, "side": 4, "line.": 4, "side2": 1, "side3": 1, "side4": 1, "brown": 1, "represent": 1, "chimney": 3, "thick": 2, "xyres@tiMainString": 1, "chimney.": 1, "potential": 3, "temp": 5, "TEMP": 2, "salinity": 1, "SALT": 2, "Compute": 1, "density": 5, "PD": 3, "specified": 2, "ncl": 1, "Yeager": 2, "zonal": 1, "avg": 1, "already": 1, "binned": 1, "basins": 2, "Plots": 1, "vs": 1, "salt": 4, "scatter": 3, "pd": 12, "PARAMETERS": 1, "case": 2, "ocnfile": 2, "depth_min": 3, "cm": 3, "depth": 6, "layer": 3, "included": 1, "depth_max": 3, "limits": 1, "smincn": 3, "smaxcn": 3, "tmincn": 3, "tmaxcn": 3, "Choose": 1, "basin": 12, "southern": 1, "ocean": 2, "pacific": 1, "indian": 1, "atlantic": 1, "labrador": 1, "GIN": 1, "arctic": 1, "bi": 4, "check": 1, "bi.lt.0.or.bi.gt.10": 1, "exit": 1, "bi.eq.0": 1, "blab": 8, "bi.eq.1": 1, "bi.eq.2": 1, "bi.eq.3": 1, "bi.eq.6": 1, "bi.eq.8": 1, "bi.eq.9": 1, "bi.eq.10": 1, "initial": 1, "resource": 2, "settings": 1, "Postscript": 1, "focn": 3, "z_t": 1, "lat_t": 1, "section": 2, "choice": 1, "temp_ba": 2, "salt_ba": 2, "put": 1, "tdata_ba": 2, "ndtooned": 5, "sdata_ba": 2, "ydata": 2, "xdata": 2, "potenial": 1, "rho_mwjf": 2, "i.e.": 1, "brought": 1, "surface": 1, "WARNING": 1, "T": 1, "S": 1, "diagrams": 1, "POTENTIAL": 1, "DENSITY...": 1, "something": 1, "other": 1, "you": 4, "plotting": 4, "computed": 1, "layer.": 1, "meters": 1, "tspan": 3, "sspan": 3, "better...": 1, "numbers": 1, "t_range": 2, "conform_dims": 2, "/51": 2, "s_range": 2, "Put": 1, "kg/m3": 1, "pot": 1, "den": 1, "printVarInfo": 1, "Graphics": 2, "res@xyMarkLineModes": 1, "res@xyMarkers": 1, "res@xyMarkerColors": 1, "res@pmLegendDisplayMode": 1, "res@txFontHeightF": 2, "res@tiXAxisString": 2, "salt@units": 1, "res@tiXAxisFontHeightF": 1, "res@tiYAxisString": 2, "temp@units": 1, "res@tiYAxisFontHeightF": 1, "res@trXMinF": 2, "res@trXMaxF": 2, "res@trYMinF": 1, "res@trYMaxF": 1, "depth_min/100.": 1, "depth_max/100.": 1, "gsn_csm_xy": 4, "resov": 2, "resov@gsnDraw": 1, "resov@gsnFrame": 1, "resov@cnLevelSelectionMode": 1, "resov@cnInfoLabelOn": 1, "resov@cnLineLabelPlacementMode": 1, "resov@cnLineLabelFontHeightF": 1, "plotpd": 2, "unique_9.ncl": 1, "over": 5, "Creating": 2, "topography": 1, "Reading": 2, "Manually": 1, "creating": 1, "Customizing": 1, "generates": 1, "Trinidad": 1, "Colorado.": 1, "west": 1, "binfile": 14, "quad_name": 2, "fbinrecread": 12, "map_cornersW": 3, "lonW": 2, "/1201/": 4, "latW": 3, "minmax_elevW": 1, "tmpW": 1, "/1201": 3, "east": 1, "map_cornersE": 3, "lonE": 2, "latE": 2, "minmax_elevE": 3, "tmpE": 1, "min_elev": 2, "/minmax_elevW": 2, "*3.28": 2, "max_elev": 2, "lat@long_name": 1, "lon@long_name": 1, "/tmpW*3.28/": 1, "feet": 2, "/tmpE": 1, "*3.28/": 1, "Define": 2, "colormap.": 1, "cmap": 4, "/1.00": 7, "/0.00": 4, "/0.51": 1, "/0.25": 1, "/0.12": 1, "/0.63": 2, "/0.82": 1, "/0.78": 1, "resources": 11, "res@mpLimitMode": 2, "res@mpDataBaseVersion": 1, "res@mpOutlineBoundarySets": 2, "res@mpLeftCornerLonF": 2, "res@mpLeftCornerLatF": 2, "res@mpRightCornerLonF": 2, "res@mpRightCornerLatF": 2, "tickmark": 1, "res@tmXBLabelFontHeightF": 1, "res@pmLabelBarWidthF": 1, "res@lbTitleString": 1, "res@lbTitleFontHeightF": 1, "res@lbLabelFontHeightF": 1, "res@lbTitleOffsetF": 1, "res@lbBoxMinorExtentF": 1, "res@pmLabelBarOrthogonalPosF": 1, ".05": 1, "res@tiMainOffsetYF": 1, "Move": 1, "down": 1, "towards": 1, "graphic.": 1, "res@tiMainFontHeightF": 1, "viewport_4.ncl": 1, "XY": 4, "curves": 1, "drawNDCGrid": 2, "nicely": 1, "labeled": 1, "NDC": 3, "Changing": 1, "size/shape": 1, "viewport": 2, "polymarkers": 5, "text": 3, "space": 1, "retrieve": 1, "Maximizing": 1, "after": 1, "they": 1, "res@vpWidthF": 2, "width": 1, "height": 1, "res@vpHeightF": 2, "First": 1, "res@vpXF": 3, "res@vpYF": 2, "Higher": 1, "plot1": 3, "Second": 1, "Same": 1, "X": 1, "location": 1, "Lower": 1, "plot2": 3, "Advance": 2, "Now": 1, "illustrations.": 1, "helpful": 1, "showing": 1, "square.": 1, "draw_vp_box": 2, "boxes": 1, "viewports.": 1, "frame.": 2, "Uncomment": 1, "next": 2, "these": 1, "PS": 2, "PDF": 1, "output.": 1, "psres": 2, "maximize_output": 1, "calls": 1, "station": 4, "illustrating": 1, "how": 1, "wind": 5, "barb": 3, "directions": 1, "adjusted": 1, "projection.": 1, "City": 1, "names.": 1, "cities": 1, "city_lats": 2, "city_lons": 2, "Station": 1, "cities.": 2, "imdat": 2, "workstation.": 1, "white": 1, "black": 1, "world": 1, "mpres": 2, "mpres@gsnFrame": 1, "mpres@mpSatelliteDistF": 1, "mpres@mpOutlineBoundarySets": 1, "mpres@mpCenterLatF": 1, "mpres@mpCenterLonF": 1, "mpres@mpCenterRotF": 1, "gsn_map": 1, "Scale": 1, "aspects": 1, "scaled": 1, "wmsetp": 3, "In": 1, "middle": 1, "Nebraska": 1, "north": 1, "magnitude": 1, "knots.": 1, "wmbarbmap": 1, "selected": 1, "call": 2, "informs": 1, "wmstnm": 2, "barbs": 1, "drawn": 1, "To": 2, "illustrate": 1, "adjustment": 1, "winds": 1, "north.": 1, "WRF": 1, "static": 1, "************************************************": 23, "dominant": 1, "category": 1, "stl": 5, "dom": 2, "cat": 2, "soiltype": 2, "sbl": 5, "lat2d": 11, "lon2d": 9, "lsMask": 4, "lnd": 1, "mas": 1, "Use": 1, "areas": 1, "Associate": 1, "D": 5, "use@lat2d": 1, "use@lon2d": 1, "stl@lat2d": 1, "stl@lon2d": 1, "sbl@lat2d": 1, "sbl@lon2d": 1, "should": 1, "examined": 1, "via": 1, "ncdump": 1, "v": 1, "grid_type": 1, "static.wrsi": 1, "type.": 1, "enter": 1, "projection": 2, "x11": 1, "ncgm": 1, "manually": 1, "interval": 1, "activate": 1, "res@lbLabelAutoStride": 1, "let": 1, "figure": 1, "lb": 1, "stride": 1, "labeling": 1, "tickmarks": 1, "dimll": 6, "res@mpProjection": 1, "LoV": 2, "logitude": 1, "projection.eq.": 1, "res@mpLambertParallel1F": 1, "Latin1": 1, "res@mpLambertParallel2F": 1, "Latin2": 1, "res@mpLambertMeridianF": 1, "res@mpOutlineDrawOrder": 1, "continental": 1, "outline": 1, "state": 1, "boundaries": 1, "res@tfDoNDCOverlay": 1, "cyclic": 1, "allocate": 1, "plts": 5, "Tell": 1, "b": 1, "own": 1, "resP@gsnPanelRowSpec": 1, "lower": 1, "********************************************************": 2, "Plot": 2, "storm": 1, "stracks": 1, "wrfout": 1, "files.": 1, "JUN": 1, "So": 1, "Young": 1, "Ha": 1, "MMM/NCAR": 1, "SEP": 1, "Slightly": 1, "modified": 1, "Mary": 1, "Haley": 1, "extra": 1, "comments.": 1, "DATES": 1, "/1512": 1, "ndate": 14, "sdate": 2, "sprinti": 1, "Experiment": 1, "legend": 1, "EXP": 3, "nexp": 4, "info.": 1, "XLAT": 1, "XLONG": 1, "Level": 1, "Pressure": 1, "slp": 2, "wrf_user_getvar": 2, "dims": 2, "Array": 1, "track": 1, "imin": 7, "jmin": 7, "smin": 7, "fs": 3, "systemfunc": 2, "nfs": 4, ".ne.": 1, "ifs": 10, "wrf_user_list_times": 1, "slp2d": 4, "We": 1, "need": 1, "find": 1, "minima.": 1, "slp1d": 2, "minind": 1, "Convert": 1, "back": 1, "indeces": 1, "array.": 1, "minij": 3, "ind_resolve": 1, "slp1d.eq.min": 1, "file.": 1, "Change": 1, "draw.": 1, "advance.": 1, "Maximize": 1, "WRF_map_c": 1, "Set": 3, "up": 3, "options": 1, "gsn_csm_map": 1, "polymarkers.": 1, "gsres": 6, "gsres@gsMarkerIndex": 2, "dot": 3, "gsres@gsMarkerSizeF": 2, "cols": 6, "/5": 1, "polylines.": 1, "res_lines": 2, "res_lines@gsLineThicknessF": 1, "gsn_add_polyxxx": 1, "unique": 1, "variable.": 1, "Loop": 3, "through": 3, "i": 36, "res_lines@gsLineColor": 1, "xx": 2, "/lon2d": 1, "yy": 2, "/lat2d": 1, "lon1d": 6, "lat1d": 6, "gsres@gsMarkerColor": 3, "gsn_add_polymarker": 3, "Date": 1, "Legend": 1, "txres": 3, "txres@txFontHeightF": 1, "txres@txFontColor": 2, "txid1": 2, "txres@txJust": 3, "i.eq.1": 1, "gsn_add_text": 2, "marker": 1, "legend.": 1, "Or": 1, "just": 1, "instead.": 1, "txid2": 2, "pmid2": 2, "ii": 1, "/129": 1, "ilat": 1, "jj": 2, "/110": 1, "jlon": 1, "ji": 5, "ii*mlon": 1, "col": 1, "xy_29.ncl": 1, "ASCII": 1, "headers": 1, "separate": 1, "procedure": 2, "specific": 1, "originally": 1, "Dr.": 1, "Birgit": 1, "Hassler": 1, "NOAA": 1, "****************************************************": 1, "Procedure": 1, "plotTCOPolym": 2, "filName": 2, "xTitle": 2, "yTitle": 4, "y": 3, "MarkerCol": 5, "OldYear": 3, "xmarker": 3, "ymarker": 3, "aspect": 1, "ratio": 1, "ndc": 1, "coord": 1, "res@xyMarkLineMode": 1, "res@xyMarker": 1, "res@xyMarkerColor": 1, "ork": 1, "i.gt.0": 1, ".gt.OldYear": 1, "plot@": 1, "unique_string": 1, "***********************************************************": 2, "MAIN": 1, "ascii": 3, "nfil": 2, "nhead": 2, "number": 1, "header": 1, "ncol": 2, "O3": 8, "nf": 4, "filx": 3, "readAsciiTable": 1, "dimd": 2, "rows": 2, "toint": 3, "user": 1, "decision": 1, "mon": 4, "hour": 3, "mn": 4, "sec": 4, "d0": 1, "COARDS/udunits": 1, "tunits": 3, "cd_inv_calendar": 1, "Gregorin": 1, "year*10000": 1, "mon*100": 1, "date@units": 1, "O3@long_name": 2, "O3@units": 1, "year@long_name": 2, "may": 1 }, "NL": { "g3": 2, "#": 20, "problem": 2, "assign0": 1, "vars": 4, "constraints": 10, "objectives": 6, "ranges": 2, "eqns": 2, "nonlinear": 8, "network": 4, "linear": 4, "in": 4, "both": 2, "variables": 6, ";": 4, "functions": 2, "arith": 2, "flags": 2, "discrete": 2, "binary": 2, "integer": 2, "(": 2, "b": 6, "c": 4, "o": 4, ")": 2, "nonzeros": 2, "Jacobian": 2, "gradients": 2, "max": 2, "name": 2, "lengths": 2, "common": 2, "exprs": 2, "c1": 2, "o1": 2, "C0": 2, "n0": 129, "C1": 2, "C2": 2, "C3": 2, "C4": 2, "C5": 2, "O0": 2, "r": 2, "k8": 1, "J0": 2, "J1": 2, "J2": 2, "J3": 2, "J4": 2, "J5": 2, "G0": 2, "balassign0": 1, "C6": 1, "C7": 1, "C8": 1, "C9": 1, "C10": 1, "C11": 1, "C12": 1, "C13": 1, "C14": 1, "C15": 1, "C16": 1, "C17": 1, "C18": 1, "C19": 1, "C20": 1, "C21": 1, "C22": 1, "C23": 1, "C24": 1, "C25": 1, "C26": 1, "C27": 1, "C28": 1, "C29": 1, "C30": 1, "C31": 1, "C32": 1, "C33": 1, "C34": 1, "C35": 1, "C36": 1, "C37": 1, "C38": 1, "C39": 1, "C40": 1, "C41": 1, "C42": 1, "C43": 1, "C44": 1, "C45": 1, "C46": 1, "C47": 1, "C48": 1, "C49": 1, "C50": 1, "C51": 1, "C52": 1, "C53": 1, "C54": 1, "C55": 1, "C56": 1, "C57": 1, "C58": 1, "C59": 1, "C60": 1, "C61": 1, "C62": 1, "C63": 1, "C64": 1, "C65": 1, "C66": 1, "C67": 1, "C68": 1, "C69": 1, "C70": 1, "C71": 1, "C72": 1, "C73": 1, "C74": 1, "C75": 1, "C76": 1, "C77": 1, "C78": 1, "C79": 1, "C80": 1, "C81": 1, "C82": 1, "C83": 1, "C84": 1, "C85": 1, "C86": 1, "C87": 1, "C88": 1, "C89": 1, "C90": 1, "C91": 1, "C92": 1, "C93": 1, "C94": 1, "C95": 1, "C96": 1, "C97": 1, "C98": 1, "C99": 1, "C100": 1, "C101": 1, "C102": 1, "C103": 1, "C104": 1, "C105": 1, "C106": 1, "C107": 1, "C108": 1, "C109": 1, "C110": 1, "C111": 1, "C112": 1, "C113": 1, "C114": 1, "C115": 1, "C116": 1, "C117": 1, "C118": 1, "C119": 1, "C120": 1, "k159": 1, "J6": 1, "J7": 1, "J8": 1, "J9": 1, "J10": 1, "J11": 1, "J12": 1, "J13": 1, "J14": 1, "J15": 1, "J16": 1, "J17": 1, "J18": 1, "J19": 1, "J20": 1, "J21": 1, "J22": 1, "J23": 1, "J24": 1, "J25": 1, "J26": 1, "-": 1225, "J27": 1, "J28": 1, "J29": 1, "J30": 1, "J31": 1, "J32": 1, "J33": 1, "J34": 1, "J35": 1, "J36": 1, "J37": 1, "J38": 1, "J39": 1, "J40": 1, "J41": 1, "J42": 1, "J43": 1, "J44": 1, "J45": 1, "J46": 1, "J47": 1, "J48": 1, "J49": 1, "J50": 1, "J51": 1, "J52": 1, "J53": 1, "J54": 1, "J55": 1, "J56": 1, "J57": 1, "J58": 1, "J59": 1, "J60": 1, "J61": 1, "J62": 1, "J63": 1, "J64": 1, "J65": 1, "J66": 1, "J67": 1, "J68": 1, "J69": 1, "J70": 1, "J71": 1, "J72": 1, "J73": 1, "J74": 1, "J75": 1, "J76": 1, "J77": 1, "J78": 1, "J79": 1, "J80": 1, "J81": 1, "J82": 1, "J83": 1, "J84": 1, "J85": 1, "J86": 1, "J87": 1, "J88": 1, "J89": 1, "J90": 1, "J91": 1, "J92": 1, "J93": 1, "J94": 1, "J95": 1, "J96": 1, "J97": 1, "J98": 1, "J99": 1, "J100": 1, "J101": 1, "J102": 1, "J103": 1, "J104": 1, "J105": 1, "J106": 1, "J107": 1, "J108": 1, "J109": 1, "J110": 1, "J111": 1, "J112": 1, "J113": 1, "J114": 1, "J115": 1, "J116": 1, "J117": 1, "J118": 1, "J119": 1, "J120": 1 }, "NSIS": { ";": 39, "bigtest.nsi": 1, "This": 2, "script": 1, "attempts": 1, "to": 6, "test": 1, "most": 1, "of": 3, "the": 4, "functionality": 1, "NSIS": 3, "exehead.": 1, "-": 205, "ifdef": 2, "HAVE_UPX": 1, "packhdr": 1, "tmp.dat": 1, "endif": 4, "NOCOMPRESS": 1, "SetCompress": 1, "off": 1, "Name": 1, "Caption": 1, "Icon": 1, "OutFile": 1, "SetDateSave": 1, "on": 6, "SetDatablockOptimize": 1, "CRCCheck": 1, "SilentInstall": 1, "normal": 1, "BGGradient": 1, "FFFFFF": 1, "InstallColors": 1, "FF8080": 1, "XPStyle": 1, "InstallDir": 1, "InstallDirRegKey": 1, "HKLM": 9, "CheckBitmap": 1, "LicenseText": 1, "LicenseData": 1, "RequestExecutionLevel": 1, "admin": 1, "Page": 4, "license": 1, "components": 1, "directory": 3, "instfiles": 2, "UninstPage": 2, "uninstConfirm": 1, "ifndef": 2, "NOINSTTYPES": 1, "only": 1, "if": 4, "not": 2, "defined": 1, "InstType": 6, "/NOCUSTOM": 1, "/COMPONENTSONLYONCUSTOM": 1, "AutoCloseWindow": 1, "false": 1, "ShowInstDetails": 1, "show": 1, "Section": 5, "empty": 1, "string": 1, "makes": 1, "it": 3, "hidden": 1, "so": 1, "would": 1, "starting": 1, "with": 1, "write": 2, "reg": 1, "info": 1, "StrCpy": 2, "DetailPrint": 1, "WriteRegStr": 4, "SOFTWARE": 7, "NSISTest": 7, "BigNSISTest": 8, "uninstall": 2, "strings": 1, "SetOutPath": 3, "INSTDIR": 15, "File": 3, "/a": 1, "CreateDirectory": 1, "recursively": 1, "create": 1, "a": 2, "for": 2, "fun.": 1, "WriteUninstaller": 1, "Nop": 1, "fun": 1, "SectionEnd": 5, "SectionIn": 4, "Start": 2, "MessageBox": 11, "MB_OK": 8, "MB_YESNO": 3, "IDYES": 2, "MyLabel": 2, "SectionGroup": 2, "/e": 1, "SectionGroup1": 1, "WriteRegDword": 3, "WriteRegBin": 1, "WriteINIStr": 5, "Call": 6, "MyFunctionTest": 1, "DeleteINIStr": 1, "DeleteINISec": 1, "ReadINIStr": 1, "StrCmp": 1, "INIDelSuccess": 2, "ClearErrors": 1, "ReadRegStr": 1, "HKCR": 1, "xyz_cc_does_not_exist": 1, "IfErrors": 1, "NoError": 2, "Goto": 1, "ErrorYay": 2, "CSCTest": 1, "Group2": 1, "BeginTestSection": 1, "IfFileExists": 1, "BranchTest69": 1, "|": 3, "MB_ICONQUESTION": 1, "IDNO": 1, "NoOverwrite": 1, "skipped": 2, "file": 4, "doesn": 2, "s": 1, "icon": 1, "start": 1, "minimized": 1, "and": 1, "give": 1, "hotkey": 1, "(": 5, "Ctrl": 1, "+": 2, "Shift": 1, "Q": 2, ")": 5, "CreateShortCut": 2, "SW_SHOWMINIMIZED": 1, "CONTROL": 1, "SHIFT": 1, "MyTestVar": 1, "myfunc": 1, "test.ini": 2, "MySectionIni": 1, "Value1": 1, "failed": 1, "TextInSection": 1, "will": 1, "example2.": 1, "Hit": 1, "next": 1, "continue.": 1, "{": 8, "NSISDIR": 1, "}": 8, "Contrib": 1, "Graphics": 1, "Icons": 1, "nsis1": 1, "uninstall.ico": 1, "Uninstall": 2, "Software": 1, "Microsoft": 1, "Windows": 3, "CurrentVersion": 1, "silent.nsi": 1, "LogicLib.nsi": 1, "bt": 1, "uninst.exe": 1, "SMPROGRAMS": 2, "Big": 1, "Test": 2, "*.*": 2, "BiG": 1, "Would": 1, "you": 1, "like": 1, "remove": 1, "cpdest": 3, "MyProjectFamily": 2, "MyProject": 1, "Note": 1, "could": 1, "be": 1, "removed": 1, "IDOK": 1, "t": 1, "exist": 1, "NoErrorMsg": 1, "x64.nsh": 1, "A": 1, "few": 1, "simple": 1, "macros": 1, "handle": 1, "installations": 1, "x64": 1, "machines.": 1, "RunningX64": 4, "checks": 1, "installer": 1, "is": 2, "running": 1, "x64.": 1, "If": 1, "EndIf": 1, "DisableX64FSRedirection": 4, "disables": 1, "system": 2, "redirection.": 2, "EnableX64FSRedirection": 4, "enables": 1, "SYSDIR": 1, "some.dll": 2, "#": 3, "extracts": 2, "C": 2, "System32": 1, "SysWOW64": 1, "___X64__NSH___": 3, "define": 4, "include": 1, "LogicLib.nsh": 1, "macro": 3, "_RunningX64": 1, "_a": 1, "_b": 1, "_t": 2, "_f": 2, "insertmacro": 2, "_LOGICLIB_TEMP": 3, "System": 4, "kernel32": 4, "GetCurrentProcess": 1, "i.s": 1, "IsWow64Process": 1, "*i.s": 1, "Pop": 1, "_": 1, "macroend": 3, "Wow64EnableWow64FsRedirection": 2, "i0": 1, "i1": 1 }, "Nemerle": { "using": 1, "System.Console": 1, ";": 2, "module": 1, "Program": 1, "{": 2, "Main": 1, "(": 2, ")": 2, "void": 1, "WriteLine": 1, "}": 2 }, "NetLinx": { "#if_not_defined": 1, "MOCK_PROJECTOR": 2, "#define": 1, "DEFINE_DEVICE": 2, "dvPROJECTOR": 2, ";": 56, "DEFINE_CONSTANT": 2, "POWER_STATE_ON": 2, "POWER_STATE_OFF": 3, "POWER_STATE_WARMING": 1, "POWER_STATE_COOLING": 1, "INPUT_HDMI": 3, "INPUT_VGA": 2, "INPUT_COMPOSITE": 2, "INPUT_SVIDEO": 2, "#include": 2, "DEFINE_TYPE": 2, "struct": 1, "projector_t": 4, "{": 16, "integer": 4, "power_state": 1, "input": 3, "lamp_hours": 1, "}": 16, "DEFINE_VARIABLE": 2, "volatile": 1, "proj_1": 6, "define_function": 2, "initialize": 2, "(": 15, "self": 2, ")": 15, "self.power_state": 1, "self.input": 2, "self.lamp_hours": 1, "switch_input": 5, "print": 1, "LOG_LEVEL_INFO": 1, "DEFINE_START": 2, "DEFINE_EVENT": 2, "data_event": 1, "[": 10, "]": 10, "string": 1, "parse_message": 1, "data.text": 1, "command": 1, "online": 1, "offline": 1, "button_event": 6, "dvTP": 6, "BTN_HDMI": 2, "BTN_VGA": 2, "BTN_COMPOSITE": 2, "BTN_SVIDEO": 2, "push": 1, "switch": 1, "button.input.channel": 1, "case": 4, "release": 1, "DEFINE_PROGRAM": 2, "BTN_POWER_ON": 1, "proj_1.power_state": 2, "BTN_POWER_OFF": 1, "#end_if": 1, "PROGRAM_NAME": 1, "dvDebug": 17, "//": 12, "For": 1, "debug": 1, "output.": 1, "dvIO": 3, "Volume": 1, "up/down": 1, "button": 1, "connections.": 1, "MIC1": 1, "Microphone": 4, "MIC2": 1, "MIC3": 1, "MIC4": 1, "WLS1": 1, "Wireless": 2, "mic": 2, "WLS2": 1, "IPOD": 1, "iPod": 1, "input.": 2, "CD": 2, "player": 1, "volume": 3, "inputs": 4, "DEFINE_LATCHING": 1, "DEFINE_MUTUALLY_EXCLUSIVE": 1, "volArrayInit": 1, "VOL_UNMUTED": 1, "PUSH": 2, "volArrayIncrement": 1, "Increment": 1, "the": 2, "up": 1, "a": 2, "step.": 2, "send_string": 16, "volArrayDecrement": 1, "Decrement": 1, "down": 1 }, "NetLinx+ERB": { "#if_not_defined": 2, "Sample": 4, "#define": 2, "DEFINE_DEVICE": 2, "DEFINE_CONSTANT": 2, "<%>": 2, "global_constant_justify": 4, "20": 2, "<%=>": 4, "video_sources": 6, "BTN_VID_FOH_PC": 2, "btn": 8, "11": 2, "input": 14, "VID_SRC_FOH_PC": 2, "BTN_VID_STAGE_PC": 2, "12": 2, "VID_SRC_STAGE_PC": 2, "BTN_VID_BLURAY": 2, "13": 2, "VID_SRC_BLURAY": 2, "print_constant_hash": 2, "remap": 4, "justify": 4, "DEFINE_TYPE": 2, "DEFINE_VARIABLE": 2, "DEFINE_START": 2, "DEFINE_EVENT": 2, "group": 2, "name": 4, "dvTP": 2, "outputs": 2, "VID_DEST_PROJECTOR": 2, "DEFINE_PROGRAM": 2, "#end_if": 2 }, "NetLogo": { "patches": 7, "-": 28, "own": 1, "[": 17, "living": 6, ";": 12, "indicates": 1, "if": 2, "the": 6, "cell": 10, "is": 1, "live": 4, "neighbors": 5, "counts": 1, "how": 1, "many": 1, "neighboring": 1, "cells": 2, "are": 1, "alive": 1, "]": 17, "to": 6, "setup": 2, "blank": 1, "clear": 2, "all": 5, "ask": 6, "death": 5, "reset": 2, "ticks": 2, "end": 6, "random": 2, "ifelse": 3, "float": 1, "<": 1, "initial": 1, "density": 1, "birth": 4, "set": 5, "true": 1, "pcolor": 2, "fgcolor": 1, "false": 1, "bgcolor": 1, "go": 1, "count": 1, "with": 2, "Starting": 1, "a": 1, "new": 1, "here": 1, "ensures": 1, "that": 1, "finish": 1, "executing": 2, "first": 1, "before": 1, "any": 1, "of": 2, "them": 1, "start": 1, "second": 1, "ask.": 1, "This": 1, "keeps": 1, "in": 2, "synch": 1, "each": 2, "other": 1, "so": 1, "births": 1, "and": 1, "deaths": 1, "at": 1, "generation": 1, "happen": 1, "lockstep.": 1, "tick": 1, "draw": 1, "let": 1, "erasing": 2, "patch": 2, "mouse": 5, "xcor": 2, "ycor": 2, "while": 1, "down": 1, "display": 1 }, "NewLisp": { "SHEBANG#!newlisp": 2, ";": 72, "@module": 1, "IRC": 13, "@description": 1, "a": 9, "basic": 1, "irc": 7, "library": 1, "@version": 1, "early": 1, "alpha": 1, "-": 259, "@author": 1, "cormullion": 1, "Usage": 1, "(": 432, "init": 2, ")": 425, "username/nick": 1, "not": 3, "that": 1, "one": 1, "obviously": 1, "connect": 3, "irc/server": 1, "join": 6, "channel": 16, "{": 24, "#newlisp": 2, "}": 24, "room": 1, "either": 1, "read": 8, "loop": 6, "monitor": 1, "only": 2, "no": 1, "input": 1, "or": 1, "session": 4, "command": 8, "line": 8, "end": 2, "with": 6, "/QUIT": 1, "context": 5, "define": 24, "Idle": 1, "time": 4, "seconds": 1, "Itime": 3, "stamp": 3, "since": 1, "last": 2, "message": 26, "was": 1, "processed": 1, "register": 4, "callback": 25, "name": 18, "function": 6, "println": 13, "registering": 1, "for": 6, "sym": 3, "term": 2, "prefix": 2, "push": 4, "list": 35, "Icallbacks": 4, "deregister": 1, "deregistering": 1, "setf": 1, "assoc": 1, "nil": 6, "current": 1, "callbacks": 12, "do": 14, "data": 13, "when": 5, "set": 42, "error": 9, "in": 8, "dolist": 12, "rf": 1, "ref": 1, "all": 5, "func": 2, "entry": 1, "if": 14, "catch": 3, "apply": 1, "Inickname": 4, "str": 4, "Ichannels": 7, "of": 8, "day": 2, "server": 4, "port": 2, "Iconnected": 4, "true": 3, "identify": 1, "password": 2, "net": 10, "send": 11, "Iserver": 10, "format": 8, "part": 1, "chan": 3, "empty": 4, "leave": 2, "specified": 1, "begin": 5, "replace": 2, "quit": 1, "privmsg": 1, "user": 4, "notice": 1, "to": 14, "cond": 7, "starts": 5, "/": 1, "default": 1, "character": 1, "username": 10, "first": 11, "clean": 2, "parse": 3, "sender": 4, "|": 2, "slice": 1, "text": 7, "+": 2, "find": 4, "process": 3, "ctcp": 2, "target": 6, "PRIVMSG": 2, "NOTICE": 2, "trim": 2, "messages": 2, "parts": 1, "let": 2, "buffer": 6, "peek": 2, "receive": 1, "unless": 1, "monitoring": 1, "while": 4, "sleep": 2, "print": 3, "raw": 3, "example": 1, "using": 1, "lookup": 2, "date": 5, "value": 3, "%": 3, "H": 1, "M": 1, "S": 1, "interactive": 1, "terminal": 1, "must": 1, "add": 3, "display": 3, "outgoing": 1, "zero": 1, "string": 12, "finished": 1, "exit": 4, "code": 2, "[": 2, "]": 2, "simple": 1, "bot": 2, "load": 1, "env": 1, "HOME": 1, "/projects/programming/newlisp": 1, "projects/irc.lsp": 1, "idle": 1, "event": 2, "/text": 1, "module": 2, "loads": 1, "the": 20, "SQLite3": 1, "database": 5, "FUNCTIONS": 1, "displayln": 13, "open": 5, "sql": 21, "db": 3, "sql3": 7, "close": 4, "SAFE": 1, "FOR": 1, "SQL": 4, "this": 3, "makes": 1, "strings": 1, "safe": 2, "inserting": 1, "into": 3, "statements": 1, "avoid": 2, "injection": 2, "issues": 1, "it": 1, "&": 1, "apos": 1, "query": 21, "sqlarray": 3, "results": 1, "setq": 2, "return": 2, "macro": 2, "create": 3, "record": 6, "save": 3, "values": 6, "temp": 28, "table": 8, "args": 10, "s": 4, "rest": 9, "eval": 1, "now": 4, "arguments": 2, "as": 1, "symbols": 6, "under": 1, "index": 5, "num": 9, "leading": 1, "keeps": 1, "max": 4, "at": 1, "DB": 9, "d": 2, "extend": 6, "chop": 2, "actually": 1, "run": 1, "against": 1, "delete": 4, "re": 2, "done": 2, "so": 2, "context.": 2, "update": 1, "idx": 3, "we": 3, "need": 1, "number": 1, "keep": 1, "them": 1, "correct": 1, "order": 1, "length": 8, "D2": 2, "continue": 1, "temporary": 1, "debugging": 1, "q": 4, "quote": 2, "is": 2, "non": 2, "numeric": 2, "are": 1, "sanitized": 1, "put": 2, "second": 2, "argument": 2, "symbol": 2, "will": 2, "have": 3, "be": 2, "I": 2, "more": 3, "you": 1, "than": 1, "just": 1, "they": 1, "become": 1, "elements": 1, "WHERE": 1, "clause": 1, "access": 4, "log": 1, "file": 1, "items": 3, "integer": 1, "Id": 2, "UserId": 2, "Date": 7, "parsed": 1, "Result": 2, "Referrer": 2, "UserAgent": 2, "IP": 1, "UserName": 1, "Request": 1, "Size": 1, "constant": 1, "logic": 1, "alist": 3, "i": 3, "sequence": 2, "NUM": 3, "<": 1, "res": 1, "v": 1, "variants": 2, "dec": 1, "solutions": 2 }, "Nginx": { "server": 10, "{": 40, "listen": 6, ";": 118, "server_name": 5, "www.example.com": 1, "return": 2, "scheme": 2, "//example.com": 1, "request_uri": 2, "}": 40, "ssl": 1, "example.com": 1, "ssl_certificate": 1, "/srv/www/example.com/ssl/example.com.crt": 1, "ssl_certificate_key": 1, "/srv/www/example.com/ssl/example.com.key": 1, "ssl_session_timeout": 1, "m": 3, "ssl_session_cache": 1, "shared": 1, "SSL": 1, "ssl_dhparam": 1, "/etc/ssl/certs/dhparam.pem": 1, "ssl_protocols": 1, "TLSv1": 1, "TLSv1.1": 1, "TLSv1.2": 1, "include": 6, "snippets/ssl_ciphers_intermediate.conf": 1, "ssl_prefer_server_ciphers": 1, "on": 6, "#add_header": 1, "Strict": 1, "-": 22, "Transport": 1, "Security": 1, "max": 2, "age": 1, "ssl_stapling": 1, "ssl_stapling_verify": 1, "ssl_trusted_certificate": 1, "/srv/www/example.com/ssl/unified": 1, "ssl.crt": 1, "resolver": 1, "resolver_timeout": 1, "s": 1, "root": 7, "/srv/www/example.com/htdocs": 1, "index": 3, "index.php": 5, "index.html": 3, "index.htm": 3, "charset": 1, "UTF": 1, "autoindex": 1, "off": 11, "if": 5, "(": 16, "bad_method": 1, ")": 16, "error_page": 2, "access_log": 10, "/var/log/nginx/example.com.access.log": 1, "error_log": 2, "/var/log/nginx/example.com.error.log": 1, "rewrite": 2, "/wp": 2, "admin": 1, "//": 1, "host": 1, "uri/": 2, "permanent": 1, "location": 27, "/": 9, "try_files": 6, "uri": 5, "/index.php": 4, "args": 1, "/favicon.ico": 1, "log_not_found": 5, "/apple": 2, "touch": 2, "icon.png": 1, "icon": 1, "precomposed.png": 1, "*": 10, ".": 7, "gp": 1, "|": 59, "gif": 2, "jpg": 2, "jpe": 1, "g": 1, "png": 2, "ico": 2, "wmv": 1, "avi": 1, "asf": 1, "asx": 1, "mpg": 1, "mpeg": 1, "mp4": 1, "pls": 1, "mp3": 1, "mid": 1, "wav": 1, "swf": 1, "flv": 1, "html": 3, "htm": 1, "txt": 2, "js": 3, "css": 3, "exe": 1, "zip": 1, "tar": 1, "rar": 1, "gz": 1, "tgz": 1, "bz2": 1, "uha": 1, "z": 1, "doc": 1, "docx": 1, "xls": 1, "xlsx": 1, "pdf": 1, "iso": 1, "woff": 2, "expires": 2, "add_header": 3, "Pragma": 1, "public": 1, "Cache": 1, "Control": 2, "deny": 6, "all": 6, "wp": 3, "admin/includes": 1, "includes/theme": 1, "compat/": 1, "includes/js/tinymce/langs/.*": 1, ".php": 6, "content/": 1, "internal": 1, "uploads": 1, "files": 1, "/.*": 2, "/robots.txt": 1, "/sitemap.xml": 1, "/sitemap.xml.gz": 1, "eot": 1, "otf": 1, "ttf": 1, "Access": 1, "Allow": 1, "Origin": 1, "/50x.html": 2, "/usr/share/nginx/html": 1, "set": 6, "skip_cache": 7, "request_method": 1, "POST": 1, "query_string": 1, "http_cookie": 1, "[": 1, "]": 1, "fastcgi_split_path_info": 1, "+": 4, "/.": 1, "fastcgi_script_name": 1, "path_info": 2, "fastcgi_path_info": 1, "fastcgi_param": 1, "PATH_INFO": 1, "fastcgi_pass": 3, "unix": 2, "/var/run/example.com.sock": 2, "fastcgi_index": 2, "#fastcgi_param": 1, "HTTPS": 1, "fastcgi.conf": 2, "fastcgi_cache_bypass": 1, "fastcgi_no_cache": 1, "fastcgi_cache": 1, "WORDPRESS": 2, "fastcgi_cache_valid": 1, "/purge": 1, "fastcgi_cache_purge": 1, "/phpmyadmin": 2, "/usr/share/": 3, "/phpmyadmin/": 2, "jpeg": 1, "xml": 1, "/phpMyAdmin": 1, "last": 1, "#": 5, "End": 1, "of": 1, "block.": 1, "user": 1, "www": 2, "worker_processes": 1, "logs/error.log": 1, "pid": 1, "logs/nginx.pid": 1, "worker_rlimit_nofile": 1, "events": 1, "worker_connections": 1, "http": 3, "conf/mime.types": 1, "/etc/nginx/proxy.conf": 1, "/etc/nginx/fastcgi.conf": 1, "default_type": 1, "application/octet": 1, "stream": 1, "log_format": 1, "main": 5, "logs/access.log": 1, "sendfile": 1, "tcp_nopush": 1, "server_names_hash_bucket_size": 1, "this": 1, "seems": 1, "to": 1, "be": 1, "required": 1, "for": 1, "some": 1, "vhosts": 1, "php/fastcgi": 1, "domain1.com": 1, "www.domain1.com": 1, "logs/domain1.access.log": 1, "simple": 2, "reverse": 1, "proxy": 1, "domain2.com": 1, "www.domain2.com": 1, "logs/domain2.access.log": 1, "images": 1, "javascript": 1, "flash": 1, "media": 1, "static": 1, "/var/www/virtual/big.server.com/htdocs": 1, "d": 1, "proxy_pass": 2, "//127.0.0.1": 1, "upstream": 1, "big_server_com": 1, "weight": 2, "load": 1, "balancing": 1, "big.server.com": 1, "logs/big.server.access.log": 1, "//big_server_com": 1 }, "Nimrod": { "echo": 1 }, "Nit": { "#": 415, "import": 28, "gtk": 1, "class": 34, "CalculatorContext": 7, "var": 213, "result": 21, "nullable": 18, "Float": 3, "null": 53, "last_op": 4, "Char": 8, "current": 32, "after_point": 12, "Int": 74, "fun": 124, "push_op": 2, "(": 634, "op": 11, ")": 634, "do": 145, "apply_last_op_if_any": 2, "if": 170, "then": 143, "self.result": 2, "else": 83, "store": 1, "for": 54, "next": 10, "end": 211, "prepare": 1, "push_digit": 1, "digit": 1, "*": 22, "+": 60, "digit.to_f": 2, "pow": 1, "after_point.to_f": 1, "self.after_point": 1, "-": 91, "self.current": 3, "switch_to_decimals": 1, "return": 122, "/": 12, "CalculatorGui": 2, "super": 20, "GtkCallable": 1, "win": 2, "GtkWindow": 2, "container": 3, "GtkGrid": 2, "lbl_disp": 3, "GtkLabel": 2, "but_eq": 3, "GtkButton": 2, "but_dot": 3, "context": 9, "new": 202, "redef": 44, "signal": 2, "sender": 3, "user_data": 5, "context.after_point": 1, "after_point.abs": 1, "isa": 15, "is": 83, "an": 5, "operation": 1, "c": 19, "but_dot.sensitive": 2, "false": 16, "context.switch_to_decimals": 4, "lbl_disp.text": 3, "true": 26, "context.push_op": 15, "s": 74, "context.result.to_precision_native": 1, "index": 7, "i": 48, "in": 57, "s.length.times": 1, "chiffre": 3, "s.chars": 2, "[": 138, "]": 112, "and": 30, "s.substring": 2, "s.length": 3, "a": 71, "number": 7, "n": 18, "context.push_digit": 25, "context.current.to_precision_native": 1, "init": 16, "init_gtk": 1, "win.add": 1, "container.attach": 7, "digits": 1, "but": 8, "GtkButton.with_label": 5, "n.to_s": 1, "but.request_size": 2, "but.signal_connect": 2, "self": 58, "%": 3, "/3": 1, "operators": 2, "r": 21, "op.to_s": 1, "but_eq.request_size": 1, "but_eq.signal_connect": 1, ".": 15, "but_dot.request_size": 1, "but_dot.signal_connect": 1, "#C": 1, "but_c": 2, "but_c.request_size": 1, "but_c.signal_connect": 1, "win.show_all": 1, "context.result.to_precision": 6, "assert": 83, "print": 136, "#test": 2, "multiple": 1, "decimals": 1, "button": 1, ".environ": 3, "app": 1, "run_gtk": 1, "module": 20, "callback_chimpanze": 1, "callback_monkey": 2, "Chimpanze": 2, "MonkeyActionCallable": 7, "create": 1, "monkey": 4, "Monkey": 4, "Invoking": 1, "method": 20, "which": 4, "will": 10, "take": 2, "some": 2, "time": 5, "to": 35, "compute": 1, "be": 14, "back": 1, "wokeUp": 4, "with": 9, "information.": 1, "Callback": 1, "defined": 4, "Interface": 1, "monkey.wokeUpAction": 1, "Inherit": 1, "callback": 11, "by": 8, "interface": 4, "Back": 2, "of": 51, "wokeUpAction": 2, "message": 9, "Object": 9, "m": 5, "m.create": 1, "{": 36, "#include": 10, "": 2, "": 1, "typedef": 2, "struct": 8, "int": 11, "id": 4, ";": 87, "age": 2, "}": 36, "CMonkey": 6, "toCall": 6, "MonkeyAction": 5, "//": 13, "Method": 1, "reproduce": 3, "answer": 2, "Please": 1, "note": 1, "that": 5, "function": 3, "pointer": 2, "only": 9, "used": 2, "the": 113, "void": 3, "cbMonkey": 2, "*mkey": 2, "callbackFunc": 2, "CMonkey*": 1, "MonkeyAction*": 1, "*data": 3, "sleep": 5, "mkey": 2, "data": 6, "background": 1, "treatment": 1, "redirected": 1, "nit_monkey_callback_func": 2, "To": 1, "call": 3, "your": 2, "signature": 1, "must": 1, "written": 2, "like": 1, "this": 4, "": 1, "Name": 1, "_": 1, "": 1, "...": 2, "MonkeyActionCallable_wokeUp": 1, "abstract": 3, "extern": 28, "*monkey": 1, "malloc": 4, "sizeof": 4, "get": 2, "Must": 1, "as": 3, "Nit/C": 1, "because": 4, "C": 4, "inside": 1, "MonkeyActionCallable.wokeUp": 1, "Allocating": 1, "memory": 2, "keep": 2, "reference": 2, "received": 1, "parameters": 1, "receiver": 1, "Message": 1, "Incrementing": 1, "counter": 1, "prevent": 1, "from": 13, "releasing": 1, "MonkeyActionCallable_incr_ref": 1, "Object_incr_ref": 1, "Calling": 1, "passing": 1, "Receiver": 1, "Function": 1, "object": 3, "Datas": 1, "recv": 23, "&": 3, "circular_list": 1, "CircularList": 6, "E": 15, "Like": 2, "standard": 2, "Array": 19, "or": 15, "LinkedList": 1, "Sequence.": 1, "Sequence": 2, "The": 19, "first": 8, "node": 10, "list": 10, "any": 2, "special": 2, "case": 4, "empty": 3, "handled": 1, "private": 21, "CLNode": 6, "iterator": 1, "CircularListIterator": 2, "self.node.item": 2, "push": 3, "e": 4, "new_node": 4, "self.node": 13, "not": 30, "one": 4, "so": 4, "attach": 1, "nodes": 3, "correctly.": 2, "old_last_node": 2, "n.prev": 4, "new_node.next": 1, "new_node.prev": 1, "old_last_node.next": 1, "pop": 2, "prev": 3, "n.item": 1, "detach": 1, "prev_prev": 2, "prev.prev": 1, "prev_prev.next": 1, "prev.item": 1, "unshift": 1, "Circularity": 2, "has": 4, "benefits.": 2, "self.node.prev": 1, "shift": 1, "self.node.next": 2, "self.pop": 1, "Move": 1, "at": 5, "last": 8, "position": 2, "second": 1, "etc.": 1, "rotate": 1, "n.next": 1, "Sort": 1, "using": 2, "Josephus": 1, "algorithm.": 1, "josephus": 1, "step": 2, "res": 8, "while": 9, "self.is_empty": 2, "count": 2, "self.rotate": 1, "kill": 1, "x": 21, "self.shift": 1, "res.add": 1, "res.node": 1, "item": 5, "circular": 3, "list.": 4, "Because": 2, "circularity": 1, "there": 3, "always": 1, "default": 2, "let": 1, "it": 7, "previous": 5, "Coherence": 1, "between": 1, "maintained": 1, "IndexedIterator": 1, "pointed.": 1, "Is": 1, "empty.": 5, "iterated.": 1, "is_ok": 1, "Empty": 1, "lists": 2, "are": 7, "OK.": 2, "Pointing": 1, "again": 1, "self.index": 3, "self.list.node": 1, "list.node": 1, "self.list": 1, "i.add_all": 1, "i.first": 1, "i.join": 3, "i.push": 1, "i.shift": 1, "i.pop": 1, "i.unshift": 1, "i.josephus": 1, "clock": 4, "Clock": 10, "total": 1, "minutes": 12, "total_minutes": 2, "Note": 10, "read": 2, "acces": 1, "public": 1, "write": 3, "access": 4, "private.": 1, "hour": 3, "self.total_minutes": 8, "set": 2, "hour.": 1, "<": 15, "changed": 1, "accordinlgy": 1, "self.hours": 1, "hours": 9, "updated": 1, "h": 7, "arrow": 2, "interval": 1, "hour_pos": 2, "replace": 1, "updated.": 1, "to_s": 3, "reset": 1, "hours*60": 1, "self.reset": 1, "o": 5, "type": 5, "test": 1, "required": 1, "Thanks": 1, "adaptive": 1, "typing": 1, "no": 3, "downcast": 1, "i.e.": 1, "code": 3, "safe": 4, "o.total_minutes": 2, "c.minutes": 1, "c.hours": 1, "c2": 2, "c2.minutes": 1, "clock_more": 1, "now": 1, "comparable": 1, "Comparable": 1, "Comparaison": 1, "make": 1, "sense": 1, "other": 4, "OTHER": 1, "Comparable.": 1, "All": 1, "methods": 2, "rely": 1, "on": 5, "c1": 1, "c3": 1, "c1.minutes": 1, "curl_http": 1, "curl": 11, "MyHttpFetcher": 2, "CurlCallbacks": 1, "Curl": 4, "our_body": 1, "String": 45, "self.curl": 1, "Release": 1, "destroy": 1, "self.curl.destroy": 1, "Header": 1, "header_callback": 1, "line": 3, "We": 1, "silent": 1, "testing": 1, "purposes": 2, "#if": 1, "line.has_prefix": 1, "Body": 1, "body_callback": 1, "self.our_body": 1, "Stream": 1, "Cf": 1, "No": 1, "registered": 1, "stream_callback": 1, "buffer": 3, "size": 10, "args.length": 3, "url": 2, "args": 9, "request": 1, "CurlHTTPRequest": 1, "HTTP": 3, "Get": 2, "Request": 3, "request.verbose": 3, "getResponse": 3, "request.execute": 2, "CurlResponseSuccess": 2, "CurlResponseFailed": 5, "Post": 1, "myHttpFetcher": 2, "request.delegate": 1, "postDatas": 5, "HeaderMap": 3, "request.datas": 1, "postResponse": 3, "file": 23, "headers": 3, "request.headers": 1, "downloadResponse": 3, "request.download_to_file": 1, "CurlFileResponseSuccess": 1, "Program": 1, "logic": 1, "curl_mail": 1, "mail_request": 1, "CurlMailRequest": 1, "response": 5, "mail_request.set_outgoing_server": 1, "mail_request.from": 1, "mail_request.to": 1, "mail_request.cc": 1, "mail_request.bcc": 1, "headers_body": 4, "mail_request.headers_body": 1, "mail_request.body": 1, "mail_request.subject": 1, "mail_request.verbose": 1, "mail_request.execute": 1, "CurlMailResponseSuccess": 1, "draw_operation": 1, "enum": 3, "n_chars": 1, "abs": 2, "log10f": 1, "float": 1, "as_operator": 1, "b": 11, "abort": 2, "override_dispc": 1, "Bool": 18, "lines": 7, "Line": 53, "P": 51, "s/2": 23, "y": 9, "lines.add": 1, "q4": 4, "s/4": 1, "l": 16, "lines.append": 1, "tl": 2, "tr": 2, "hack": 3, "support": 1, "bug": 1, "evaluation": 1, "software": 1, "draw": 1, "dispc": 2, "gap": 1, "w": 3, "length": 6, "*gap": 1, "map": 8, ".filled_with": 1, "ci": 2, "self.chars": 3, "local_dispc": 4, "c.override_dispc": 1, "c.lines": 1, "line.o.x": 1, "ci*size": 1, "ci*gap": 1, "line.o.y": 1, "ine.len": 1, "map.length": 3, ".length": 2, "line.step_x": 1, "line.step_y": 1, "printn": 11, "step_x": 1, "step_y": 1, "len": 7, "op_char": 3, "disp_char": 6, "disp_size": 6, "disp_gap": 6, "gets.to_i": 4, "gets.chars": 2, "op_char.as_operator": 1, "len_a": 2, "a.n_chars": 1, "len_b": 2, "b.n_chars": 1, "len_res": 3, "result.n_chars": 1, "max_len": 5, "len_a.max": 1, "len_b.max": 1, "d": 8, "line_a": 3, "a.to_s": 1, "line_a.draw": 1, "line_b": 3, "op_char.to_s": 1, "b.to_s": 1, "line_b.draw": 1, "disp_size*max_len": 1, "*disp_gap": 1, "line_res": 3, "result.to_s": 1, "line_res.draw": 1, "drop_privileges": 1, "privileges": 1, "opts": 1, "OptionContext": 1, "opt_ug": 2, "OptionUserAndGroup.for_dropping_privileges": 1, "opt_ug.mandatory": 1, "opts.add_option": 1, "opts.parse": 1, "opts.errors.is_empty": 1, "opts.errors": 1, "opts.usage": 1, "exit": 4, "user_group": 2, "opt_ug.value": 1, "user_group.drop_privileges": 1, "extern_methods": 1, "Returns": 14, "th": 2, "fibonnaci": 1, "implemented": 1, "here": 1, "optimization": 1, "fib": 4, "Int_fib": 3, "System": 1, "seconds": 1, "Return": 6, "atan2l": 1, "libmath": 1, "atan_with": 2, "atan2": 1, "This": 4, "Nit": 2, "It": 1, "use": 3, "local": 1, "operator": 2, "all": 8, "objects": 2, "String.to_cstring": 3, "equivalent": 1, "char*": 1, "foo": 2, "long": 2, "recv_fib": 2, "recv_plus_fib": 2, "Int__plus": 1, "nit_string": 2, "Int_to_s": 1, "char": 4, "*c_string": 1, "String_to_cstring": 2, "printf": 1, "c_string": 1, "Equivalent": 1, "pure": 1, "bar": 2, "ib": 1, "oo": 1, "fibonacci": 3, "Calculate": 1, "element": 1, "sequence.": 1, ".fibonacci": 2, "usage": 3, "args.first.to_i.fibonacci": 1, "intrude": 2, "stream": 5, "ropes": 1, "string_search": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "FStream": 6, "IOS": 1, "path": 33, "file.": 3, "FILE": 1, "*.": 1, "NativeFile": 3, "file_stat": 4, "FileStat": 7, "_file.file_stat": 1, "File": 2, "descriptor": 2, "fd": 18, "_file.fileno": 1, "IFStream": 3, "BufferedIStream": 1, "PollableIStream": 2, "Misc": 1, "Open": 3, "same": 2, "again.": 1, "original": 1, "reused": 1, "therefore": 1, "reopened": 1, "can": 1, "different": 1, "reopen": 1, "eof": 1, "_file.address_is_null": 9, "close": 17, "_file": 8, "NativeFile.io_open_read": 2, "path.to_cstring": 3, "last_error": 12, "IOError": 10, "end_reached": 7, "_buffer_pos": 2, "_buffer.clear": 2, "_file.io_close": 2, "fill_buffer": 1, "nb": 4, "_file.io_read": 1, "_buffer.items": 1, "_buffer.capacity": 1, "_buffer.length": 1, "End": 1, "reading.": 1, "open": 16, "self.path": 5, "prepare_buffer": 3, "from_fd": 2, "fd_to_stream": 6, "read_only": 2, "OFStream": 4, "OStream": 3, "_is_writable": 10, "FlatText": 1, "write_native": 3, "s.to_cstring": 1, "s.substrings": 1, "i.to_cstring": 1, "i.length": 1, "is_writable": 2, "Write": 1, "bytes": 1, "native": 3, "NativeString": 11, "err": 2, "_file.io_write": 1, "Big": 1, "problem": 1, "writing.": 1, "NativeFile.io_open_write": 1, "Creates": 1, "wipe_write": 2, ".to_cstring": 2, "mode": 9, "fdopen": 1, "returns": 2, "available": 1, "interruption": 1, "possibly": 1, "protected": 9, "poll": 3, "streams": 2, "in_fds": 5, "out_fds": 5, "HashMap": 2, "s.fd": 1, "in_fds.add": 1, "out_fds.add": 1, "polled_fd": 3, "intern_poll": 2, "Int.as": 1, "in_len": 4, "out_len": 3, "total_len": 5, "pollfd": 2, "*c_fds": 1, "sigset_t": 1, "sigmask": 1, "first_polled_fd": 3, "Array_of_Int_length": 2, "c_fds": 10, "Array_of_Int__index": 2, ".fd": 2, ".events": 2, "POLLIN": 1, "": 1, "events": 1, "POLLOUT": 1, "fds": 1, "unlimited": 1, "timeout": 1, "1": 1, ".revents": 2, "||": 1, "POLLHUP": 1, "break": 3, "Int_as_nullable": 1, "fprintf": 1, "stderr": 2, "strerror": 1, "errno": 2, "null_Int": 1, "###############################################################################": 2, "Stdin": 2, "NativeFile.native_stdin": 1, "poll_in": 1, "Stdout": 2, "NativeFile.native_stdout": 1, "Stderr": 2, "NativeFile.native_stderr": 1, "Streamable": 2, "write_to": 2, "care": 1, "creating": 1, "write_to_file": 1, "filepath": 2, "OFStream.open": 2, "stream.close": 1, "names": 1, "exists": 1, "file_exists": 2, "to_cstring.file_exists": 1, "status": 3, "see": 3, "POSIX": 5, "stat": 4, "to_cstring.file_stat": 1, "symlink.": 1, "lstat": 2, "file_lstat": 2, "to_cstring.file_lstat": 1, "Remove": 4, "success": 2, "file_delete": 2, "to_cstring.file_delete": 1, "Copy": 1, "content": 2, "dest": 8, "file_copy_to": 1, "input": 2, "IFStream.open": 1, "output": 3, "input.eof": 1, "input.read": 1, "output.write": 1, "input.close": 1, "output.close": 1, "trailing": 4, "extension": 5, "ext": 7, "usually": 1, "starts": 2, "dot": 4, "could": 1, "anything.": 1, ".strip_extension": 4, "present": 1, "returned": 2, "unmodified.": 1, "strip_extension": 1, "has_suffix": 1, "substring": 4, "ext.length": 1, "Extract": 2, "basename": 2, "remove": 4, ".basename": 8, "Index": 2, "pos": 8, "chars.last_index_of_from": 2, "n.strip_extension": 1, "dirname": 2, ".dirname": 8, "canonicalized": 1, "absolute": 2, "pathname": 1, "realpath": 2, "cs": 1, "to_cstring.file_realpath": 1, "cs.to_s_with_copy": 1, "cs.free_malloc": 1, "FIXME": 1, "leak": 1, "Simplify": 1, "useless": 1, "removing": 1, "resolving": 1, "resolved": 1, "they": 2, "start": 2, "starting": 4, "removed": 2, "trainling": 1, "wonrk": 1, "string": 4, "I/O": 1, "performed": 1, "validity": 1, "checked": 1, ".simplify_path": 6, "simplify_path": 2, "self.split_with": 2, "a2": 1, "continue": 4, "a2.is_empty": 3, "a2.last": 1, "a2.pop": 1, "a2.push": 1, "a2.length": 1, "a2.first": 1, "a2.join": 1, "Correctly": 1, "join": 2, "two": 1, "directory": 16, "separator.": 1, "Using": 1, "does": 1, "work": 1, "following": 3, "cases": 3, "ends": 1, "ensures": 1, "valid.": 1, ".join_path": 6, "You": 1, "may": 3, "want": 1, "result.": 1, "works": 1, "paths.": 1, "join_path": 3, "path.is_empty": 1, "path.chars": 1, "self.last": 1, "Convert": 1, "program": 3, "name.": 2, "Ensure": 1, "treated": 1, "shells": 1, "when": 1, "In": 3, "order": 1, "prepend": 1, "./": 1, "needed.": 1, ".to_program_name": 3, "At": 1, "least": 1, "shell": 1, "detect": 1, "error.": 1, "to_program_name": 1, "self.has_prefix": 1, "Alias": 1, "quite": 1, "useful": 1, "chaining": 1, "changes": 1, "path.": 1, "being": 1, "relative": 3, "one.": 1, "a/b/c": 1, "needed": 2, "go": 2, ".relpath": 11, "If": 2, "considered": 1, "relatively": 1, "getcwd": 6, "still": 1, "independent": 2, "parts": 1, "exhibited": 1, "p": 2, "getcwd.basename": 1, "For": 2, "resolution": 2, "eg.": 1, "paths": 3, "URL": 1, "than": 1, "just": 1, "force": 1, "p2": 2, "start/": 2, "Neither": 1, "real": 1, "exist": 1, "directories": 2, "since": 1, "done": 1, "manipulations": 1, "without": 3, "underlying": 1, "system.": 1, "designate": 1, "both": 2, "relpath": 1, "cwd": 1, "cwd/self": 1, ".simplify_path.split": 2, "from.last.is_empty": 1, "from.pop": 1, "root": 2, "cwd/dest": 1, "to.last.is_empty": 1, "to.pop": 1, "common": 1, "prefixes": 1, "from.is_empty": 1, "to.is_empty": 2, "from.first": 1, "to.first": 1, "from.shift": 1, "to.shift": 1, "Result": 1, "going": 2, "up": 4, "down": 1, "from_len": 3, "from.length": 1, "to.join": 2, "Create": 1, "intermediate": 1, "mkdir": 1, "dirs": 3, "FlatBuffer": 1, "dirs.is_empty": 1, ".is_empty": 1, "was": 1, "path.add": 2, "d.is_empty": 1, "path.append": 1, "path.to_s.to_cstring.file_mkdir": 1, "Delete": 2, "its": 1, "Does": 1, "through": 1, "symbolic": 1, "links": 1, "stuck": 1, "cycle": 2, "filesystem.": 1, "rmdir": 3, "ok": 7, "self.files": 1, "file_path": 1, "self.join_path": 1, "file_path.file_lstat": 1, "stat.is_dir": 1, "file_path.rmdir": 1, "file_path.file_delete": 1, "stat.free": 1, "itself": 1, "to_cstring.rmdir": 1, "Change": 1, "working": 1, ".chdir": 2, "TODO": 1, "chdir": 1, "to_cstring.file_chdir": 1, "right": 1, "most": 1, "Only": 1, "returned.": 3, "There": 1, "combined": 1, "extensions.": 1, ".file_extension": 6, "Hoever": 1, "hidden": 1, "files": 3, "never": 1, "considered.": 1, "file_extension": 1, "last_slash": 3, "chars.last_index_of": 1, "contained": 1, "within": 1, "represented": 1, "Set": 2, "HashSet": 3, ".add": 1, "NativeString.to_s": 1, ".as": 1, "*dir_path": 1, "DIR": 1, "*dir": 1, "dir_path": 3, "dir": 3, "opendir": 1, "NULL": 3, "perror": 1, "HashSet_of_String": 1, "results": 4, "file_name": 3, "dirent": 1, "*de": 1, "new_HashSet_of_String": 1, "de": 4, "readdir": 1, "strcmp": 2, "d_name": 3, "&&": 1, "NativeString_to_s": 1, "strdup": 1, "HashSet_of_String_add": 1, "closedir": 1, "HashSet_of_String_as_Set_of_String": 1, "stat*": 1, "stat_element": 4, "file_mkdir": 1, "file_chdir": 1, "file_realpath": 1, "permission": 1, "bits": 1, "atime": 1, "change": 1, "ctime": 1, "modification": 1, "mtime": 1, "regular": 1, "device": 3, "pipe": 1, "sockect": 1, "is_reg": 1, "S_ISREG": 1, "st_mode": 7, "is_dir": 1, "S_ISDIR": 1, "character": 1, "is_chr": 1, "S_ISCHR": 1, "block": 1, "is_blk": 1, "S_ISBLK": 1, "fifo": 1, "is_fifo": 1, "S_ISFIFO": 1, "link": 1, "is_lnk": 1, "S_ISLNK": 1, "socket": 7, "is_sock": 1, "S_ISSOCK": 1, "FILE*": 1, "io_read": 1, "buf": 2, "io_write": 1, "io_close": 1, "fileno": 2, "io_open_read": 1, "io_open_write": 1, "native_stdin": 1, "native_stdout": 1, "native_stderr": 1, "Sys": 1, "Standard": 3, "stdin": 1, "writable": 3, "stdout": 3, "errors": 1, "Object...": 1, "sys.stdout.write": 3, "objects.to_s": 1, "object.to_s": 1, "getc": 1, "sys.stdin.read_char.ascii": 1, "gets": 2, "sys.stdin.read_line": 1, "file_getcwd.to_s": 1, "file_getcwd": 1, "html": 1, "NitHomepage": 2, "HTMLPage": 1, "head": 5, "add": 39, ".attr": 17, ".text": 27, "body": 1, ".add_class": 4, "add_html": 7, "page": 2, "page.write_to": 1, "page.write_to_file": 1, "int_stack": 1, "IntStack": 2, "Null": 1, "means": 1, "stack": 3, "ISNode": 4, "Add": 2, "integer": 2, "stack.": 2, "val": 5, "self.head": 5, "pushed": 1, "integer.": 1, "followings": 2, "statically": 3, "head.val": 1, "head.next": 1, "sum": 12, "integers": 1, "sumall": 1, "cur": 3, "condition": 1, "cur.val": 1, "cur.next": 1, "attributes": 1, "have": 1, "value": 2, "free": 2, "constructor": 2, "implicitly": 2, "defined.": 2, "stored": 1, "node.": 1, "any.": 1, "A": 1, "l.push": 4, "l.sumall": 1, "loop": 2, "l.pop": 5, "gives": 2, "alternative": 1, "meetup": 6, "opportunity_model": 1, "boilerplate": 1, "welcome": 1, "template": 2, "OpportunityMeetupPage": 1, "OpportunityPage": 1, "Meetup": 3, "supposed": 1, "show": 1, "Answer": 1, "from_id": 1, "db": 11, "OpportunityDB.open": 2, "db.find_meetup_by_id": 1, "db.close": 2, "meetup.answer_mode": 1, "header.page_js": 11, "rendering": 4, "OpportunityHomePage": 1, ".write_to_string": 1, "header": 1, "meetup.to_html": 1, "footer": 1, "Build": 1, "HTML": 1, "to_html": 1, "OpportunityDB": 1, "t": 2, "Template": 4, "t.add": 37, "date.is_empty": 1, "place.is_empty": 1, "answers": 4, "i.to_s": 2, "participants": 1, "i.load_answers": 1, "j": 1, "k": 7, "i.answers": 1, "color": 6, "answer_mode": 2, "Compute": 1, "score": 1, "each": 1, "scores": 5, "maxsc": 4, "i.id": 5, "i.score": 1, "scores.has_key": 1, "opengles2_hello_triangle": 1, "glesv2": 1, "egl": 1, "mnit_linux": 1, "sdl": 1, "x11": 1, "window_width": 2, "window_height": 2, "##": 6, "SDL": 2, "sdl_display": 1, "SDLDisplay": 1, "sdl_wm_info": 1, "SDLSystemWindowManagerInfo": 1, "x11_window_handle": 2, "sdl_wm_info.x11_window_handle": 1, "X11": 1, "x_display": 3, "x_open_default_display": 1, "EGL": 2, "egl_display": 6, "EGLDisplay": 1, "egl_display.is_valid": 2, "egl_display.initialize": 1, "egl_display.error": 3, "config_chooser": 1, "EGLConfigChooser": 1, "#config_chooser.surface_type_egl": 1, "config_chooser.blue_size": 1, "config_chooser.green_size": 1, "config_chooser.red_size": 1, "#config_chooser.alpha_size": 1, "#config_chooser.depth_size": 1, "#config_chooser.stencil_size": 1, "#config_chooser.sample_buffers": 1, "config_chooser.close": 1, "configs": 3, "config_chooser.choose": 1, "configs.is_empty": 1, "config": 4, "attribs": 1, "config.attribs": 2, "configs.first": 1, "format": 1, ".native_visual_id": 1, "surface": 5, "egl_display.create_window_surface": 1, "surface.is_ok": 1, "egl_display.create_context": 1, "context.is_ok": 1, "make_current_res": 2, "egl_display.make_current": 2, "width": 2, "surface.attribs": 2, ".width": 1, "height": 2, ".height": 1, "egl_bind_opengl_es_api": 1, "GLESv2": 1, "assert_no_gl_error": 6, "gl_shader_compiler": 1, "gl_error.to_s": 1, "GLProgram": 1, "program.is_ok": 1, "program.info_log": 1, "vertex_shader": 2, "GLVertexShader": 1, "vertex_shader.is_ok": 1, "vertex_shader.source": 1, "vertex_shader.compile": 1, "vertex_shader.is_compiled": 1, "fragment_shader": 2, "GLFragmentShader": 1, "fragment_shader.is_ok": 1, "fragment_shader.source": 1, "fragment_shader.compile": 1, "fragment_shader.is_compiled": 1, "program.attach_shader": 2, "program.bind_attrib_location": 1, "program.link": 1, "program.is_linked": 1, "vertices": 2, "vertex_array": 1, "VertexArray": 1, "vertex_array.attrib_pointer": 1, "gl_clear_color": 1, "gl_viewport": 1, "gl_clear_color_buffer": 1, "program.use": 1, "vertex_array.enable": 1, "vertex_array.draw_arrays_triangles": 1, "egl_display.swap_buffers": 1, "program.delete": 1, "vertex_shader.delete": 1, "fragment_shader.delete": 1, "EGLSurface.none": 2, "EGLContext.none": 1, "egl_display.destroy_context": 1, "egl_display.destroy_surface": 1, "sdl_display.destroy": 1, "print_arguments": 1, "procedural_array": 1, "array_sum": 2, "array_sum_alt": 2, "a.length": 1, "socket_client": 1, "Socket.client": 1, ".to_i": 2, "s.connected": 1, "s.write": 1, "s.close": 1, "socket_server": 1, "args.is_empty": 1, "Socket.server": 1, "clients": 2, "Socket": 1, "max": 2, "fs": 1, "SocketObserver": 1, "fs.readset.set": 2, "fs.select": 1, "fs.readset.is_set": 1, "ns": 1, "socket.accept": 1, "ns.write": 1, "ns.close": 1, "###": 2, "Here": 2, "definition": 1, "specific": 1, "templates": 2, "TmplComposers": 2, "Short": 2, "composers": 4, "TmplComposer": 3, "Detailled": 1, "composer_details": 2, "TmplComposerDetail": 3, "composer": 1, "add_composer": 1, "firstname": 5, "lastname": 6, "birth": 5, "death": 5, "composers.add": 1, "composer_details.add": 1, "add_all": 2, "name": 4, "self.name": 1, "self.firstname": 1, "self.lastname": 1, "self.birth": 1, "self.death": 1, "simple": 1, "f": 1, "f.add_composer": 3, "f.write_to": 1, "websocket_server": 1, "websocket": 1, "sock": 1, "WebSocket": 1, "msg": 8, "sock.listener.eof": 2, "sys.errno.strerror": 1, "sock.accept": 2, "sock.connected": 1, "sys.stdin.poll_in": 1, "sock.close": 1, "sock.disconnect_client": 1, "sock.write": 1, "sock.can_read": 1, "sock.read_line": 1 }, "Nix": { "{": 11, "stdenv": 1, "fetchurl": 2, "fetchgit": 5, "openssl": 2, "zlib": 2, "pcre": 2, "libxml2": 2, "libxslt": 2, "expat": 2, "rtmp": 4, "false": 5, "fullWebDAV": 3, "syslog": 4, "moreheaders": 3, "...": 1, "}": 10, "let": 1, "version": 2, ";": 32, "mainSrc": 2, "url": 5, "sha256": 5, "-": 12, "ext": 5, "git": 2, "//github.com/arut/nginx": 2, "module.git": 3, "rev": 4, "dav": 2, "https": 2, "//github.com/yaoweibin/nginx_syslog_patch.git": 1, "//github.com/agentzh/headers": 1, "more": 1, "nginx": 1, "in": 1, "stdenv.mkDerivation": 1, "rec": 1, "name": 1, "src": 1, "buildInputs": 1, "[": 5, "]": 5, "+": 10, "stdenv.lib.optional": 5, "patches": 1, "if": 2, "then": 2, "else": 2, "configureFlags": 1, "preConfigure": 1, "export": 1, "NIX_CFLAGS_COMPILE": 1, "postInstall": 1, "mv": 1, "out/sbin": 1, "out/bin": 1, "true": 1, "meta": 1, "description": 1, "maintainers": 1, "stdenv.lib.maintainers.raskin": 1, "platforms": 1, "stdenv.lib.platforms.all": 1, "inherit": 1 }, "Nu": { "SHEBANG#!nush": 1, "(": 14, "puts": 1, ")": 14, ";": 22, "main.nu": 1, "Entry": 1, "point": 1, "for": 1, "a": 1, "Nu": 1, "program.": 1, "Copyright": 1, "c": 1, "Tim": 1, "Burks": 1, "Neon": 1, "Design": 1, "Technology": 1, "Inc.": 1, "load": 4, "basics": 1, "cocoa": 1, "definitions": 1, "menu": 1, "generation": 1, "Aaron": 1, "Hillegass": 1, "t": 1, "retain": 1, "it.": 1, "NSApplication": 2, "sharedApplication": 2, "setDelegate": 1, "set": 1, "delegate": 1, "ApplicationDelegate": 1, "alloc": 1, "init": 1, "this": 1, "makes": 1, "the": 3, "application": 1, "window": 1, "take": 1, "focus": 1, "when": 1, "we": 1, "ve": 1, "started": 1, "it": 1, "from": 1, "terminal": 1, "activateIgnoringOtherApps": 1, "YES": 1, "run": 1, "main": 1, "Cocoa": 1, "event": 1, "loop": 1, "NSApplicationMain": 1, "nil": 1 }, "OCaml": { "let": 758, "err_argv": 1, "err_not_opt": 1, "err_not_pos": 1, "err_help": 1, "s": 172, "err_empty_list": 2, "rev_compare": 1, "n": 38, "str": 36, "Printf.sprintf": 22, "pr": 5, "Format.fprintf": 2, "pr_str": 1, "Format.pp_print_string": 2, "pr_char": 1, "Format.pp_print_char": 1, "str_of_pp": 1, "pp": 23, "v": 97, "Format.str_formatter": 1, ";": 1001, "Format.flush_str_formatter": 1, "(": 995, ")": 1000, "quote": 22, "alts_str": 3, "quoted": 2, "true": 24, "alts": 4, "if": 118, "then": 117, "else": 106, "fun": 38, "-": 713, "in": 263, "match": 127, "with": 139, "|": 523, "[": 132, "]": 134, "invalid_arg": 3, "a": 106, "b": 33, "rev_alts": 3, "List.rev": 4, "String.concat": 15, "List.rev_map": 3, "List.tl": 1, "List.hd": 1, "pr_white_str": 3, "spaces": 2, "ppf": 25, "left": 5, "ref": 12, "and": 13, "right": 8, "len": 12, "String.length": 15, "flush": 10, "String.sub": 5, "incr": 2, "while": 1, "<": 131, "do": 6, "s.": 3, "Format.pp_force_newline": 1, "&&": 8, "Format.pp_print_space": 1, "done": 6, "pr_text": 2, "pr_lines": 1, "false": 42, "pr_to_temp_file": 1, "try": 8, "exec": 2, "Filename.basename": 3, "Sys.argv.": 1, "file": 42, "oc": 169, "Filename.open_temp_file": 1, "Format.formatter_of_out_channel": 1, "Format.pp_print_flush": 2, "close_out": 7, "at_exit": 1, "Sys.remove": 1, "Sys_error": 2, "e": 59, "Some": 60, "_": 158, "None": 44, "levenshtein_distance": 2, "t": 520, "minimum": 2, "c": 62, "min": 9, "m": 36, "d": 235, "Array.make_matrix": 1, "+": 60, "for": 9, "i": 42, "to": 10, "d.": 9, ".": 11, "j": 123, "t.": 1, "suggest": 1, "candidates": 2, "add": 6, "acc": 30, "name": 130, "dist": 2, "suggs": 2, "List.fold_left": 4, "max_int": 1, "module": 84, "Trie": 1, "sig": 7, "type": 106, "val": 17, "is_empty": 2, "string": 43, "find": 2, "Ambiguous": 2, "Not_found": 5, "ambiguities": 2, "list": 12, "value": 6, "Pre": 6, "of": 28, "Amb": 6, "Nil": 4, "succs": 5, "not": 6, "important": 1, "our": 1, "use.": 1, "Also": 1, "the": 5, "following": 1, "is": 4, "tail": 1, "recursive": 1, "but": 2, "stack": 5, "bounded": 1, "by": 1, "key": 31, "length.": 1, "*": 15, "k": 107, "rec": 33, "aux": 6, "pre_d": 3, "{": 84, "Key": 5, "t.succs": 3, "}": 85, "t.v": 3, "as": 23, "find_node": 3, "Cmap.find": 1, "k.": 1, ".v": 1, "Ok": 4, "p": 25, "add_char": 1, "String.make": 1, "rem_char": 1, "to_list": 1, "Cmap.fold": 1, "function": 35, "rest": 5, "compare": 5, "a.id": 1, "r": 26, "g": 1, "Nth": 8, "<=>": 3, "1": 9, "Left": 1, "Right": 2, "format_pos": 4, "al": 3, "is_opt": 3, "a.docv": 6, "a.absent": 1, "Error": 1, "a.p_kind": 2, "args": 6, "List.sort": 2, "rev_cmp": 2, "snd": 2, "ei.term": 3, "invocation": 1, "ei": 19, "get_synopsis_section": 2, "extract_synopsis": 3, "syn": 4, "S": 4, "man": 9, "block": 14, "fst": 4, ".man": 1, "P": 1, "synopsis": 4, "make_arg_label": 1, "is_pos": 1, "fmt_name": 2, "var": 7, "a.o_kind": 1, "Flag": 1, "Opt": 1, "Opt_vopt": 1, "names": 14, "a.o_names": 1, "make_arg_items": 2, "buf": 7, "Buffer.create": 3, "subst_docv": 1, "docv": 4, "subst": 3, "Buffer.clear": 1, "Buffer.add_substitute": 1, "Buffer.contents": 2, ".docs": 1, ".o_names": 1, "String.lowercase": 2, "ss": 2, "Manpage.block": 1, "orphans": 5, "merge": 1, "merge_orphans": 3, "ts": 3, "#Manpage.block": 1, "cmds": 2, "make_cmd_items": 1, "cmp": 7, "items": 2, "List.stable_sort": 1, "List.rev_append": 1, "rev_text": 2, "merge_items": 1, "Orphan_mark": 1, "@": 57, "ei_subst": 3, ".name": 2, "ei.main": 2, "title": 2, "name_section": 1, "text": 1, "print": 1, "fmt": 7, "Manpage.print": 1, "pr_synopsis": 1, "Manpage.escape": 1, "Manpage.plain_esc": 1, "pr_version": 1, ".version": 1, "assert": 9, "end": 71, "Err": 1, "struct": 40, "invalid": 2, "kind": 10, "exp": 4, "invalid_val": 2, "no": 1, "not_dir": 1, "is_dir": 1, "element": 1, "sep_miss": 1, "sep": 2, "unknown": 1, "hints": 4, "did_you_mean": 2, "hs": 2, "ambiguous": 1, "ambs": 2, "pos_excess": 1, "excess": 2, "List.map": 6, "flag_value": 1, "f": 72, "opt_value_missing": 1, "opt_parse_value": 1, "opt_repeated": 1, "more": 2, "information.@": 2, "<2>": 1, "Try": 1, "%": 24, "help": 3, "": 1, "a@": 3, "Usage": 1, "@.": 1, "command": 11, "option": 13, "ARGUMENTS": 1, "OPTIONS": 2, "expected": 7, "character": 1, "an": 1, "integer": 4, "bit": 2, "ld": 1, "Ld": 1, "processor": 1, "native": 1, "nd": 1, "floating": 1, "point": 1, "number": 1, "enum": 1, "or": 3, "directory": 2, "array": 1, "pair": 1, "triple": 1, "quadruple": 1, "COMMANDS": 1, "pager": 4, "groff": 4, "plain": 4, "Show": 3, "output": 8, "format": 5, "FMT": 2, "version": 2, "information.": 1, "this": 1, "dummy": 2, "AS": 1, "IS": 1, "AND": 3, "ANY": 4, "EXPRESS": 1, "OR": 8, "IMPLIED": 2, "WARRANTIES": 2, "INCLUDING": 3, "BUT": 2, "NOT": 3, "LIMITED": 2, "TO": 2, "THE": 4, "OF": 8, "MERCHANTABILITY": 1, "FITNESS": 1, "FOR": 2, "A": 1, "PARTICULAR": 1, "PURPOSE": 1, "ARE": 1, "DISCLAIMED.": 1, "IN": 3, "NO": 1, "EVENT": 1, "SHALL": 1, "COPYRIGHT": 1, "OWNER": 1, "CONTRIBUTORS": 1, "BE": 1, "LIABLE": 1, "DIRECT": 1, "INDIRECT": 1, "INCIDENTAL": 1, "SPECIAL": 1, "EXEMPLARY": 1, "CONSEQUENTIAL": 1, "DAMAGES": 1, "PROCUREMENT": 1, "SUBSTITUTE": 1, "GOODS": 1, "SERVICES": 1, "LOSS": 1, "USE": 2, "DATA": 1, "PROFITS": 1, "BUSINESS": 1, "INTERRUPTION": 1, "HOWEVER": 1, "CAUSED": 1, "ON": 1, "THEORY": 1, "LIABILITY": 2, "WHETHER": 1, "CONTRACT": 1, "STRICT": 1, "TORT": 1, "NEGLIGENCE": 1, "OTHERWISE": 1, "ARISING": 1, "WAY": 1, "OUT": 1, "THIS": 1, "SOFTWARE": 1, "EVEN": 1, "IF": 1, "ADVISED": 1, "POSSIBILITY": 1, "SUCH": 1, "DAMAGE.": 1, "string_of": 1, "Format.formatter_of_buffer": 1, "begin": 24, "open": 15, "Ctypes": 2, "PosixTypes": 2, "Foreign": 18, "tm": 9, "structure": 2, "ty": 7, "label": 2, "field": 1, "tm_sec": 1, "int": 37, "tm_min": 1, "tm_hour": 1, "tm_mday": 1, "tm_mon": 2, "tm_year": 2, "tm_wday": 1, "tm_yday": 1, "tm_isdst": 1, "seal": 1, "typ": 21, "time": 21, "foreign": 12, "check_errno": 4, "ptr": 11, "time_t": 4, "returning": 8, "asctime": 2, "localtime": 2, "timep": 3, "allocate_n": 3, "count": 5, "@timep": 1, "Printf.printf": 2, "getf": 2, "@tm": 2, "print_endline": 1, "shared": 1, "Eliom_content": 1, "Html5.D": 1, "Eliom_parameter": 1, "server": 2, "Example": 1, "Eliom_registration.App": 1, "application_name": 1, "main": 2, "Eliom_service.service": 1, "path": 1, "get_params": 1, "unit": 20, "client": 1, "hello_popup": 2, "Dom_html.window##alert": 1, "Js.string": 1, "Example.register": 1, "service": 1, "Lwt.return": 1, "html": 1, "head": 1, "pcdata": 4, "body": 3, "h1": 1, "h2": 1, "a_onclick": 1, "Ops": 2, "x": 44, "List": 1, "map": 5, "l": 65, "hd": 6, "tl": 6, "fold": 4, "Option": 1, "opt": 2, "Lazy": 1, "mutable": 21, "waiters": 5, "make": 4, "push": 4, "cps": 7, "force": 1, "l.value": 2, "when": 6, "l.waiters": 5, "<->": 23, "Base.List.iter": 1, "l.push": 1, "get_state": 1, "lazy_from_val": 1, "OrderedType": 1, "bool": 6, "partition": 1, "cardinal": 4, "Empty": 4, "Node": 6, "mapi": 2, "filter": 4, "pvd": 1, "enumeration": 2, "End": 27, "More": 6, "cons_enum": 10, "m1": 4, "m2": 4, "compare_aux": 3, "e1": 8, "e2": 8, "v1": 4, "d1": 4, "r1": 4, "v2": 4, "d2": 4, "r2": 4, "Ord.compare": 2, "equal": 1, "equal_aux": 3, "bindings_aux": 4, "accu": 3, "bindings": 1, "choose": 1, "min_binding": 1, "Mirage_misc": 1, "StringSet": 1, "include": 2, "Set.Make": 1, "String": 6, "of_list": 1, "empty": 2, "List.iter": 6, "main_ml": 4, "append_main": 142, "failwith": 9, "append": 135, "newline_main": 43, "newline": 13, "set_main_ml": 2, "open_out": 7, "mode": 36, "Unix": 31, "Xen": 30, "MacOSX": 30, "string_of_mode": 2, "set_mode": 1, "get_mode": 1, "Type": 22, "Function": 3, "CONFIGURABLE": 2, "module_name": 61, "packages": 45, "libraries": 39, "configure": 32, "clean": 30, "update_path": 31, "TODO": 1, "N": 1, "todo": 8, "N.name": 1, "base": 22, "impl": 86, "App": 18, "app": 4, "string_of_impl": 3, "a.": 14, "Impl": 18, "M": 9, "M.module_name": 3, "b.": 1, "folder": 1, "fn": 10, "fn.fn": 2, "iterator": 2, "iter": 4, "fn.i": 2, "driver_initialisation_error": 12, "Name": 1, "ids": 3, "Hashtbl.create": 3, "create": 3, "Hashtbl.find": 1, "Hashtbl.replace": 1, "of_key": 1, "find_or_create": 1, "functor_name": 2, "M.name": 1, "Name.of_key": 19, "module_names": 2, "h": 2, "configured": 3, "Hashtbl.mem": 1, "Hashtbl.add": 1, "M.configure": 1, "configure_app": 3, "cofind": 1, "Name.names": 1, "M.packages": 1, "M.libraries": 1, "M.clean": 1, "root": 56, "b.m": 1, "M.update_path": 1, "b.t": 1, "implementation": 1, "Io_page": 2, "io_page": 9, "IO_PAGE": 2, "default_io_page": 2, "Time": 2, "TIME": 2, "default_time": 6, "Clock": 2, "clock": 16, "CLOCK": 2, "default_clock": 6, "Random": 2, "random": 15, "RANDOM": 2, "default_random": 5, "Entropy": 2, "construction": 4, "entropy": 4, "ENTROPY": 2, "default_entropy": 1, "Console": 3, "console": 16, "CONSOLE": 2, "default_console": 1, "custom_console": 1, "Crunch": 3, "String.capitalize": 14, "Io_page.packages": 1, "Io_page.libraries": 1, "ml": 3, "mli": 2, "command_exists": 2, "error": 9, "Sys.file_exists": 4, "info": 12, "blue_s": 10, "Sys.getcwd": 3, "/": 20, "remove": 8, "kv_ro": 6, "KV_RO": 2, "crunch": 1, "dirname": 4, "Direct_kv_ro": 2, "Crunch.module_name": 1, "Crunch.packages": 2, "Crunch.libraries": 2, "Crunch.configure": 1, "direct_kv_ro": 1, "Block": 2, "BLOCK": 2, "block_of_file": 3, "filename": 2, "Fat": 2, "Impl.name": 36, "t.io_page": 7, "t.block": 8, "Impl.packages": 19, "Impl.libraries": 19, "Impl.configure": 19, "Impl.module_name": 22, "Impl.clean": 19, "Impl.update_path": 18, "fs": 7, "FS": 2, "fat": 9, "Fat.block": 1, "kv_ro_of_fs": 1, "dummy_fat": 3, "Fat_of_files": 2, "dir": 6, "regexp": 6, "t.dir": 3, "t.regexp": 2, "block_file": 5, "Unix.chmod": 2, "o755": 2, "fat_of_files": 1, "Fat_of_files.dir": 1, "network_config": 2, "Tap0": 4, "Custom": 4, "Network": 3, "network": 16, "NETWORK": 2, "tap0": 1, "netif": 1, "dev": 2, "Ethif": 2, "ethernet": 3, "ETHERNET": 2, "etif": 7, "prefix": 2, "ip_config": 1, "address": 2, "gateways": 2, "ip": 16, "IP": 2, "ipv4": 6, "v4": 2, "ipv6": 4, "v6": 2, "create_ipv4": 2, "net": 6, "config": 8, "IPV4.ethernet": 1, "IPV4": 6, "default_ipv4_conf": 3, "Ipaddr.V4.of_string_exn": 1, "netmask": 1, "default_ipv4": 1, "create_ipv6": 1, "IPV6.ethernet": 1, "IPV6": 1, "UDP_direct": 1, "V": 2, "V.t": 2, "UDPV4_socket": 1, "Ipaddr.V4.t": 3, "Ipaddr.V4.to_string": 3, "tcp": 9, "TCP": 5, "tcpv4": 4, "tcpv6": 3, "direct_tcp": 1, "TCP_direct": 3, "TCP_direct.clock": 1, "socket_tcpv4": 1, "TCPV4_socket": 1, "STACKV4_direct": 4, "DHCP": 4, "ipv4_config": 1, "t.clock": 7, "t.time": 8, "t.console": 18, "t.network": 10, "t.random": 8, "t.config": 2, "meta_ipv4_config": 2, "net_init_error_msg_fn": 2, "STACKV4_socket": 2, "ipv4s": 3, "meta_ips": 3, "ips": 2, "t.ipv4s": 2, "stackv4": 8, "STACKV4": 2, "direct_stackv4_with_dhcp": 1, "STACKV4_direct.console": 3, "direct_stackv4_with_default_ipv4": 1, "direct_stackv4_with_static_ipv4": 1, "socket_stackv4": 1, "STACKV4_socket.console": 1, "Channel_over_TCP": 2, "channel": 4, "CHANNEL": 2, "channel_over_tcp": 1, "flow": 2, "VCHAN_localhost": 2, "uuid": 10, "VCHAN_xenstore": 2, "vchan": 7, "STACK4": 2, "vchan_localhost": 3, "vchan_xen": 2, "vchan_default": 1, "Conduit": 4, "Stack": 22, "module_name_core": 17, "stack_subname": 5, "vchan_subname": 4, "conduit": 6, "conduit_direct": 1, "conduit_client": 1, "Ipaddr.t": 1, "Vchan": 3, "conduit_server": 2, "Port": 2, "Resolver_unix": 2, "Resolver_direct": 2, "DNS": 14, "subname": 9, "res_ns": 2, "ns": 4, "res_ns_port": 2, "ns_port": 4, "resolver": 4, "Resolver": 2, "resolver_dns": 1, "resolver_unix_system": 1, "HTTP": 5, "Channel": 17, "port": 2, "http": 4, "http_server_of_channel": 1, "chan": 2, "http_server": 1, "job": 4, "JOB": 2, "Job": 1, "Name.create": 1, "t.name": 25, "t.impl": 5, "Tracing": 1, "size": 2, "unix_trace_file": 2, "StringSet.singleton": 3, "Sys.command": 1, "stdout": 1, "t.size": 2, "tracing": 12, "Tracing.t": 1, "mprof_trace": 1, "Tracing.size": 1, "jobs": 5, "config_file": 5, "reset": 2, "set_config_file": 2, "get_config_file": 5, "t.jobs": 10, "register": 1, "Filename.dirname": 3, "registered": 2, "ps": 15, "StringSet.empty": 2, "add_to_opam_packages": 1, "StringSet.union": 6, "StringSet.of_list": 4, "StringSet.add": 2, "t.tracing": 3, "Tracing.packages": 1, "set": 10, "StringSet.elements": 2, "ls": 15, "add_to_ocamlfind_libraries": 1, "Tracing.libraries": 1, "configure_myocamlbuild_ml": 2, "minor": 6, "major": 6, "ocaml_version": 1, "||": 15, "t.root": 24, "generated_by_mirage": 6, "clean_myocamlbuild_ml": 2, "configure_main_libvirt_xml": 2, "clean_main_libvirt_xml": 2, "configure_main_xl": 2, "clean_main_xl": 2, "configure_main_xe": 2, "clean_main_xe": 2, "get_extra_ld_flags": 2, "pkgs": 5, "read_command": 2, "split": 2, "line": 4, "cut_at": 1, "ldflags": 2, "configure_makefile": 2, "libraries_str": 2, "generate_image": 2, "need_zImage": 2, "uname_m": 1, "machine": 3, "extra_c_archives": 2, "pkg_config_deps": 3, "clean_makefile": 2, "no_opam_version_check_": 3, "no_opam_version_check": 1, "configure_opam": 2, "opam_version": 3, "version_error": 3, "int_of_string": 2, "Failure": 2, "opam": 1, "clean_opam": 2, "manage_opam_packages_": 4, "manage_opam_packages": 1, "configure_job": 2, "param_names": 3, "Impl.names": 1, "dedup": 1, "configure_main": 2, "Tracing.configure": 1, "clean_main": 2, "List.length": 2, "Impl.functor_name": 1, "in_dir": 4, "uname_s": 1, "build": 1, "run": 1, "compile_and_dynlink": 2, "Dynlink.adapt_filename": 1, "Filename.chop_extension": 1, "Dynlink.loadfile": 1, "Dynlink.Error": 1, "err": 2, "Dynlink.error_message": 1, "scan_conf": 2, "realpath": 3, "files": 2, "Array.to_list": 1, "Sys.readdir": 1, "List.filter": 1, "load": 1, "set_section": 1, "Cmm": 1, "Arch": 1, "Reg": 1, "Mach": 1, "stackp": 9, "r.loc": 1, "class": 1, "reload": 2, "object": 1, "self": 1, "inherit": 1, "Reloadgen.reload_generic": 1, "super": 1, "method": 2, "reload_operation": 1, "op": 6, "arg": 16, "res": 12, "Iintop": 3, "Iadd": 2, "Isub": 1, "Iand": 1, "Ior": 1, "Ixor": 1, "Icomp": 1, "Icheckbound": 1, "arg.": 18, "self#makereg": 6, "Iintop_imm": 2, ".loc": 2, "res.": 3, "super#reload_operation": 4, "Idiv": 1, "Imod": 1, "Ilsl": 1, "Ilsr": 1, "Iasr": 1, "Imul": 1, "Iaddf": 1, "Isubf": 1, "Imulf": 1, "Idivf": 1, "Ifloatofint": 1, "Iintoffloat": 1, "Iconst_int": 1, "0x7FFFFFFFn": 1, "Iconst_symbol": 1, "pic_code": 1, "Clflags.dlcode": 1, "reload_test": 1, "tst": 2, "Iinttest": 1, "Ifloattest": 2, "Clt": 1, "Cle": 1, "Ceq": 1, "Cne": 1, "Cgt": 1, "Cge": 1, "fundecl": 1, "new": 2, "#fundecl": 1, "sigset_t": 9, "sigemptyset": 2, "setp": 6, "ignore": 4, "sigfillset": 2, "full": 1, "sigaddset": 2, "signal": 6, "sigdelset": 2, "del": 1, "sigismember": 2, "mem": 1, "io_buffer_size": 4, "invalid_encode": 2, "invalid_bounds": 3, "unsafe_chr": 2, "Char.unsafe_chr": 2, "unsafe_blit": 3, "String.unsafe_blit": 1, "unsafe_array_get": 2, "Array.unsafe_get": 1, "unsafe_byte": 24, "Char.code": 3, "String.unsafe_get": 1, "unsafe_set_byte": 23, "byte": 7, "String.unsafe_set": 1, "uchar": 8, "u_bom": 3, "u_rep": 1, "is_uchar": 1, "cp": 14, "pp_cp": 3, "0xFFFF": 1, "U": 2, "04X": 1, "X": 1, "cp_to_string": 1, "thread": 1, "safe": 1, "Format": 2, "str_formatter": 1, "flush_str_formatter": 1, "Unicode": 1, "encoding": 17, "schemes": 1, "UTF_8": 15, "UTF_16": 6, "UTF_16BE": 13, "UTF_16LE": 12, "decoder_encoding": 5, "US_ASCII": 4, "ISO_8859_1": 4, "encoding_of_string": 1, "uppercase": 1, "IANA": 1, "UTF": 2, "8": 1, "encoding_to_string": 1, "malformed": 22, "Malformed": 14, "malformed_pair": 5, "be": 5, "hi": 29, "bs1": 2, "bs0": 4, "String.create": 5, "j0": 11, "j1": 11, "lsr": 23, "land": 29, "r_us_ascii": 2, "b0": 15, "Uchar": 50, "r_iso_8859_1": 2, "utf_8_len": 3, "r_utf_8": 8, "b1": 23, "b10": 6, "lsl": 9, "lor": 22, "b2": 14, "b3": 17, "r_utf_16": 6, "u": 42, "Hi": 4, "r_utf_16_lo": 5, "lo": 12, "r_encoding": 3, "some": 4, "BOM": 11, "ASCII": 5, "utf_8_len.": 3, "Decode": 5, "src": 13, "in_channel": 1, "Manual": 7, "nln": 8, "NLF": 2, "Readline": 2, "decode": 4, "Await": 7, "pp_decode": 1, "bs": 2, "bs.": 2, "decoder": 6, "nl": 9, "i_pos": 4, "i_max": 3, "t_len": 4, "t_need": 9, "removed_bom": 2, "last_cr": 10, "col": 2, "byte_count": 4, "i_rem": 9, "d.i_max": 3, "d.i_pos": 29, "eoi": 3, "d.i": 14, "min_int": 1, "refill": 7, "get": 1, "input": 2, "ontinue": 1, "d.k": 12, "ic": 2, "rc": 2, "need": 12, "d.t_len": 39, "d.t_need": 11, "t_fill": 12, "blit": 6, "d.t": 25, "rem": 37, "ret": 33, "d.byte_count": 3, "d.pp": 4, "decode_us_ascii": 4, "decode_iso_8859_1": 4, "t_decode_utf_8": 5, "decode_utf_8": 17, "t_decode_utf_16be_lo": 3, "bcount": 6, "decode_utf_16be": 13, "t_decode_utf_16be": 3, "decode_utf_16be_lo": 3, "t_decode_utf_16le_lo": 3, "decode_utf_16le": 11, "t_decode_utf_16le": 3, "decode_utf_16le_lo": 3, "2": 5, "Encoding": 1, "guessing": 1, "The": 1, "guess": 2, "simple": 1, "starting": 1, "after": 2, "tedious": 1, "uutf": 1, "decoders": 1, "are": 1, "designed": 1, "put": 1, "bytes": 2, "back": 1, "stream": 1, "guessed_utf_8": 2, "start": 1, "handles": 2, "third": 1, "read": 5, "0": 5, "handle": 2, "second": 1, "first": 1, "4": 1, "guessed_utf_16": 3, "decode_utf_16": 3, "t_decode_utf_16": 4, "t_decode_utf_16_lo": 2, "guess_encoding": 2, "setup": 2, "d.encoding": 7, "nline": 14, "d.col": 4, "d.line": 3, "ncol": 5, "ncount": 18, "d.count": 3, "cr": 18, "d.last_cr": 5, "inlined": 1, "pp_remove_bom": 2, "utf16": 3, "removes": 1, "init": 1, "16": 1, "0xFEFF": 1, "d.removed_bom": 4, "0xFFFE": 1, "reversed": 1, "from": 1, "pp_nln_none": 2, "0x000A": 1, "LF": 1, "pp_nln_readline": 2, "d.nl": 8, "pp_nln_nlf": 2, "pp_nln_ascii": 2, "decode_fun": 3, "decoder_line": 1, "decoder_col": 1, "decoder_byte_count": 1, "decoder_count": 1, "decoder_removed_bom": 1, "decoder_src": 1, "d.src": 1, "decoder_nln": 1, "d.nln": 1, "set_decoder_encoding": 1, "Encode": 1, "dst": 11, "out_channel": 1, "Buffer": 4, "encode": 4, "encoder": 4, "destination": 1, "encoded": 1, "o": 3, "current": 1, "chunk": 1, "o_pos": 3, "next": 2, "position": 4, "write": 2, "o_max": 3, "maximal": 2, "four": 1, "buffer": 1, "overlapping": 1, "writes": 1, "t_pos": 2, "t_max": 2, "continuation": 1, "Partial": 2, "o_rem": 5, "e.o_max": 2, "e.o_pos": 27, "e.o": 10, "partial": 2, "e.dst": 2, "e.k": 4, "Buffer.add_substring": 1, "t_range": 6, "max": 3, "e.t_pos": 5, "e.t_max": 2, "t_flush": 7, "e.t": 6, "encode_utf_8": 4, "encode_utf_16be": 4, "encode_fun": 2, "encode_utf_16le": 1, "encoder_encoding": 1, "e.encoding": 1, "encoder_dst": 1, "dst_rem": 1, "encoding_guess": 1, "w": 11, "add_utf_16le": 1, "Buffer.add_char": 1 }, "Objective-C": { "//": 338, "#import": 63, "": 5, "#if": 42, "TARGET_OS_IPHONE": 12, "": 1, "__IPHONE_OS_VERSION_MAX_ALLOWED": 4, "__IPHONE_4_0": 6, "": 2, "Necessary": 1, "for": 105, "background": 1, "task": 1, "support": 4, "#endif": 60, "": 2, "@class": 4, "ASIDataDecompressor": 4, ";": 2185, "extern": 6, "NSString": 134, "*ASIHTTPRequestVersion": 2, "#ifndef": 9, "__IPHONE_3_2": 2, "#define": 65, "__MAC_10_5": 2, "__MAC_10_6": 2, "typedef": 47, "enum": 17, "_ASIAuthenticationState": 1, "{": 595, "ASINoAuthenticationNeededYet": 3, "ASIHTTPAuthenticationNeeded": 1, "ASIProxyAuthenticationNeeded": 1, "}": 585, "ASIAuthenticationState": 5, "_ASINetworkErrorType": 1, "ASIConnectionFailureErrorType": 2, "ASIRequestTimedOutErrorType": 2, "ASIAuthenticationErrorType": 3, "ASIRequestCancelledErrorType": 2, "ASIUnableToCreateRequestErrorType": 2, "ASIInternalErrorWhileBuildingRequestType": 3, "ASIInternalErrorWhileApplyingCredentialsType": 1, "ASIFileManagementError": 2, "ASITooMuchRedirectionErrorType": 3, "ASIUnhandledExceptionError": 3, "ASICompressionError": 1, "ASINetworkErrorType": 1, "NSString*": 13, "const": 37, "NetworkRequestErrorDomain": 12, "unsigned": 63, "long": 71, "ASIWWANBandwidthThrottleAmount": 2, "NS_BLOCKS_AVAILABLE": 8, "void": 265, "(": 2283, "ASIBasicBlock": 15, ")": 2280, "ASIHeadersBlock": 3, "NSDictionary": 37, "*responseHeaders": 2, "ASISizeBlock": 5, "size": 17, "ASIProgressBlock": 5, "total": 4, "ASIDataBlock": 3, "NSData": 28, "*data": 2, "@interface": 23, "ASIHTTPRequest": 31, "NSOperation": 1, "": 1, "The": 15, "url": 24, "this": 50, "operation": 2, "should": 8, "include": 1, "GET": 1, "params": 1, "in": 42, "the": 197, "query": 1, "string": 10, "where": 1, "appropriate": 4, "NSURL": 21, "*url": 2, "Will": 7, "always": 2, "contain": 4, "original": 2, "used": 16, "making": 1, "request": 113, "value": 25, "of": 34, "can": 20, "change": 2, "when": 46, "a": 78, "is": 77, "redirected": 2, "*originalURL": 2, "Temporarily": 1, "stores": 1, "we": 73, "are": 15, "about": 4, "to": 115, "redirect": 4, "to.": 2, "be": 49, "nil": 133, "again": 1, "do": 5, "*redirectURL": 2, "delegate": 29, "-": 705, "will": 57, "notified": 2, "various": 1, "changes": 4, "state": 35, "via": 5, "ASIHTTPRequestDelegate": 1, "protocol": 10, "id": 176, "": 1, "Another": 1, "that": 23, "also": 1, "status": 4, "and": 44, "progress": 13, "updates": 2, "Generally": 1, "you": 10, "won": 3, "s": 35, "more": 5, "likely": 1, "sessionCookies": 2, "NSMutableArray": 31, "*requestCookies": 2, "populated": 1, "with": 19, "cookies": 5, "NSArray": 27, "*responseCookies": 3, "If": 30, "use": 26, "useCookiePersistence": 3, "true": 10, "network": 4, "requests": 21, "present": 3, "valid": 5, "from": 18, "previous": 2, "BOOL": 139, "useKeychainPersistence": 4, "attempt": 3, "read": 4, "credentials": 35, "keychain": 7, "save": 3, "them": 10, "they": 6, "successfully": 4, "presented": 2, "useSessionPersistence": 6, "reuse": 3, "duration": 1, "session": 5, "until": 2, "clearSession": 2, "called": 3, "allowCompressedResponse": 3, "inform": 1, "server": 8, "accept": 2, "compressed": 2, "data": 27, "automatically": 2, "decompress": 1, "gzipped": 7, "responses.": 1, "Default": 10, "true.": 1, "shouldCompressRequestBody": 6, "body": 8, "gzipped.": 1, "false.": 1, "You": 1, "probably": 4, "need": 10, "enable": 1, "feature": 1, "on": 26, "your": 2, "webserver": 1, "make": 3, "work.": 1, "Tested": 1, "apache": 1, "only.": 1, "When": 15, "downloadDestinationPath": 11, "set": 24, "result": 9, "downloaded": 6, "file": 14, "at": 10, "location": 3, "not": 29, "download": 9, "stored": 9, "memory": 3, "*downloadDestinationPath": 2, "files": 5, "Once": 2, "complete": 12, "decompressed": 3, "if": 330, "necessary": 2, "moved": 2, "*temporaryFileDownloadPath": 2, "response": 17, "shouldWaitToInflateCompressedResponses": 4, "NO": 33, "created": 3, "path": 11, "containing": 1, "inflated": 6, "as": 17, "it": 28, "comes": 3, "*temporaryUncompressedDataDownloadPath": 2, "Used": 13, "writing": 2, "NSOutputStream": 6, "*fileDownloadOutputStream": 2, "*inflatedFileDownloadOutputStream": 2, "fails": 2, "or": 18, "completes": 6, "finished": 3, "cancelled": 5, "an": 20, "error": 75, "occurs": 1, "NSError": 51, "code": 16, "Connection": 1, "failure": 1, "occurred": 1, "inspect": 1, "[": 1272, "userInfo": 15, "]": 1272, "objectForKey": 29, "NSUnderlyingErrorKey": 3, "information": 5, "*error": 3, "Username": 2, "password": 11, "authentication": 18, "*username": 2, "*password": 2, "User": 1, "Agent": 1, "*userAgentString": 2, "Domain": 2, "NTLM": 6, "*domain": 2, "proxy": 11, "*proxyUsername": 2, "*proxyPassword": 2, "*proxyDomain": 2, "Delegate": 2, "displaying": 2, "upload": 4, "usually": 2, "NSProgressIndicator": 4, "but": 5, "supply": 2, "different": 4, "object": 36, "handle": 5, "yourself": 4, "": 2, "uploadProgressDelegate": 8, "downloadProgressDelegate": 10, "Whether": 1, "t": 15, "want": 5, "hassle": 1, "adding": 1, "authenticating": 2, "proxies": 3, "their": 3, "apps": 1, "shouldPresentProxyAuthenticationDialog": 2, "CFHTTPAuthenticationRef": 2, "proxyAuthentication": 7, "*proxyCredentials": 2, "during": 4, "int": 63, "proxyAuthenticationRetryCount": 4, "Authentication": 3, "scheme": 5, "Basic": 2, "Digest": 2, "*proxyAuthenticationScheme": 2, "Realm": 1, "required": 2, "*proxyAuthenticationRealm": 3, "HTTP": 9, "eg": 2, "OK": 1, "Not": 2, "found": 12, "etc": 1, "responseStatusCode": 3, "Description": 1, "*responseStatusMessage": 3, "Size": 3, "contentLength": 6, "partially": 1, "content": 5, "partialDownloadSize": 8, "POST": 2, "payload": 1, "postLength": 6, "amount": 12, "totalBytesRead": 4, "uploaded": 2, "totalBytesSent": 5, "Last": 2, "incrementing": 2, "lastBytesRead": 3, "sent": 6, "lastBytesSent": 3, "This": 7, "lock": 19, "prevents": 1, "being": 4, "inopportune": 1, "moment": 1, "NSRecursiveLock": 13, "*cancelledLock": 2, "Called": 6, "implemented": 7, "starts.": 1, "requestStarted": 3, "SEL": 19, "didStartSelector": 2, "receives": 3, "headers.": 1, "didReceiveResponseHeaders": 2, "didReceiveResponseHeadersSelector": 2, "Location": 1, "header": 20, "shouldRedirect": 3, "YES": 67, "then": 1, "needed": 3, "restart": 1, "by": 12, "calling": 1, "redirectToURL": 2, "simply": 1, "cancel": 5, "willRedirectSelector": 2, "successfully.": 1, "requestFinished": 4, "didFinishSelector": 2, "fails.": 1, "requestFailed": 2, "didFailSelector": 2, "data.": 1, "didReceiveData": 2, "implement": 1, "method": 5, "must": 6, "populate": 1, "responseData": 5, "write": 5, "didReceiveDataSelector": 2, "recording": 1, "something": 1, "last": 1, "happened": 1, "compare": 4, "current": 5, "date": 3, "time": 10, "out": 7, "NSDate": 9, "*lastActivityTime": 2, "Number": 1, "seconds": 2, "wait": 1, "before": 6, "timing": 1, "default": 9, "NSTimeInterval": 10, "timeOutSeconds": 3, "HEAD": 10, "length": 32, "starts": 2, "shouldResetUploadProgress": 3, "shouldResetDownloadProgress": 3, "showAccurateProgress": 7, "preset": 2, "*mainRequest": 2, "only": 12, "update": 6, "indicator": 4, "according": 2, "how": 2, "much": 2, "has": 6, "received": 5, "so": 15, "far": 2, "Also": 1, "see": 1, "comments": 1, "ASINetworkQueue.h": 1, "ensure": 1, "incremented": 4, "once": 3, "updatedProgress": 3, "Prevents": 1, "post": 2, "built": 2, "than": 9, "largely": 1, "subclasses": 2, "haveBuiltPostBody": 3, "internally": 3, "may": 8, "reflect": 1, "internal": 3, "buffer": 7, "CFNetwork": 3, "/": 19, "PUT": 1, "operations": 1, "sizes": 1, "greater": 1, "uploadBufferSize": 6, "timeout": 6, "unless": 2, "bytes": 8, "have": 15, "been": 1, "Likely": 1, "KB": 4, "iPhone": 3, "Mac": 2, "OS": 1, "X": 1, "Leopard": 1, "x": 10, "Text": 1, "encoding": 7, "responses": 5, "send": 2, "Content": 1, "Type": 1, "charset": 5, "value.": 1, "Defaults": 2, "NSISOLatin1StringEncoding": 2, "NSStringEncoding": 6, "defaultResponseEncoding": 4, "text": 12, "didn": 3, "set.": 1, "responseEncoding": 3, "Tells": 1, "delete": 1, "partial": 2, "downloads": 1, "allows": 1, "existing": 1, "resume": 2, "download.": 1, "NO.": 1, "allowResumeForFileDownloads": 2, "Custom": 1, "user": 6, "associated": 1, "*userInfo": 2, "NSInteger": 56, "tag": 2, "Use": 6, "rather": 4, "defaults": 2, "false": 3, "useHTTPVersionOne": 3, "get": 4, "tell": 2, "main": 8, "loop": 1, "stop": 4, "retry": 3, "new": 10, "needsRedirect": 3, "Incremented": 1, "every": 3, "redirects.": 1, "reaches": 1, "give": 2, "up": 4, "redirectCount": 2, "check": 1, "secure": 1, "certificate": 2, "self": 508, "signed": 1, "certificates": 2, "development": 1, "DO": 1, "NOT": 1, "USE": 1, "IN": 1, "PRODUCTION": 1, "validatesSecureCertificate": 3, "SecIdentityRef": 3, "clientCertificateIdentity": 5, "*clientCertificates": 2, "Details": 1, "could": 1, "these": 3, "best": 5, "local": 1, "*PACurl": 2, "See": 5, "values": 3, "above.": 1, "No": 1, "yet": 1, "authenticationNeeded": 3, "ASIHTTPRequests": 1, "store": 4, "same": 6, "asked": 3, "avoids": 1, "extra": 1, "round": 1, "trip": 1, "after": 5, "succeeded": 1, "which": 1, "efficient": 1, "authenticated": 1, "large": 1, "bodies": 1, "slower": 1, "connections": 3, "Set": 4, "explicitly": 2, "affects": 1, "cache": 17, "YES.": 1, "Credentials": 1, "never": 1, "asks": 1, "For": 2, "using": 8, "authenticationScheme": 4, "*": 323, "kCFHTTPAuthenticationSchemeBasic": 2, "very": 2, "first": 11, "shouldPresentCredentialsBeforeChallenge": 4, "hasn": 1, "doing": 1, "anything": 1, "expires": 1, "persistentConnectionTimeoutSeconds": 4, "yes": 1, "keep": 2, "alive": 1, "connectionCanBeReused": 4, "Stores": 1, "persistent": 5, "connection": 17, "currently": 4, "use.": 1, "It": 2, "particular": 2, "specify": 2, "expire": 2, "A": 4, "host": 9, "port": 17, "connection.": 2, "These": 1, "determine": 1, "whether": 1, "reused": 2, "subsequent": 2, "all": 3, "match": 1, "An": 2, "determining": 1, "available": 1, "number": 3, "reference": 1, "don": 2, "ve": 7, "opened": 3, "one.": 1, "stream": 13, "closed": 1, "+": 208, "released": 2, "either": 1, "another": 1, "timer": 5, "fires": 1, "NSMutableDictionary": 18, "*connectionInfo": 2, "automatic": 1, "redirects": 2, "standard": 1, "follow": 1, "behaviour": 2, "most": 1, "browsers": 1, "shouldUseRFC2616RedirectBehaviour": 2, "record": 1, "downloading": 5, "downloadComplete": 2, "ID": 1, "uniquely": 1, "identifies": 1, "primarily": 1, "debugging": 1, "NSNumber": 11, "*requestID": 3, "ASIHTTPRequestRunLoopMode": 2, "synchronous": 1, "NSDefaultRunLoopMode": 2, "other": 6, "*runLoopMode": 2, "checks": 1, "NSTimer": 5, "*statusTimer": 2, "setDefaultCache": 2, "configure": 2, "": 9, "downloadCache": 5, "policy": 7, "ASICacheDelegate.h": 2, "possible": 3, "ASICachePolicy": 4, "cachePolicy": 3, "storage": 2, "ASICacheStoragePolicy": 2, "cacheStoragePolicy": 2, "was": 4, "pulled": 1, "didUseCachedResponse": 3, "secondsToCache": 3, "custom": 2, "interval": 1, "expiring": 1, "&&": 126, "shouldContinueWhenAppEntersBackground": 3, "UIBackgroundTaskIdentifier": 1, "backgroundTask": 7, "helper": 1, "inflate": 2, "*dataDecompressor": 2, "Controls": 1, "without": 1, "responseString": 3, "All": 2, "no": 7, "raw": 3, "discarded": 1, "rawResponseData": 4, "temporaryFileDownloadPath": 2, "normal": 1, "temporaryUncompressedDataDownloadPath": 3, "contents": 1, "into": 1, "Setting": 1, "especially": 1, "useful": 1, "users": 1, "conjunction": 1, "streaming": 1, "parser": 3, "allow": 1, "passed": 2, "while": 12, "still": 2, "running": 4, "behind": 1, "scenes": 1, "PAC": 7, "own": 3, "isPACFileRequest": 3, "http": 4, "https": 1, "webservers": 1, "*PACFileRequest": 2, "asynchronously": 1, "reading": 1, "URLs": 2, "NSInputStream": 7, "*PACFileReadStream": 2, "storing": 1, "NSMutableData": 5, "*PACFileData": 2, "startSynchronous.": 1, "Currently": 1, "detection": 2, "synchronously": 1, "isSynchronous": 2, "//block": 12, "execute": 4, "startedBlock": 5, "headers": 11, "headersReceivedBlock": 5, "completionBlock": 5, "failureBlock": 5, "bytesReceivedBlock": 8, "bytesSentBlock": 5, "downloadSizeIncrementedBlock": 5, "uploadSizeIncrementedBlock": 5, "handling": 4, "dataReceivedBlock": 5, "authenticationNeededBlock": 5, "proxyAuthenticationNeededBlock": 5, "redirections": 1, "requestRedirectedBlock": 5, "#pragma": 44, "mark": 42, "init": 38, "dealloc": 14, "initWithURL": 4, "newURL": 16, "requestWithURL": 7, "usingCache": 5, "andCachePolicy": 3, "setStartedBlock": 1, "aStartedBlock": 1, "setHeadersReceivedBlock": 1, "aReceivedBlock": 2, "setCompletionBlock": 1, "aCompletionBlock": 1, "setFailedBlock": 1, "aFailedBlock": 1, "setBytesReceivedBlock": 1, "aBytesReceivedBlock": 1, "setBytesSentBlock": 1, "aBytesSentBlock": 1, "setDownloadSizeIncrementedBlock": 1, "aDownloadSizeIncrementedBlock": 1, "setUploadSizeIncrementedBlock": 1, "anUploadSizeIncrementedBlock": 1, "setDataReceivedBlock": 1, "setAuthenticationNeededBlock": 1, "anAuthenticationBlock": 1, "setProxyAuthenticationNeededBlock": 1, "aProxyAuthenticationBlock": 1, "setRequestRedirectedBlock": 1, "aRedirectBlock": 1, "setup": 2, "addRequestHeader": 5, "applyCookieHeader": 2, "buildRequestHeaders": 3, "applyAuthorizationHeader": 2, "buildPostBody": 3, "appendPostData": 3, "appendPostDataFromFile": 3, "isResponseCompressed": 3, "startSynchronous": 2, "startAsynchronous": 2, "clearDelegatesAndCancel": 2, "HEADRequest": 1, "upload/download": 1, "updateProgressIndicators": 1, "updateUploadProgress": 3, "updateDownloadProgress": 3, "removeUploadProgressSoFar": 1, "incrementDownloadSizeBy": 1, "incrementUploadSizeBy": 3, "updateProgressIndicator": 4, "withProgress": 4, "ofTotal": 4, "performSelector": 7, "selector": 12, "onTarget": 7, "target": 5, "withObject": 10, "callerToRetain": 7, "caller": 1, "talking": 1, "delegates": 2, "requestReceivedResponseHeaders": 1, "newHeaders": 1, "failWithError": 11, "theError": 6, "retryUsingNewConnection": 1, "parsing": 2, "readResponseHeaders": 2, "parseStringEncodingFromHeaders": 2, "parseMimeType": 2, "**": 27, "mimeType": 2, "andResponseEncoding": 2, "stringEncoding": 1, "fromContentType": 2, "contentType": 1, "stuff": 1, "applyCredentials": 1, "newCredentials": 16, "applyProxyCredentials": 2, "findCredentials": 1, "findProxyCredentials": 2, "retryUsingSuppliedCredentials": 1, "cancelAuthentication": 1, "attemptToApplyCredentialsAndResume": 1, "attemptToApplyProxyCredentialsAndResume": 1, "showProxyAuthenticationDialog": 1, "showAuthenticationDialog": 1, "addBasicAuthenticationHeaderWithUsername": 2, "theUsername": 1, "andPassword": 2, "thePassword": 1, "handlers": 1, "handleNetworkEvent": 2, "CFStreamEventType": 2, "type": 7, "handleBytesAvailable": 1, "handleStreamComplete": 1, "handleStreamError": 1, "cleanup": 1, "markAsFinished": 4, "removeTemporaryDownloadFile": 1, "removeTemporaryUncompressedDownloadFile": 1, "removeTemporaryUploadFile": 1, "removeTemporaryCompressedUploadFile": 1, "removeFileAtPath": 1, "err": 8, "connectionID": 1, "expirePersistentConnections": 1, "defaultTimeOutSeconds": 3, "setDefaultTimeOutSeconds": 1, "newTimeOutSeconds": 1, "client": 1, "setClientCertificateIdentity": 1, "anIdentity": 1, "sessionProxyCredentialsStore": 1, "sessionCredentialsStore": 1, "storeProxyAuthenticationCredentialsInSessionStore": 1, "storeAuthenticationCredentialsInSessionStore": 2, "removeProxyAuthenticationCredentialsFromSessionStore": 1, "removeAuthenticationCredentialsFromSessionStore": 3, "findSessionProxyAuthenticationCredentials": 1, "findSessionAuthenticationCredentials": 2, "saveCredentialsToKeychain": 3, "saveCredentials": 4, "NSURLCredential": 8, "forHost": 2, "realm": 14, "forProxy": 2, "savedCredentialsForHost": 1, "savedCredentialsForProxy": 1, "removeCredentialsForHost": 1, "removeCredentialsForProxy": 1, "setSessionCookies": 1, "newSessionCookies": 1, "addSessionCookie": 1, "NSHTTPCookie": 1, "newCookie": 1, "agent": 2, "defaultUserAgentString": 1, "setDefaultUserAgentString": 1, "mime": 1, "mimeTypeForFileAtPath": 1, "bandwidth": 3, "measurement": 1, "throttling": 1, "maxBandwidthPerSecond": 2, "setMaxBandwidthPerSecond": 1, "averageBandwidthUsedPerSecond": 2, "performThrottling": 2, "isBandwidthThrottled": 2, "incrementBandwidthUsedInLastSecond": 1, "setShouldThrottleBandwidthForWWAN": 1, "throttle": 1, "throttleBandwidthForWWANUsingLimit": 1, "limit": 1, "reachability": 1, "isNetworkReachableViaWWAN": 1, "queue": 12, "NSOperationQueue": 4, "sharedQueue": 4, "defaultCache": 3, "maxUploadReadLength": 1, "activity": 1, "isNetworkInUse": 1, "setShouldUpdateNetworkActivityIndicator": 1, "shouldUpdate": 1, "showNetworkActivityIndicator": 1, "hideNetworkActivityIndicator": 1, "miscellany": 1, "base64forData": 1, "theData": 1, "expiryDateForRequest": 1, "maxAge": 2, "dateFromRFC1123String": 1, "isMultitaskingSupported": 2, "threading": 1, "NSThread": 4, "threadForRequest": 3, "@property": 150, "retain": 73, "*proxyHost": 1, "assign": 84, "proxyPort": 2, "*proxyType": 1, "setter": 2, "setURL": 3, "nonatomic": 40, "readonly": 19, "*authenticationRealm": 2, "*requestHeaders": 1, "*requestCredentials": 1, "*rawResponseData": 1, "*requestMethod": 1, "*postBody": 1, "*postBodyFilePath": 1, "shouldStreamPostDataFromDisk": 4, "didCreateTemporaryPostDataFile": 1, "*authenticationScheme": 1, "shouldPresentAuthenticationDialog": 1, "authenticationRetryCount": 2, "haveBuiltRequestHeaders": 1, "inProgress": 4, "numberOfTimesToRetryOnTimeout": 2, "retryCount": 3, "shouldAttemptPersistentConnection": 2, "@end": 39, "": 1, "#else": 8, "": 1, "@": 267, "static": 107, "*defaultUserAgent": 1, "*ASIHTTPRequestRunLoopMode": 1, "CFOptionFlags": 1, "kNetworkEvents": 1, "kCFStreamEventHasBytesAvailable": 1, "|": 13, "kCFStreamEventEndEncountered": 1, "kCFStreamEventErrorOccurred": 1, "*sessionCredentialsStore": 1, "*sessionProxyCredentialsStore": 1, "*sessionCredentialsLock": 1, "*sessionCookies": 1, "RedirectionLimit": 1, "ReadStreamClientCallBack": 1, "CFReadStreamRef": 5, "readStream": 5, "*clientCallBackInfo": 1, "ASIHTTPRequest*": 1, "clientCallBackInfo": 1, "*progressLock": 1, "*ASIRequestCancelledError": 1, "*ASIRequestTimedOutError": 1, "*ASIAuthenticationError": 1, "*ASIUnableToCreateRequestError": 1, "*ASITooMuchRedirectionError": 1, "*bandwidthUsageTracker": 1, "nextConnectionNumberToCreate": 1, "*persistentConnectionsPool": 1, "*connectionsLock": 1, "nextRequestID": 1, "bandwidthUsedInLastSecond": 1, "*bandwidthMeasurementDate": 1, "NSLock": 2, "*bandwidthThrottlingLock": 1, "shouldThrottleBandwidthForWWANOnly": 1, "*sessionCookiesLock": 1, "*delegateAuthenticationLock": 1, "*throttleWakeUpTime": 1, "runningRequestCount": 1, "shouldUpdateNetworkActivityIndicator": 1, "*networkThread": 1, "*sharedQueue": 1, "cancelLoad": 3, "destroyReadStream": 3, "scheduleReadStream": 1, "unscheduleReadStream": 1, "willAskDelegateForCredentials": 1, "willAskDelegateForProxyCredentials": 1, "askDelegateForProxyCredentials": 1, "askDelegateForCredentials": 1, "failAuthentication": 1, "measureBandwidthUsage": 1, "recordBandwidthUsage": 1, "startRequest": 3, "updateStatus": 2, "checkRequestStatus": 2, "reportFailure": 3, "reportFinished": 1, "performRedirect": 1, "shouldTimeOut": 2, "willRedirect": 1, "willAskDelegateToConfirmRedirect": 1, "performInvocation": 2, "NSInvocation": 4, "invocation": 4, "releasingObject": 2, "objectToRelease": 1, "hideNetworkActivityIndicatorAfterDelay": 1, "hideNetworkActivityIndicatorIfNeeeded": 1, "runRequests": 1, "configureProxies": 2, "fetchPACFile": 1, "finishedDownloadingPACFile": 1, "theRequest": 1, "runPACScript": 1, "script": 1, "timeOutPACRead": 1, "useDataFromCache": 2, "updatePartialDownloadSize": 1, "registerForNetworkReachabilityNotifications": 1, "unsubscribeFromNetworkReachabilityNotifications": 1, "reachabilityChanged": 1, "NSNotification": 2, "note": 1, "performBlockOnMainThread": 2, "block": 18, "releaseBlocksOnMainThread": 4, "releaseBlocks": 3, "blocks": 16, "callBlock": 1, "*postBodyWriteStream": 1, "*postBodyReadStream": 1, "*compressedPostBody": 1, "*compressedPostBodyFilePath": 1, "willRetryRequest": 1, "*readStream": 1, "readStreamIsScheduled": 1, "setSynchronous": 2, "@implementation": 15, "initialize": 2, "class": 31, "persistentConnectionsPool": 3, "alloc": 47, "connectionsLock": 3, "progressLock": 1, "bandwidthThrottlingLock": 1, "sessionCookiesLock": 1, "sessionCredentialsLock": 1, "delegateAuthenticationLock": 1, "bandwidthUsageTracker": 1, "initWithCapacity": 2, "ASIRequestTimedOutError": 1, "initWithDomain": 5, "dictionaryWithObjectsAndKeys": 10, "NSLocalizedDescriptionKey": 10, "ASIAuthenticationError": 1, "ASIRequestCancelledError": 2, "ASIUnableToCreateRequestError": 3, "ASITooMuchRedirectionError": 1, "setMaxConcurrentOperationCount": 1, "setRequestMethod": 3, "setRunLoopMode": 2, "setShouldAttemptPersistentConnection": 2, "setPersistentConnectionTimeoutSeconds": 2, "setShouldPresentCredentialsBeforeChallenge": 1, "setShouldRedirect": 1, "setShowAccurateProgress": 1, "setShouldResetDownloadProgress": 1, "setShouldResetUploadProgress": 1, "setAllowCompressedResponse": 1, "setShouldWaitToInflateCompressedResponses": 1, "setDefaultResponseEncoding": 1, "setShouldPresentProxyAuthenticationDialog": 1, "setTimeOutSeconds": 1, "setUseSessionPersistence": 1, "setUseCookiePersistence": 1, "setValidatesSecureCertificate": 1, "setRequestCookies": 2, "autorelease": 21, "setDidStartSelector": 1, "@selector": 28, "setDidReceiveResponseHeadersSelector": 1, "setWillRedirectSelector": 1, "willRedirectToURL": 1, "setDidFinishSelector": 1, "setDidFailSelector": 1, "setDidReceiveDataSelector": 1, "setCancelledLock": 1, "setDownloadCache": 3, "return": 191, "ASIUseDefaultCachePolicy": 1, "*request": 1, "setCachePolicy": 1, "setAuthenticationNeeded": 2, "requestAuthentication": 7, "CFRelease": 25, "redirectURL": 1, "release": 66, "statusTimer": 3, "invalidate": 2, "postBody": 11, "compressedPostBody": 4, "requestHeaders": 6, "requestCookies": 1, "fileDownloadOutputStream": 1, "inflatedFileDownloadOutputStream": 1, "username": 8, "domain": 2, "authenticationRealm": 4, "requestCredentials": 1, "proxyHost": 2, "proxyType": 1, "proxyUsername": 3, "proxyPassword": 3, "proxyDomain": 1, "proxyAuthenticationRealm": 2, "proxyAuthenticationScheme": 2, "proxyCredentials": 1, "originalURL": 1, "lastActivityTime": 1, "responseCookies": 1, "responseHeaders": 5, "requestMethod": 13, "cancelledLock": 37, "postBodyFilePath": 7, "compressedPostBodyFilePath": 4, "postBodyWriteStream": 7, "postBodyReadStream": 2, "PACurl": 1, "clientCertificates": 2, "responseStatusMessage": 1, "connectionInfo": 13, "requestID": 2, "dataDecompressor": 1, "userAgentString": 1, "super": 29, "*blocks": 1, "array": 84, "addObject": 16, "performSelectorOnMainThread": 2, "waitUntilDone": 4, "isMainThread": 2, "Blocks": 1, "exits": 1, "setRequestHeaders": 2, "dictionaryWithCapacity": 2, "setObject": 9, "forKey": 10, "Are": 1, "submitting": 1, "disk": 1, "were": 5, "close": 5, "setPostBodyWriteStream": 2, "*path": 1, "setCompressedPostBodyFilePath": 1, "NSTemporaryDirectory": 2, "stringByAppendingPathComponent": 2, "NSProcessInfo": 2, "processInfo": 2, "globallyUniqueString": 2, "*err": 3, "ASIDataCompressor": 2, "compressDataFromFile": 1, "toFile": 1, "&": 54, "else": 37, "setPostLength": 3, "NSFileManager": 1, "attributesOfItemAtPath": 1, "fileSize": 1, "errorWithDomain": 6, "stringWithFormat": 6, "Otherwise": 2, "*compressedBody": 1, "compressData": 1, "setCompressedPostBody": 1, "compressedBody": 1, "isEqualToString": 13, "||": 47, "setHaveBuiltPostBody": 1, "setupPostBody": 3, "setPostBodyFilePath": 1, "setDidCreateTemporaryPostDataFile": 1, "initToFileAtPath": 1, "append": 1, "open": 2, "setPostBody": 1, "maxLength": 3, "appendData": 2, "*stream": 1, "initWithFileAtPath": 1, "NSUInteger": 95, "bytesRead": 5, "hasBytesAvailable": 1, "char": 20, "*256": 1, "sizeof": 16, "break": 18, "dataWithBytes": 1, "*m": 1, "unlock": 20, "m": 1, "newRequestMethod": 3, "*u": 1, "u": 3, "isEqual": 6, "NULL": 161, "setRedirectURL": 2, "d": 11, "setDelegate": 4, "newDelegate": 6, "q": 2, "setQueue": 2, "newQueue": 3, "cancelOnRequestThread": 2, "DEBUG_REQUEST_STATUS": 4, "ASI_DEBUG_LOG": 11, "isCancelled": 6, "setComplete": 3, "CFRetain": 4, "willChangeValueForKey": 1, "didChangeValueForKey": 1, "onThread": 2, "Clear": 3, "setDownloadProgressDelegate": 2, "setUploadProgressDelegate": 2, "initWithBytes": 1, "*encoding": 1, "rangeOfString": 1, ".location": 1, "NSNotFound": 1, "uncompressData": 1, "DEBUG_THROTTLING": 2, "setInProgress": 3, "NSRunLoop": 2, "currentRunLoop": 2, "runMode": 1, "runLoopMode": 2, "beforeDate": 1, "distantFuture": 1, "start": 3, "addOperation": 1, "concurrency": 1, "isConcurrent": 1, "isFinished": 1, "isExecuting": 1, "logic": 1, "@try": 1, "UIBackgroundTaskInvalid": 3, "UIApplication": 2, "sharedApplication": 2, "beginBackgroundTaskWithExpirationHandler": 1, "dispatch_async": 1, "dispatch_get_main_queue": 1, "endBackgroundTask": 1, "generated": 3, "ASINetworkQueue": 4, "already.": 1, "proceed.": 1, "setDidUseCachedResponse": 1, "Must": 1, "call": 8, "create": 1, "needs": 1, "mainRequest": 9, "ll": 6, "already": 4, "CFHTTPMessageRef": 3, "Create": 1, "request.": 1, "CFHTTPMessageCreateRequest": 1, "kCFAllocatorDefault": 3, "CFStringRef": 4, "CFURLRef": 1, "kCFHTTPVersion1_0": 1, "kCFHTTPVersion1_1": 1, "//If": 2, "let": 8, "generate": 1, "its": 9, "Even": 1, "chance": 2, "add": 5, "ASIS3Request": 1, "does": 3, "process": 1, "@catch": 1, "NSException": 19, "*exception": 1, "*underlyingError": 1, "exception": 3, "name": 14, "reason": 1, "NSLocalizedFailureReasonErrorKey": 1, "underlyingError": 1, "@finally": 1, "Do": 3, "DEBUG_HTTP_AUTHENTICATION": 4, "*credentials": 1, "auth": 2, "basic": 3, "any": 3, "cached": 2, "key": 32, "challenge": 1, "apply": 2, "like": 1, "CFHTTPMessageApplyCredentialDictionary": 2, "CFDictionaryRef": 2, "setAuthenticationScheme": 1, "happens": 4, "%": 30, "re": 9, "retrying": 1, "our": 6, "measure": 1, "throttled": 1, "setPostBodyReadStream": 2, "ASIInputStream": 2, "inputStreamWithData": 2, "setReadStream": 2, "NSMakeCollectable": 3, "CFReadStreamCreateForStreamedHTTPRequest": 1, "CFReadStreamCreateForHTTPRequest": 1, "lowercaseString": 1, "*sslProperties": 2, "initWithObjectsAndKeys": 1, "numberWithBool": 3, "kCFStreamSSLAllowsExpiredCertificates": 1, "kCFStreamSSLAllowsAnyRoot": 1, "kCFStreamSSLValidatesCertificateChain": 1, "kCFNull": 1, "kCFStreamSSLPeerName": 1, "CFReadStreamSetProperty": 1, "kCFStreamPropertySSLSettings": 1, "CFTypeRef": 1, "sslProperties": 2, "*certificates": 1, "arrayWithCapacity": 2, "count": 104, "*oldStream": 1, "redirecting": 2, "connecting": 2, "intValue": 4, "setConnectionInfo": 2, "Check": 1, "expired": 1, "timeIntervalSinceNow": 1, "<": 61, "DEBUG_PERSISTENT_CONNECTIONS": 3, "removeObject": 2, "//Some": 1, "previously": 1, "there": 1, "one": 1, "We": 7, "just": 4, "old": 5, "//lists.apple.com/archives/Macnetworkprog/2006/Mar/msg00119.html": 1, "oldStream": 4, "streamSuccessfullyOpened": 1, "setConnectionCanBeReused": 2, "Record": 1, "started": 1, "nothing": 2, "setLastActivityTime": 1, "setStatusTimer": 2, "timerWithTimeInterval": 1, "repeats": 1, "addTimer": 1, "forMode": 1, "here": 2, "safely": 1, "***Black": 1, "magic": 1, "warning***": 1, "reliable": 1, "way": 1, "track": 1, "strong": 4, "slow.": 1, "secondsSinceLastActivity": 1, "*1.5": 1, "updating": 1, "checking": 1, "told": 1, "us": 2, "auto": 2, "resuming": 1, "Range": 1, "take": 1, "account": 1, "perhaps": 1, "setTotalBytesSent": 1, "CFReadStreamCopyProperty": 2, "kCFStreamPropertyHTTPRequestBytesWrittenCount": 1, "unsignedLongLongValue": 1, "middle": 1, "said": 1, "might": 4, "MaxValue": 2, "UIProgressView": 2, "double": 5, "max": 7, "setMaxValue": 2, "examined": 1, "since": 1, "authenticate": 1, "bytesReadSoFar": 3, "setUpdatedProgress": 1, "didReceiveBytes": 2, "totalSize": 2, "setLastBytesRead": 1, "pass": 5, "pointer": 2, "directly": 1, "itself": 1, "setArgument": 4, "atIndex": 6, "argumentNumber": 1, "callback": 3, "NSMethodSignature": 1, "*cbSignature": 1, "methodSignatureForSelector": 1, "*cbInvocation": 1, "invocationWithMethodSignature": 1, "cbSignature": 1, "cbInvocation": 5, "setSelector": 1, "setTarget": 1, "forget": 2, "know": 3, "removeObjectForKey": 1, "dateWithTimeIntervalSinceNow": 1, "ignore": 1, "ASIFallbackToCacheIfLoadFailsCachePolicy": 2, "canUseCachedDataForRequest": 1, "setError": 2, "*failedRequest": 1, "compatible": 1, "fail": 1, "failedRequest": 4, "message": 2, "kCFStreamPropertyHTTPResponseHeader": 1, "Make": 1, "sure": 1, "tells": 1, "keepAliveHeader": 2, "NSScanner": 2, "*scanner": 1, "scannerWithString": 1, "scanner": 5, "scanString": 2, "intoString": 3, "scanInt": 2, "scanUpToString": 1, "what": 3, "hard": 1, "throw": 1, "away.": 1, "*userAgentHeader": 1, "*acceptHeader": 1, "userAgentHeader": 2, "acceptHeader": 2, "setHaveBuiltRequestHeaders": 1, "Force": 2, "rebuild": 2, "cookie": 1, "incase": 1, "got": 1, "some": 1, "remain": 1, "ones": 3, "URLWithString": 1, "valueForKey": 2, "relativeToURL": 1, "absoluteURL": 1, "setNeedsRedirect": 1, "means": 1, "manually": 1, "added": 5, "those": 1, "global": 1, "But": 1, "safest": 1, "option": 1, "responseCode": 1, "Handle": 1, "*mimeType": 1, "setResponseEncoding": 2, "saveProxyCredentialsToKeychain": 1, "*authenticationCredentials": 2, "credentialWithUser": 2, "kCFHTTPAuthenticationUsername": 2, "kCFHTTPAuthenticationPassword": 2, "persistence": 2, "NSURLCredentialPersistencePermanent": 2, "authenticationCredentials": 4, "setProxyAuthenticationRetryCount": 1, "Apply": 1, "whatever": 1, "ok": 1, "CFMutableDictionaryRef": 1, "*sessionCredentials": 1, "dictionary": 64, "sessionCredentials": 6, "setRequestCredentials": 1, "*newCredentials": 1, "*user": 1, "*pass": 1, "*theRequest": 1, "try": 3, "connect": 1, "website": 1, "kCFHTTPAuthenticationSchemeNTLM": 1, "Ok": 1, "extract": 1, "NSArray*": 1, "ntlmComponents": 1, "componentsSeparatedByString": 1, "AUTH": 6, "Request": 6, "parent": 1, "properties": 1, "ASIAuthenticationDialog": 2, "had": 1, "#include": 25, "": 2, "": 3, "": 1, "": 1, "": 1, "": 1, "char*": 3, "getDisplayName": 2, "CGDirectDisplayID": 2, "displayID": 2, "info": 5, "names": 4, "CFIndex": 3, "IODisplayCreateInfoDictionary": 1, "CGDisplayIOServicePort": 1, "kIODisplayOnlyPreferredName": 1, "CFDictionaryGetValue": 1, "CFSTR": 5, "kDisplayProductName": 1, "CFDictionaryGetValueIfPresent": 1, "void**": 1, "_glfwInputError": 2, "GLFW_PLATFORM_ERROR": 2, "strdup": 1, "CFStringGetMaximumSizeForEncoding": 1, "CFStringGetLength": 1, "kCFStringEncodingUTF8": 2, "calloc": 9, "CFStringGetCString": 1, "GLFWbool": 3, "modeIsGood": 3, "CGDisplayModeRef": 7, "mode": 12, "uint32_t": 3, "flags": 5, "CGDisplayModeGetIOFlags": 1, "kDisplayModeValidFlag": 1, "kDisplayModeSafeFlag": 1, "GLFW_FALSE": 5, "kDisplayModeInterlacedFlag": 1, "kDisplayModeStretchedFlag": 1, "format": 26, "CGDisplayModeCopyPixelEncoding": 2, "CFStringCompare": 3, "IO16BitDirectPixels": 2, "IO32BitDirectPixels": 1, "GLFW_TRUE": 3, "GLFWvidmode": 6, "vidmodeFromCGDisplayMode": 3, "CVDisplayLinkRef": 3, "link": 9, "result.width": 1, "CGDisplayModeGetWidth": 1, "result.height": 1, "CGDisplayModeGetHeight": 1, "result.refreshRate": 3, "CGDisplayModeGetRefreshRate": 1, "CVTime": 1, "CVDisplayLinkGetNominalOutputVideoRefreshPeriod": 1, "time.flags": 1, "kCVTimeIsIndefinite": 1, "time.timeScale": 1, "time.timeValue": 1, "result.redBits": 2, "result.greenBits": 2, "result.blueBits": 2, "CGDisplayFadeReservationToken": 5, "beginFadeReservation": 3, "token": 13, "kCGDisplayFadeReservationInvalidToken": 2, "CGAcquireDisplayFadeReservation": 1, "kCGErrorSuccess": 1, "CGDisplayFade": 2, "kCGDisplayBlendNormal": 2, "kCGDisplayBlendSolidColor": 2, "TRUE": 2, "endFadeReservation": 3, "FALSE": 3, "CGReleaseDisplayFadeReservation": 1, "//////////////////////////////////////////////////////////////////////////": 4, "//////": 4, "GLFW": 2, "API": 2, "_glfwSetVideoModeNS": 1, "_GLFWmonitor*": 8, "monitor": 26, "GLFWvidmode*": 4, "desired": 2, "CFArrayRef": 2, "modes": 9, "i": 61, "native": 5, "_glfwChooseVideoMode": 1, "_glfwPlatformGetVideoMode": 1, "_glfwCompareVideoModes": 3, "CVDisplayLinkCreateWithCGDisplay": 2, "ns.displayID": 10, "CGDisplayCopyAllDisplayModes": 2, "CFArrayGetCount": 2, "dm": 7, "CFArrayGetValueAtIndex": 2, "continue": 4, "ns.previousMode": 6, "CGDisplayCopyDisplayMode": 1, "CGDisplaySetDisplayMode": 2, "CVDisplayLinkRelease": 1, "_glfwRestoreVideoModeNS": 1, "CGDisplayModeRelease": 1, "platform": 1, "_GLFWmonitor**": 2, "_glfwPlatformGetMonitors": 1, "int*": 4, "displayCount": 7, "monitors": 4, "CGDirectDisplayID*": 1, "displays": 9, "*count": 5, "CGGetOnlineDisplayList": 2, "CGDisplayIsAsleep": 1, "CGSize": 6, "CGDisplayScreenSize": 1, "_glfwAllocMonitor": 1, "size.width": 2, "size.height": 2, "ns.unitNumber": 3, "CGDisplayUnitNumber": 1, "free": 6, "_glfwPlatformIsSameMonitor": 1, "second": 2, "_glfwPlatformGetMonitorPos": 1, "xpos": 2, "ypos": 2, "CGRect": 42, "bounds": 3, "CGDisplayBounds": 1, "*xpos": 1, "bounds.origin.x": 1, "*ypos": 1, "bounds.origin.y": 1, "_glfwPlatformGetVideoModes": 1, "j": 10, "_GLFW_REQUIRE_INIT_OR_RETURN": 1, "kCGNullDirectDisplay": 1, "Foo": 2, "NSObject": 5, "": 2, "FooAppDelegate": 2, "": 1, "@private": 2, "NSWindow": 2, "*window": 2, "IBOutlet": 1, "@synthesize": 7, "window": 1, "applicationDidFinishLaunching": 1, "aNotification": 1, "PullRequest": 4, "MAC_OS_X_VERSION_MAX_ALLOWED": 1, "MAC_OS_X_VERSION_10_5": 1, "initWithTitle": 1, "title": 8, "__title": 17, "retain_stub": 4, "__title_isset": 12, "initWithCoder": 1, "NSCoder": 2, "decoder": 4, "containsValueForKey": 1, "decodeObjectForKey": 1, "encodeWithCoder": 1, "encoder": 2, "encodeObject": 1, "hash": 8, "anObject": 20, "isKindOfClass": 3, "*other": 1, "release_stub": 3, "dealloc_stub": 1, "autorelease_stub": 1, "setTitle": 3, "titleIsSet": 1, "unsetTitle": 1, "": 2, "inProtocol": 8, "fieldName": 2, "fieldType": 6, "fieldID": 5, "readStructBeginReturningName": 1, "readFieldBeginReturningName": 1, "TType_STOP": 1, "switch": 4, "case": 9, "TType_STRING": 2, "fieldValue": 2, "readString": 1, "TProtocolUtil": 2, "skipType": 2, "onProtocol": 2, "readFieldEnd": 1, "readStructEnd": 1, "outProtocol": 7, "writeStructBeginWithName": 1, "writeFieldBeginWithName": 1, "writeString": 1, "writeFieldEnd": 1, "writeFieldStop": 1, "writeStructEnd": 1, "validate": 1, "description": 1, "NSMutableString": 2, "ms": 5, "stringWithString": 2, "appendString": 2, "appendFormat": 1, "linguistConstants": 1, "argc": 1, "*argv": 1, "NSLog": 4, "": 1, "": 2, "": 1, "": 1, "#ifdef": 10, "__OBJC__": 4, "": 2, "": 2, "": 2, "": 1, "": 2, "": 1, "__cplusplus": 2, "NSINTEGER_DEFINED": 3, "defined": 16, "__LP64__": 4, "NS_BUILD_32_LIKE_64": 3, "NSIntegerMin": 3, "LONG_MIN": 3, "NSIntegerMax": 4, "LONG_MAX": 3, "NSUIntegerMax": 7, "ULONG_MAX": 3, "INT_MIN": 3, "INT_MAX": 2, "UINT_MAX": 3, "_JSONKIT_H_": 3, "__GNUC__": 14, "__APPLE_CC__": 2, "JK_DEPRECATED_ATTRIBUTE": 6, "__attribute__": 3, "deprecated": 1, "JSONKIT_VERSION_MAJOR": 1, "JSONKIT_VERSION_MINOR": 1, "JKFlags": 5, "JKParseOptionNone": 1, "JKParseOptionStrict": 1, "JKParseOptionComments": 2, "<<": 16, "JKParseOptionUnicodeNewlines": 2, "JKParseOptionLooseUnicode": 2, "JKParseOptionPermitTextAfterValidJSON": 2, "JKParseOptionValidFlags": 1, "JKParseOptionFlags": 12, "JKSerializeOptionNone": 3, "JKSerializeOptionPretty": 2, "JKSerializeOptionEscapeUnicode": 2, "JKSerializeOptionEscapeForwardSlashes": 2, "JKSerializeOptionValidFlags": 1, "JKSerializeOptionFlags": 16, "struct": 20, "JKParseState": 18, "Opaque": 1, "private": 1, "type.": 3, "JSONDecoder": 2, "*parseState": 16, "decoderWithParseOptions": 1, "parseOptionFlags": 11, "initWithParseOptions": 1, "clearCache": 1, "parseUTF8String": 2, "size_t": 23, "Deprecated": 4, "JSONKit": 11, "v1.4.": 4, "objectWithUTF8String": 4, "instead.": 4, "parseJSONData": 2, "jsonData": 6, "objectWithData": 7, "mutableObjectWithUTF8String": 2, "mutableObjectWithData": 2, "////////////": 4, "Deserializing": 1, "methods": 2, "JSONKitDeserializing": 2, "objectFromJSONString": 1, "objectFromJSONStringWithParseOptions": 2, "mutableObjectFromJSONString": 1, "mutableObjectFromJSONStringWithParseOptions": 2, "objectFromJSONData": 1, "objectFromJSONDataWithParseOptions": 2, "mutableObjectFromJSONData": 1, "mutableObjectFromJSONDataWithParseOptions": 2, "Serializing": 1, "JSONKitSerializing": 3, "JSONData": 3, "Invokes": 2, "JSONDataWithOptions": 8, "includeQuotes": 6, "serializeOptions": 14, "JSONString": 3, "JSONStringWithOptions": 8, "serializeUnsupportedClassesUsingDelegate": 4, "__BLOCKS__": 1, "JSONKitSerializingBlockAdditions": 2, "serializeUnsupportedClassesUsingBlock": 4, "": 1, "": 1, "": 1, "": 1, "": 1, "//#include": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "//#import": 1, "": 1, "": 1, "": 1, "__has_feature": 3, "JK_ENABLE_CF_TRANSFER_OWNERSHIP_CALLBACKS": 2, "#warning": 1, "As": 1, "v1.4": 1, "longer": 2, "required.": 1, "option.": 1, "__OBJC_GC__": 1, "#error": 6, "Objective": 2, "C": 6, "Garbage": 1, "Collection": 1, "objc_arc": 1, "Automatic": 1, "Reference": 1, "Counting": 1, "ARC": 1, "ULLONG_MAX": 1, "LLONG_MIN": 1, "requires": 4, "types": 2, "bits": 1, "respectively.": 1, "WORD_BIT": 1, "LONG_BIT": 1, "bit": 1, "architectures.": 1, "SIZE_MAX": 1, "SSIZE_MAX": 1, "JK_HASH_INIT": 1, "JK_FAST_TRAILING_BYTES": 2, "JK_CACHE_SLOTS_BITS": 2, "JK_CACHE_SLOTS": 1, "JK_CACHE_PROBES": 1, "JK_INIT_CACHE_AGE": 1, "JK_TOKENBUFFER_SIZE": 1, "JK_STACK_OBJS": 1, "JK_JSONBUFFER_SIZE": 1, "JK_UTF8BUFFER_SIZE": 1, "JK_ENCODE_CACHE_SLOTS": 1, "JK_ATTRIBUTES": 15, "attr": 3, "...": 11, "##__VA_ARGS__": 7, "JK_EXPECTED": 4, "cond": 12, "expect": 3, "__builtin_expect": 1, "JK_EXPECT_T": 22, "JK_EXPECT_F": 14, "JK_PREFETCH": 2, "ptr": 3, "__builtin_prefetch": 1, "JK_STATIC_INLINE": 10, "__inline__": 1, "always_inline": 1, "JK_ALIGNED": 1, "arg": 11, "aligned": 1, "JK_UNUSED_ARG": 2, "unused": 3, "JK_WARN_UNUSED": 1, "warn_unused_result": 9, "JK_WARN_UNUSED_CONST": 1, "JK_WARN_UNUSED_PURE": 1, "pure": 2, "JK_WARN_UNUSED_SENTINEL": 1, "sentinel": 1, "JK_NONNULL_ARGS": 1, "nonnull": 6, "JK_WARN_UNUSED_NONNULL_ARGS": 1, "JK_WARN_UNUSED_CONST_NONNULL_ARGS": 1, "JK_WARN_UNUSED_PURE_NONNULL_ARGS": 1, "__GNUC_MINOR__": 3, "JK_ALLOC_SIZE_NON_NULL_ARGS_WARN_UNUSED": 2, "nn": 4, "alloc_size": 1, "JKArray": 14, "JKDictionaryEnumerator": 4, "JKDictionary": 22, "JSONNumberStateStart": 1, "JSONNumberStateFinished": 1, "JSONNumberStateError": 1, "JSONNumberStateWholeNumberStart": 1, "JSONNumberStateWholeNumberMinus": 1, "JSONNumberStateWholeNumberZero": 1, "JSONNumberStateWholeNumber": 1, "JSONNumberStatePeriod": 1, "JSONNumberStateFractionalNumberStart": 1, "JSONNumberStateFractionalNumber": 1, "JSONNumberStateExponentStart": 1, "JSONNumberStateExponentPlusMinus": 1, "JSONNumberStateExponent": 1, "JSONStringStateStart": 1, "JSONStringStateParsing": 1, "JSONStringStateFinished": 1, "JSONStringStateError": 1, "JSONStringStateEscape": 1, "JSONStringStateEscapedUnicode1": 1, "JSONStringStateEscapedUnicode2": 1, "JSONStringStateEscapedUnicode3": 1, "JSONStringStateEscapedUnicode4": 1, "JSONStringStateEscapedUnicodeSurrogate1": 1, "JSONStringStateEscapedUnicodeSurrogate2": 1, "JSONStringStateEscapedUnicodeSurrogate3": 1, "JSONStringStateEscapedUnicodeSurrogate4": 1, "JSONStringStateEscapedNeedEscapeForSurrogate": 1, "JSONStringStateEscapedNeedEscapedUForSurrogate": 1, "JKParseAcceptValue": 2, "JKParseAcceptComma": 2, "JKParseAcceptEnd": 3, "JKParseAcceptValueOrEnd": 1, "JKParseAcceptCommaOrEnd": 1, "JKClassUnknown": 1, "JKClassString": 1, "JKClassNumber": 1, "JKClassArray": 1, "JKClassDictionary": 1, "JKClassNull": 1, "JKManagedBufferOnStack": 1, "JKManagedBufferOnHeap": 1, "JKManagedBufferLocationMask": 1, "JKManagedBufferLocationShift": 1, "JKManagedBufferMustFree": 1, "JKManagedBufferFlags": 1, "JKObjectStackOnStack": 1, "JKObjectStackOnHeap": 1, "JKObjectStackLocationMask": 1, "JKObjectStackLocationShift": 1, "JKObjectStackMustFree": 1, "JKObjectStackFlags": 1, "JKTokenTypeInvalid": 1, "JKTokenTypeNumber": 1, "JKTokenTypeString": 1, "JKTokenTypeObjectBegin": 1, "JKTokenTypeObjectEnd": 1, "JKTokenTypeArrayBegin": 1, "JKTokenTypeArrayEnd": 1, "JKTokenTypeSeparator": 1, "JKTokenTypeComma": 1, "JKTokenTypeTrue": 1, "JKTokenTypeFalse": 1, "JKTokenTypeNull": 1, "JKTokenTypeWhiteSpace": 1, "JKTokenType": 2, "JKValueTypeNone": 1, "JKValueTypeString": 1, "JKValueTypeLongLong": 1, "JKValueTypeUnsignedLongLong": 1, "JKValueTypeDouble": 1, "JKValueType": 1, "JKEncodeOptionAsData": 1, "JKEncodeOptionAsString": 1, "JKEncodeOptionAsTypeMask": 1, "JKEncodeOptionCollectionObj": 1, "JKEncodeOptionStringObj": 1, "JKEncodeOptionStringObjTrimQuotes": 1, "JKEncodeOptionType": 2, "JKHash": 4, "JKTokenCacheItem": 2, "JKTokenCache": 2, "JKTokenValue": 2, "JKParseToken": 2, "JKPtrRange": 2, "JKObjectStack": 5, "JKBuffer": 2, "JKConstBuffer": 2, "JKConstPtrRange": 2, "JKRange": 2, "JKManagedBuffer": 5, "JKFastClassLookup": 2, "JKEncodeCache": 6, "JKEncodeState": 11, "JKObjCImpCache": 2, "JKHashTableEntry": 21, "serializeObject": 1, "options": 6, "optionFlags": 1, "encodeOption": 2, "JKSERIALIZER_BLOCKS_PROTO": 1, "releaseState": 1, "keyHash": 21, "UTF32": 11, "uint16_t": 1, "UTF16": 1, "uint8_t": 1, "UTF8": 2, "conversionOK": 1, "sourceExhausted": 1, "targetExhausted": 1, "sourceIllegal": 1, "ConversionResult": 1, "UNI_REPLACEMENT_CHAR": 1, "UNI_MAX_BMP": 1, "UNI_MAX_UTF16": 1, "UNI_MAX_UTF32": 1, "UNI_MAX_LEGAL_UTF32": 1, "UNI_SUR_HIGH_START": 1, "UNI_SUR_HIGH_END": 1, "UNI_SUR_LOW_START": 1, "UNI_SUR_LOW_END": 1, "trailingBytesForUTF8": 1, "offsetsFromUTF8": 1, "firstByteMark": 1, "JK_AT_STRING_PTR": 1, "stringBuffer.bytes.ptr": 2, "JK_END_STRING_PTR": 1, "stringBuffer.bytes.length": 1, "*_JKArrayCreate": 2, "*objects": 5, "mutableCollection": 7, "_JKArrayInsertObjectAtIndex": 3, "*array": 9, "newObject": 12, "objectIndex": 48, "_JKArrayReplaceObjectAtIndexWithObject": 3, "_JKArrayRemoveObjectAtIndex": 3, "_JKDictionaryCapacityForCount": 4, "*_JKDictionaryCreate": 2, "*keys": 2, "*keyHashes": 2, "*_JKDictionaryHashEntry": 2, "*dictionary": 13, "_JKDictionaryCapacity": 3, "_JKDictionaryResizeIfNeccessary": 3, "_JKDictionaryRemoveObjectWithEntry": 3, "*entry": 4, "_JKDictionaryAddObject": 4, "*_JKDictionaryHashTableEntryForKey": 2, "aKey": 13, "_JSONDecoderCleanup": 1, "*decoder": 1, "_NSStringObjectFromJSONString": 1, "*jsonString": 1, "**error": 1, "jk_managedBuffer_release": 1, "*managedBuffer": 3, "jk_managedBuffer_setToStackBuffer": 1, "*ptr": 2, "*jk_managedBuffer_resize": 1, "newSize": 1, "jk_objectStack_release": 1, "*objectStack": 3, "jk_objectStack_setToStackBuffer": 1, "**objects": 1, "**keys": 1, "CFHashCode": 1, "*cfHashes": 1, "jk_objectStack_resize": 1, "newCount": 1, "jk_error": 1, "*format": 7, "jk_parse_string": 1, "jk_parse_number": 1, "jk_parse_is_newline": 1, "*atCharacterPtr": 1, "jk_parse_skip_newline": 1, "jk_parse_skip_whitespace": 1, "jk_parse_next_token": 1, "jk_error_parse_accept_or3": 1, "*or1String": 1, "*or2String": 1, "*or3String": 1, "*jk_create_dictionary": 1, "startingObjectIndex": 1, "*jk_parse_dictionary": 1, "*jk_parse_array": 1, "*jk_object_for_token": 1, "*jk_cachedObjects": 1, "jk_cache_age": 1, "jk_set_parsed_token": 1, "advanceBy": 1, "jk_encode_error": 1, "*encodeState": 9, "jk_encode_printf": 1, "*cacheSlot": 4, "startingAtIndex": 4, "jk_encode_write": 1, "jk_encode_writePrettyPrintWhiteSpace": 1, "jk_encode_write1slow": 2, "ssize_t": 2, "depthChange": 2, "jk_encode_write1fast": 2, "jk_encode_writen": 1, "jk_encode_object_hash": 1, "*objectPtr": 2, "jk_encode_updateCache": 1, "jk_encode_add_atom_to_buffer": 1, "jk_encode_write1": 1, "es": 3, "dc": 3, "f": 8, "_jk_encode_prettyPrint": 1, "jk_min": 1, "b": 4, "jk_max": 3, "jk_calculateHash": 1, "currentHash": 1, "c": 7, "Class": 3, "_JKArrayClass": 5, "_JKArrayInstanceSize": 4, "_JKDictionaryClass": 5, "_JKDictionaryInstanceSize": 4, "_jk_NSNumberClass": 2, "NSNumberAllocImp": 2, "_jk_NSNumberAllocImp": 2, "NSNumberInitWithUnsignedLongLongImp": 2, "_jk_NSNumberInitWithUnsignedLongLongImp": 2, "jk_collectionClassLoadTimeInitialization": 2, "constructor": 1, "NSAutoreleasePool": 2, "*pool": 1, "Though": 1, "technically": 1, "run": 1, "environment": 1, "load": 1, "initialization": 1, "less": 1, "ideal.": 1, "objc_getClass": 2, "class_getInstanceSize": 2, "methodForSelector": 2, "temp_NSNumber": 4, "initWithUnsignedLongLong": 1, "pool": 2, "": 2, "NSMutableCopying": 2, "NSFastEnumeration": 2, "capacity": 51, "mutations": 20, "allocWithZone": 4, "NSZone": 4, "zone": 8, "raise": 18, "NSInvalidArgumentException": 6, "NSStringFromClass": 18, "NSStringFromSelector": 16, "_cmd": 16, "NSCParameterAssert": 19, "objects": 58, "Directly": 2, "allocate": 2, "instance": 2, "calloc.": 2, "isa": 2, "malloc": 1, "memcpy": 2, "<=>": 15, "*newObjects": 1, "newObjects": 2, "realloc": 1, "NSMallocException": 2, "memset": 1, "memmove": 2, "atObject": 12, "NSParameterAssert": 15, "getObjects": 2, "objectsPtr": 3, "range": 8, "NSRange": 1, "NSMaxRange": 4, "NSRangeException": 6, "range.location": 2, "range.length": 1, "objectAtIndex": 8, "countByEnumeratingWithState": 2, "NSFastEnumerationState": 2, "stackbuf": 8, "len": 6, "mutationsPtr": 2, "itemsPtr": 2, "enumeratedCount": 8, "insertObject": 1, "NSInternalInconsistencyException": 4, "__clang_analyzer__": 3, "Stupid": 2, "clang": 3, "analyzer...": 2, "Issue": 2, "#19.": 2, "removeObjectAtIndex": 1, "replaceObjectAtIndex": 1, "copyWithZone": 1, "initWithObjects": 2, "mutableCopyWithZone": 1, "NSEnumerator": 2, "collection": 11, "nextObject": 6, "initWithJKDictionary": 3, "initDictionary": 4, "allObjects": 2, "arrayWithObjects": 1, "_JKDictionaryHashEntry": 2, "returnObject": 3, "entry": 41, ".key": 11, "jk_dictionaryCapacities": 4, "bottom": 6, "top": 8, "mid": 5, "tableSize": 2, "lround": 1, "floor": 1, "capacityForCount": 4, "resize": 3, "oldCapacity": 2, "NS_BLOCK_ASSERTIONS": 1, "oldCount": 2, "*oldEntry": 1, "idx": 33, "oldEntry": 9, ".keyHash": 2, ".object": 7, "keys": 5, "keyHashes": 2, "atEntry": 45, "removeIdx": 3, "entryIdx": 4, "*atEntry": 3, "addKeyEntry": 2, "addIdx": 5, "*atAddEntry": 1, "atAddEntry": 6, "keyEntry": 4, "CFEqual": 2, "CFHash": 1, "table": 7, "would": 2, "now.": 1, "entryForKey": 3, "_JKDictionaryHashTableEntryForKey": 1, "andKeys": 1, "arrayIdx": 5, "keyEnumerator": 1, "copy": 4, "Why": 1, "earth": 1, "complain": 1, "doesn": 1, "Internal": 2, "Unable": 2, "temporary": 2, "buffer.": 2, "line": 2, "#": 2, "ld": 2, "Invalid": 1, "character": 1, "x.": 1, "n": 7, "r": 6, "F": 1, ".": 2, "e": 1, "Unexpected": 1, "wanted": 1, "Expected": 3, "MainMenuViewController": 2, "TTTableViewController": 1, "///////////////////////////////////////////////////////////////////////////////////////////////////": 24, "initWithNibName": 3, "nibNameOrNil": 1, "bundle": 3, "NSBundle": 1, "nibBundleOrNil": 1, "self.title": 2, "//self.variableHeightRows": 1, "self.tableViewStyle": 1, "UITableViewStyleGrouped": 1, "self.dataSource": 1, "TTSectionedDataSource": 1, "dataSourceWithObjects": 1, "TTTableTextItem": 48, "itemWithText": 48, "URL": 48, "PlaygroundViewController": 2, "UIViewController": 2, "UIScrollView*": 1, "_scrollView": 9, "": 1, "CGFloat": 44, "kFramePadding": 7, "kElementSpacing": 3, "kGroupSpacing": 5, "addHeader": 5, "yOffset": 42, "UILabel*": 2, "label": 6, "UILabel": 2, "initWithFrame": 12, "CGRectZero": 5, "label.text": 2, "label.font": 3, "UIFont": 3, "systemFontOfSize": 2, "label.numberOfLines": 2, "frame": 38, "label.frame": 4, "frame.origin.x": 3, "frame.origin.y": 16, "frame.size.width": 4, "frame.size.height": 15, "sizeWithFont": 2, "constrainedToSize": 2, "CGSizeMake": 3, ".height": 4, "addSubview": 8, "label.frame.size.height": 2, "TT_RELEASE_SAFELY": 12, "addText": 5, "loadView": 4, "UIScrollView": 1, "self.view.bounds": 2, "_scrollView.autoresizingMask": 1, "UIViewAutoresizingFlexibleWidth": 4, "UIViewAutoresizingFlexibleHeight": 1, "self.view": 4, "NSLocalizedString": 9, "UIButton*": 1, "button": 5, "UIButton": 1, "buttonWithType": 1, "UIButtonTypeRoundedRect": 1, "forState": 4, "UIControlStateNormal": 1, "addTarget": 1, "action": 1, "debugTestAction": 2, "forControlEvents": 1, "UIControlEventTouchUpInside": 1, "sizeToFit": 1, "button.frame": 2, "TTCurrentLocale": 2, "displayNameForKey": 1, "NSLocaleIdentifier": 1, "localeIdentifier": 1, "TTPathForBundleResource": 1, "TTPathForDocumentsResource": 1, "dataUsingEncoding": 2, "NSUTF8StringEncoding": 2, "md5Hash": 1, "setContentSize": 1, "viewDidUnload": 2, "viewDidAppear": 2, "animated": 27, "flashScrollIndicators": 1, "DEBUG": 1, "TTDPRINTMETHODNAME": 1, "TTDPRINT": 9, "TTMAXLOGLEVEL": 1, "TTDERROR": 1, "TTLOGLEVEL_ERROR": 1, "TTDWARNING": 1, "TTLOGLEVEL_WARNING": 1, "TTDINFO": 1, "TTLOGLEVEL_INFO": 1, "TTDCONDITIONLOG": 3, "rand": 1, "TTDASSERT": 2, "SBJsonParser": 2, "maxDepth": 2, "NSData*": 1, "objectWithString": 5, "repr": 5, "jsonText": 1, "NSError**": 2, "self.maxDepth": 2, "Methods": 1, "self.error": 3, "SBJsonStreamParserAccumulator": 2, "*accumulator": 1, "SBJsonStreamParserAdapter": 2, "*adapter": 1, "adapter.delegate": 1, "accumulator": 1, "SBJsonStreamParser": 2, "*parser": 1, "parser.maxDepth": 1, "parser.delegate": 1, "adapter": 1, "parse": 1, "SBJsonStreamParserComplete": 1, "accumulator.value": 1, "SBJsonStreamParserWaitingForData": 1, "SBJsonStreamParserError": 1, "parser.error": 1, "error_": 2, "tmp": 3, "*ui": 1, "*error_": 1, "ui": 1, "Project": 2, "version": 2, "Siesta.": 2, "FOUNDATION_EXPORT": 2, "SiestaVersionNumber": 1, "SiestaVersionString": 1, "StyleViewController": 2, "TTViewController": 1, "TTStyle*": 7, "_style": 8, "_styleHighlight": 6, "_styleDisabled": 6, "_styleSelected": 6, "_styleType": 6, "kTextStyleType": 2, "kViewStyleType": 2, "kImageStyleType": 2, "initWithStyleName": 1, "styleType": 3, "TTStyleSheet": 4, "globalStyleSheet": 4, "styleWithSelector": 4, "UIControlStateHighlighted": 1, "UIControlStateDisabled": 1, "UIControlStateSelected": 1, "addTextView": 5, "style": 29, "textFrame": 3, "TTRectInset": 3, "UIEdgeInsetsMake": 3, "StyleView*": 2, "StyleView": 2, "text.text": 1, "TTStyleContext*": 1, "context": 4, "TTStyleContext": 1, "context.frame": 1, "context.delegate": 1, "context.font": 1, "systemFontSize": 1, "addToSize": 1, "CGSizeZero": 1, "textFrame.size": 1, "text.frame": 1, "text.style": 1, "text.backgroundColor": 1, "UIColor": 3, "colorWithRed": 3, "green": 3, "blue": 3, "alpha": 3, "text.autoresizingMask": 1, "UIViewAutoresizingFlexibleBottomMargin": 3, "addView": 5, "viewFrame": 4, "view": 11, "view.style": 2, "view.backgroundColor": 2, "view.autoresizingMask": 2, "addImageView": 5, "TTImageView*": 1, "TTImageView": 1, "view.urlPath": 1, "imageFrame": 2, "view.frame": 2, "imageFrame.size": 1, "view.image.size": 1, "TUITableViewStylePlain": 2, "regular": 1, "TUITableViewStyleGrouped": 1, "grouped": 1, "stick": 1, "scroll": 3, "TUITableViewStyle": 4, "TUITableViewScrollPositionNone": 2, "TUITableViewScrollPositionTop": 2, "TUITableViewScrollPositionMiddle": 1, "TUITableViewScrollPositionBottom": 1, "TUITableViewScrollPositionToVisible": 3, "supported": 1, "TUITableViewScrollPosition": 5, "TUITableViewInsertionMethodBeforeIndex": 1, "NSOrderedAscending": 4, "TUITableViewInsertionMethodAtIndex": 1, "NSOrderedSame": 1, "TUITableViewInsertionMethodAfterIndex": 1, "NSOrderedDescending": 4, "TUITableViewInsertionMethod": 3, "TUITableViewCell": 23, "@protocol": 3, "TUITableViewDataSource": 2, "TUITableView": 25, "TUITableViewDelegate": 1, "": 1, "TUIScrollViewDelegate": 1, "tableView": 45, "heightForRowAtIndexPath": 2, "TUIFastIndexPath": 89, "indexPath": 47, "@optional": 2, "willDisplayCell": 2, "cell": 21, "forRowAtIndexPath": 2, "subview": 1, "didSelectRowAtIndexPath": 3, "left/right": 2, "mouse": 2, "down": 1, "up/down": 1, "didDeselectRowAtIndexPath": 3, "didClickRowAtIndexPath": 1, "withEvent": 2, "NSEvent": 3, "event": 8, "look": 1, "clickCount": 1, "TUITableView*": 1, "shouldSelectRowAtIndexPath": 3, "TUIFastIndexPath*": 1, "forEvent": 3, "NSEvent*": 1, "NSMenu": 1, "menuForRowAtIndexPath": 1, "tableViewWillReloadData": 3, "tableViewDidReloadData": 3, "targetIndexPathForMoveFromRowAtIndexPath": 1, "fromPath": 1, "toProposedIndexPath": 1, "proposedPath": 1, "TUIScrollView": 1, "__unsafe_unretained": 2, "": 4, "_dataSource": 6, "weak": 2, "_sectionInfo": 27, "TUIView": 17, "_pullDownView": 4, "_headerView": 8, "_lastSize": 1, "_contentHeight": 7, "NSMutableIndexSet": 6, "_visibleSectionHeaders": 6, "_visibleItems": 14, "_reusableTableCells": 5, "_selectedIndexPath": 9, "_indexPathShouldBeFirstResponder": 2, "_futureMakeFirstResponderToken": 2, "_keepVisibleIndexPathForReload": 2, "_relativeOffsetForReload": 2, "drag": 1, "reorder": 1, "_dragToReorderCell": 5, "CGPoint": 7, "_currentDragToReorderLocation": 1, "_currentDragToReorderMouseOffset": 1, "_currentDragToReorderIndexPath": 1, "_currentDragToReorderInsertionMethod": 1, "_previousDragToReorderIndexPath": 1, "_previousDragToReorderInsertionMethod": 1, "animateSelectionChanges": 3, "forceSaveScrollPosition": 1, "derepeaterEnabled": 1, "layoutSubviewsReentrancyGuard": 1, "didFirstLayout": 1, "dataSourceNumberOfSectionsInTableView": 1, "delegateTableViewWillDisplayCellForRowAtIndexPath": 1, "maintainContentOffsetAfterReload": 3, "_tableFlags": 1, "creation.": 1, "calls": 1, "UITableViewStylePlain": 1, "unsafe_unretained": 2, "dataSource": 2, "": 4, "readwrite": 1, "reloadData": 3, "reloadDataMaintainingVisibleIndexPath": 2, "relativeOffset": 5, "reloadLayout": 2, "numberOfSections": 10, "numberOfRowsInSection": 9, "section": 60, "rectForHeaderOfSection": 4, "rectForSection": 3, "rectForRowAtIndexPath": 7, "NSIndexSet": 4, "indexesOfSectionsInRect": 2, "rect": 10, "indexesOfSectionHeadersInRect": 2, "indexPathForCell": 2, "returns": 4, "visible": 16, "indexPathsForRowsInRect": 3, "indexPathForRowAtPoint": 2, "point": 11, "indexPathForRowAtVerticalOffset": 2, "offset": 23, "indexOfSectionWithHeaderAtPoint": 2, "indexOfSectionWithHeaderAtVerticalOffset": 2, "enumerateIndexPathsUsingBlock": 2, "*indexPath": 11, "*stop": 7, "enumerateIndexPathsWithOptions": 2, "NSEnumerationOptions": 4, "usingBlock": 6, "enumerateIndexPathsFromIndexPath": 4, "fromIndexPath": 6, "toIndexPath": 12, "withOptions": 4, "headerViewForSection": 6, "cellForRowAtIndexPath": 9, "index": 11, "visibleCells": 3, "order": 1, "sortedVisibleCells": 2, "indexPathsForVisibleRows": 2, "scrollToRowAtIndexPath": 3, "atScrollPosition": 3, "scrollPosition": 9, "indexPathForSelectedRow": 4, "representing": 1, "row": 36, "selection.": 1, "indexPathForFirstRow": 2, "indexPathForLastRow": 2, "selectRowAtIndexPath": 3, "deselectRowAtIndexPath": 3, "*pullDownView": 1, "pullDownViewIsVisible": 3, "*headerView": 6, "dequeueReusableCellWithIdentifier": 2, "identifier": 7, "": 1, "@required": 1, "canMoveRowAtIndexPath": 2, "moveRowAtIndexPath": 2, "numberOfSectionsInTableView": 3, "NSIndexPath": 5, "indexPathForRow": 11, "inSection": 11, "HEADER_Z_POSITION": 2, "beginning": 1, "height": 19, "TUITableViewRowInfo": 3, "TUITableViewSection": 16, "*_tableView": 1, "*_headerView": 1, "reusable": 1, "similar": 1, "UITableView": 1, "sectionIndex": 23, "numberOfRows": 13, "sectionHeight": 9, "sectionOffset": 8, "*rowInfo": 1, "initWithNumberOfRows": 2, "_tableView": 3, "rowInfo": 7, "_setupRowHeights": 2, "*header": 1, "self.headerView": 2, "roundf": 2, "header.frame.size.height": 1, "h": 3, "_tableView.delegate": 1, ".offset": 2, "rowHeight": 2, "sectionRowOffset": 2, "tableRowOffset": 2, "headerHeight": 4, "self.headerView.frame.size.height": 1, "headerView": 14, "_tableView.dataSource": 3, "respondsToSelector": 8, "_headerView.autoresizingMask": 1, "TUIViewAutoresizingFlexibleWidth": 1, "_headerView.layer.zPosition": 1, "Private": 1, "_updateSectionInfo": 2, "_updateDerepeaterViews": 2, "pullDownView": 1, "_tableFlags.animateSelectionChanges": 3, "_tableFlags.delegateTableViewWillDisplayCellForRowAtIndexPath": 1, "setDataSource": 1, "_tableFlags.dataSourceNumberOfSectionsInTableView": 2, "setAnimateSelectionChanges": 1, "*s": 3, "y": 12, "CGRectMake": 8, "self.bounds.size.width": 4, "indexPath.section": 3, "indexPath.row": 1, "*section": 8, "removeFromSuperview": 4, "removeAllIndexes": 2, "*sections": 1, ".size.height": 1, "self.contentInset.top*2": 1, "section.sectionOffset": 1, "sections": 4, "self.contentInset.bottom": 1, "_enqueueReusableCell": 2, "*identifier": 1, "cell.reuseIdentifier": 1, "*c": 1, "lastObject": 1, "removeLastObject": 1, "prepareForReuse": 1, "allValues": 1, "SortCells": 1, "*a": 2, "*b": 2, "*ctx": 1, "a.frame.origin.y": 2, "b.frame.origin.y": 2, "*v": 2, "v": 4, "sortedArrayUsingComparator": 1, "NSComparator": 1, "NSComparisonResult": 1, "INDEX_PATHS_FOR_VISIBLE_ROWS": 4, "allKeys": 1, "*i": 4, "*cell": 7, "*indexes": 2, "CGRectIntersectsRect": 5, "indexes": 4, "addIndex": 3, "*indexPaths": 1, "cellRect": 7, "indexPaths": 2, "CGRectContainsPoint": 1, "cellRect.origin.y": 1, "origin": 1, "brief": 1, "Obtain": 1, "whose": 2, "specified": 1, "exists": 1, "negative": 1, "returned": 1, "param": 1, "p": 3, "0": 2, "width": 1, "point.y": 1, "section.headerView": 9, "sectionLowerBound": 2, "fromIndexPath.section": 1, "sectionUpperBound": 3, "toIndexPath.section": 1, "rowLowerBound": 2, "fromIndexPath.row": 1, "rowUpperBound": 3, "toIndexPath.row": 1, "irow": 3, "lower": 1, "bound": 1, "iteration...": 1, "rowCount": 3, "...then": 1, "zero": 1, "iterations": 1, "_topVisibleIndexPath": 1, "*topVisibleIndex": 1, "sortedArrayUsingSelector": 1, "topVisibleIndex": 2, "setFrame": 2, "_tableFlags.forceSaveScrollPosition": 1, "setContentOffset": 2, "_tableFlags.didFirstLayout": 1, "prevent": 2, "layout": 3, "pinned": 5, "TUITableViewSectionHeader": 5, ".pinnedToViewport": 2, "pinnedHeader": 1, "CGRectGetMaxY": 2, "headerFrame": 4, "pinnedHeader.frame.origin.y": 1, "intersecting": 1, "push": 1, "upwards.": 1, "pinnedHeaderFrame": 2, "pinnedHeader.frame": 2, "pinnedHeaderFrame.origin.y": 1, "notify": 3, "section.headerView.frame": 1, "setNeedsLayout": 3, "section.headerView.superview": 1, "remove": 4, "offscreen": 2, "toRemove": 1, "enumerateIndexesUsingBlock": 1, "removeIndex": 1, "_layoutCells": 3, "visibleCellsNeedRelayout": 5, "remaining": 1, "cells": 7, "cell.frame": 1, "cell.layer.zPosition": 1, "visibleRect": 3, "Example": 1, "*oldVisibleIndexPaths": 1, "*newVisibleIndexPaths": 1, "*indexPathsToRemove": 1, "oldVisibleIndexPaths": 2, "mutableCopy": 2, "indexPathsToRemove": 2, "removeObjectsInArray": 2, "newVisibleIndexPaths": 2, "*indexPathsToAdd": 1, "indexPathsToAdd": 2, "newly": 1, "superview": 1, "bringSubviewToFront": 1, "self.contentSize": 3, "headerViewRect": 3, "s.height": 3, "_headerView.frame.size.height": 2, "visible.size.width": 3, "_headerView.frame": 1, "_headerView.hidden": 4, "show": 2, "pullDownRect": 4, "_pullDownView.frame.size.height": 2, "_pullDownView.hidden": 4, "_pullDownView.frame": 1, "self.delegate": 10, "recycle": 1, "regenerated": 3, "layoutSubviews": 5, "because": 1, "dragged": 1, "clear": 3, "removeAllObjects": 1, "laid": 1, "next": 2, "_tableFlags.layoutSubviewsReentrancyGuard": 3, "setAnimationsEnabled": 1, "CATransaction": 3, "begin": 1, "setDisableActions": 1, "_preLayoutCells": 2, "munge": 2, "contentOffset": 2, "_layoutSectionHeaders": 2, "_tableFlags.derepeaterEnabled": 1, "commit": 1, "selected": 2, "overlapped": 1, "r.size.height": 4, "headerFrame.size.height": 1, "r.origin.y": 1, "v.size.height": 2, "scrollRectToVisible": 2, "sec": 3, "_makeRowAtIndexPathFirstResponder": 2, "responder": 2, "made": 1, "acceptsFirstResponder": 1, "self.nsWindow": 3, "makeFirstResponderIfNotAlreadyInResponderChain": 1, "futureMakeFirstResponderRequestToken": 1, "*oldIndexPath": 1, "oldIndexPath": 2, "setSelected": 2, "setNeedsDisplay": 2, "selection": 3, "actually": 2, "NSResponder": 1, "*firstResponder": 1, "firstResponder": 3, "indexPathForFirstVisibleRow": 2, "*firstIndexPath": 1, "firstIndexPath": 4, "indexPathForLastVisibleRow": 2, "*lastIndexPath": 5, "lastIndexPath": 8, "performKeyAction": 2, "repeative": 1, "press": 1, "noCurrentSelection": 2, "isARepeat": 1, "TUITableViewCalculateNextIndexPathBlock": 3, "selectValidIndexPath": 3, "*startForNoSelection": 2, "calculateNextIndexPath": 4, "foundValidNextRow": 4, "*newIndexPath": 1, "newIndexPath": 6, "startForNoSelection": 1, "_delegate": 2, "self.animateSelectionChanges": 1, "charactersIgnoringModifiers": 1, "characterAtIndex": 1, "NSUpArrowFunctionKey": 1, "lastIndexPath.section": 2, "lastIndexPath.row": 2, "rowsInSection": 7, "NSDownArrowFunctionKey": 1, "_tableFlags.maintainContentOffsetAfterReload": 2, "setMaintainContentOffsetAfterReload": 1, "newValue": 2, "indexPathWithIndexes": 1, "indexAtPosition": 2 }, "Objective-C++": { "#include": 26, "": 1, "": 1, "#if": 10, "(": 612, "defined": 1, "OBJC_API_VERSION": 2, ")": 610, "&&": 12, "static": 16, "inline": 3, "IMP": 4, "method_setImplementation": 2, "Method": 2, "m": 3, "i": 29, "{": 151, "oi": 2, "-": 175, "method_imp": 2, ";": 494, "return": 149, "}": 148, "#endif": 19, "namespace": 1, "WebCore": 1, "ENABLE": 10, "DRAG_SUPPORT": 7, "const": 16, "double": 1, "EventHandler": 30, "TextDragDelay": 1, "RetainPtr": 4, "": 4, "&": 21, "currentNSEventSlot": 6, "DEFINE_STATIC_LOCAL": 1, "event": 30, "NSEvent": 21, "*EventHandler": 2, "currentNSEvent": 13, ".get": 1, "class": 14, "CurrentEventScope": 14, "WTF_MAKE_NONCOPYABLE": 1, "public": 1, "*": 34, "private": 1, "m_savedCurrentEvent": 3, "#ifndef": 3, "NDEBUG": 2, "m_event": 3, "*event": 11, "ASSERT": 13, "bool": 26, "wheelEvent": 5, "Page*": 7, "page": 33, "m_frame": 24, "if": 104, "false": 40, "scope": 6, "PlatformWheelEvent": 2, "chrome": 8, "platformPageClient": 4, "handleWheelEvent": 2, "wheelEvent.isAccepted": 1, "PassRefPtr": 2, "": 1, "currentKeyboardEvent": 1, "[": 268, "NSApp": 5, "currentEvent": 2, "]": 266, "switch": 4, "type": 10, "case": 25, "NSKeyDown": 4, "PlatformKeyboardEvent": 6, "platformEvent": 2, "platformEvent.disambiguateKeyDownEvent": 1, "RawKeyDown": 1, "KeyboardEvent": 2, "create": 3, "document": 6, "defaultView": 2, "NSKeyUp": 3, "default": 3, "keyEvent": 2, "BEGIN_BLOCK_OBJC_EXCEPTIONS": 13, "||": 18, "END_BLOCK_OBJC_EXCEPTIONS": 13, "void": 18, "focusDocumentView": 1, "FrameView*": 7, "frameView": 4, "view": 28, "NSView": 14, "*documentView": 1, "documentView": 2, "focusNSView": 1, "focusController": 1, "setFocusedFrame": 1, "passWidgetMouseDownEventToWidget": 3, "MouseEventWithHitTestResults": 7, "RenderObject*": 2, "target": 6, "targetNode": 3, "renderer": 7, "isWidget": 2, "passMouseDownEventToWidget": 3, "toRenderWidget": 3, "widget": 18, "RenderWidget*": 1, "renderWidget": 2, "lastEventIsMouseUp": 2, "*currentEventAfterHandlingMouseDown": 1, "currentEventAfterHandlingMouseDown": 3, "NSLeftMouseUp": 3, "timestamp": 8, "Widget*": 3, "pWidget": 2, "RefPtr": 1, "": 1, "LOG_ERROR": 1, "true": 29, "platformWidget": 6, "*nodeView": 1, "nodeView": 9, "superview": 5, "*view": 4, "hitTest": 2, "convertPoint": 2, "locationInWindow": 4, "fromView": 3, "nil": 25, "client": 3, "firstResponder": 1, "clickCount": 8, "<=>": 1, "1": 1, "acceptsFirstResponder": 1, "needsPanelToBecomeKey": 1, "makeFirstResponder": 1, "wasDeferringLoading": 3, "defersLoading": 1, "setDefersLoading": 2, "m_sendingEventToSubview": 24, "*outerView": 1, "getOuterView": 1, "beforeMouseDown": 1, "outerView": 2, "widget.get": 2, "mouseDown": 2, "afterMouseDown": 1, "m_mouseDownView": 5, "m_mouseDownWasInSubframe": 7, "m_mousePressed": 2, "findViewInSubviews": 3, "*superview": 1, "*target": 1, "NSEnumerator": 1, "*e": 1, "subviews": 1, "objectEnumerator": 1, "*subview": 1, "while": 4, "subview": 3, "e": 1, "nextObject": 1, "mouseDownViewIfStillGood": 3, "*mouseDownView": 1, "mouseDownView": 3, "topFrameView": 3, "*topView": 1, "topView": 2, "eventLoopHandleMouseDragged": 1, "mouseDragged": 2, "//": 7, "eventLoopHandleMouseUp": 1, "mouseUp": 2, "passSubframeEventToSubframe": 4, "Frame*": 5, "subframe": 13, "HitTestResult*": 2, "hoveredNode": 5, "NSLeftMouseDragged": 1, "NSOtherMouseDragged": 1, "NSRightMouseDragged": 1, "dragController": 1, "didInitiateDrag": 1, "NSMouseMoved": 2, "eventHandler": 6, "handleMouseMoveEvent": 3, "currentPlatformMouseEvent": 8, "NSLeftMouseDown": 3, "Node*": 1, "node": 3, "isFrameView": 2, "handleMouseReleaseEvent": 3, "originalNSScrollViewScrollWheel": 4, "_nsScrollViewScrollWheelShouldRetainSelf": 3, "selfRetainingNSScrollViewScrollWheel": 3, "NSScrollView": 2, "SEL": 2, "nsScrollViewScrollWheelShouldRetainSelf": 2, "isMainThread": 3, "setNSScrollViewScrollWheelShouldRetainSelf": 3, "shouldRetain": 2, "method": 2, "class_getInstanceMethod": 1, "objc_getRequiredClass": 1, "@selector": 4, "scrollWheel": 2, "reinterpret_cast": 1, "": 1, "*self": 1, "selector": 2, "shouldRetainSelf": 3, "self": 70, "retain": 1, "release": 1, "passWheelEventToWidget": 1, "NSView*": 1, "static_cast": 1, "": 1, "frame": 3, "NSScrollWheel": 1, "v": 6, "loader": 1, "resetMultipleFormSubmissionProtection": 1, "handleMousePressEvent": 2, "int": 36, "%": 2, "handleMouseDoubleClickEvent": 1, "else": 11, "sendFakeEventsAfterWidgetTracking": 1, "*initiatingEvent": 1, "eventType": 5, "initiatingEvent": 22, "*fakeEvent": 1, "fakeEvent": 6, "mouseEventWithType": 2, "location": 3, "modifierFlags": 6, "windowNumber": 6, "context": 6, "eventNumber": 3, "pressure": 3, "postEvent": 3, "atStart": 3, "YES": 6, "keyEventWithType": 1, "characters": 3, "charactersIgnoringModifiers": 2, "isARepeat": 2, "keyCode": 2, "window": 1, "convertScreenToBase": 1, "mouseLocation": 1, "mouseMoved": 2, "frameHasPlatformWidget": 4, "passMousePressEventToSubframe": 1, "mev": 6, "mev.event": 3, "passMouseMoveEventToSubframe": 1, "m_mouseDownMayStartDrag": 1, "passMouseReleaseEventToSubframe": 1, "PlatformMouseEvent": 5, "*windowView": 1, "windowView": 2, "CONTEXT_MENUS": 2, "sendContextMenuEvent": 2, "eventMayStartDrag": 2, "eventActivatedView": 1, "m_activationEventNumber": 1, "event.eventNumber": 1, "": 1, "createDraggingClipboard": 1, "NSPasteboard": 2, "*pasteboard": 1, "pasteboardWithName": 1, "NSDragPboard": 1, "pasteboard": 2, "declareTypes": 1, "NSArray": 3, "array": 2, "owner": 15, "ClipboardMac": 1, "Clipboard": 1, "DragAndDrop": 1, "ClipboardWritable": 1, "tabsToAllFormControls": 1, "KeyboardEvent*": 1, "KeyboardUIMode": 1, "keyboardUIMode": 5, "handlingOptionTab": 4, "isKeyboardOptionTab": 1, "KeyboardAccessTabsToLinks": 2, "KeyboardAccessFull": 1, "needsKeyboardEventDisambiguationQuirks": 2, "Document*": 1, "applicationIsSafari": 1, "url": 2, ".protocolIs": 2, "Settings*": 1, "settings": 5, "DASHBOARD_SUPPORT": 1, "usesDashboardBackwardCompatibilityMode": 1, "unsigned": 2, "accessKeyModifiers": 1, "AXObjectCache": 1, "accessibilityEnhancedUserInterfaceEnabled": 1, "CtrlKey": 2, "|": 3, "AltKey": 1, "#import": 3, "": 1, "": 1, "#ifdef": 6, "OODEBUG": 1, "#define": 1, "OODEBUG_SQL": 4, "OOOODatabase": 1, "OODB": 1, "NSString": 25, "*kOOObject": 1, "@": 28, "*kOOInsert": 1, "*kOOUpdate": 1, "*kOOExecSQL": 1, "#pragma": 5, "mark": 5, "OORecord": 3, "abstract": 1, "superclass": 1, "for": 14, "records": 1, "@implementation": 7, "+": 55, "id": 19, "record": 18, "OO_AUTORETURNS": 2, "OO_AUTORELEASE": 3, "alloc": 11, "init": 4, "insert": 7, "*record": 4, "insertWithParent": 1, "parent": 10, "OODatabase": 26, "sharedInstance": 37, "copyJoinKeysFrom": 1, "to": 6, "delete": 4, "update": 4, "indate": 4, "upsert": 4, "commit": 6, "rollback": 5, "setNilValueForKey": 1, "key": 2, "OOReference": 2, "": 1, "zeroForNull": 4, "NSNumber": 4, "numberWithInt": 1, "setValue": 1, "forKey": 1, "OOArray": 16, "": 14, "select": 21, "intoClass": 11, "joinFrom": 10, "cOOString": 15, "sql": 21, "selectRecordsRelatedTo": 1, "importFrom": 1, "OOFile": 4, "file": 2, "delimiter": 4, "delim": 4, "rows": 2, "OOMetaData": 21, "import": 1, "file.string": 1, "insertArray": 3, "BOOL": 11, "exportTo": 1, "file.save": 1, "export": 1, "bindToView": 1, "OOView": 2, "delegate": 4, "bindRecord": 1, "toView": 1, "updateFromView": 1, "updateRecord": 1, "description": 6, "*metaData": 14, "metaDataForClass": 3, "hack": 1, "required": 2, "where": 1, "contains": 1, "a": 9, "field": 1, "avoid": 1, "recursion": 1, "OOStringArray": 6, "ivars": 5, "<<": 2, "metaData": 26, "encode": 3, "dictionaryWithValuesForKeys": 3, "@end": 14, "OOAdaptor": 6, "all": 3, "methods": 1, "by": 1, "objsql": 1, "access": 2, "database": 12, "@interface": 6, "NSObject": 1, "sqlite3": 1, "*db": 1, "sqlite3_stmt": 1, "*stmt": 1, "struct": 5, "_str_link": 5, "*next": 2, "char": 9, "str": 7, "*strs": 1, "OO_UNSAFE": 1, "*owner": 3, "initPath": 5, "path": 9, "prepare": 4, "bindCols": 5, "cOOStringArray": 3, "columns": 7, "values": 29, "cOOValueDictionary": 2, "startingAt": 5, "pno": 13, "bindNulls": 8, "bindResultsIntoInstancesOfClass": 4, "Class": 9, "recordClass": 16, "sqlite_int64": 2, "lastInsertRowID": 2, "NSData": 3, "OOExtras": 9, "initWithDescription": 1, "is": 2, "the": 5, "low": 1, "level": 1, "interface": 1, "particular": 2, "": 1, "sharedInstanceForPath": 2, "OODocument": 1, ".path": 1, "OONil": 1, "OO_RELEASE": 6, "exec": 10, "fmt": 9, "...": 3, "va_list": 3, "argp": 12, "va_start": 3, "*sql": 5, "initWithFormat": 3, "arguments": 3, "va_end": 3, "objects": 4, "deleteArray": 2, "object": 13, "commitTransaction": 3, "super": 3, "adaptor": 1, "registerSubclassesOf": 1, "recordSuperClass": 2, "numClasses": 5, "objc_getClassList": 2, "NULL": 4, "*classes": 2, "malloc": 2, "sizeof": 2, "": 1, "viewClasses": 4, "classNames": 4, "scan": 1, "registered": 2, "classes": 12, "relevant": 1, "subclasses": 1, "c": 14, "<": 5, "superClass": 5, "class_getName": 4, "class_getSuperclass": 1, "respondsToSelector": 2, "ooTableSql": 1, "tableMetaDataForClass": 8, "break": 6, "delay": 1, "creation": 1, "views": 1, "until": 1, "after": 1, "tables": 1, "": 1, "in": 9, "order": 1, "free": 3, "Register": 1, "list": 1, "of": 2, "before": 1, "using": 2, "them": 2, "so": 2, "can": 1, "determine": 1, "relationships": 1, "between": 1, "registerTableClassesNamed": 1, "tableClass": 2, "NSBundle": 1, "mainBundle": 1, "classNamed": 1, "Send": 1, "any": 2, "SQL": 1, "Sql": 1, "format": 1, "string": 1, "escape": 1, "Any": 1, "results": 3, "returned": 1, "are": 1, "placed": 1, "as": 1, "an": 1, "dictionary": 1, "results.": 1, "*/": 1, "errcode": 12, "OOString": 6, "stringForSql": 2, "*aColumnName": 1, "**results": 1, "allKeys": 1, "objectAtIndex": 1, "OOValueDictionary": 5, "joinValues": 4, "sharedColumns": 5, "*parentMetaData": 1, "parentMetaData": 2, "naturalJoinTo": 1, "joinableColumns": 1, "whereClauseFor": 2, "qualifyNulls": 2, "NO": 3, "ooOrderBy": 2, "OOFormat": 5, "NSLog": 4, "*joinValues": 1, "*adaptor": 7, "": 1, "tablesRelatedByNaturalJoinFrom": 1, "tablesWithNaturalJoin": 5, "**tablesWithNaturalJoin": 1, "*childMetaData": 1, "tableMetaDataByClassName": 3, "prepareSql": 1, "toTable": 1, "childMetaData": 1, "OODictionary": 2, "": 1, "tmpResults": 1, "kOOExecSQL": 1, "*exec": 2, "OOWarn": 9, "errmsg": 5, "continue": 3, "OORef": 2, "": 1, "*values": 3, "kOOObject": 3, "isInsert": 4, "kOOInsert": 1, "isUpdate": 5, "kOOUpdate": 2, "newValues": 3, "changedCols": 4, "*name": 4, "*newValues": 1, "name": 9, "isEqual": 1, "tableName": 4, "columns/": 1, "nchanged": 4, "*object": 1, "lastSQL": 4, "**changedCols": 1, "quote": 2, "commaQuote": 2, "": 1, "commited": 2, "updateCount": 2, "transaction": 2, "updated": 2, "NSMutableDictionary": 1, "*d": 1, "*transaction": 1, "d": 2, "": 1, "OO_ARC": 1, "boxed": 1, "valueForKey": 1, "pointerValue": 1, "setValuesForKeysWithDictionary": 2, "decode": 2, "count": 1, "className": 3, "createTableSQL": 2, "*idx": 1, "indexes": 1, "idx": 2, "implements": 1, ".directory": 1, ".mkdir": 1, "sqlite3_open": 1, "db": 8, "SQLITE_OK": 6, "*path": 1, "sqlite3_prepare_v2": 1, "stmt": 20, "sqlite3_errmsg": 3, "bindValue": 2, "value": 26, "asParameter": 2, "OODEBUG_BIND": 1, "OONull": 3, "sqlite3_bind_null": 1, "OOSQL_THREAD_SAFE_BUT_USES_MORE_MEMORY": 1, "isKindOfClass": 3, "sqlite3_bind_text": 2, "UTF8String": 1, "SQLITE_STATIC": 3, "#else": 1, "len": 4, "lengthOfBytesUsingEncoding": 1, "NSUTF8StringEncoding": 3, "*str": 2, "next": 3, "strs": 6, "getCString": 1, "maxLength": 1, "encoding": 2, "sqlite3_bind_blob": 1, "bytes": 5, "length": 4, "*type": 1, "objCType": 1, "sqlite3_bind_int": 1, "intValue": 3, "sqlite3_bind_int64": 1, "longLongValue": 1, "sqlite3_bind_double": 1, "doubleValue": 1, "*columns": 1, "valuesForNextRow": 2, "ncols": 2, "sqlite3_column_count": 1, "sqlite3_column_name": 1, "sqlite3_column_type": 2, "SQLITE_NULL": 1, "SQLITE_INTEGER": 1, "initWithLongLong": 1, "sqlite3_column_int64": 1, "SQLITE_FLOAT": 1, "initWithDouble": 1, "sqlite3_column_double": 1, "SQLITE_TEXT": 1, "*bytes": 2, "sqlite3_column_text": 1, "NSMutableString": 1, "initWithBytes": 2, "sqlite3_column_bytes": 2, "SQLITE_BLOB": 1, "sqlite3_column_blob": 1, "out": 4, "awakeFromDB": 4, "instancesRespondToSelector": 1, "sqlite3_step": 1, "SQLITE_ROW": 1, "SQLITE_DONE": 1, "out.alloc": 1, "sqlite3_changes": 1, "sqlite3_finalize": 1, "sqlite3_last_insert_rowid": 1, "dealloc": 1, "sqlite3_close": 1, "OO_DEALLOC": 1, "instances": 1, "represent": 1, "table": 1, "and": 2, "it": 2, "s": 2, "l": 1, "C": 1, "S": 1, "I": 1, "L": 1, "q": 1, "Q": 1, "f": 1, "_": 2, "tag": 1, "A": 2, "<'>": 1, "iptr": 4, "*optr": 1, "unhex": 2, "*iptr": 1, "*16": 1, "hex": 1, "initWithBytesNoCopy": 1, "optr": 1, "freeWhenDone": 1, "stringValue": 4, "charValue": 1, "shortValue": 1, "OOReplace": 2, "reformat": 4, "NSDictionary": 2, "__IPHONE_OS_VERSION_MIN_REQUIRED": 1, "UISwitch": 2, "text": 1, "self.on": 1 }, "Objective-J": { "//": 2, "@import": 8, "": 1, "": 1, "var": 31, "SliderToolbarItemIdentifier": 3, "AddToolbarItemIdentifier": 3, "RemoveToolbarItemIdentifier": 3, ";": 191, "@implementation": 8, "AppController": 3, "CPObject": 3, "{": 44, "CPString": 7, "lastIdentifier": 4, "CPDictionary": 1, "photosets": 8, "CPCollectionView": 6, "listCollectionView": 18, "photosCollectionView": 12, "}": 44, "-": 35, "(": 144, "void": 17, ")": 144, "applicationDidFinishLaunching": 3, "CPNotification": 3, "aNotification": 3, "//the": 2, "first": 1, "thing": 1, "we": 4, "need": 1, "to": 5, "do": 1, "is": 3, "create": 2, "a": 7, "window": 2, "take": 1, "up": 2, "the": 23, "full": 1, "screen": 2, "//we": 3, "ll": 2, "place": 1, "our": 3, "collection": 8, "view": 8, "which": 1, "manages": 1, "of": 2, "//each": 1, "cell": 1, "will": 5, "represent": 1, "one": 1, "photo": 5, "and": 3, "choosing": 1, "cells": 2, "select": 1, "that": 1, "listScrollView": 5, "[": 278, "CPScrollView": 2, "alloc": 37, "]": 278, "initWithFrame": 23, "CGRectMake": 18, "CGRectGetHeight": 9, "bounds": 15, "setAutohidesScrollers": 2, "YES": 5, "setAutoresizingMask": 9, "CPViewHeightSizable": 6, "contentView": 17, "setBackgroundColor": 8, "CPColor": 15, "colorWithRed": 1, "/": 7, "green": 1, "blue": 1, "alpha": 3, "by": 1, "creating": 1, "single": 2, "prototype": 3, "CPCollectionViewItem": 3, "setting": 1, "its": 1, "view.": 1, "class": 1, "then": 1, "duplicate": 1, "this": 3, "item": 3, "as": 5, "many": 1, "times": 1, "it": 5, "needs": 1, "photosListItem": 3, "init": 2, "setView": 3, "PhotosListCell": 2, "CGRectMakeZero": 4, "setDelegate": 4, "self": 32, "want": 1, "delegate": 5, "methods": 3, "setItemPrototype": 2, "//set": 1, "setMinItemSize": 3, "CGSizeMake": 14, "setMaxItemSize": 3, "setMaxNumberOfColumns": 1, "//setting": 1, "column": 1, "make": 1, "appear": 1, "vertical": 1, "list": 1, "setVerticalMargin": 1, "CPViewWidthSizable": 6, "//finally": 1, "put": 1, "inside": 1, "scroll": 1, "s": 1, "content": 3, "so": 1, "show": 1, "on": 2, "addSubview": 17, "//repeat": 1, "process": 1, "with": 2, "another": 1, "for": 4, "actual": 2, "photos": 3, "//this": 3, "time": 1, "use": 1, "different": 1, "PhotoCell": 3, "photoItem": 3, "scrollView": 6, "CGRectGetWidth": 7, "|": 7, "setDocumentView": 1, "colorWithCalibratedWhite": 2, "//bring": 1, "forward": 1, "display": 2, "theWindow": 4, "orderFront": 5, "//get": 1, "most": 1, "interesting": 1, "flickr": 1, "request": 6, "CPURLRequest": 2, "requestWithURL": 2, "connection": 3, "CPJSONPConnection": 4, "sendRequest": 2, "callback": 2, "add": 2, "id": 4, "sender": 4, "string": 4, "prompt": 2, "if": 13, "//create": 1, "new": 1, "tag": 1, "returned": 2, "from": 2, "javascript": 1, "+": 20, "encodeURIComponent": 1, "remove": 2, "//remove": 1, "removeImageListWithIdentifier": 2, "allKeys": 4, "objectAtIndex": 1, "selectionIndexes": 2, "firstIndex": 2, "addImageList": 2, "CPArray": 3, "images": 2, "withIdentifier": 2, "aString": 8, "setObject": 1, "forKey": 1, "setContent": 3, "copy": 2, "setSelectionIndexes": 3, "CPIndexSet": 3, "indexSetWithIndex": 2, "indexOfObject": 2, "nextIndex": 2, "MAX": 1, "removeObjectForKey": 1, "adjustImageSize": 2, "newSize": 5, "value": 1, "collectionViewDidChangeSelection": 1, "aCollectionView": 2, "listIndex": 3, "CPNotFound": 1, "return": 9, "key": 2, "objectForKey": 1, "indexSet": 1, "aConnection": 2, "didReceiveData": 1, "data": 3, "method": 2, "called": 1, "when": 1, "network": 2, "returns.": 1, "//information": 1, "flickr.": 1, "set": 1, "array": 1, "urls": 1, "data.photos.photo": 1, "didFailWithError": 1, "error": 3, "alert": 1, "//a": 1, "occurred": 1, "//these": 1, "two": 1, "are": 1, "toolbar": 4, "tell": 1, "what": 1, "should": 1, "user": 1, "toolbarAllowedItemIdentifiers": 1, "CPToolbar": 3, "aToolbar": 4, "toolbarDefaultItemIdentifiers": 2, "CPToolbarFlexibleSpaceItemIdentifier": 1, "returns": 1, "given": 1, "identifier": 1, "CPToolbarItem": 2, "itemForItemIdentifier": 1, "anItemIdentifier": 5, "willBeInsertedIntoToolbar": 1, "BOOL": 3, "aFlag": 1, "toolbarItem": 20, "initWithItemIdentifier": 1, "PhotoResizeView": 2, "setMinSize": 3, "setMaxSize": 3, "setLabel": 3, "else": 5, "image": 10, "CPImage": 11, "initWithContentsOfFile": 9, "CPBundle": 4, "mainBundle": 4, "pathForResource": 4, "size": 8, "CPSizeMake": 8, "highlighted": 4, "setImage": 8, "setAlternateImage": 3, "setTarget": 3, "setAction": 4, "@selector": 4, "@end": 8, "CPTextField": 7, "CreateLabel": 1, "flickr_labelWithText": 3, "label": 29, "setStringValue": 2, "sizeToFit": 2, "setTextShadowColor": 4, "whiteColor": 5, "setTextShadowOffset": 2, "CPView": 11, "CGRect": 2, "aFrame": 7, "super": 1, "slider": 6, "CPSlider": 1, "setMinValue": 1, "setMaxValue": 1, "setIntValue": 1, "setFrameOrigin": 3, "CGPointMake": 3, "frame": 2, "highlightView": 14, "setRepresentedObject": 2, "JSObject": 2, "anObject": 4, "CGRectInset": 1, "setFont": 1, "CPFont": 1, "systemFontOfSize": 1, "setSelected": 2, "flag": 4, "CGRectCreateCopy": 1, "blueColor": 2, "positioned": 2, "CPWindowBelow": 2, "relativeTo": 2, "setTextColor": 2, "blackColor": 2, "removeFromSuperview": 2, "CPImageView": 3, "imageView": 11, "CGRectMakeCopy": 1, "setImageScaling": 1, "CPScaleProportionally": 1, "setHasShadow": 1, "nil": 2, "thumbForFlickrPhoto": 2, "loadStatus": 1, "CPImageLoadStatusCompleted": 1, "imageDidLoad": 1, "anImage": 2, "setFrame": 1, "function": 2, "urlForFlickrPhoto": 1, "photo.farm": 2, "photo.server": 2, "photo.id": 2, "photo.secret": 2, "": 2, "CPWindow": 2, "initWithContentRect": 4, "styleMask": 4, "CPBorderlessBridgeWindowMask": 2, "navigationArea": 5, "redColor": 1, "CPViewMaxXMargin": 2, "metaDataArea": 4, "CGRectGetMaxY": 1, "greenColor": 1, "CPViewMinYMargin": 1, "contentArea": 4, "": 1, "": 1, "": 1, "LOInfoView": 2, "drawRect": 1, "r": 1, "setFill": 1, "path": 3, "CPBezierPath": 1, "bezierPath": 1, "appendBezierPathWithRoundedRect": 1, "xRadius": 1, "yRadius": 1, "fill": 1, "CPPanel": 3, "initInfoWindow": 2, "infoWindow": 6, "CPHUDBackgroundWindowMask": 2, "CPResizableWindowMask": 1, "setFloatingPanel": 2, "_infoContent": 3, "_iconImage": 2, "_iconView": 3, "_infoView": 3, "_webView": 3, "CPWebView": 1, "loadHTMLString": 1, "@": 2, "rootWindow": 3, "grayColor": 1, "gameWindow": 5, "setTitle": 1, "_board": 5, "LOBoard": 1, "_bgImage": 2, "resetBoard": 2, "_buttonImage": 2, "_buttonPressImage": 2, "_resetButton": 7, "CPButton": 1, "setBordered": 1, "NO": 1 }, "Omgrofl": { "lol": 14, "iz": 11, "wtf": 1, "liek": 1, "lmao": 1, "brb": 1, "w00t": 1, "Hello": 1, "World": 1, "rofl": 13, "lool": 5, "loool": 6, "stfu": 1 }, "Opa": { "server": 1, "Server.one_page_server": 1, "(": 4, "-": 1, "

": 2, "Hello": 2, "world": 2, "

": 2, ")": 4, "Server.start": 1, "Server.http": 1, "{": 2, "page": 1, "function": 1, "}": 2, "title": 1 }, "Opal": { "starts": 1, "[": 4, "]": 4, "middles": 1, "qualifiers": 1, "finishes": 1, "alert": 1, "starts.sample": 1, "+": 3, "middles.sample": 1, "qualifiers.sample": 1, "finishes.sample": 1 }, "OpenCL": { "double": 3, "run_fftw": 1, "(": 18, "int": 3, "n": 4, "const": 4, "float": 3, "*": 5, "x": 5, "y": 4, ")": 18, "{": 4, "fftwf_plan": 1, "p1": 3, "fftwf_plan_dft_1d": 1, "fftwf_complex": 2, "FFTW_FORWARD": 1, "FFTW_ESTIMATE": 1, ";": 12, "nops": 3, "t": 4, "cl": 2, "realTime": 2, "for": 1, "op": 3, "<": 1, "+": 4, "fftwf_execute": 1, "}": 4, "-": 1, "/": 1, "fftwf_destroy_plan": 1, "return": 1, "typedef": 1, "foo_t": 3, "#ifndef": 1, "ZERO": 3, "#define": 2, "#endif": 1, "FOO": 1, "__kernel": 1, "void": 1, "foo": 1, "__global": 1, "__local": 1, "uint": 1, "barrier": 1, "CLK_LOCAL_MEM_FENCE": 1, "if": 1, "*x": 1 }, "OpenEdge ABL": { "USING": 3, "Progress.Lang.*.": 3, "CLASS": 2, "email.Email": 2, "USE": 2, "-": 73, "WIDGET": 2, "POOL": 2, "&": 3, "SCOPED": 1, "DEFINE": 16, "QUOTES": 1, "@#": 1, "%": 2, "*": 2, "+": 21, "._MIME_BOUNDARY_.": 1, "#@": 1, "WIN": 1, "From": 4, "To": 8, "CC": 2, "BCC": 2, "Personal": 1, "Private": 1, "Company": 2, "confidential": 2, "normal": 1, "urgent": 2, "non": 1, "Cannot": 3, "locate": 3, "file": 6, "in": 3, "the": 3, "filesystem": 3, "R": 3, "File": 3, "exists": 3, "but": 3, "is": 3, "not": 3, "readable": 3, "Error": 3, "copying": 3, "from": 3, "<\">": 8, "ttSenders": 2, "cEmailAddress": 8, "n": 13, "ttToRecipients": 1, "Reply": 3, "ttReplyToRecipients": 1, "Cc": 2, "ttCCRecipients": 1, "Bcc": 2, "ttBCCRecipients": 1, "Return": 1, "Receipt": 1, "ttDeliveryReceiptRecipients": 1, "Disposition": 3, "Notification": 1, "ttReadReceiptRecipients": 1, "Subject": 2, "Importance": 3, "H": 1, "High": 1, "L": 1, "Low": 1, "Sensitivity": 2, "Priority": 2, "Date": 4, "By": 1, "Expiry": 2, "Mime": 1, "Version": 1, "Content": 10, "Type": 4, "multipart/mixed": 1, ";": 5, "boundary": 1, "text/plain": 2, "charset": 2, "Transfer": 4, "Encoding": 4, "base64": 2, "bit": 2, "application/octet": 1, "stream": 1, "attachment": 2, "filename": 2, "ttAttachments.cFileName": 2, "cNewLine.": 1, "RETURN": 7, "lcReturnData.": 1, "END": 12, "METHOD.": 6, "METHOD": 6, "PUBLIC": 6, "CHARACTER": 9, "send": 1, "(": 44, ")": 44, "objSendEmailAlgorithm": 1, "sendEmail": 2, "INPUT": 11, "THIS": 1, "OBJECT": 2, ".": 14, "CLASS.": 2, "MESSAGE": 2, "INTERFACE": 1, "email.SendEmailAlgorithm": 1, "ipobjEmail": 1, "AS": 21, "INTERFACE.": 1, "PARAMETER": 3, "objSendEmailAlg": 2, "email.SendEmailSocket": 1, "NO": 13, "UNDO.": 12, "VARIABLE": 12, "vbuffer": 9, "MEMPTR": 2, "vstatus": 1, "LOGICAL": 1, "vState": 2, "INTEGER": 6, "ASSIGN": 2, "vstate": 1, "FUNCTION": 1, "getHostname": 1, "RETURNS": 1, "cHostname": 1, "THROUGH": 1, "hostname": 1, "ECHO.": 1, "IMPORT": 1, "UNFORMATTED": 1, "cHostname.": 2, "CLOSE.": 1, "FUNCTION.": 1, "PROCEDURE": 2, "newState": 2, "INTEGER.": 1, "pstring": 4, "CHARACTER.": 1, "newState.": 1, "IF": 2, "THEN": 2, "RETURN.": 1, "SET": 5, "SIZE": 5, "LENGTH": 3, "PUT": 1, "STRING": 7, "pstring.": 1, "SELF": 4, "WRITE": 1, "PROCEDURE.": 2, "ReadSocketResponse": 1, "vlength": 5, "str": 3, "v": 1, "GET": 3, "BYTES": 2, "AVAILABLE": 2, "VIEW": 1, "ALERT": 1, "BOX.": 1, "DO": 2, "READ": 1, "handleResponse": 1, "END.": 2, "email.Util": 1, "FINAL": 1, "PRIVATE": 1, "STATIC": 5, "cMonthMap": 2, "EXTENT": 1, "INITIAL": 1, "[": 2, "]": 2, "ABLDateTimeToEmail": 3, "ipdttzDateTime": 6, "DATETIME": 3, "TZ": 2, "DAY": 1, "MONTH": 1, "YEAR": 1, "TRUNCATE": 2, "MTIME": 1, "/": 2, "ABLTimeZoneToString": 2, "TIMEZONE": 1, "ipdtDateTime": 2, "ipiTimeZone": 3, "ABSOLUTE": 1, "MODULO": 1, "LONGCHAR": 4, "ConvertDataToBase64": 1, "iplcNonEncodedData": 2, "lcPreBase64Data": 4, "lcPostBase64Data": 3, "mptrPostBase64Data": 3, "i": 3, "COPY": 1, "LOB": 1, "FROM": 1, "TO": 2, "mptrPostBase64Data.": 1, "BASE64": 1, "ENCODE": 1, "BY": 1, "SUBSTRING": 1, "CHR": 2, "lcPostBase64Data.": 1 }, "OpenRC runscript": { "SHEBANG#!openrc-run": 1, "description": 1, "extra_started_commands": 1, "command": 2, "command_args": 1, "start_stop_daemon_args": 1, "depend": 1, "(": 2, ")": 2, "{": 2, "need": 1, "localmount": 1, "use": 1, "logger": 1, "}": 2, "reload": 1, "ebegin": 1, "start": 1, "-": 6, "stop": 1, "daemon": 1, "exec": 1, "signal": 1, "HUP": 1, "eend": 1 }, "OpenSCAD": { "fn": 1, ";": 6, "difference": 1, "(": 11, ")": 11, "{": 2, "union": 1, "translate": 4, "[": 5, "]": 5, "cube": 1, "center": 3, "true": 3, "cylinder": 2, "h": 2, "r1": 1, "r2": 1, "sphere": 2, "r": 3, "}": 2 }, "Org": { "#": 13, "+": 13, "OPTIONS": 1, "H": 1, "num": 1, "nil": 4, "toc": 2, "n": 1, "@": 1, "t": 10, "|": 4, "-": 30, "f": 2, "*": 3, "TeX": 1, "LaTeX": 1, "skip": 1, "d": 2, "(": 11, "HIDE": 1, ")": 11, "tags": 2, "not": 1, "in": 2, "STARTUP": 1, "align": 1, "fold": 1, "nodlcheck": 1, "hidestars": 1, "oddeven": 1, "lognotestate": 1, "SEQ_TODO": 1, "TODO": 1, "INPROGRESS": 1, "i": 1, "WAITING": 1, "w@": 1, "DONE": 1, "CANCELED": 1, "c@": 1, "TAGS": 1, "Write": 1, "w": 1, "Update": 1, "u": 1, "Fix": 1, "Check": 1, "c": 1, "TITLE": 1, "org": 10, "ruby": 6, "AUTHOR": 1, "Brian": 1, "Dewey": 1, "EMAIL": 1, "bdewey@gmail.com": 1, "LANGUAGE": 1, "en": 1, "PRIORITIES": 1, "A": 1, "C": 1, "B": 1, "CATEGORY": 1, "worg": 1, "{": 1, "Back": 1, "to": 8, "Worg": 1, "rubygems": 2, "ve": 1, "already": 1, "created": 1, "a": 4, "site.": 1, "Make": 1, "sure": 1, "you": 2, "have": 1, "installed": 1, "sudo": 1, "gem": 1, "install": 1, ".": 1, "You": 1, "need": 1, "register": 1, "new": 2, "Webby": 3, "filter": 3, "handle": 1, "mode": 2, "content.": 2, "makes": 1, "this": 2, "easy.": 1, "In": 1, "the": 6, "lib/": 1, "folder": 1, "of": 2, "your": 2, "site": 1, "create": 1, "file": 1, "orgmode.rb": 1, "BEGIN_EXAMPLE": 2, "require": 1, "Filters.register": 1, "do": 2, "input": 3, "Orgmode": 2, "Parser.new": 1, ".to_html": 1, "end": 1, "END_EXAMPLE": 1, "This": 2, "code": 1, "creates": 1, "that": 1, "will": 1, "use": 1, "parser": 1, "translate": 1, "into": 1, "HTML.": 1, "Create": 1, "For": 1, "example": 1, "title": 2, "Parser": 1, "created_at": 1, "status": 2, "Under": 1, "development": 1, "erb": 1, "orgmode": 3, "<%=>": 2, "page": 2, "Status": 1, "Description": 1, "Helpful": 1, "Ruby": 1, "routines": 1, "for": 3, "parsing": 1, "files.": 1, "The": 3, "most": 1, "significant": 1, "thing": 2, "library": 1, "does": 1, "today": 1, "is": 5, "convert": 1, "files": 1, "textile.": 1, "Currently": 1, "cannot": 1, "much": 1, "customize": 1, "conversion.": 1, "supplied": 1, "textile": 1, "conversion": 1, "optimized": 1, "extracting": 1, "from": 1, "orgfile": 1, "as": 1, "opposed": 1, "History": 1, "**": 1, "Version": 1, "first": 1, "output": 2, "HTML": 2, "gets": 1, "class": 1, "now": 1, "indented": 1, "Proper": 1, "support": 1, "multi": 1, "paragraph": 2, "list": 1, "items.": 1, "See": 1, "part": 1, "last": 1, "bullet.": 1, "Fixed": 1, "bugs": 1, "wouldn": 1, "s": 1, "all": 1, "there": 1, "it": 1 }, "Ox": { "#include": 2, "Kapital": 4, "(": 119, "L": 2, "const": 4, "N": 5, "entrant": 8, "exit": 2, "KP": 14, ")": 119, "{": 22, "StateVariable": 1, ";": 91, "this.entrant": 1, "this.exit": 1, "this.KP": 1, "actual": 2, "Kbar*vals/": 1, "-": 31, "upper": 3, "log": 2, ".Inf": 2, "}": 22, "Transit": 1, "FeasA": 2, "decl": 3, "ent": 5, "CV": 7, "stayout": 3, "[": 25, "]": 25, "exit.pos": 1, "tprob": 5, "sigu": 2, "SigU": 2, "if": 5, "v": 2, "&&": 1, "return": 10, "<0>": 1, "ones": 1, "probn": 2, "Kbe": 2, "/sigu": 1, "Kb0": 2, "+": 14, "Kb2": 2, "*upper": 1, "/": 1, "vals": 1, "tprob.*": 1, "zeros": 4, ".*stayout": 1, "FirmEntry": 6, "Run": 1, "Initialize": 3, "GenerateSample": 2, "BDP": 2, "BayesianDP": 1, "Rust": 1, "Reachable": 2, "sige": 2, "new": 19, "StDeviations": 1, "<0.3,0.3>": 1, "LaggedAction": 1, "d": 2, "array": 1, "Kparams": 1, "Positive": 4, "Free": 1, "Kb1": 1, "Determined": 1, "EndogenousStates": 1, "K": 3, "KN": 1, "SetDelta": 1, "Probability": 1, "kcoef": 3, "ecost": 3, "Negative": 1, "CreateSpaces": 1, "Volume": 3, "LOUD": 1, "EM": 4, "ValueIteration": 1, "//": 17, "Solve": 1, "data": 4, "DataSet": 1, "Simulate": 1, "DataN": 1, "DataT": 1, "FALSE": 1, "Print": 1, "ImaiJainChing": 1, "delta": 1, "*CV": 2, "Utility": 1, "u": 2, "ent*CV": 1, "*AV": 1, "|": 1, "ParallelObjective": 1, "obj": 18, "DONOTUSECLIENT": 2, "isclass": 1, "obj.p2p": 2, "oxwarning": 1, "obj.L": 1, "P2P": 2, "ObjClient": 4, "ObjServer": 7, "this.obj": 2, "Execute": 4, "basetag": 2, "STOP_TAG": 1, "iml": 1, "obj.NvfuncTerms": 2, "Nparams": 6, "obj.nstruct": 2, "Loop": 2, "nxtmsgsz": 2, "//free": 1, "param": 1, "length": 1, "is": 1, "no": 2, "greater": 1, "than": 1, "QUIET": 2, "println": 2, "ID": 2, "Server": 1, "Recv": 1, "ANY_TAG": 1, "//receive": 1, "the": 1, "ending": 1, "parameter": 1, "vector": 1, "Encode": 3, "Buffer": 8, "//encode": 1, "it.": 1, "Decode": 1, "obj.nfree": 1, "obj.cur.V": 1, "vfunc": 2, "CstrServer": 3, "SepServer": 3, "Lagrangian": 1, "rows": 1, "obj.cur": 1, "Vec": 1, "obj.Kvar.v": 1, "imod": 1, "Tag": 1, "obj.K": 1, "TRUE": 1, "obj.Kvar": 1, "PDF": 1, "*": 5, "nldge": 1, "ParticleLogLikeli": 1, "it": 5, "ip": 1, "mss": 3, "mbas": 1, "ms": 8, "my": 4, "mx": 7, "vw": 7, "vwi": 4, "dws": 3, "mhi": 3, "mhdet": 2, "loglikeli": 4, "mData": 4, "vxm": 1, "vxs": 1, "mxm": 1, "<": 4, "mxsu": 1, "mxsl": 1, "time": 2, "timeall": 1, "timeran": 1, "timelik": 1, "timefun": 1, "timeint": 1, "timeres": 1, "GetData": 1, "m_asY": 1, "sqrt": 1, "*M_PI": 1, "m_cY": 1, "determinant": 2, "m_mMSbE.": 2, "covariance": 2, "invert": 2, "of": 2, "measurement": 1, "shocks": 1, "m_vSss": 1, "m_cPar": 4, "m_cS": 1, "start": 1, "particles": 2, "m_vXss": 1, "m_cX": 1, "steady": 1, "state": 3, "and": 1, "policy": 2, "init": 1, "likelihood": 1, "//timeall": 1, "timer": 3, "for": 2, "sizer": 1, "rann": 1, "m_cSS": 1, "m_mSSbE": 1, "noise": 1, "fg": 1, "&": 2, "transition": 1, "prior": 1, "as": 1, "proposal": 1, "m_oApprox.FastInterpolate": 1, "interpolate": 1, "fy": 1, "m_cMS": 1, "evaluate": 1, "importance": 1, "weights": 2, "observation": 1, "error": 1, "exp": 2, "outer": 1, "/mhdet": 2, "sumr": 1, "my*mhi": 1, ".*my": 1, ".": 3, ".NaN": 1, "can": 1, "happen": 1, "extrem": 1, "sumc": 1, "or": 1, "extremely": 1, "wrong": 1, "parameters": 1, "dws/m_cPar": 1, "loglikelihood": 1, "contribution": 1, "//timelik": 1, "/100": 1, "//time": 1, "resample": 1, "vw/dws": 1, "selection": 1, "step": 1, "in": 1, "c": 1, "on": 1, "normalized": 1 }, "Oxygene": { "": 1, "DefaultTargets=": 1, "xmlns=": 1, "": 3, "": 1, "Loops": 2, "": 1, "": 1, "exe": 1, "": 1, "": 1, "": 1, "": 1, "False": 4, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "Properties": 1, "App.ico": 1, "": 1, "": 1, "Condition=": 3, "Release": 2, "": 1, "": 1, "{": 1, "BD89C": 1, "-": 4, "B610": 1, "CEE": 1, "CAF": 1, "C515D88E2C94": 1, "}": 1, "": 1, "": 3, "": 1, "DEBUG": 1, ";": 2, "TRACE": 1, "": 1, "": 2, ".": 2, "bin": 2, "Debug": 1, "": 2, "": 1, "True": 3, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "Project=": 1, "": 2, "": 5, "Include=": 12, "": 5, "(": 5, "Framework": 5, ")": 5, "mscorlib.dll": 1, "": 5, "": 5, "System.dll": 1, "ProgramFiles": 1, "Reference": 1, "Assemblies": 1, "Microsoft": 1, "v3.5": 1, "System.Core.dll": 1, "": 1, "": 1, "System.Data.dll": 1, "System.Xml.dll": 1, "": 2, "": 4, "": 1, "": 1, "": 2, "ResXFileCodeGenerator": 1, "": 2, "": 1, "": 1, "SettingsSingleFileGenerator": 1, "": 1, "": 1 }, "Oz": { "%": 1, "declare": 1, "fun": 5, "{": 10, "Sum": 2, "N": 12, "}": 10, "local": 3, "SumAux": 3, "in": 4, "Acc": 7, "if": 3, "then": 4, "else": 3, "-": 2, "end": 12, "Prime": 1, "PrimeAcc": 4, "(": 4, ")": 4, "false": 2, "elseif": 1, "true": 1, "mod": 1, "div": 1, "Reverse": 1, "L": 2, "RevList": 3, "NewCell": 1, "nil": 1, "for": 1, "E": 2, "do": 1, "|": 1, "@RevList": 2 }, "PAWN": { "#if": 147, "defined": 113, "_INC_SAMP_Community_fixes": 2, "#endinput": 1, "#endif": 145, "#define": 252, "_inc_fixes": 2, "_FIXES_IS_UNSET": 94, "(": 515, "%": 50, ")": 514, "*": 2, "-": 16, "+": 14, "FIX_GetPlayerColour": 8, "FIX_GetPlayerColor": 3, "#else": 22, "#elseif": 93, "#undef": 93, "FIX_FILTERSCRIPT": 7, "FIX_SpawnPlayer": 5, "FIX_SetPlayerName": 5, "FIX_GetPlayerSkin": 5, "FIX_GetWeaponName": 5, "FIX_SetPlayerWorldBounds": 7, "FIX_TogglePlayerControllable": 7, "SetObjectMaterial": 1, "FIX_HydraSniper": 5, "FIX_IsPlayerInCheckpoint": 5, "FIX_IsPlayerInRaceCheckpoint": 5, "FIX_GetPlayerWeapon": 5, "FIX_PutPlayerInVehicle": 5, "FIX_KEY_AIM": 7, "KEY_AIM": 2, "FIX_SPECIAL_ACTION_PISSING": 7, "SPECIAL_ACTION_PISSING": 2, "FIX_Natives": 8, "FIX_IsValidVehicle": 7, "IsValidVehicle": 2, "FIX_GetGravity": 7, "GetGravity": 2, "FIX_gpci": 7, "gpci": 2, "FIX_BODYPARTS": 7, "BODY_PART_TORSO": 2, "FIX_CAMERAMODES": 7, "CAM_MODE_NONE": 2, "FIX_DriveBy": 5, "FIX_SetPlayerCheckpoint": 5, "FIX_SetPlayerRaceCheckpoint": 5, "FIX_TextDrawCreate": 5, "FIX_TextDrawSetString": 5, "FIX_AllowInteriorWeapons": 6, "FIX_OnPlayerEnterVehicle": 8, "OnPlayerClickMap": 2, "FIX_OnPlayerEnterVehicle_2": 4, "FIX_AllowTeleport": 6, "FIX_SetPlayerSpecialAction": 5, "FIX_ClearAnimations": 5, "FIX_ClearAnimations_2": 5, "FIX_GangZoneCreate": 5, "FIX_OnDialogResponse": 6, "GetVehicleModelInfo": 1, "FIX_GetPlayerDialog": 5, "FIX_PlayerDialogResponse": 5, "FIX_SetSpawnInfo": 6, "GetPlayerVersion": 1, "FIX_SetPlayerSkin": 5, "FIX_HideMenuForPlayer": 11, "FIX_valstr": 5, "FIX_file_inc": 14, "FIX_fclose": 5, "FIX_fwrite": 5, "FIX_fread": 5, "FIX_fputchar": 5, "FIX_fgetchar": 5, "FIX_fblockwrite": 5, "FIX_fblockread": 5, "FIX_fseek": 5, "FIX_flength": 5, "FIX_IsPlayerAttachedObjSlotUsed": 5, "FIX_SetPlayerAttachedObject": 5, "FIX_OnPlayerDeath": 5, "FIX_strins": 5, "FIX_IsPlayerConnected": 6, "FIX_OnPlayerCommandText": 5, "FIX_TrainExit": 5, "FIX_Kick": 6, "EnableVehicleFriendlyFire": 1, "FIX_OnVehicleMod": 6, "FIX_random": 5, "FIX_sleep": 5, "FIX_Menus": 12, "FIX_AddMenuItem": 6, "FIX_SetMenuColumnHeader": 6, "FIX_ShowMenuForPlayer": 6, "FIX_GetPlayerMenu": 8, "FIX_HideMenuForPlayer_2": 7, "&&": 3, "#error": 3, "requires": 2, "FIX_DisableMenu": 6, "FIX_DisableMenuRow": 6, "||": 14, "_FIX_Menus": 3, "FIX_GetPlayerInterior": 5, "FIX_ApplyAnimation": 7, "FIX_ApplyAnimation_2": 9, "FIX_OnPlayerSpawn": 5, "FIX_GameText": 14, "FIX_HideGameText": 5, "FIX_GameTextStyles": 9, "FIX_OnPlayerConnect": 5, "FIX_OnPlayerDisconnect": 6, "FIX_CreatePlayerTextDraw": 5, "FIX_PlayerTextDrawSetString": 5, "FIX_SetPlayerCamera": 5, "FIX_SetPlayerTime": 5, "FIX_OnPlayerRequestClass": 5, "FIX_SetPlayerColour": 7, "FIX_SetPlayerColor": 3, "FIX_FileMaths": 6, "FIX_GetPlayerWeaponData": 5, "CHAIN_ORDER": 5, "PRE_HOOK": 2, "forward": 32, "@CO_": 2, ";": 72, "public": 5, "{": 23, "return": 6, "}": 23, "FIXES": 1, "@CO_FIXES": 1, "static": 7, "stock": 7, "_FIXES_IncludeStates": 2, "<_ALS>": 3, "_ALS_x0": 2, "_ALS": 4, "_ALS_x1": 2, "_ALS_x2": 1, "_ALS_x3": 1, "_ALS_go": 1, "FIXES_GT_STYLE_COUNT": 6, "FIXES_SilentKick": 5, "FIXES_Debug": 7, "FIXES_PRINTF": 3, "print": 6, "_FIXES_gIsFilterscript": 3, "printf": 1, "FIXES_UseStateHooks": 1, "INVALID_DIALOG_ID": 2, "FIXES_Single": 7, "_FIXES_IS_IN_CHARGE": 2, "if": 3, "FIXES_gsSettings": 2, "&": 1, "e_FIXES_SETTINGS_IN_CHARGE": 2, "enum": 3, "E_FIXES_WORLDBOUND_DATA": 2, "//": 14, ".": 10, "Float": 10, "E_FIXES_WORLDBOUND_DATA_PX": 1, "E_FIXES_WORLDBOUND_DATA_PY": 1, "E_FIXES_WORLDBOUND_DATA_PZ": 1, "E_FIXES_WORLDBOUND_DATA_LX": 1, "E_FIXES_WORLDBOUND_DATA_LY": 1, "E_FIXES_WORLDBOUND_DATA_UX": 1, "E_FIXES_WORLDBOUND_DATA_UY": 1, "e_FIXES_BOOLS": 2, "<<": 2, "Handy": 2, "definition": 2, "for": 3, "nothing": 2, "set.": 2, "e_FIXES_BOOLS_NONE": 1, "Does": 1, "this": 1, "player": 1, "have": 1, "worldbounds": 1, "enabled": 1, "e_FIXES_BOOLS_WORLDBOUNDS": 1, "e_FIXES_BOOLS_UNCONTROLLABLE": 1, "e_FIXES_BOOLS_PUT_IN_VEHICLE": 1, "e_FIXES_BOOLS_BLOCK": 1, "e_FIXES_BOOLS_TELEPORT": 1, "e_FIXES_BOOLS_CONNECTED": 1, "e_FIXES_BOOLS_INTERIOR": 1, "e_FIXES_BOOLS_PUT_IN_TRAIN": 1, "e_FIXES_BOOLS_KICKED": 1, "e_FIXES_BOOLS_ON_PLAYER_CONNECT": 1, "e_FIXES_BOOLS_DRIVE_BY": 1, "e_FIXES_BOOLS_FIRST_SPAWN": 1, "e_FIXES_BOOLS_FIRST_CLASS": 1, "e_FIXES_BOOLS_SPECTATING": 1, "e_FIXES_BOOLS_CP_DELAYED": 1, "e_FIXES_BOOLS_RACE_CP_DELAYED": 1, "e_FIXES_SETTINGS": 2, "e_FIXES_SETTINGS_NONE": 1, "e_FIXES_SETTINGS_INTERIOR": 1, "e_FIXES_SETTINGS_ADMIN_TELEPORT": 1, "e_FIXES_SETTINGS_DROP_ALL_DATA": 1, "e_FIXES_SETTINGS_MENU_SET": 1, "e_FIXES_SETTINGS_ENDING": 1, "e_FIXES_SETTINGS_ENDED": 1, "e_FIXES_SETTINGS_NO_GAME_TEXT": 1, "e_FIXES_SETTINGS_SECOND_USE": 2, "_FIXES_CEILDIV": 5, "/": 2, "_FIXES_INFINITY": 1, "_FIXES_N_INFINITY": 1, "_FIXES_ATTACHMENTS": 2, "cellbits": 4, "MAX_PLAYER_ATTACHED_OBJECTS": 1, "_FIXES_FOREACH": 1, "new": 5, "MAX_PLAYERS": 24, "[": 97, "]": 97, "_FIXES_IN_RANGE": 2, "cellmin": 4, "<": 7, "_FIXES_NO_RANGE": 1, "_FIXES_FORWARD": 1, "_FIXES_IS_PLAYER_CONNECTED": 2, "IsPlayerConnected": 3, "bool": 13, "FIXES_gscSpace": 6, "FIXES_gsPlayersIterator": 1, "...": 4, "FIXES_gsValidMenus": 1, "MAX_MENUS": 1, "FIXES_gsPlayerIP": 1, "FIXES_gsPlayerSkin": 1, "FIXES_gsPlayerBools": 1, "FIXES_gsWorldbounds": 1, "FIXES_gsPlayerWeapon": 1, "FIXES_gsVehicleSeatData": 1, "//FIXES_gsVehicleLocked": 1, "MAX_VEHICLES": 1, "FIXES_gsDialogID": 1, "FIXES_gsInterior": 1, "FIXES_gsObjectSlots": 1, "FIXES_gsLastAnimation": 1, "FIXES_gsLastCash": 1, "FIXES_gsDriveByWeapon": 1, "Menu": 2, "FIXES_gsCurrentMenu": 1, "INVALID_MENU": 1, "Text": 2, "FIXES_gsGTStyle": 7, "FIXES_gsPlayerPGTShown": 1, "PlayerText": 1, "FIXES_gsPGTStyle": 1, "FIXES_gsGTTimer": 1, "FIXES_gsAnimTimer": 1, "FIXES_gsClassAnimName": 1, "FIXES_gsPlayerAnimLibs": 1, "FIXES_pvarNotNewPlayer": 1, "FIXES_pvarPlayerWeapon": 1, "FIXES_pvarPlayerSkin": 1, "FIXES_pvarPlayerSpectate": 1, "FIXES_gscKick": 1, "FIXES_pvarKick": 1, "FIXES_pvarPlayerDialog": 1, "FIXES_pvarPlayerInterior": 1, "FIXES_pvarCurrentDialog": 1, "FIXES_pvarPlayerLastCash": 1, "FIXES_gscHideGameTextTimer": 1, "FIXES_gscDriveBy": 1, "FIXES_gscSetCamera": 1, "FIXES_gscSetTime": 1, "FIXES_gscSetColor": 1, "FIXES_gscSetCheckpoint": 1, "FIXES_pvarPlayerCheckpoint": 1, "FIXES_gscSetRaceCheckpoint": 1, "FIXES_pvarPlayerRaceCheckpoint": 1, "FIXES_gscNULL": 1, "const": 2, "FIXES_gscPlayerColours": 1, "FIXES_gscMaxPassengers": 1, "FIXES_gscVehicleMods": 1, "FIXES_gscAnimIndexes": 1, "FIXES_gscAnimLib": 1, "FIXES_gscDot": 1, "FIXES_gscSpec@": 3, "FIXES_gscSpec@i": 1, "FIXES_gscSpec@ii": 1, "FIXES_gscSpec@ai": 1, "FIXES_gscSpec@is": 1, "FIXES_gscSpec@iii": 1, "FIXES_gscSpec@isii": 1, "FIXES_gscSpec@ifff": 1, "FIXES_gscSpec@iifff": 1, "FIXES_gscSpec@iifffffff": 1, "FIXES_gscSpec@iffff": 1, "FIXES_gscSpec@iiiis": 1, "FIXES_gscSpec@iiiii": 1, "FIXES_gscSpec@iiiiii": 1, "FIXES_gscTempName": 1, "FIXES_gscOrderProperty": 2, "FIXES_gscNoGMProperty": 3, "FIXES_gscDetermineOrder": 3, "FIXES_gscSetPlayerMenu": 1, "FIXES_gscClearPlayerMenu": 1, "FIXES_gscAllowTeleport": 1, "FIXES_gscPutPlayerInVehicle": 1, "FIXES_gscAllowInteriorWeapons": 1, "FIXES_gscSetPlayerAttachedObj": 1, "FIXES_gscTogglePlayerControl": 1, "FIXES_gscSetPlayerWorldBounds": 1, "FIXES_gscGameTextShow": 1, "FIXES_gscReturnProperty": 1, "FIXES_gscSingleProperty": 1, "FIXES_gscMenuProperty": 1, "FIXES_gscFixesError": 1, "_FIXES_KEY_AIM": 2, "_FIXES_SPECIAL_ACTION_PISSING": 2, "native": 4, "vehicleid": 1, "playerid": 6, "serial": 1, "maxlen": 1, "BODY_PART_GROIN": 1, "BODY_PART_LEFT_ARM": 1, "BODY_PART_RIGHT_ARM": 1, "BODY_PART_LEFT_LEG": 1, "BODY_PART_RIGHT_LEG": 1, "BODY_PART_HEAD": 1, "CAM_MODE_DISCONNECTED": 1, "CAM_MODE_BEHINDCAR": 1, "CAM_MODE_FOLLOWPED": 1, "CAM_MODE_SNIPER": 1, "CAM_MODE_ROCKETLAUNCHER": 1, "CAM_MODE_FIXED": 1, "CAM_MODE_1STPERSON": 1, "CAM_MODE_CAM_ON_A_STRING": 1, "CAM_MODE_BEHINDBOAT": 1, "CAM_MODE_CAMERA": 1, "CAM_MODE_ROCKETLAUNCHER_HS": 1, "CAM_MODE_AIMWEAPON": 1, "CAM_MODE_AIMWEAPON_FROMCAR": 1, "CAM_MODE_DW_HELI_CHASE": 1, "IS_FILTERSCRIPT": 1, "File": 52, "operator": 23, "a": 27, "b": 25, "_": 16, "operator*": 2, "operator/": 3, "<=(File:a,>": 1, "_FIXES_DetermineOrder": 1, "FIXES_DetermineOrder": 1, "deleteproperty": 2, "Called": 1, "in": 1, "the": 1, "Game": 1, "Mode": 1, "first": 1, "thus": 1, "needs": 1, "correcting": 1, "setproperty": 1, "CallRemoteFunction": 2, "_ALS_IsPlayerConnected": 3, "BAD_IsPlayerConnected": 1, "FIXES_IsPlayerConnected": 2, "_FIXES_CreateGameTextDraws": 1, "INVALID_PLAYER_ID": 1, "t": 62, "Global": 6, "style": 6, "vehicle": 1, "name": 3, "TextDrawCreate": 6, "TextDrawLetterSize": 5, "TextDrawAlignment": 5, "TextDrawColor": 5, "TextDrawSetShadow": 5, "TextDrawSetOutline": 5, "TextDrawBackgroundColor": 5, "TextDrawFont": 5, "TextDrawSetProportional": 5, "TextDrawUseBox": 5, "true": 5, "TextDrawBoxColor": 5, "TextDrawTextSize": 5, "location": 1, "radio": 2, "switch": 1, "positive": 1, "money": 2, "negative": 1, "#include": 1, "": 1, "OneSecTimer": 2, "lasttick": 5, "main": 1, "OnGameModeInit": 1, "Set": 1, "timer": 1, "of": 1, "second.": 1, "SetTimer": 1, "SetGameModeText": 1, "AddPlayerClass": 1, "GetTickCount": 3, "sText": 5, "format": 1, "sizeof": 1, "SendClientMessageToAll": 1 }, "PHP": { "<": 16, "php": 18, "namespace": 30, "Symfony": 24, "Component": 24, "Console": 17, ";": 1461, "use": 31, "Input": 6, "InputInterface": 4, "ArgvInput": 2, "ArrayInput": 3, "InputDefinition": 2, "InputOption": 15, "InputArgument": 3, "Output": 5, "OutputInterface": 6, "ConsoleOutput": 2, "ConsoleOutputInterface": 2, "Command": 6, "HelpCommand": 2, "ListCommand": 2, "Helper": 3, "HelperSet": 3, "FormatterHelper": 2, "DialogHelper": 2, "class": 23, "Application": 3, "{": 1003, "private": 24, "commands": 39, "wantHelps": 4, "false": 154, "runningCommand": 5, "name": 199, "version": 8, "catchExceptions": 4, "autoExit": 4, "definition": 3, "helperSet": 6, "public": 207, "function": 217, "__construct": 9, "(": 2551, ")": 2554, "this": 935, "-": 1323, "true": 160, "array": 325, "getDefaultHelperSet": 2, "getDefaultInputDefinition": 2, "foreach": 98, "getDefaultCommands": 2, "as": 100, "command": 41, "add": 7, "}": 1004, "run": 4, "input": 28, "null": 167, "output": 67, "if": 463, "new": 78, "try": 3, "statusCode": 14, "doRun": 2, "catch": 3, "Exception": 6, "e": 18, "throw": 19, "instanceof": 8, "renderException": 3, "getErrorOutput": 2, "else": 73, "getCode": 1, "is_numeric": 7, "&&": 123, "exit": 7, "return": 314, "getCommandName": 2, "hasParameterOption": 7, "setDecorated": 2, "elseif": 31, "setInteractive": 2, "function_exists": 5, "getHelperSet": 3, "has": 7, "inputStream": 2, "get": 12, "getInputStream": 1, "posix_isatty": 1, "setVerbosity": 2, "VERBOSITY_QUIET": 1, "VERBOSITY_VERBOSE": 2, "writeln": 13, "getLongVersion": 3, "find": 17, "setHelperSet": 1, "getDefinition": 2, "getHelp": 2, "messages": 16, "sprintf": 27, "getOptions": 1, "option": 5, "[": 747, "]": 747, ".": 171, "getName": 15, "getShortcut": 2, "getDescription": 3, "implode": 8, "PHP_EOL": 3, "setCatchExceptions": 1, "boolean": 4, "Boolean": 4, "setAutoExit": 1, "setName": 1, "getVersion": 3, "setVersion": 1, "register": 1, "addCommands": 1, "setApplication": 2, "isEnabled": 1, "getAliases": 3, "alias": 87, "isset": 109, "InvalidArgumentException": 9, "helpCommand": 3, "setCommand": 1, "getNamespaces": 3, "namespaces": 4, "extractNamespace": 7, "array_values": 5, "array_unique": 4, "array_filter": 2, "findNamespace": 4, "allNamespaces": 3, "n": 12, "explode": 9, "found": 4, "i": 42, "part": 12, "abbrevs": 31, "static": 7, "getAbbreviations": 4, "array_map": 2, "p": 3, "message": 17, "<=>": 3, "alternatives": 10, "findAlternativeNamespace": 2, "count": 32, "getAbbreviationSuggestions": 4, "searchName": 13, "pos": 3, "strrpos": 2, "substr": 6, "namespace.substr": 1, "suggestions": 2, "aliases": 8, "findAlternativeCommands": 2, "all": 11, "substr_count": 1, "+": 33, "names": 3, "for": 9, "len": 11, "strlen": 14, "abbrev": 4, "asText": 1, "raw": 2, "width": 7, "sortCommands": 4, "space": 5, "space.": 1, "asXml": 2, "asDom": 2, "dom": 12, "DOMDocument": 2, "formatOutput": 1, "appendChild": 10, "xml": 5, "createElement": 6, "commandsXML": 3, "setAttribute": 2, "namespacesXML": 3, "namespaceArrayXML": 4, "continue": 7, "commandXML": 3, "createTextNode": 1, "node": 42, "getElementsByTagName": 1, "item": 9, "importNode": 3, "saveXml": 1, "string": 6, "encoding": 2, "mb_detect_encoding": 1, "mb_strlen": 1, "do": 2, "title": 10, "get_class": 4, "getTerminalWidth": 3, "PHP_INT_MAX": 1, "lines": 3, "preg_split": 1, "getMessage": 1, "line": 11, "str_split": 1, "max": 2, "str_repeat": 2, "title.str_repeat": 1, "line.str_repeat": 1, "message.": 1, "getVerbosity": 1, "trace": 12, "getTrace": 1, "array_unshift": 2, "getFile": 2, "getLine": 2, "type": 62, "file": 20, "while": 7, "getPrevious": 1, "getSynopsis": 1, "protected": 59, "defined": 5, "ansicon": 4, "getenv": 2, "preg_replace": 4, "preg_match": 6, "getSttyColumns": 3, "match": 4, "getTerminalHeight": 1, "trim": 3, "getFirstArgument": 1, "REQUIRED": 1, "VALUE_NONE": 7, "descriptorspec": 2, "process": 10, "proc_open": 1, "pipes": 4, "is_resource": 1, "info": 5, "stream_get_contents": 1, "fclose": 2, "proc_close": 1, "namespacedCommands": 5, "key": 67, "ksort": 2, "&": 21, "limit": 3, "parts": 4, "array_pop": 1, "array_slice": 1, "callback": 5, "findAlternatives": 3, "collection": 3, "call_user_func": 2, "lev": 6, "levenshtein": 2, "3": 2, "strpos": 15, "values": 53, "/": 3, "||": 52, "value": 53, "asort": 1, "array_keys": 8, "BrowserKit": 1, "DomCrawler": 5, "Crawler": 2, "Link": 3, "Form": 4, "Process": 1, "PhpProcess": 2, "abstract": 2, "Client": 1, "history": 15, "cookieJar": 9, "server": 20, "request": 76, "response": 33, "crawler": 7, "insulated": 7, "redirect": 6, "followRedirects": 5, "History": 2, "CookieJar": 2, "setServerParameters": 2, "followRedirect": 4, "insulate": 1, "class_exists": 2, "RuntimeException": 2, "array_merge": 32, "setServerParameter": 1, "getServerParameter": 1, "default": 10, "getHistory": 1, "getCookieJar": 1, "getCrawler": 1, "getResponse": 1, "getRequest": 1, "click": 1, "link": 10, "submit": 2, "getMethod": 6, "getUri": 8, "form": 23, "setValues": 2, "getPhpValues": 2, "getPhpFiles": 2, "method": 31, "uri": 23, "parameters": 4, "files": 7, "content": 6, "changeHistory": 4, "getAbsoluteUri": 2, "isEmpty": 2, "current": 4, "parse_url": 3, "PHP_URL_HOST": 1, "PHP_URL_SCHEME": 1, "Request": 3, "allValues": 1, "filterRequest": 2, "doRequestInProcess": 2, "doRequest": 2, "filterResponse": 2, "updateFromResponse": 1, "getHeader": 2, "createCrawlerFromContent": 2, "getContent": 2, "getScript": 2, "sys_get_temp_dir": 2, "isSuccessful": 1, "getOutput": 3, "unserialize": 1, "LogicException": 4, "addContent": 1, "back": 2, "requestFromRequest": 4, "forward": 2, "reload": 1, "empty": 105, "restart": 1, "clear": 2, "currentUri": 7, "path": 20, "PHP_URL_PATH": 1, "path.": 1, "getParameters": 1, "getFiles": 3, "getServer": 1, "": 8, "CakePHP": 6, "tm": 6, "Rapid": 2, "Development": 2, "Framework": 2, "http": 14, "cakephp": 4, "org": 10, "Copyright": 5, "2005": 4, "2012": 4, "Cake": 7, "Software": 5, "Foundation": 4, "Inc": 4, "cakefoundation": 4, "Licensed": 2, "under": 2, "The": 4, "MIT": 6, "License": 4, "Redistributions": 2, "of": 12, "must": 2, "retain": 2, "the": 21, "above": 2, "copyright": 5, "notice": 2, "Project": 2, "package": 2, "Controller": 4, "since": 2, "v": 17, "0": 5, "2": 2, "9": 2, "license": 8, "www": 4, "opensource": 2, "licenses": 2, "mit": 2, "App": 20, "uses": 46, "CakeResponse": 2, "Network": 1, "ClassRegistry": 9, "Utility": 6, "ComponentCollection": 2, "View": 9, "CakeEvent": 13, "Event": 6, "CakeEventListener": 4, "CakeEventManager": 5, "controller": 3, "organization": 1, "business": 1, "logic": 1, "Provides": 1, "basic": 2, "functionality": 1, "such": 1, "rendering": 1, "views": 1, "inside": 1, "layouts": 1, "automatic": 1, "model": 34, "availability": 1, "redirection": 2, "callbacks": 4, "and": 5, "more": 1, "Controllers": 2, "should": 1, "provide": 1, "a": 15, "number": 1, "action": 7, "methods": 5, "These": 1, "are": 6, "on": 4, "that": 5, "not": 3, "prefixed": 1, "with": 8, "_": 1, "Each": 1, "serves": 1, "an": 5, "endpoint": 1, "performing": 2, "specific": 1, "resource": 1, "or": 9, "resources": 1, "For": 2, "example": 3, "adding": 1, "editing": 1, "object": 14, "listing": 1, "set": 26, "objects": 5, "You": 2, "can": 2, "access": 1, "using": 3, "contains": 1, "POST": 1, "GET": 1, "FILES": 1, "*": 25, "were": 1, "request.": 1, "After": 1, "required": 2, "actions": 2, "controllers": 2, "responsible": 1, "creating": 2, "response.": 2, "This": 6, "usually": 1, "takes": 1, "generated": 2, "possibly": 1, "to": 13, "another": 1, "action.": 1, "In": 1, "either": 1, "case": 32, "allows": 1, "you": 1, "manipulate": 1, "aspects": 1, "created": 9, "by": 5, "Dispatcher": 1, "based": 2, "routing.": 1, "By": 1, "conventional": 1, "names.": 1, "/posts/index": 1, "maps": 1, "PostsController": 1, "index": 5, "re": 1, "map": 1, "urls": 1, "Router": 6, "connect": 1, "@package": 2, "Cake.Controller": 1, "@property": 8, "AclComponent": 1, "Acl": 1, "AuthComponent": 1, "Auth": 1, "CookieComponent": 1, "Cookie": 1, "EmailComponent": 1, "Email": 1, "PaginatorComponent": 1, "Paginator": 1, "RequestHandlerComponent": 1, "RequestHandler": 1, "SecurityComponent": 1, "Security": 1, "SessionComponent": 1, "Session": 1, "@link": 2, "//book.cakephp.org/2.0/en/controllers.html": 1, "*/": 2, "extends": 4, "Object": 4, "implements": 3, "helpers": 1, "_responseClass": 1, "viewPath": 3, "layoutPath": 1, "viewVars": 3, "view": 5, "layout": 5, "autoRender": 6, "autoLayout": 2, "Components": 7, "components": 1, "viewClass": 10, "ext": 1, "plugin": 33, "cacheAction": 1, "passedArgs": 2, "scaffold": 2, "modelClass": 25, "modelKey": 2, "validationErrors": 50, "_mergeParent": 4, "_eventManager": 12, "Inflector": 12, "singularize": 4, "underscore": 3, "childMethods": 2, "get_class_methods": 2, "parentMethods": 2, "array_diff": 3, "CakeRequest": 5, "setRequest": 2, "parent": 14, "__isset": 2, "switch": 7, "is_array": 38, "list": 29, "pluginSplit": 12, "loadModel": 3, "__get": 2, "params": 34, "load": 3, "settings": 5, "__set": 1, "camelize": 3, "array_key_exists": 11, "invokeAction": 1, "ReflectionMethod": 2, "_isPrivateAction": 2, "PrivateActionException": 1, "invokeArgs": 1, "ReflectionException": 1, "_getScaffold": 2, "MissingActionException": 1, "privateAction": 4, "isPublic": 1, "in_array": 26, "prefixes": 4, "prefix": 2, "Scaffold": 1, "_mergeControllerVars": 2, "pluginController": 9, "pluginDot": 4, "mergeParent": 2, "is_subclass_of": 3, "pluginVars": 3, "appVars": 6, "merge": 12, "_mergeVars": 5, "get_class_vars": 2, "_mergeUses": 3, "implementedEvents": 2, "constructClasses": 1, "init": 4, "getEventManager": 13, "attach": 4, "startupProcess": 1, "dispatch": 11, "shutdownProcess": 1, "httpCodes": 3, "code": 6, "id": 82, "MissingModelException": 1, "url": 18, "status": 15, "extract": 9, "EXTR_OVERWRITE": 3, "event": 35, "//TODO": 1, "Remove": 1, "following": 1, "when": 1, "events": 1, "fully": 1, "migrated": 1, "break": 22, "breakOn": 4, "collectReturn": 1, "isStopped": 4, "result": 21, "_parseBeforeRedirect": 2, "session_write_close": 1, "header": 7, "is_string": 7, "codes": 3, "array_flip": 1, "send": 2, "_stop": 1, "resp": 6, "compact": 8, "one": 20, "two": 6, "data": 190, "array_combine": 2, "setAction": 1, "args": 5, "func_get_args": 5, "unset": 22, "call_user_func_array": 3, "validate": 9, "errors": 10, "validateErrors": 1, "invalidFields": 2, "render": 3, "className": 27, "models": 6, "keys": 19, "currentModel": 2, "currentObject": 6, "getObject": 1, "is_a": 1, "location": 1, "body": 4, "referer": 5, "local": 2, "disableCache": 2, "flash": 1, "pause": 2, "postConditions": 1, "op": 9, "bool": 5, "exclusive": 2, "cond": 5, "arrayOp": 2, "fields": 60, "field": 88, "fieldOp": 11, "strtoupper": 3, "paginate": 3, "scope": 2, "whitelist": 14, "beforeFilter": 1, "beforeRender": 1, "beforeRedirect": 1, "afterFilter": 1, "beforeScaffold": 2, "_beforeScaffold": 1, "afterScaffoldSave": 2, "_afterScaffoldSave": 1, "afterScaffoldSaveError": 2, "_afterScaffoldSaveError": 1, "scaffoldError": 2, "_scaffoldError": 1, "php_help": 1, "arg": 1, "t": 37, "php_permission": 1, "TRUE": 3, "php_eval": 1, "global": 2, "theme_path": 5, "theme_info": 3, "conf": 14, "old_theme_path": 2, "drupal_get_path": 2, "dirname": 2, "filename": 2, "ob_start": 1, "print": 1, "eval": 1, "ob_get_contents": 1, "ob_end_clean": 1, "_php_filter_tips": 1, "filter": 1, "format": 3, "long": 2, "FALSE": 2, "base_url": 1, "php_filter_info": 1, "filters": 2, "Test": 1, "Plugins": 1, "described": 1, "which": 1, "will": 1, "be": 3, "used": 1, "system": 1, "includes": 1, "single": 1, "ctools_context_required": 1, "file_entity_file_display_content_type_render": 1, "subtype": 2, "panel_args": 1, "context": 7, "clone": 1, "NULL": 2, "block": 10, "stdClass": 1, "module": 1, "delta": 2, "fid": 4, "ctools_template_identifier": 1, "file_view_file": 1, "title_link": 1, "entity_uri": 1, "file_entity_file_display_content_type_edit_form": 1, "form_state": 7, "formatters": 4, "file_info_formatter_types": 1, "formatter": 17, "check_plain": 3, "filter_xss": 1, "defaults": 8, "settings_form": 3, "file_type": 1, "view_mode": 1, "file_entity_file_display_content_type_edit_form_submit": 1, "file_entity_file_display_content_type_admin_title": 1, "identifier": 1, "SHEBANG#!php": 4, "": 1, "aMenuLinks": 1, "Array": 13, "Blog": 1, "SITE_DIR": 4, "Photos": 1, "photo": 1, "About": 1, "me": 1, "about": 1, "Contact": 1, "contacts": 1, "<<": 2, "is": 9, "PHP": 4, "CS": 2, "Fixer.": 2, "c": 3, "Fabien": 2, "Potencier": 2, "": 2, "Dariusz": 2, "Rumi": 2, "ski": 2, "": 2, "source": 4, "subject": 3, "bundled": 2, "in": 4, "LICENSE.": 2, "EOF": 2, "PhpCsFixer": 4, "Config": 2, "create": 17, "setRiskyAllowed": 2, "setRules": 2, "setFinder": 2, "Finder": 2, "exclude": 2, "__DIR__": 5, "Field": 9, "FormField": 3, "ArrayAccess": 1, "button": 6, "DOMNode": 3, "initialize": 2, "getFormNode": 1, "getValues": 3, "isDisabled": 2, "FileFormField": 3, "hasValue": 1, "getValue": 2, "qs": 4, "http_build_query": 3, "parse_str": 2, "queryString": 2, "sep": 1, "sep.": 1, "getRawUri": 1, "getAttribute": 10, "remove": 4, "offsetExists": 1, "offsetGet": 1, "offsetSet": 1, "offsetUnset": 1, "setNode": 1, "nodeName": 13, "parentNode": 1, "FormFieldRegistry": 2, "document": 6, "root": 4, "xpath": 2, "DOMXPath": 1, "query": 102, "hasAttribute": 1, "InputFormField": 2, "ChoiceFormField": 2, "addChoice": 1, "TextareaFormField": 1, "base": 8, "segments": 13, "getSegments": 4, "target": 20, "array_shift": 5, "self": 3, "k": 7, "setValue": 1, "walk": 3, "registry": 4, "m": 5, "shows": 1, "sending": 1, "s": 1, "mail": 11, "require": 4, "PHPMailerAutoload": 1, "Create": 1, "PHPMailer": 2, "instance": 1, "Set": 10, "who": 2, "sent": 2, "from": 2, "setFrom": 1, "//Set": 3, "alternative": 2, "reply": 1, "address": 1, "addReplyTo": 1, "addAddress": 1, "Subject": 1, "//Read": 1, "HTML": 2, "external": 1, "convert": 1, "referenced": 1, "images": 1, "embedded": 1, "//convert": 1, "into": 1, "plain": 2, "text": 2, "msgHTML": 1, "file_get_contents": 1, "__FILE__": 1, "//Replace": 1, "manually": 1, "AltBody": 1, "//Attach": 1, "image": 1, "addAttachment": 1, "//send": 1, "check": 1, "echo": 5, "ErrorInfo": 1, "relational": 2, "mapper": 2, "DBO": 2, "backed": 2, "mapping": 1, "database": 2, "tables": 5, "versions": 1, "5": 1, "Model": 5, "10": 1, "Validation": 1, "String": 5, "BehaviorCollection": 2, "ModelBehavior": 1, "ConnectionManager": 2, "Xml": 2, "Automatically": 1, "selects": 1, "table": 21, "pluralized": 1, "lowercase": 1, "User": 1, "have": 2, "at": 1, "least": 1, "primary": 3, "key.": 1, "Cake.Model": 1, "//book.cakephp.org/2.0/en/models.html": 1, "useDbConfig": 7, "useTable": 12, "displayField": 4, "schemaName": 1, "primaryKey": 38, "_schema": 11, "validationDomain": 1, "tablePrefix": 8, "tableToModel": 4, "cacheQueries": 1, "belongsTo": 7, "hasOne": 2, "hasMany": 2, "hasAndBelongsToMany": 24, "actsAs": 2, "Behaviors": 6, "cacheSources": 7, "findQueryType": 3, "recursive": 9, "order": 4, "virtualFields": 8, "_associationKeys": 2, "_associations": 5, "__backAssociation": 22, "__backInnerAssociation": 1, "__backOriginalAssociation": 1, "__backContainableAssociation": 1, "_insertID": 1, "_sourceConfigured": 1, "findMethods": 3, "ds": 3, "addObject": 2, "parentClass": 3, "get_parent_class": 1, "tableize": 2, "_createLinks": 3, "__call": 1, "dispatchMethod": 1, "getDataSource": 15, "relation": 7, "assocKey": 13, "dynamic": 2, "isKeySet": 1, "AppModel": 1, "_constructLinkedModel": 2, "schema": 11, "hasField": 7, "setDataSource": 2, "property_exists": 3, "bindModel": 1, "reset": 6, "assoc": 75, "assocName": 6, "unbindModel": 1, "_generateAssociation": 2, "dynamicWith": 3, "sort": 1, "setSource": 1, "tableName": 4, "db": 45, "method_exists": 5, "sources": 3, "listSources": 1, "strtolower": 1, "MissingTableException": 1, "is_object": 2, "SimpleXMLElement": 1, "_normalizeXmlData": 3, "toArray": 1, "reverse": 1, "_setAliasData": 2, "modelName": 3, "fieldSet": 3, "fieldName": 6, "fieldValue": 7, "deconstruct": 2, "getAssociated": 4, "getColumnType": 4, "useNewDate": 2, "dateFields": 5, "timeFields": 2, "date": 9, "val": 27, "columns": 5, "str_replace": 3, "describe": 1, "getColumnTypes": 1, "trigger_error": 1, "__d": 1, "E_USER_WARNING": 1, "cols": 7, "column": 10, "startQuote": 4, "endQuote": 4, "checkVirtual": 3, "isVirtualField": 3, "hasMethod": 2, "getVirtualField": 1, "filterKey": 2, "properties": 4, "read": 3, "conditions": 41, "saveField": 1, "options": 85, "save": 9, "fieldList": 1, "_whitelist": 4, "keyPresentAndEmpty": 2, "exists": 6, "validates": 60, "updateCol": 6, "colType": 4, "time": 3, "strtotime": 1, "joined": 5, "x": 4, "y": 2, "success": 10, "cache": 2, "_prepareUpdateFields": 2, "update": 2, "fInfo": 4, "isUUID": 5, "j": 2, "array_search": 1, "uuid": 3, "updateCounterCache": 6, "_saveMulti": 2, "_clearCache": 2, "join": 22, "joinModel": 8, "keyInfo": 4, "withModel": 4, "pluginName": 1, "dbMulti": 6, "newData": 5, "newValues": 8, "newJoins": 7, "primaryAdded": 3, "idField": 3, "row": 17, "keepExisting": 3, "associationForeignKey": 5, "links": 4, "oldLinks": 4, "delete": 9, "oldJoin": 4, "insertMulti": 1, "foreignKey": 11, "fkQuoted": 3, "escapeField": 6, "intval": 4, "updateAll": 3, "foreignKeys": 3, "included": 3, "array_intersect": 1, "old": 2, "saveAll": 1, "numeric": 1, "validateMany": 4, "saveMany": 3, "validateAssociated": 5, "saveAssociated": 5, "transactionBegun": 4, "begin": 2, "record": 10, "saved": 18, "commit": 2, "rollback": 2, "associations": 9, "association": 47, "notEmpty": 4, "_return": 3, "recordData": 2, "cascade": 10, "_deleteDependent": 3, "_deleteLinks": 3, "_collectForeignKeys": 2, "savedAssociatons": 3, "deleteAll": 2, "records": 6, "ids": 8, "_id": 2, "getID": 2, "hasAny": 1, "buildQuery": 2, "is_null": 1, "results": 22, "resetAssociations": 3, "_filterResults": 2, "ucfirst": 2, "modParams": 2, "_findFirst": 1, "state": 15, "_findCount": 1, "calculate": 2, "expression": 1, "_findList": 1, "tokenize": 1, "lst": 4, "combine": 1, "_findNeighbors": 1, "prevVal": 2, "return2": 6, "_findThreaded": 1, "nest": 1, "isUnique": 1, "is_bool": 1, "sql": 1, "Yii": 3, "console": 3, "bootstrap": 1, "yiiframework": 2, "com": 3, "2008": 1, "LLC": 1, "YII_DEBUG": 2, "define": 2, "fcgi": 1, "doesn": 1, "STDIN": 3, "fopen": 1, "stdin": 1, "r": 1, "vendor": 2, "yiisoft": 1, "yii2": 1, "yii": 2, "autoload": 1, "config": 3, "application": 2, "_SERVER": 1, "_GET": 1, "var": 2, "I": 1, "am": 1, "Isabelle": 1, "ROOT": 1, "github": 1, "Autogenerated": 1, "Thrift": 9, "Compiler": 1, "DO": 1, "NOT": 1, "EDIT": 1, "UNLESS": 1, "YOU": 3, "ARE": 2, "SURE": 1, "THAT": 1, "KNOW": 1, "WHAT": 1, "DOING": 1, "Base": 1, "TBase": 1, "Type": 2, "TType": 5, "TMessageType": 1, "TException": 1, "TProtocolException": 1, "Protocol": 2, "TProtocol": 1, "TBinaryProtocolAccelerated": 1, "TApplicationException": 1, "PullRequest": 1, "_TSPEC": 3, "vals=": 1, "1": 1, "STRING": 3, "vals": 3, "xfer": 17, "fname": 3, "ftype": 6, "readStructBegin": 1, "readFieldBegin": 1, "STOP": 1, "readString": 1, "skip": 2, "readFieldEnd": 1, "readStructEnd": 1, "write": 1, "writeStructBegin": 1, "writeFieldBegin": 1, "writeString": 1, "writeFieldEnd": 1, "writeFieldStop": 1, "writeStructEnd": 1 }, "PLSQL": { "create": 7, "or": 8, "replace": 6, "type": 4, "myobject": 2, "AUTHID": 3, "DEFINER": 3, "AS": 4, "OBJECT": 1, "(": 69, "m_name": 1, "varchar2": 2, ")": 69, "member": 2, "function": 6, "toString": 1, "RETURN": 9, "VARCHAR2": 10, "map": 1, "Compare": 1, "return": 19, "not": 4, "instantiable": 1, "final": 1, ";": 114, "/": 10, "prompt": 1, "myarray": 2, "as": 1, "table": 2, "of": 4, "CREATE": 3, "OR": 3, "REPLACE": 3, "PACKAGE": 2, "BODY": 1, "linguistpackage": 4, "PROCEDURE": 3, "proc_1": 2, "IS": 6, "BEGIN": 6, "NULL": 3, "END": 10, "FUNCTION": 8, "function1": 2, "param1": 8, "CURSOR": 1, "c": 5, "select": 2, "*": 2, "from": 4, "dual": 1, "v": 3, "%": 1, "ROWTYPE": 1, "open": 1, "fetch": 1, "into": 1, "close": 1, "end": 25, "function2": 2, "NUMBER": 7, "DATE": 2, "SYSDATE": 1, "-": 17, "a": 2, "few": 2, "more": 2, "to": 4, "use": 2, "all": 2, "basic": 3, "SQL": 2, "types": 2, "function3": 2, "TIMESTAMP": 2, "CHAR": 2, "IF": 4, "THEN": 1, "ELSE": 1, "function4": 2, "CLOB": 2, "BLOB": 2, "null": 4, "k_constant": 1, "CONSTANT": 1, "procedure": 3, "package": 4, "plsqlguide": 4, "is": 11, "p_main": 3, "body": 2, "begin": 5, "htp.prn": 3, "for": 1, "row": 1, "in": 1, "parts": 1, "loop": 8, "||": 10, "row.pid": 1, "row.name": 1, "row.description": 1, "row.quantity": 1, "row.price": 1, "prime#": 4, "invalid_argument_error": 2, "exception": 1, "nth": 4, "i_num": 9, "pls_integer": 4, "number": 11, "t_primes": 2, "index": 1, "by": 1, "b_primes": 4, "is_prime": 3, "i_candidate": 4, "boolean": 1, "l_num": 4, "l_prime": 11, "l_result": 5, "if": 20, "<": 4, "then": 17, "false": 2, "true": 2, "ceil": 2, "+": 8, "exit": 3, "when": 4, "next": 3, "i_prime": 3, "l_next": 6, "case": 3, "mod": 1, "else": 6, "while": 2, "l_index": 7, "raise": 1, "b_primes.exists": 2, "who_called_me": 2, "owner": 2, "OUT": 4, "name": 2, "lineno": 2, "caller_t": 3, "depth": 3, "DEFAULT": 2, "based": 1, "version": 1, "asktom": 1, "call_stack": 5, "default": 1, "dbms_utility.format_call_stack": 1, "n": 17, "found_stack": 3, "BOOLEAN": 1, "FALSE": 1, "line": 17, "cnt": 4, "LOOP": 2, "instr": 2, "chr": 1, "substr": 7, "NOT": 1, "like": 6, "TRUE": 1, "to_number": 1, "set": 1, "rest": 1, "..": 1, "change": 1, "length": 5, "elsif": 4, "ltrim": 2, "rtrim": 2, "upper": 1, "nvl": 1, "LTRIM": 1, "RTRIM": 1, "SUBSTR": 1, "LINE": 1, "N": 1 }, "PLpgSQL": { "load": 12, ";": 416, "create": 71, "table": 5, "t1": 15, "(": 221, "a": 20, "int": 53, "b": 20, ")": 221, "function": 117, "f1": 148, "returns": 56, "void": 46, "as": 66, "begin": 51, "if": 78, "false": 39, "then": 41, "update": 5, "set": 5, "c": 10, "end": 100, "language": 61, "plpgsql": 53, "select": 71, "drop": 56, "g1": 35, "out": 20, "sql": 10, "declare": 36, "r": 65, "record": 26, "raise": 20, "notice": 20, "r.c": 15, "setof": 5, "*": 15, "from": 15, "for": 10, "in": 10, "loop": 20, "or": 31, "replace": 31, "+": 10, "return": 5, "[": 15, "]": 15, "type": 7, "diagnostic_info_type": 6, "status": 3, "text": 15, "message": 5, "detail": 5, "row_count": 3, "dg": 8, "NULL": 5, "dg.status": 3, "dg.mistake": 3, "_exception_type": 4, "state": 2, "_exception": 4, "exception": 2, "when": 2, "others": 2, "get": 2, "stacked": 2, "diagnostics": 2, "_exception.state": 2, "RETURNED_SQLSTATE": 2, "_exception.message": 2, "MESSAGE_TEXT": 2, "_exception.detail": 2, "PG_EXCEPTION_DETAIL": 2, "_exception.hint": 2, "PG_EXCEPTION_HINT": 2, "DROP": 2, "FUNCTION": 4, "IF": 4, "EXISTS": 2, "list_sites": 2, "CREATE": 2, "OR": 2, "REPLACE": 2, "RETURNS": 2, "TABLE": 2, "fc": 2, "json": 3, "AS": 19, "func": 4, "BEGIN": 2, "RETURN": 4, "QUERY": 4, "SELECT": 11, "row_to_json": 5, "feat_col": 2, "FROM": 10, "array_to_json": 4, "array_agg": 4, "feat": 2, "features": 1, "DISTINCT": 1, "ON": 1, "new_id": 5, "ST_ASGeoJSON": 1, "loc.geom": 1, "geometry": 1, "prop": 2, "properties": 1, "location": 1, "loc": 1, "END": 3, "LANGUAGE": 2, "get_observations": 2, "character": 1, "varying": 1, "integer": 2, "kind": 4, "varchar": 1, "site_id": 4, "THEN": 3, "obs": 6, "observation_date": 3, "date": 3, "o2_abs": 1, "value": 3, "oxygen": 3, "WHERE": 3, "ELSIF": 2, "o2_rel": 1, "temp": 1 }, "POV-Ray SDL": { "//": 9, "#version": 12, ";": 62, "#include": 21, "#declare": 57, "AreaLight": 2, "on": 22, "Radiosity": 2, "Photons": 2, "TestLight": 2, "off": 2, "show_Fog": 2, "true": 13, "show_Water": 2, "show_Terrain": 2, "show_Building": 2, "show_Table": 2, "show_TableCloth": 3, "show_Chair": 2, "show_Table_Stuff": 2, "global_settings": 2, "{": 356, "max_trace_level": 2, "assumed_gamma": 2, "#if": 28, "(": 129, ")": 129, "radiosity": 2, "pretrace_start": 2, "pretrace_end": 2, "count": 2, "nearest_count": 2, "error_bound": 2, "recursion_limit": 2, "low_error_factor": 2, "gray_threshold": 2, "minimum_reuse": 2, "brightness": 2, "adc_bailout": 2, "/2": 2, "normal": 10, "}": 355, "#end": 44, "photons": 5, "spacing": 1, "camera": 2, "location": 2, "<0.5,>": 1, "0": 88, "5": 2, "1": 9, "2": 23, "direction": 2, "y": 12, "sky": 1, "z": 19, "up": 3, "right": 2, "x*image_width/image_height": 2, "keep": 1, "propotions": 1, "with": 1, "any": 1, "aspect": 1, "ratio": 1, "look_at": 1, "<5,>": 1, "4": 6, "3": 5, "9": 1, "angle": 1, "light_source": 3, "<2,>": 1, "color": 57, "rgb": 46, "<3.0,>": 1, "6": 3, "*10000": 1, "<3.43,2.87,1.95>": 1, "area_light": 2, "*x": 16, "*y": 29, "jitter": 2, "circular": 2, "orient": 2, "reflection": 14, "refraction": 2, "fog": 1, "fog_type": 1, "fog_alt": 1, "fog_offset": 1, "rgbt": 13, "<0.60,>": 1, "68": 1, "82": 1, "distance": 1, "version": 10, "<": 31, "Mat_Glass": 3, "material": 7, "texture": 47, "pigment": 28, "finish": 22, "ambient": 22, "diffuse": 22, "specular": 18, "roughness": 13, "fresnel": 5, "conserve_energy": 5, "interior": 7, "ior": 7, "fade_distance": 4, "fade_power": 4, "fade_color": 4, "<0.4,0.4,0.4>": 1, "Mat_Liquid": 2, "<0.8,0.3,0.4>": 1, "#local": 37, "Content_Shape": 2, "merge": 4, "cylinder": 23, "*z": 52, "object": 57, "Round_Cylinder_Merge": 7, "-": 70, "Glass": 2, "union": 25, "difference": 4, "translate": 72, "torus": 13, "rotate": 59, "scale": 39, "Tex_Stone": 10, "agate": 1, "color_map": 11, "[": 63, "<0.6,0.6,0.6>": 3, "]": 63, "warp": 6, "turbulence": 10, "<0.7,0.4,0.4>": 1, "<0.3,1.2,1.2>": 1, "*0.25": 1, "//0.1": 2, "granite": 7, "Tex_Floor_A": 2, "Tex_Floor_B": 2, "<0.18,0.18,0.22>": 1, "Tex_Floor": 2, "checker": 1, "fn_Rad": 2, "function": 9, "sin": 5, "pow": 3, "abs": 6, "z*0.4": 1, "+": 23, "Small_Column_part1": 2, "isosurface": 2, "min": 2, "sqrt": 2, "x*x": 3, "y*y": 2, "x": 9, "z*2": 1, "max_gradient": 2, "//eval": 1, "accuracy": 4, "contained_by": 2, "box": 12, "Small_Column": 2, "Round_Cylinder_Union": 2, "Large_Column": 2, "Round_Box_Union": 9, "<-0.23,-0.23,-0.1>": 1, "<0.23,0.23,0.15>": 1, "<-0.20,-0.20,0.00>": 1, "<0.20,0.20,0.70>": 1, "<-0.23,-0.23,0.58>": 1, "<0.23,0.23,0.70>": 1, "<-0.26,-0.26,0.64>": 1, "<0.26,0.26,0.74>": 1, "<-0.26,-0.26,2.80>": 1, "<0.26,0.26,2.88>": 1, "Balustrade": 3, "<0.0,-0.15,0>": 1, "<5,0.15,0.1>": 1, "<0.0,-0.15,0.64>": 1, "<5,0.15,0.74>": 1, "Cnt": 8, "#while": 2, "Cnt*0.5": 1, "Walls": 2, "<-0.5,-0.5,-1>": 2, "<-2,5.5,3.2>": 1, "<5.5,-2,3.2>": 1, "Ceiling_Segment": 11, "<-0.20,-0.20,2.94>": 1, "<0.20,0.20,2.98>": 1, "<-0.14,-0.14,2.94>": 1, "<0.14,0.14,3.01>": 1, "Ceiling": 2, "<5.6,5.6,3.04>": 1, "<-2,-2,3.5>": 2, "<0.0,-0.26,3.1>": 2, "<6,0.26,2.88>": 2, "<5,5,0>": 4, "<5.0,5.0,2.95>": 1, "<4.44,4.44,0>": 1, "<4.44,3.94,0>": 1, "<3.94,4.44,0>": 1, "<3.94,3.94,0>": 1, "<4.44,3.44,0>": 1, "<3.44,4.44,0>": 1, "<3.94,3.44,0>": 1, "<3.44,3.94,0>": 1, "<4.44,2.94,0>": 1, "<2.94,4.44,0>": 1, "Base": 2, "<5.4,5.4,0>": 1, "<0,0,-1>": 1, "<6,6,-1>": 1, "<0,0,-2>": 1, "Tex_Table_Foot": 4, "metallic": 9, "Tex_Table_Foot_Bottom": 4, "Tex_Dark_Wood": 4, "bozo": 5, "<0.0,0.0,0.16>": 2, "<0.0,0.0,0.08>": 2, "<0.0,0.0,0.0>": 2, "<4,1,1>": 2, "*0.036": 2, "Chair_Tube_Rad": 8, "Chair_Tube_Curve_Rad": 8, "Chair_Leg_Angle": 5, "Chair_Leg_AngleA": 1, "Chair_Leg_Depth": 1, "Chair_Plate_Curve_Rad": 35, "Chair_Plate_Thickness": 30, "Chair_Plate_Width": 16, "Chair_Plate_UWidth": 9, "Chair_Plate_Height": 2, "Chair_Plate_UAngle": 5, "Chair_Plate_Depth": 1, "Chair_Leg": 5, "intersection": 9, "plane": 17, "<-Chair_Tube_Curve_Rad,0,0>": 1, "<-Chair_Tube_Curve_Rad,0,-Chair_Plate_Height+0.01>": 1, "Chair_Leg_Angle*y": 2, "<0,0,Chair_Tube_Curve_Rad>": 1, "": 1, "<-Chair_Tube_Curve_Rad,0,-Chair_Plate_Height-0.003>": 1, "<-Chair_Tube_Curve_Rad,0,-Chair_Plate_Height+0.025>": 1, "Chair_Leg_Depth*x": 1, "Chair_Plate_Height*cos": 3, "radians": 9, "#macro": 10, "Chair_Back": 3, "Rotate": 1, "<-Chair_Leg_Depth,>": 1, "<-0.08,>": 1, "<-4-Chair_Leg_Depth-Chair_Tube_Curve_Rad,>": 1, "Chair_Tube_Curve_Rad*z": 4, "Rotate*x": 1, "Chair_Base": 2, "Chair_Tube_Rad*2*y": 2, "Chair_Leg_AngleA*x": 2, "Chair_Plate": 2, "Chair_Plate_Width/2": 7, "Chair_Plate_Width/1.8": 2, "<0.0,>": 8, "sphere": 9, "<-Chair_Plate_Depth,>": 10, "<-Chair_Plate_Depth-Chair_Plate_Curve_Rad,>": 1, "Chair_Back_Plate": 2, "30": 2, "*Chair_Plate_Thickness": 1, "40": 2, "Chair_Plate_UAngle*x": 6, "<1,>": 3, "cos": 2, "Chair_Plate_UWidth*y": 2, "<4+Chair_Plate_Thickness,>": 8, "8": 2, "<-4-Chair_Leg_Depth-Chair_Tube_Curve_Rad+Chair_Tube_Rad,>": 1, "<2.68,3.35,0>": 1, "nx": 1, "ny": 1, "ZP": 1, "ZS": 1, "Nbr": 2, "vertex_vectors": 1, "nx*ny": 1, "<-0.35592,-0.35616,0.31541>": 1, "<-0.36168,-0.34964,0.32452>": 1, "<-0.36685,-0.34249,0.33361>": 1, "<-0.37122,-0.33488,0.34282>": 1, "<-0.37518,-0.32706,0.35207>": 1, "<-0.37935,-0.31939,0.36145>": 1, "<-0.38404,-0.31214,0.37091>": 1, "<-0.38958,-0.30556,0.38035>": 1, "<-0.39618,-0.30007,0.38972>": 1, "<-0.40374,-0.29602,0.39905>": 1, "<-0.41187,-0.29331,0.40832>": 1, "<-0.42017,-0.29123,0.41751>": 1, "<-0.42787,-0.28740,0.42664>": 1, "<-0.43451,-0.28169,0.43565>": 1, "<-0.43902,-0.27389,0.44448>": 1, "<-0.44053,-0.26456,0.45305>": 1, "<-0.43874,-0.25480,0.46126>": 1, "<-0.43422,-0.24574,0.46908>": 1, "<-0.42958,-0.23699,0.47696>": 1, "<-0.42909,-0.22709,0.48490>": 1, "<-0.43330,-0.21774,0.49266>": 1, "<-0.44198,-0.21156,0.49979>": 1, "<-0.45268,-0.20913,0.50633>": 1, "<-0.46379,-0.20937,0.51260>": 1, "<-0.47348,-0.20478,0.51937>": 1, "<-0.47923,-0.19545,0.52581>": 1, "<-0.47799,-0.18406,0.53132>": 1, "<-0.47180,-0.17392,0.53610>": 1, "<-0.46550,-0.16443,0.54096>": 1, "<-0.46576,-0.15265,0.54656>": 1, "<-0.47382,-0.14354,0.55147>": 1, "<-0.48558,-0.14027,0.55515>": 1, "<-0.49547,-0.13422,0.55978>": 1, "<-0.49992,-0.12291,0.56422>": 1, "<-0.49618,-0.11116,0.56725>": 1, "<-0.48742,-0.10196,0.56967>": 1, "<-0.48660,-0.08936,0.57326>": 1, "<-0.49360,-0.07884,0.57589>": 1, "<-0.50537,-0.07381,0.57824>": 1, "<-0.51092,-0.06250,0.58087>": 1, "<-0.50818,-0.05001,0.58201>": 1, "<-0.49857,-0.04125,0.58244>": 1, "<-0.49585,-0.02897,0.58362>": 1, "<-0.49991,-0.01714,0.58411>": 1, "<-0.50878,-0.00811,0.58500>": 1, "<-0.50917,0.00496,0.58493>": 1, "<-0.50100,0.01463,0.58383>": 1, "<-0.49548,0.02603,0.58338>": 1, "<-0.49750,0.03889,0.58227>": 1, "<-0.50716,0.04766,0.58171>": 1, "<-0.51053,0.05988,0.58096>": 1, "<-0.50521,0.07163,0.57825>": 1, "<-0.49371,0.07717,0.57564>": 1, "<-0.48643,0.08741,0.57312>": 1, "<-0.48711,0.10021,0.56953>": 1, "<-0.49587,0.10962,0.56689>": 1, "<-0.49897,0.12189,0.56376>": 1, "<-0.49345,0.13317,0.55935>": 1, "<-0.48310,0.13851,0.55496>": 1, "<-0.47196,0.14338,0.55117>": 1, "<-0.46530,0.15343,0.54635>": 1, "<-0.46665,0.16501,0.54102>": 1, "<-0.47450,0.17393,0.53636>": 1, "<-0.48025,0.18446,0.53164>": 1, "<-0.48041,0.19606,0.52600>": 1, "<-0.47361,0.20474,0.51912>": 1, "<-0.46355,0.20815,0.51218>": 1, "<-0.45236,0.20747,0.50617>": 1, "<-0.44162,0.21032,0.49972>": 1, "<-0.43343,0.21707,0.49262>": 1, "<-0.42989,0.22650,0.48483>": 1, "<-0.43100,0.23616,0.47688>": 1, "<-0.43592,0.24474,0.46926>": 1, "<-0.43998,0.25391,0.46163>": 1, "<-0.44131,0.26365,0.45360>": 1, "<-0.43940,0.27286,0.44510>": 1, "<-0.43452,0.28036,0.43621>": 1, "<-0.42766,0.28572,0.42710>": 1, "<-0.41980,0.28916,0.41798>": 1, "<-0.41135,0.29122,0.40887>": 1, "<-0.40325,0.29439,0.39964>": 1, "<-0.39597,0.29900,0.39029>": 1, "<-0.38976,0.30491,0.38085>": 1, "<-0.38464,0.31181,0.37140>": 1, "<-0.38026,0.31928,0.36195>": 1, "<-0.37639,0.32705,0.35261>": 1, "<-0.37252,0.33490,0.34333>": 1, "<-0.36800,0.34258,0.33412>": 1, "<-0.36256,0.34969,0.32503>": 1, "<-0.35644,0.35623,0.31592>": 1, "<-0.34951,-0.36255,0.32437>": 1, "<-0.35616,-0.35667,0.33347>": 1, "<-0.36217,-0.35018,0.34242>": 1, "<-0.36724,-0.34300,0.35158>": 1, "<-0.37135,-0.33528,0.36079>": 1, "<-0.37493,-0.32734,0.37012>": 1, "<-0.37875,-0.31957,0.37952>": 1, "<-0.38332,-0.31225,0.38898>": 1, "<-0.38892,-0.30576,0.39837>": 1, "<-0.39566,-0.30046,0.40774>": 1, "<-0.40332,-0.29654,0.41707>": 1, "<-0.41155,-0.29406,0.42634>": 1, "<-0.41984,-0.29171,0.43558>": 1, "<-0.42752,-0.28755,0.44477>": 1, "<-0.43384,-0.28119,0.45377>": 1, "<-0.43771,-0.27270,0.46250>": 1, "<-0.43849,-0.26305,0.47086>": 1, "<-0.43626,-0.25346,0.47882>": 1, "<-0.43118,-0.24476,0.48650>": 1, "<-0.42872,-0.23532,0.49448>": 1, "<-0.43053,-0.22537,0.50249>": 1, "<-0.43699,-0.21724,0.51004>": 1, "<-0.44664,-0.21267,0.51695>": 1, "<-0.45761,-0.21208,0.52323>": 1, "<-0.46787,-0.20924,0.53001>": 1, "<-0.47545,-0.20104,0.53687>": 1, "<-0.47675,-0.18970,0.54295>": 1, "<-0.47289,-0.17914,0.54830>": 1, "<-0.46580,-0.16986,0.55309>": 1, "<-0.46484,-0.15823,0.55854>": 1, "<-0.47140,-0.14822,0.56338>": 1, "<-0.48206,-0.14310,0.56739>": 1, "<-0.49252,-0.13769,0.57189>": 1, "<-0.49772,-0.12671,0.57641>": 1, "<-0.49530,-0.11471,0.57950>": 1, "<-0.48749,-0.10482,0.58198>": 1, "<-0.48644,-0.09237,0.58557>": 1, "<-0.49302,-0.08196,0.58825>": 1, "<-0.50350,-0.07541,0.59079>": 1, "<-0.50862,-0.06395,0.59347>": 1, "<-0.50716,-0.05131,0.59468>": 1, "<-0.49825,-0.04184,0.59509>": 1, "<-0.49560,-0.02952,0.59642>": 1, "<-0.49957,-0.01796,0.59711>": 1, "<-0.50831,-0.00793,0.59824>": 1, "<-0.50783,0.00469,0.59826>": 1, "<-0.50020,0.01487,0.59715>": 1, "<-0.49605,0.02666,0.59635>": 1, "<-0.49758,0.03948,0.59513>": 1, "<-0.50585,0.04934,0.59452>": 1, "<-0.50824,0.06187,0.59357>": 1, "<-0.50304,0.07327,0.59056>": 1, "<-0.49258,0.08023,0.58806>": 1, "<-0.48645,0.09137,0.58532>": 1, "<-0.48756,0.10360,0.58180>": 1, "<-0.49512,0.11356,0.57919>": 1, "<-0.49676,0.12578,0.57588>": 1, "<-0.49075,0.13636,0.57134>": 1, "<-0.47986,0.14129,0.56728>": 1, "<-0.47009,0.14791,0.56301>": 1, "<-0.46512,0.15882,0.55784>": 1, "<-0.46722,0.17017,0.55245>": 1, "<-0.47505,0.17930,0.54805>": 1, "<-0.47838,0.19036,0.54290>": 1, "<-0.47590,0.20144,0.53690>": 1, "<-0.46778,0.20873,0.53011>": 1, "<-0.45733,0.21038,0.52357>": 1, "<-0.44644,0.21122,0.51737>": 1, "<-0.43674,0.21619,0.51046>": 1, "<-0.43089,0.22472,0.50288>": 1, "<-0.42962,0.23461,0.49482>": 1, "<-0.43269,0.24385,0.48689>": 1, "<-0.43745,0.25266,0.47921>": 1, "<-0.43928,0.26218,0.47122>": 1, "<-0.43811,0.27162,0.46283>": 1, "<-0.43389,0.27980,0.45414>": 1, "<-0.42734,0.28590,0.44514>": 1, "<-0.41956,0.28983,0.43601>": 1, "<-0.41119,0.29195,0.42691>": 1, "<-0.40303,0.29486,0.41769>": 1, "<-0.39551,0.29922,0.40836>": 1, "<-0.38903,0.30504,0.39894>": 1, "<-0.38384,0.31193,0.38952>": 1, "<-0.37968,0.31950,0.38011>": 1, "<-0.37614,0.32737,0.37067>": 1, "<-0.37274,0.33533,0.36132>": 1, "<-0.36853,0.34299,0.35201>": 1, "<-0.36322,0.35010,0.34286>": 1, "<-0.35692,0.35650,0.33392>": 1, "<-0.34999,0.36226,0.32517>": 1, "<-0.34261,-0.36819,0.33344>": 1, "<-0.34999,-0.36317,0.34233>": 1, "<-0.35691,-0.35745,0.35134>": 1, "<-0.36285,-0.35089,0.36045>": 1, "<-0.36768,-0.34356,0.36965>": 1, "<-0.37132,-0.33566,0.37897>": 1, "<-0.37430,-0.32757,0.38829>": 1, "<-0.37789,-0.31970,0.39772>": 1, "<-0.38240,-0.31235,0.40708>": 1, "<-0.38819,-0.30587,0.41653>": 1, "<-0.39522,-0.30073,0.42593>": 1, "<-0.40306,-0.29706,0.43530>": 1, "<-0.41157,-0.29511,0.44455>": 1, "<-0.41989,-0.29237,0.45378>": 1, "<-0.42745,-0.28751,0.46289>": 1, "<-0.43338,-0.28039,0.47186>": 1, "<-0.43652,-0.27140,0.48047>": 1, "<-0.43645,-0.26166,0.48866>": 1, "<-0.43369,-0.25232,0.49657>": 1, "<-0.42918,-0.24343,0.50452>": 1, "<-0.42894,-0.23361,0.51260>": 1, "<-0.43291,-0.22414,0.52048>": 1, "<-0.44114,-0.21740,0.52754>": 1, "<-0.45119,-0.21408,0.53434>": 1, "<-0.46216,-0.21313,0.54076>": 1, "<-0.47069,-0.20674,0.54753>": 1, "<-0.47482,-0.19633,0.55383>": 1, "<-0.47303,-0.18494,0.55937>": 1, "<-0.46655,-0.17517,0.56424>": 1, "<-0.46449,-0.16404,0.56984>": 1, "<-0.46955,-0.15341,0.57492>": 1, "<-0.47854,-0.14614,0.57937>": 1, "<-0.48915,-0.14087,0.58374>": 1, "<-0.49505,-0.13057,0.58827>": 1, "<-0.49414,-0.11839,0.59170>": 1, "<-0.48767,-0.10792,0.59446>": 1, "<-0.48676,-0.09573,0.59819>": 1, "<-0.49271,-0.08515,0.60082>": 1, "<-0.50072,-0.07676,0.60323>": 1, "<-0.50605,-0.06558,0.60627>": 1, "<-0.50390,-0.05321,0.60722>": 1, "<-0.49833,-0.04262,0.60817>": 1, "<-0.49911,-0.03043,0.60923>": 1, "<-0.49970,-0.01837,0.60969>": 1, "<-0.50570,-0.00748,0.61113>": 1, "<-0.50550,0.00491,0.61133>": 1, "<-0.50004,0.01559,0.61021>": 1, "<-0.49925,0.02806,0.60906>": 1, "<-0.49839,0.04022,0.60791>": 1, "<-0.50348,0.05149,0.60709>": 1, "<-0.50549,0.06367,0.60583>": 1, "<-0.50052,0.07469,0.60313>": 1, "<-0.49294,0.08381,0.60054>": 1, "<-0.48687,0.09441,0.59780>": 1, "<-0.48811,0.10674,0.59440>": 1, "<-0.49384,0.11744,0.59178>": 1, "<-0.49403,0.12957,0.58870>": 1, "<-0.48777,0.13955,0.58376>": 1, "<-0.47735,0.14504,0.57932>": 1, "<-0.46857,0.15297,0.57461>": 1, "<-0.46506,0.16416,0.56962>": 1, "<-0.46802,0.17507,0.56412>": 1, "<-0.47457,0.18458,0.55944>": 1, "<-0.47593,0.19613,0.55392>": 1, "<-0.47114,0.20616,0.54762>": 1, "<-0.46212,0.21205,0.54065>": 1, "<-0.45105,0.21251,0.53462>": 1, "<-0.44100,0.21610,0.52796>": 1, "<-0.43299,0.22317,0.52069>": 1, "<-0.42947,0.23270,0.51285>": 1, "<-0.43016,0.24258,0.50482>": 1, "<-0.43502,0.25152,0.49701>": 1, "<-0.43738,0.26094,0.48898>": 1, "<-0.43697,0.27062,0.48079>": 1, "<-0.43342,0.27929,0.47210>": 1, "<-0.42735,0.28603,0.46332>": 1, "<-0.41968,0.29054,0.45416>": 1, "<-0.41123,0.29303,0.44510>": 1, "<-0.40283,0.29544,0.43586>": 1, "<-0.39512,0.29954,0.42649>": 1, "<-0.38838,0.30511,0.41705>": 1, "<-0.38301,0.31195,0.40760>": 1, "<-0.37888,0.31956,0.39823>": 1, "<-0.37569,0.32757,0.38884>": 1, "<-0.37286,0.33581,0.37947>": 1, "<-0.36906,0.34362,0.37012>": 1, "<-0.36398,0.35086,0.36085>": 1, "<-0.35773,0.35728,0.35181>": 1, "<-0.35060,0.36276,0.34299>": 1, "<-0.34300,0.36758,0.33433>": 1, "<-0.33512,-0.37291,0.34274>": 1, "<-0.34307,-0.36875,0.35143>": 1, "<-0.35075,-0.36391,0.36039>": 1, "<-0.35762,-0.35821,0.36947>": 1, "<-0.36345,-0.35150,0.37862>": 1, "<-0.36804,-0.34399,0.38793>": 1, "<-0.37130,-0.33596,0.39728>": 1, "<-0.37398,-0.32773,0.40673>": 1, "<-0.37734,-0.31980,0.41617>": 1, "<-0.38190,-0.31239,0.42559>": 1, "<-0.38785,-0.30598,0.43500>": 1, "<-0.39507,-0.30098,0.44441>": 1, "<-0.40310,-0.29753,0.45376>": 1, "<-0.41171,-0.29555,0.46302>": 1, "<-0.41998,-0.29227,0.47214>": 1, "<-0.42730,-0.28684,0.48116>": 1, "<-0.43265,-0.27918,0.49005>": 1, "<-0.43500,-0.26993,0.49849>": 1, "<-0.43458,-0.26024,0.50672>": 1, "<-0.43133,-0.25103,0.51467>": 1, "<-0.42878,-0.24164,0.52270>": 1, "<-0.43030,-0.23180,0.53073>": 1, "<-0.43620,-0.22318,0.53822>": 1, "<-0.44535,-0.21761,0.54516>": 1, "<-0.45603,-0.21582,0.55156>": 1, "<-0.46540,-0.21132,0.55836>": 1, "<-0.47150,-0.20236,0.56486>": 1, "<-0.47213,-0.19092,0.57077>": 1, "<-0.46801,-0.18031,0.57589>": 1, "<-0.46492,-0.16960,0.58145>": 1, "<-0.46839,-0.15875,0.58699>": 1, "<-0.47571,-0.14994,0.59158>": 1, "<-0.48568,-0.14380,0.59596>": 1, "<-0.49176,-0.13401,0.60062>": 1, "<-0.49228,-0.12212,0.60420>": 1, "<-0.48767,-0.11098,0.60713>": 1, "<-0.49001,-0.09966,0.61069>": 1, "<-0.49217,-0.08821,0.61352>": 1, "<-0.49897,-0.07872,0.61652>": 1, "<-0.50307,-0.06720,0.61914>": 1, "<-0.50192,-0.05495,0.62052>": 1, "<-0.49817,-0.04339,0.62116>": 1, "<-0.49904,-0.03132,0.62245>": 1, "<-0.49963,-0.01942,0.62313>": 1, "<-0.50295,-0.00757,0.62359>": 1, "<-0.50341,0.00465,0.62328>": 1, "<-0.49998,0.01627,0.62218>": 1, "<-0.49918,0.02890,0.62208>": 1, "<-0.49852,0.04114,0.62081>": 1, "<-0.50117,0.05310,0.62000>": 1, "<-0.50216,0.06529,0.61862>": 1, "<-0.49776,0.07642,0.61594>": 1, "<-0.49242,0.08679,0.61323>": 1, "<-0.49029,0.09827,0.61038>": 1, "<-0.48829,0.10945,0.60656>": 1, "<-0.49185,0.12070,0.60345>": 1, "<-0.49116,0.13260,0.59979>": 1, "<-0.48414,0.14236,0.59485>": 1, "<-0.47498,0.14909,0.59100>": 1, "<-0.46766,0.15835,0.58656>": 1, "<-0.46545,0.16965,0.58137>": 1, "<-0.46976,0.18012,0.57638>": 1, "<-0.47337,0.19069,0.57140>": 1, "<-0.47231,0.20186,0.56568>": 1, "<-0.46553,0.21044,0.55901>": 1, "<-0.45570,0.21443,0.55214>": 1, "<-0.44516,0.21641,0.54563>": 1, "<-0.43625,0.22227,0.53857>": 1, "<-0.43073,0.23098,0.53104>": 1, "<-0.42948,0.24076,0.52301>": 1, "<-0.43256,0.25006,0.51513>": 1, "<-0.43559,0.25945,0.50714>": 1, "<-0.43575,0.26924,0.49895>": 1, "<-0.43286,0.27839,0.49030>": 1, "<-0.42711,0.28562,0.48149>": 1, "<-0.41973,0.29068,0.47253>": 1, "<-0.41139,0.29357,0.46336>": 1, "<-0.40290,0.29585,0.45423>": 1, "<-0.39505,0.29979,0.44488>": 1, "<-0.38809,0.30522,0.43545>": 1, "<-0.38253,0.31205,0.42601>": 1, "<-0.37837,0.31971,0.41660>": 1, "<-0.37535,0.32789,0.40722>": 1, "<-0.37290,0.33619,0.39777>": 1, "<-0.36944,0.34422,0.38838>": 1, "<-0.36465,0.35157,0.37903>": 1, "<-0.35855,0.35807,0.36988>": 1, "<-0.35139,0.36355,0.36096>": 1, "<-0.34358,0.36805,0.35220>": 1, "<-0.33543,0.37201,0.34358>": 1, "<-0.32728,-0.37687,0.35198>": 1, "<-0.33557,-0.37325,0.36075>": 1, "<-0.34379,-0.36928,0.36963>": 1, "<-0.35146,-0.36458,0.37861>": 1, "<-0.35834,-0.35881,0.38772>": 1, "<-0.36399,-0.35196,0.39702>": 1, "<-0.36826,-0.34433,0.40643>": 1, "<-0.37122,-0.33622,0.41588>": 1, "<-0.37365,-0.32794,0.42539>": 1, "<-0.37698,-0.31993,0.43481>": 1, "<-0.38158,-0.31250,0.44426>": 1, "<-0.38773,-0.30613,0.45374>": 1, "<-0.39511,-0.30125,0.46311>": 1, "<-0.40327,-0.29794,0.47244>": 1, "<-0.41187,-0.29572,0.48161>": 1, "<-0.41992,-0.29192,0.49074>": 1, "<-0.42680,-0.28586,0.49978>": 1, "<-0.43155,-0.27783,0.50855>": 1, "<-0.43340,-0.26841,0.51692>": 1, "<-0.43289,-0.25874,0.52505>": 1, "<-0.42990,-0.24938,0.53310>": 1, "<-0.42938,-0.23972,0.54111>": 1, "<-0.43278,-0.23030,0.54887>": 1, "<-0.44008,-0.22275,0.55610>": 1, "<-0.44943,-0.21815,0.56289>": 1, "<-0.45959,-0.21486,0.56970>": 1, "<-0.46713,-0.20748,0.57648>": 1, "<-0.46975,-0.19661,0.58254>": 1, "<-0.46868,-0.18556,0.58789>": 1, "<-0.46551,-0.17475,0.59334>": 1, "<-0.46777,-0.16401,0.59895>": 1, "<-0.47524,-0.15545,0.60359>": 1, "<-0.48160,-0.14664,0.60830>": 1, "<-0.48819,-0.13744,0.61308>": 1, "<-0.48955,-0.12583,0.61673>": 1, "<-0.48769,-0.11412,0.61988>": 1, "<-0.48937,-0.10262,0.62355>": 1, "<-0.49165,-0.09106,0.62656>": 1, "<-0.49498,-0.07998,0.62922>": 1, "<-0.49804,-0.06868,0.63165>": 1, "<-0.49678,-0.05687,0.63279>": 1, "<-0.49805,-0.04438,0.63452>": 1, "<-0.49900,-0.03229,0.63572>": 1, "<-0.49964,-0.02002,0.63617>": 1, "<-0.49997,-0.00761,0.63642>": 1, "<-0.49999,0.00504,0.63623>": 1, "<-0.49972,0.01746,0.63585>": 1, "<-0.49914,0.02987,0.63526>": 1, "<-0.49824,0.04216,0.63430>": 1, "<-0.49704,0.05433,0.63288>": 1, "<-0.49726,0.06649,0.63117>": 1, "<-0.49456,0.07809,0.62870>": 1, "<-0.49191,0.08962,0.62627>": 1, "<-0.48966,0.10123,0.62323>": 1, "<-0.48858,0.11276,0.61936>": 1, "<-0.48925,0.12393,0.61591>": 1, "<-0.48731,0.13563,0.61191>": 1, "<-0.48060,0.14553,0.60724>": 1, "<-0.47539,0.15501,0.60327>": 1, "<-0.46748,0.16362,0.59874>": 1, "<-0.46614,0.17470,0.59324>": 1, "<-0.47010,0.18544,0.58830>": 1, "<-0.47086,0.19670,0.58293>": 1, "<-0.46740,0.20722,0.57712>": 1, "<-0.45966,0.21413,0.57031>": 1, "<-0.44939,0.21670,0.56346>": 1, "<-0.44027,0.22170,0.55655>": 1, "<-0.43311,0.22931,0.54922>": 1, "<-0.42991,0.23887,0.54161>": 1, "<-0.43089,0.24857,0.53346>": 1, "<-0.43387,0.25782,0.52553>": 1, "<-0.43428,0.26750,0.51732>": 1, "<-0.43213,0.27696,0.50886>": 1, "<-0.42693,0.28486,0.49990>": 1, "<-0.41979,0.29049,0.49097>": 1, "<-0.41160,0.29388,0.48185>": 1, "<-0.40306,0.29631,0.47269>": 1, "<-0.39506,0.30012,0.46347>": 1, "<-0.38797,0.30542,0.45408>": 1, "<-0.38225,0.31216,0.44460>": 1, "<-0.37804,0.31989,0.43508>": 1, "<-0.37511,0.32800,0.42570>": 1, "<-0.37283,0.33642,0.41628>": 1, "<-0.36970,0.34451,0.40683>": 1, "<-0.36517,0.35211,0.39748>": 1, "<-0.35926,0.35878,0.38820>": 1, "<-0.35211,0.36426,0.37915>": 1, "<-0.34420,0.36869,0.37026>": 1, "<-0.33595,0.37227,0.36152>": 1, "<-0.32759,0.37569,0.35283>": 1, "<-0.31944,-0.38059,0.36139>": 1, "<-0.32767,-0.37680,0.37009>": 1, "<-0.33616,-0.37349,0.37897>": 1, "<-0.34436,-0.36975,0.38787>": 1, "<-0.35210,-0.36508,0.39696>": 1, "<-0.35885,-0.35926,0.40623>": 1, "<-0.36430,-0.35228,0.41566>": 1, "<-0.36834,-0.34457,0.42510>": 1, "<-0.37111,-0.33637,0.43466>": 1, "<-0.37346,-0.32803,0.44413>": 1, "<-0.37678,-0.31999,0.45357>": 1, "<-0.38155,-0.31251,0.46313>": 1, "<-0.38782,-0.30630,0.47258>": 1, "<-0.39530,-0.30156,0.48195>": 1, "<-0.40354,-0.29820,0.49120>": 1, "<-0.41202,-0.29552,0.50032>": 1, "<-0.41982,-0.29104,0.50947>": 1, "<-0.42620,-0.28453,0.51850>": 1, "<-0.43033,-0.27615,0.52718>": 1, "<-0.43199,-0.26671,0.53553>": 1, "<-0.43151,-0.25709,0.54357>": 1, "<-0.42961,-0.24747,0.55160>": 1, "<-0.43097,-0.23786,0.55946>": 1, "<-0.43621,-0.22911,0.56707>": 1, "<-0.44403,-0.22246,0.57391>": 1, "<-0.45340,-0.21803,0.58053>": 1, "<-0.46165,-0.21181,0.58753>": 1, "<-0.46631,-0.20182,0.59395>": 1, "<-0.46698,-0.19066,0.59966>": 1, "<-0.46632,-0.18044,0.60555>": 1, "<-0.47011,-0.17039,0.61095>": 1, "<-0.47368,-0.16015,0.61598>": 1, "<-0.47807,-0.15001,0.62072>": 1, "<-0.48348,-0.14020,0.62552>": 1, "<-0.48513,-0.12888,0.62946>": 1, "<-0.48604,-0.11736,0.63289>": 1, "<-0.48868,-0.10585,0.63620>": 1, "<-0.49108,-0.09405,0.63907>": 1, "<-0.49338,-0.08213,0.64161>": 1, "<-0.49508,-0.07000,0.64416>": 1, "<-0.49570,-0.05812,0.64582>": 1, "<-0.49799,-0.04567,0.64752>": 1, "<-0.49547,-0.03807,0.65000>": 1, "<-0.49974,-0.02057,0.64931>": 1, "<-0.50010,-0.00779,0.64950>": 1, "<-0.50011,0.00525,0.64938>": 1, "<-0.49980,0.01800,0.64897>": 1, "<-0.49916,0.03069,0.64825>": 1, "<-0.49818,0.04328,0.64717>": 1, "<-0.49690,0.05578,0.64570>": 1, "<-0.49533,0.06821,0.64377>": 1, "<-0.49370,0.08053,0.64134>": 1, "<-0.49135,0.09261,0.63880>": 1, "<-0.48898,0.10449,0.63593>": 1, "<-0.48648,0.11559,0.63249>": 1, "<-0.48455,0.12688,0.62886>": 1, "<-0.48232,0.13815,0.62461>": 1, "<-0.47751,0.14887,0.62014>": 1, "<-0.47388,0.15956,0.61564>": 1, "<-0.47032,0.16979,0.61092>": 1, "<-0.46643,0.18016,0.60584>": 1, "<-0.46840,0.19125,0.60053>": 1, "<-0.46700,0.20186,0.59495>": 1, "<-0.46205,0.21119,0.58844>": 1, "<-0.45356,0.21692,0.58132>": 1, "<-0.44430,0.22127,0.57473>": 1, "<-0.43658,0.22817,0.56740>": 1, "<-0.43142,0.23695,0.55987>": 1, "<-0.43042,0.24661,0.55198>": 1, "<-0.43246,0.25614,0.54397>": 1, "<-0.43281,0.26578,0.53587>": 1, "<-0.43107,0.27522,0.52755>": 1, "<-0.42657,0.28359,0.51879>": 1, "<-0.41978,0.28989,0.50966>": 1, "<-0.41179,0.29396,0.50053>": 1, "<-0.40334,0.29666,0.49133>": 1, "<-0.39532,0.30039,0.48214>": 1, "<-0.38809,0.30562,0.47281>": 1, "<-0.38222,0.31223,0.46336>": 1, "<-0.37791,0.31991,0.45387>": 1, "<-0.37488,0.32820,0.44433>": 1, "<-0.37269,0.33658,0.43495>": 1, "<-0.36972,0.34478,0.42547>": 1, "<-0.36546,0.35238,0.41606>": 1, "<-0.35976,0.35917,0.40673>": 1, "<-0.35271,0.36477,0.39751>": 1, "<-0.34481,0.36913,0.38854>": 1, "<-0.33639,0.37255,0.37965>": 1, "<-0.32791,0.37562,0.37089>": 1, "<-0.31970,0.37926,0.36216>": 1, "<-0.31193,-0.38467,0.37085>": 1, "<-0.31982,-0.38014,0.37948>": 1, "<-0.32812,-0.37651,0.38827>": 1, "<-0.33663,-0.37360,0.39721>": 1, "<-0.34486,-0.37003,0.40634>": 1, "<-0.35247,-0.36542,0.41559>": 1, "<-0.35912,-0.35951,0.42498>": 1, "<-0.36438,-0.35251,0.43438>": 1, "<-0.36829,-0.34471,0.44397>": 1, "<-0.37095,-0.33649,0.45357>": 1, "<-0.37332,-0.32814,0.46303>": 1, "<-0.37682,-0.32001,0.47263>": 1, "<-0.38171,-0.31273,0.48217>": 1, "<-0.38813,-0.30666,0.49162>": 1, "<-0.39574,-0.30189,0.50104>": 1, "<-0.40389,-0.29836,0.51022>": 1, "<-0.41208,-0.29505,0.51935>": 1, "<-0.41941,-0.28995,0.52848>": 1, "<-0.42528,-0.28292,0.53748>": 1, "<-0.42901,-0.27436,0.54607>": 1, "<-0.43064,-0.26491,0.55430>": 1, "<-0.43057,-0.25519,0.56235>": 1, "<-0.43060,-0.24564,0.57031>": 1, "<-0.43382,-0.23644,0.57824>": 1, "<-0.44009,-0.22847,0.58541>": 1, "<-0.44768,-0.22193,0.59193>": 1, "<-0.45573,-0.21548,0.59873>": 1, "<-0.46129,-0.20670,0.60562>": 1, "<-0.46406,-0.19639,0.61173>": 1, "<-0.46535,-0.18531,0.61752>": 1, "<-0.46832,-0.17520,0.62348>": 1, "<-0.47205,-0.16491,0.62860>": 1, "<-0.47561,-0.15429,0.63332>": 1, "<-0.47918,-0.14345,0.63764>": 1, "<-0.48222,-0.13217,0.64168>": 1, "<-0.48528,-0.12059,0.64552>": 1, "<-0.48816,-0.10875,0.64905>": 1, "<-0.49046,-0.09663,0.65269>": 1, "<-0.49114,-0.08409,0.65612>": 1, "<-0.49066,-0.07126,0.65851>": 1, "<-0.48965,-0.05870,0.65975>": 1, "<-0.48898,-0.04581,0.66014>": 1, "<-0.48896,-0.03290,0.66019>": 1, "<-0.48919,-0.02023,0.66019>": 1, "<-0.48936,-0.00753,0.66019>": 1, "<-0.48948,0.00537,0.66018>": 1, "<-0.48959,0.01813,0.66019>": 1, "<-0.48984,0.03092,0.66018>": 1, "<-0.49029,0.04375,ZP>": 1, "<-0.49093,0.05665,0.65939>": 1, "<-0.49161,0.06961,0.65799>": 1, "<-0.49181,0.08251,0.65554>": 1, "<-0.49085,0.09518,0.65221>": 1, "<-0.48845,0.10742,0.64873>": 1, "<-0.48561,0.11928,0.64526>": 1, "<-0.48261,0.13076,0.64137>": 1, "<-0.47937,0.14226,0.63656>": 1, "<-0.47591,0.15338,0.63304>": 1, "<-0.47234,0.16407,0.62844>": 1, "<-0.46860,0.17444,0.62347>": 1, "<-0.46625,0.18520,0.61812>": 1, "<-0.46513,0.19620,0.61269>": 1, "<-0.46213,0.20645,0.60688>": 1, "<-0.45612,0.21477,0.60006>": 1, "<-0.44800,0.22092,0.59290>": 1, "<-0.44044,0.22758,0.58602>": 1, "<-0.43433,0.23564,0.57858>": 1, "<-0.43135,0.24466,0.57063>": 1, "<-0.43151,0.25414,0.56266>": 1, "<-0.43148,0.26380,0.55456>": 1, "<-0.42976,0.27336,0.54629>": 1, "<-0.42593,0.28193,0.53763>": 1, "<-0.41975,0.28875,0.52860>": 1, "<-0.41213,0.29354,0.51940>": 1, "<-0.40375,0.29686,0.51027>": 1, "<-0.39566,0.30074,0.50109>": 1, "<-0.38834,0.30592,0.49181>": 1, "<-0.38233,0.31244,0.48234>": 1, "<-0.37790,0.31996,0.47280>": 1, "<-0.37484,0.32806,0.46327>": 1, "<-0.37255,0.33652,0.45377>": 1, "<-0.36969,0.34475,0.44440>": 1, "<-0.36551,0.35253,0.43488>": 1, "<-0.35995,0.35939,0.42547>": 1, "<-0.35308,0.36502,0.41615>": 1, "<-0.34520,0.36939,0.40698>": 1, "<-0.33685,0.37264,0.39800>": 1, "<-0.32815,0.37522,0.38906>": 1, "<-0.31986,0.37882,0.38029>": 1, "<-0.31202,0.38330,0.37156>": 1, "<-0.30487,-0.38940,0.38033>": 1, "<-0.31217,-0.38402,0.38890>": 1, "<-0.32003,-0.37941,0.39770>": 1, "<-0.32843,-0.37627,0.40667>": 1, "<-0.33695,-0.37364,0.41583>": 1, "<-0.34507,-0.37022,0.42505>": 1, "<-0.35264,-0.36560,0.43445>": 1, "<-0.35913,-0.35971,0.44387>": 1, "<-0.36434,-0.35260,0.45347>": 1, "<-0.36814,-0.34477,0.46310>": 1, "<-0.37081,-0.33652,0.47256>": 1, "<-0.37340,-0.32810,0.48220>": 1, "<-0.37704,-0.32021,0.49187>": 1, "<-0.38215,-0.31306,0.50140>": 1, "<-0.38874,-0.30702,0.51085>": 1, "<-0.39630,-0.30219,0.52021>": 1, "<-0.40420,-0.29836,0.52941>": 1, "<-0.41196,-0.29428,0.53860>": 1, "<-0.41885,-0.28849,0.54776>": 1, "<-0.42415,-0.28111,0.55658>": 1, "<-0.42757,-0.27235,0.56503>": 1, "<-0.42952,-0.26278,0.57330>": 1, "<-0.43053,-0.25325,0.58133>": 1, "<-0.43263,-0.24384,0.58930>": 1, "<-0.43724,-0.23519,0.59686>": 1, "<-0.44490,-0.22823,0.60407>": 1, "<-0.45040,-0.21970,0.61035>": 1, "<-0.45563,-0.21098,0.61733>": 1, "<-0.45915,-0.20089,0.62353>": 1, "<-0.46247,-0.19014,0.62959>": 1, "<-0.46640,-0.18024,0.63556>": 1, "<-0.47035,-0.16971,0.64072>": 1, "<-0.47423,-0.15868,0.64568>": 1, "<-0.47802,-0.14731,0.65053>": 1, "<-0.47989,-0.13516,0.65581>": 1, "<-0.47905,-0.12225,0.65935>": 1, "<-0.47762,-0.10922,0.66021>": 1, "<-0.47707,-0.09643,0.66009>": 1, "<-0.47658,-0.08380,ZP>": 1, "<-0.47617,-0.07110,ZP>": 1, "<-0.47550,-0.05853,0.66008>": 1, "<-0.47542,-0.04559,ZP>": 1, "<-0.47567,-0.03261,ZP>": 1, "<-0.47599,-0.01988,ZP>": 1, "<-0.47619,-0.00722,ZP>": 1, "<-0.47630,0.00553,ZP>": 1, "<-0.47637,0.01826,ZP>": 1, "<-0.47645,0.03102,ZP>": 1, "<-0.47658,0.04382,ZP>": 1, "<-0.47681,0.05665,ZP>": 1, "<-0.47711,0.06947,ZP>": 1, "<-0.47743,0.08226,ZP>": 1, "<-0.47778,0.09507,0.66011>": 1, "<-0.47822,0.10798,0.66024>": 1, "<-0.47954,0.12114,0.65932>": 1, "<-0.48039,0.13420,0.65562>": 1, "<-0.47423,0.14634,0.65034>": 1, "<-0.47463,0.15756,0.64558>": 1, "<-0.47072,0.16870,0.64073>": 1, "<-0.46679,0.17931,0.63557>": 1, "<-0.46280,0.18946,0.62975>": 1, "<-0.46054,0.20014,0.62408>": 1, "<-0.45696,0.21031,0.61802>": 1, "<-0.45072,0.21858,0.61144>": 1, "<-0.44534,0.22738,0.60439>": 1, "<-0.43768,0.23448,0.59757>": 1, "<-0.43321,0.24304,0.58974>": 1, "<-0.43140,0.25231,0.58156>": 1, "<-0.43038,0.26166,0.57338>": 1, "<-0.42840,0.27113,0.56527>": 1, "<-0.42480,0.28005,0.55669>": 1, "<-0.41925,0.28738,0.54781>": 1, "<-0.41216,0.29288,0.53870>": 1, "<-0.40419,0.29690,0.52945>": 1, "<-0.39631,0.30100,0.52022>": 1, "<-0.38896,0.30617,0.51092>": 1, "<-0.38273,0.31258,0.50158>": 1, "<-0.37804,0.32002,0.49211>": 1, "<-0.37478,0.32807,0.48253>": 1, "<-0.37239,0.33643,0.47293>": 1, "<-0.36953,0.34470,0.46340>": 1, "<-0.36548,0.35246,0.45397>": 1, "<-0.35999,0.35943,0.44444>": 1, "<-0.35322,0.36511,0.43499>": 1, "<-0.34551,0.36944,0.42567>": 1, "<-0.33715,0.37260,0.41647>": 1, "<-0.32855,0.37496,0.40745>": 1, "<-0.31999,0.37798,0.39846>": 1, "<-0.31208,0.38259,0.38969>": 1, "<-0.30480,0.38814,0.38100>": 1, "<-0.29858,-0.39519,0.38977>": 1, "<-0.30503,-0.38876,0.39832>": 1, "<-0.31225,-0.38314,0.40710>": 1, "<-0.32023,-0.37891,0.41612>": 1, "<-0.32864,-0.37605,0.42530>": 1, "<-0.33709,-0.37361,0.43449>": 1, "<-0.34525,-0.37021,0.44390>": 1, "<-0.35270,-0.36561,0.45342>": 1, "<-0.35912,-0.35962,0.46303>": 1, "<-0.36420,-0.35249,0.47273>": 1, "<-0.36796,-0.34463,0.48229>": 1, "<-0.37078,-0.33634,0.49195>": 1, "<-0.37362,-0.32814,0.50164>": 1, "<-0.37756,-0.32039,0.51121>": 1, "<-0.38290,-0.31341,0.52071>": 1, "<-0.38958,-0.30742,0.53024>": 1, "<-0.39691,-0.30250,0.53958>": 1, "<-0.40446,-0.29816,0.54882>": 1, "<-0.41173,-0.29317,0.55807>": 1, "<-0.41797,-0.28675,0.56712>": 1, "<-0.42286,-0.27885,0.57587>": 1, "<-0.42631,-0.26981,0.58428>": 1, "<-0.42873,-0.26052,0.59236>": 1, "<-0.43215,-0.25152,0.60053>": 1, "<-0.43697,-0.24308,0.60818>": 1, "<-0.44177,-0.23424,0.61565>": 1, "<-0.44657,-0.22492,0.62255>": 1, "<-0.45173,-0.21437,0.62884>": 1, "<-0.45603,-0.20511,0.63477>": 1, "<-0.46011,-0.19582,0.64202>": 1, "<-0.46462,-0.18520,0.64785>": 1, "<-0.46822,-0.17383,0.65431>": 1, "<-0.46738,-0.16076,0.65947>": 1, "<-0.46582,-0.14751,0.66019>": 1, "<-0.46519,-0.13460,0.66007>": 1, "<-0.46474,-0.12182,ZP>": 1, "<-0.46441,-0.10907,ZP>": 1, "<-0.46417,-0.09639,ZP>": 1, "<-0.46393,-0.08381,ZP>": 1, "<-0.46366,-0.07118,ZP>": 1, "<-0.46337,-0.05837,ZP>": 1, "<-0.46318,-0.04549,ZP>": 1, "<-0.46310,-0.03262,ZP>": 1, "<-0.46313,-0.01977,ZP>": 1, "<-0.46323,-0.00700,ZP>": 1, "<-0.46336,0.00574,ZP>": 1, "<-0.46351,0.01851,ZP>": 1, "<-0.46370,0.03132,ZP>": 1, "<-0.46396,0.04414,ZP>": 1, "<-0.46426,0.05695,ZP>": 1, "<-0.46454,0.06970,ZP>": 1, "<-0.46473,0.08238,ZP>": 1, "<-0.46484,0.09507,ZP>": 1, "<-0.46497,0.10785,ZP>": 1, "<-0.46512,0.12061,ZP>": 1, "<-0.46543,0.13347,0.66012>": 1, "<-0.46597,0.14643,0.66028>": 1, "<-0.46768,0.15969,0.65958>": 1, "<-0.46861,0.17279,0.65439>": 1, "<-0.46496,0.18439,0.64801>": 1, "<-0.46055,0.19486,0.64220>": 1, "<-0.45612,0.20487,0.63608>": 1, "<-0.45167,0.21451,0.62958>": 1, "<-0.44692,0.22426,0.62343>": 1, "<-0.44229,0.23330,0.61633>": 1, "<-0.43758,0.24205,0.60874>": 1, "<-0.43264,0.25067,0.60072>": 1, "<-0.42949,0.25948,0.59262>": 1, "<-0.42697,0.26882,0.58433>": 1, "<-0.42357,0.27772,0.57604>": 1, "<-0.41857,0.28550,0.56721>": 1, "<-0.41209,0.29182,0.55812>": 1, "<-0.40465,0.29669,0.54895>": 1, "<-0.39703,0.30128,0.53960>": 1, "<-0.38981,0.30649,0.53030>": 1, "<-0.38342,0.31281,0.52093>": 1, "<-0.37842,0.32008,0.51153>": 1, "<-0.37483,0.32803,0.50200>": 1, "<-0.37220,0.33628,0.49237>": 1, "<-0.36932,0.34446,0.48276>": 1, "<-0.36533,0.35226,0.47313>": 1, "<-0.36001,0.35922,0.46359>": 1, "<-0.35328,0.36502,0.45402>": 1, "<-0.34561,0.36941,0.44451>": 1, "<-0.33740,0.37249,0.43516>": 1, "<-0.32880,0.37472,0.42587>": 1, "<-0.32031,0.37749,0.41681>": 1, "<-0.31219,0.38167,0.40785>": 1, "<-0.30492,0.38740,0.39916>": 1, "<-0.29852,0.39412,0.39046>": 1, "<-0.29348,-0.40212,0.39912>": 1, "<-0.29880,-0.39471,0.40772>": 1, "<-0.30508,-0.38798,0.41650>": 1, "<-0.31236,-0.38257,0.42551>": 1, "<-0.32035,-0.37859,0.43469>": 1, "<-0.32872,-0.37591,0.44394>": 1, "<-0.33714,-0.37351,0.45342>": 1, "<-0.34515,-0.37019,0.46301>": 1, "<-0.35250,-0.36552,0.47262>": 1, "<-0.35884,-0.35944,0.48237>": 1, "<-0.36388,-0.35225,0.49209>": 1, "<-0.36771,-0.34439,0.50180>": 1, "<-0.37076,-0.33623,0.51155>": 1, "<-0.37399,-0.32820,0.52122>": 1, "<-0.37825,-0.32072,0.53085>": 1, "<-0.38385,-0.31390,0.54050>": 1, "<-0.39046,-0.30797,0.55000>": 1, "<-0.39756,-0.30271,0.55926>": 1, "<-0.40471,-0.29754,0.56847>": 1, "<-0.41140,-0.29156,0.57769>": 1, "<-0.41705,-0.28438,0.58662>": 1, "<-0.42157,-0.27610,0.59526>": 1, "<-0.42522,-0.26720,0.60358>": 1, "<-0.42882,-0.25803,0.61172>": 1, "<-0.43352,-0.24917,0.61990>": 1, "<-0.43851,-0.24030,0.62746>": 1, "<-0.44349,-0.23098,0.63425>": 1, "<-0.44845,-0.22126,0.64144>": 1, "<-0.45198,-0.20979,0.64438>": 1, "<-0.45676,-0.20021,0.65595>": 1, "<-0.45455,-0.18638,0.66033>": 1, "<-0.45365,-0.17321,0.66013>": 1, "<-0.45310,-0.16020,ZP>": 1, "<-0.45271,-0.14743,ZP>": 1, "<-0.45234,-0.13472,ZP>": 1, "<-0.45197,-0.12207,ZP>": 1, "<-0.45152,-0.10936,ZP>": 1, "<-0.45105,-0.09656,ZP>": 1, "<-0.45067,-0.08378,ZP>": 1, "<-0.45041,-0.07099,ZP>": 1, "<-0.45025,-0.05817,ZP>": 1, "<-0.45017,-0.04532,ZP>": 1, "<-0.45015,-0.03247,ZP>": 1, "<-0.45017,-0.01965,ZP>": 1, "<-0.45025,-0.00687,ZP>": 1, "<-0.45035,0.00589,ZP>": 1, "<-0.45048,0.01865,ZP>": 1, "<-0.45063,0.03143,ZP>": 1, "<-0.45080,0.04421,ZP>": 1, "<-0.45099,0.05699,ZP>": 1, "<-0.45118,0.06975,ZP>": 1, "<-0.45140,0.08253,ZP>": 1, "<-0.45169,0.09534,ZP>": 1, "<-0.45205,0.10818,ZP>": 1, "<-0.45227,0.12085,ZP>": 1, "<-0.45251,0.13361,ZP>": 1, "<-0.45281,0.14647,0.66008>": 1, "<-0.45325,0.15936,0.66009>": 1, "<-0.45388,0.17235,0.66015>": 1, "<-0.45472,0.18560,0.66030>": 1, "<-0.45687,0.19945,0.65618>": 1, "<-0.44697,0.21331,0.65000>": 1, "<-0.44894,0.22039,0.64059>": 1, "<-0.44397,0.23014,0.63521>": 1, "<-0.43914,0.23923,0.62801>": 1, "<-0.43414,0.24815,0.62027>": 1, "<-0.42946,0.25718,0.61210>": 1, "<-0.42591,0.26612,0.60381>": 1, "<-0.42220,0.27498,0.59532>": 1, "<-0.41763,0.28314,0.58668>": 1, "<-0.41175,0.29036,0.57764>": 1, "<-0.40495,0.29627,0.56854>": 1, "<-0.39779,0.30152,0.55944>": 1, "<-0.39074,0.30701,0.55003>": 1, "<-0.38440,0.31313,0.54062>": 1, "<-0.37910,0.32018,0.53110>": 1, "<-0.37508,0.32788,0.52154>": 1, "<-0.37200,0.33607,0.51191>": 1, "<-0.36892,0.34426,0.50230>": 1, "<-0.36496,0.35203,0.49265>": 1, "<-0.35972,0.35905,0.48286>": 1, "<-0.35323,0.36482,0.47325>": 1, "<-0.34564,0.36928,0.46361>": 1, "<-0.33748,0.37239,0.45408>": 1, "<-0.32904,0.37453,0.44469>": 1, "<-0.32057,0.37717,0.43533>": 1, "<-0.31248,0.38118,0.42622>": 1, "<-0.30508,0.38664,0.41727>": 1, "<-0.29886,0.39352,0.40858>": 1, "<-0.29364,0.40125,0.39986>": 1, "<-0.28986,-0.41003,0.40835>": 1, "<-0.29396,-0.40187,0.41702>": 1, "<-0.29898,-0.39423,0.42587>": 1, "<-0.30514,-0.38756,0.43487>": 1, "<-0.31238,-0.38228,0.44408>": 1, "<-0.32033,-0.37845,0.45340>": 1, "<-0.32865,-0.37583,0.46295>": 1, "<-0.33695,-0.37345,0.47257>": 1, "<-0.34489,-0.37000,0.48220>": 1, "<-0.35223,-0.36513,0.49204>": 1, "<-0.35847,-0.35894,0.50188>": 1, "<-0.36342,-0.35179,0.51165>": 1, "<-0.36738,-0.34401,0.52148>": 1, "<-0.37081,-0.33601,0.53128>": 1, "<-0.37454,-0.32827,0.54102>": 1, "<-0.37926,-0.32097,0.55074>": 1, "<-0.38506,-0.31440,0.56040>": 1, "<-0.39151,-0.30841,0.56984>": 1, "<-0.39819,-0.30267,0.57912>": 1, "<-0.40478,-0.29657,0.58843>": 1, "<-0.41085,-0.28965,0.59748>": 1, "<-0.41619,-0.28189,0.60622>": 1, "<-0.42090,-0.27324,0.61489>": 1, "<-0.42461,-0.26402,0.62313>": 1, "<-0.42994,-0.25533,0.63119>": 1, "<-0.43524,-0.24627,0.63882>": 1, "<-0.43089,-0.24321,0.65079>": 1, "<-0.44502,-0.22663,0.65483>": 1, "<-0.44230,-0.21242,0.66048>": 1, "<-0.44145,-0.19901,0.66019>": 1, "<-0.44092,-0.18589,0.66008>": 1, "<-0.44062,-0.17323,ZP>": 1, "<-0.44018,-0.16044,ZP>": 1, "<-0.43970,-0.14771,ZP>": 1, "<-0.43914,-0.13483,ZP>": 1, "<-0.43869,-0.12199,ZP>": 1, "<-0.43834,-0.10920,ZP>": 1, "<-0.43804,-0.09643,ZP>": 1, "<-0.43780,-0.08364,ZP>": 1, "<-0.43761,-0.07084,ZP>": 1, "<-0.43748,-0.05803,ZP>": 1, "<-0.43739,-0.04521,ZP>": 1, "<-0.43734,-0.03239,ZP>": 1, "<-0.43733,-0.01957,ZP>": 1, "<-0.43737,-0.00677,ZP>": 1, "<-0.43745,0.00601,ZP>": 1, "<-0.43757,0.01878,ZP>": 1, "<-0.43771,0.03156,ZP>": 1, "<-0.43788,0.04432,ZP>": 1, "<-0.43804,0.05708,ZP>": 1, "<-0.43822,0.06983,ZP>": 1, "<-0.43840,0.08259,ZP>": 1, "<-0.43859,0.09535,ZP>": 1, "<-0.43880,0.10812,ZP>": 1, "<-0.43904,0.12096,ZP>": 1, "<-0.43942,0.13388,ZP>": 1, "<-0.43993,0.14685,ZP>": 1, "<-0.44038,0.15967,ZP>": 1, "<-0.44080,0.17249,ZP>": 1, "<-0.44110,0.18520,ZP>": 1, "<-0.44161,0.19823,0.66014>": 1, "<-0.44223,0.21058,0.66026>": 1, "<-0.44499,0.22556,0.65552>": 1, "<-0.44101,0.22268,0.65000>": 1, "<-0.43576,0.24548,0.63883>": 1, "<-0.43050,0.25447,0.63139>": 1, "<-0.42523,0.26302,0.62332>": 1, "<-0.42162,0.27226,0.61514>": 1, "<-0.41667,0.28099,0.60636>": 1, "<-0.41136,0.28845,0.59752>": 1, "<-0.40532,0.29529,0.58833>": 1, "<-0.39871,0.30147,0.57915>": 1, "<-0.39200,0.30738,0.57000>": 1, "<-0.38552,0.31369,0.56052>": 1, "<-0.37992,0.32046,0.55099>": 1, "<-0.37543,0.32793,0.54136>": 1, "<-0.37188,0.33576,0.53167>": 1, "<-0.36850,0.34381,0.52190>": 1, "<-0.36446,0.35160,0.51219>": 1, "<-0.35932,0.35863,0.50244>": 1, "<-0.35289,0.36459,0.49255>": 1, "<-0.34551,0.36909,0.48291>": 1, "<-0.33740,0.37229,0.47322>": 1, "<-0.32902,0.37448,0.46365>": 1, "<-0.32073,0.37704,0.45420>": 1, "<-0.31267,0.38091,0.44479>": 1, "<-0.30537,0.38627,0.43564>": 1, "<-0.29922,0.39307,0.42662>": 1, "<-0.29430,0.40085,0.41792>": 1, "<-0.29047,0.40932,0.40913>": 1, "<-0.28770,-0.41850,0.41745>": 1, "<-0.29057,-0.40992,0.42630>": 1, "<-0.29437,-0.40167,0.43520>": 1, "<-0.29918,-0.39407,0.44424>": 1, "<-0.30521,-0.38748,0.45347>": 1, "<-0.31239,-0.38226,0.46285>": 1, "<-0.32033,-0.37847,0.47239>": 1, "<-0.32858,-0.37580,0.48204>": 1, "<-0.33679,-0.37324,0.49178>": 1, "<-0.34465,-0.36955,0.50167>": 1, "<-0.35175,-0.36455,0.51162>": 1, "<-0.35775,-0.35837,0.52155>": 1, "<-0.36275,-0.35119,0.53154>": 1, "<-0.36695,-0.34353,0.54144>": 1, "<-0.37087,-0.33578,0.55126>": 1, "<-0.37520,-0.32834,0.56105>": 1, "<-0.38040,-0.32136,0.57084>": 1, "<-0.38629,-0.31484,0.58046>": 1, "<-0.39254,-0.30853,0.58985>": 1, "<-0.39885,-0.30202,0.59915>": 1, "<-0.40511,-0.29501,0.60828>": 1, "<-0.41043,-0.28716,0.61736>": 1, "<-0.41518,-0.27862,0.62601>": 1, "<-0.42067,-0.27033,0.63429>": 1, "<-0.42629,-0.26156,0.64230>": 1, "<-0.43215,-0.25239,0.65049>": 1, "<-0.43161,-0.23929,ZP>": 1, "<-0.42973,-0.22550,0.66023>": 1, "<-0.42882,-0.21215,0.66009>": 1, "<-0.42835,-0.19912,ZP>": 1, "<-0.42784,-0.18610,ZP>": 1, "<-0.42747,-0.17337,ZP>": 1, "<-0.42688,-0.16039,ZP>": 1, "<-0.42645,-0.14757,ZP>": 1, "<-0.42605,-0.13474,ZP>": 1, "<-0.42569,-0.12195,ZP>": 1, "<-0.42537,-0.10915,ZP>": 1, "<-0.42509,-0.09635,ZP>": 1, "<-0.42485,-0.08354,ZP>": 1, "<-0.42468,-0.07072,ZP>": 1, "<-0.42456,-0.05790,ZP>": 1, "<-0.42449,-0.04508,ZP>": 1, "<-0.42445,-0.03228,ZP>": 1, "<-0.42444,-0.01948,ZP>": 1, "<-0.42447,-0.00669,ZP>": 1, "<-0.42453,0.00609,ZP>": 1, "<-0.42462,0.01886,ZP>": 1, "<-0.42474,0.03162,ZP>": 1, "<-0.42486,0.04437,ZP>": 1, "<-0.42501,0.05713,ZP>": 1, "<-0.42516,0.06989,ZP>": 1, "<-0.42535,0.08266,ZP>": 1, "<-0.42555,0.09544,ZP>": 1, "<-0.42577,0.10823,ZP>": 1, "<-0.42603,0.12106,ZP>": 1, "<-0.42634,0.13391,ZP>": 1, "<-0.42669,0.14680,ZP>": 1, "<-0.42708,0.15969,ZP>": 1, "<-0.42762,0.17270,ZP>": 1, "<-0.42796,0.18538,ZP>": 1, "<-0.42840,0.19831,ZP>": 1, "<-0.43050,0.21190,0.66100>": 1, "<-0.42933,0.22461,0.66010>": 1, "<-0.43171,0.23802,0.66012>": 1, "<-0.43294,0.25103,0.65107>": 1, "<-0.42707,0.26033,0.64280>": 1, "<-0.42121,0.26949,0.63462>": 1, "<-0.41572,0.27782,0.62628>": 1, "<-0.41086,0.28626,0.61749>": 1, "<-0.40551,0.29414,0.60842>": 1, "<-0.39943,0.30094,0.59926>": 1, "<-0.39313,0.30751,0.58999>": 1, "<-0.38685,0.31405,0.58068>": 1, "<-0.38099,0.32083,0.57105>": 1, "<-0.37596,0.32790,0.56134>": 1, "<-0.37178,0.33549,0.55156>": 1, "<-0.36798,0.34331,0.54178>": 1, "<-0.36379,0.35098,0.53197>": 1, "<-0.35866,0.35809,0.52209>": 1, "<-0.35245,0.36411,0.51225>": 1, "<-0.34519,0.36883,0.50222>": 1, "<-0.33732,0.37214,0.49249>": 1, "<-0.32900,0.37450,0.48276>": 1, "<-0.32075,0.37710,0.47317>": 1, "<-0.31290,0.38085,0.46367>": 1, "<-0.30566,0.38612,0.45423>": 1, "<-0.29962,0.39285,0.44501>": 1, "<-0.29490,0.40063,0.43594>": 1, "<-0.29132,0.40896,0.42710>": 1, "<-0.28893,0.41786,0.41824>": 1, "<-0.28507,-0.42679,0.42657>": 1, "<-0.28860,-0.41851,0.43554>": 1, "<-0.29143,-0.40998,0.44454>": 1, "<-0.29476,-0.40177,0.45363>": 1, "<-0.29939,-0.39426,0.46293>": 1, "<-0.30535,-0.38766,0.47239>": 1, "<-0.31251,-0.38243,0.48194>": 1, "<-0.32040,-0.37863,0.49164>": 1, "<-0.32852,-0.37581,0.50146>": 1, "<-0.33659,-0.37292,0.51141>": 1, "<-0.34426,-0.36897,0.52144>": 1, "<-0.35109,-0.36381,0.53146>": 1, "<-0.35698,-0.35749,0.54159>": 1, "<-0.36200,-0.35041,0.55161>": 1, "<-0.36651,-0.34294,0.56156>": 1, "<-0.37094,-0.33559,0.57148>": 1, "<-0.37588,-0.32842,0.58135>": 1, "<-0.38142,-0.32154,0.59121>": 1, "<-0.38802,-0.31537,0.60080>": 1, "<-0.39375,-0.30817,0.61015>": 1, "<-0.39948,-0.30072,0.61950>": 1, "<-0.40520,-0.29301,0.62847>": 1, "<-0.41091,-0.28500,0.63703>": 1, "<-0.41677,-0.27664,0.64555>": 1, "<-0.42156,-0.26689,0.65581>": 1, "<-0.41835,-0.25215,0.66042>": 1, "<-0.41726,-0.23865,0.66015>": 1, "<-0.41663,-0.22542,0.66007>": 1, "<-0.41599,-0.21232,ZP>": 1, "<-0.41544,-0.19937,ZP>": 1, "<-0.41472,-0.18621,ZP>": 1, "<-0.41421,-0.17324,ZP>": 1, "<-0.41378,-0.16035,ZP>": 1, "<-0.41340,-0.14752,ZP>": 1, "<-0.41302,-0.13468,ZP>": 1, "<-0.41269,-0.12186,ZP>": 1, "<-0.41239,-0.10903,ZP>": 1, "<-0.41215,-0.09621,ZP>": 1, "<-0.41196,-0.08340,ZP>": 1, "<-0.41182,-0.07058,ZP>": 1, "<-0.41171,-0.05778,ZP>": 1, "<-0.41164,-0.04498,ZP>": 1, "<-0.41160,-0.03218,ZP>": 1, "<-0.41159,-0.01940,ZP>": 1, "<-0.41160,-0.00662,ZP>": 1, "<-0.41165,0.00615,ZP>": 1, "<-0.41172,0.01892,ZP>": 1, "<-0.41181,0.03167,ZP>": 1, "<-0.41192,0.04442,ZP>": 1, "<-0.41205,0.05717,ZP>": 1, "<-0.41219,0.06992,ZP>": 1, "<-0.41235,0.08269,ZP>": 1, "<-0.41253,0.09547,ZP>": 1, "<-0.41275,0.10828,ZP>": 1, "<-0.41302,0.12112,ZP>": 1, "<-0.41332,0.13397,ZP>": 1, "<-0.41365,0.14685,ZP>": 1, "<-0.41399,0.15970,ZP>": 1, "<-0.41435,0.17259,ZP>": 1, "<-0.41472,0.18545,ZP>": 1, "<-0.41536,0.19859,ZP>": 1, "<-0.41542,0.21137,ZP>": 1, "<-0.41663,0.22466,ZP>": 1, "<-0.41773,0.23768,0.66013>": 1, "<-0.41889,0.25091,0.66040>": 1, "<-0.42207,0.26547,0.65632>": 1, "<-0.41733,0.27580,0.64589>": 1, "<-0.41146,0.28420,0.63733>": 1, "<-0.40576,0.29223,0.62869>": 1, "<-0.40007,0.29994,0.61968>": 1, "<-0.39435,0.30741,0.61033>": 1, "<-0.38862,0.31463,0.60096>": 1, "<-0.38213,0.32078,0.59126>": 1, "<-0.37658,0.32790,0.58158>": 1, "<-0.37172,0.33516,0.57178>": 1, "<-0.36737,0.34272,0.56185>": 1, "<-0.36293,0.35021,0.55197>": 1, "<-0.35784,0.35727,0.54203>": 1, "<-0.35177,0.36346,0.53204>": 1, "<-0.34480,0.36839,0.52208>": 1, "<-0.33706,0.37202,0.51195>": 1, "<-0.32897,0.37460,0.50210>": 1, "<-0.32078,0.37733,0.49230>": 1, "<-0.31294,0.38111,0.48265>": 1, "<-0.30590,0.38627,0.47310>": 1, "<-0.29999,0.39291,0.46355>": 1, "<-0.29543,0.40055,0.45426>": 1, "<-0.29223,0.40889,0.44509>": 1, "<-0.28986,0.41757,0.43618>": 1, "<-0.28700,0.42623,0.42733>": 1, "<-0.28036,-0.43422,0.43566>": 1, "<-0.28543,-0.42667,0.44478>": 1, "<-0.28960,-0.41868,0.45366>": 1, "<-0.29208,-0.41013,0.46282>": 1, "<-0.29518,-0.40201,0.47221>": 1, "<-0.29973,-0.39451,0.48184>": 1, "<-0.30564,-0.38798,0.49147>": 1, "<-0.31276,-0.38278,0.50127>": 1, "<-0.32053,-0.37893,0.51113>": 1, "<-0.32854,-0.37585,0.52108>": 1, "<-0.33647,-0.37253,0.53124>": 1, "<-0.34374,-0.36831,0.54140>": 1, "<-0.35026,-0.36293,0.55160>": 1, "<-0.35606,-0.35654,0.56174>": 1, "<-0.36123,-0.34955,0.57186>": 1, "<-0.36606,-0.34245,0.58194>": 1, "<-0.37105,-0.33532,0.59189>": 1, "<-0.37686,-0.32863,0.60194>": 1, "<-0.38275,-0.32175,0.61167>": 1, "<-0.38866,-0.31461,0.62120>": 1, "<-0.39457,-0.30721,0.63035>": 1, "<-0.40054,-0.29949,0.63927>": 1, "<-0.40674,-0.29147,0.64823>": 1, "<-0.40821,-0.27973,0.65952>": 1, "<-0.40599,-0.26530,0.66025>": 1, "<-0.40514,-0.25198,0.66009>": 1, "<-0.40443,-0.23884,ZP>": 1, "<-0.40366,-0.22563,ZP>": 1, "<-0.40286,-0.21237,ZP>": 1, "<-0.40221,-0.19922,ZP>": 1, "<-0.40166,-0.18619,ZP>": 1, "<-0.40117,-0.17322,ZP>": 1, "<-0.40074,-0.16030,ZP>": 1, "<-0.40036,-0.14743,ZP>": 1, "<-0.40002,-0.13457,ZP>": 1, "<-0.39972,-0.12173,ZP>": 1, "<-0.39947,-0.10891,ZP>": 1, "<-0.39925,-0.09609,ZP>": 1, "<-0.39908,-0.08327,ZP>": 1, "<-0.39895,-0.07047,ZP>": 1, "<-0.39885,-0.05767,ZP>": 1, "<-0.39878,-0.04488,ZP>": 1, "<-0.39874,-0.03210,ZP>": 1, "<-0.39872,-0.01932,ZP>": 1, "<-0.39873,-0.00656,ZP>": 1, "<-0.39877,0.00620,ZP>": 1, "<-0.39882,0.01895,ZP>": 1, "<-0.39890,0.03170,ZP>": 1, "<-0.39899,0.04444,ZP>": 1, "<-0.39911,0.05719,ZP>": 1, "<-0.39924,0.06994,ZP>": 1, "<-0.39939,0.08271,ZP>": 1, "<-0.39957,0.09549,ZP>": 1, "<-0.39978,0.10830,ZP>": 1, "<-0.40002,0.12112,ZP>": 1, "<-0.40028,0.13396,ZP>": 1, "<-0.40059,0.14683,ZP>": 1, "<-0.40091,0.15970,ZP>": 1, "<-0.40127,0.17262,ZP>": 1, "<-0.40164,0.18552,ZP>": 1, "<-0.40211,0.19855,ZP>": 1, "<-0.40276,0.21173,ZP>": 1, "<-0.40366,0.22499,ZP>": 1, "<-0.40455,0.23813,ZP>": 1, "<-0.40537,0.25119,0.66009>": 1, "<-0.40631,0.26441,0.66023>": 1, "<-0.40846,0.27872,0.65969>": 1, "<-0.40731,0.29070,0.64847>": 1, "<-0.40108,0.29878,0.63948>": 1, "<-0.39515,0.30647,0.63051>": 1, "<-0.38926,0.31388,0.62135>": 1, "<-0.38337,0.32102,0.61186>": 1, "<-0.37749,0.32790,0.60219>": 1, "<-0.37180,0.33471,0.59216>": 1, "<-0.36679,0.34202,0.58224>": 1, "<-0.36202,0.34928,0.57221>": 1, "<-0.35691,0.35622,0.56222>": 1, "<-0.35097,0.36255,0.55205>": 1, "<-0.34421,0.36782,0.54191>": 1, "<-0.33678,0.37181,0.53179>": 1, "<-0.32888,0.37481,0.52169>": 1, "<-0.32089,0.37775,0.51173>": 1, "<-0.31314,0.38159,0.50177>": 1, "<-0.30609,0.38677,0.49201>": 1, "<-0.30027,0.39328,0.48241>": 1, "<-0.29584,0.40086,0.47281>": 1, "<-0.29291,0.40907,0.46345>": 1, "<-0.29092,0.41772,0.45420>": 1, "<-0.28726,0.42587,0.44529>": 1, "<-0.28275,0.43384,0.43636>": 1, "<-0.27341,-0.43997,0.44465>": 1, "<-0.28006,-0.43378,0.45387>": 1, "<-0.28575,-0.42669,0.46277>": 1, "<-0.28982,-0.41873,0.47197>": 1, "<-0.29254,-0.41044,0.48143>": 1, "<-0.29555,-0.40233,0.49118>": 1, "<-0.30005,-0.39497,0.50084>": 1, "<-0.30600,-0.38852,0.51076>": 1, "<-0.31305,-0.38340,0.52078>": 1, "<-0.32065,-0.37949,0.53084>": 1, "<-0.32847,-0.37605,0.54098>": 1, "<-0.33602,-0.37230,0.55117>": 1, "<-0.34301,-0.36764,0.56147>": 1, "<-0.34943,-0.36193,0.57177>": 1, "<-0.35510,-0.35557,0.58212>": 1, "<-0.36042,-0.34880,0.59236>": 1, "<-0.36575,-0.34186,0.60241>": 1, "<-0.37125,-0.33494,0.61267>": 1, "<-0.37731,-0.32814,0.62254>": 1, "<-0.38337,-0.32109,0.63192>": 1, "<-0.38954,-0.31373,0.64102>": 1, "<-0.39608,-0.30607,0.65060>": 1, "<-0.39441,-0.29201,0.66060>": 1, "<-0.39341,-0.27837,0.66018>": 1, "<-0.39270,-0.26510,0.66008>": 1, "<-0.39204,-0.25198,ZP>": 1, "<-0.39128,-0.23875,ZP>": 1, "<-0.39042,-0.22541,ZP>": 1, "<-0.38977,-0.21226,ZP>": 1, "<-0.38919,-0.19917,ZP>": 1, "<-0.38866,-0.18614,ZP>": 1, "<-0.38818,-0.17316,ZP>": 1, "<-0.38774,-0.16021,ZP>": 1, "<-0.38738,-0.14731,ZP>": 1, "<-0.38707,-0.13445,ZP>": 1, "<-0.38680,-0.12160,ZP>": 1, "<-0.38657,-0.10877,ZP>": 1, "<-0.38638,-0.09596,ZP>": 1, "<-0.38622,-0.08315,ZP>": 1, "<-0.38610,-0.07035,ZP>": 1, "<-0.38600,-0.05757,ZP>": 1, "<-0.38594,-0.04479,ZP>": 1, "<-0.38590,-0.03202,ZP>": 1, "<-0.38588,-0.01926,ZP>": 1, "<-0.38588,-0.00651,ZP>": 1, "<-0.38591,0.00624,ZP>": 1, "<-0.38595,0.01898,ZP>": 1, "<-0.38602,0.03171,ZP>": 1, "<-0.38610,0.04445,ZP>": 1, "<-0.38620,0.05720,ZP>": 1, "<-0.38632,0.06995,ZP>": 1, "<-0.38646,0.08271,ZP>": 1, "<-0.38663,0.09549,ZP>": 1, "<-0.38683,0.10829,ZP>": 1, "<-0.38705,0.12111,ZP>": 1, "<-0.38730,0.13394,ZP>": 1, "<-0.38758,0.14680,ZP>": 1, "<-0.38788,0.15968,ZP>": 1, "<-0.38825,0.17261,ZP>": 1, "<-0.38865,0.18558,ZP>": 1, "<-0.38914,0.19863,ZP>": 1, "<-0.38974,0.21175,ZP>": 1, "<-0.39044,0.22491,ZP>": 1, "<-0.39136,0.23819,ZP>": 1, "<-0.39221,0.25134,ZP>": 1, "<-0.39295,0.26438,0.66008>": 1, "<-0.39372,0.27759,0.66018>": 1, "<-0.39469,0.29116,0.66060>": 1, "<-0.39659,0.30542,0.65082>": 1, "<-0.39012,0.31304,0.64102>": 1, "<-0.38398,0.32037,0.63213>": 1, "<-0.37795,0.32741,0.62278>": 1, "<-0.37190,0.33421,0.61297>": 1, "<-0.36647,0.34126,0.60274>": 1, "<-0.36119,0.34831,0.59267>": 1, "<-0.35580,0.35520,0.58257>": 1, "<-0.35008,0.36152,0.57233>": 1, "<-0.34356,0.36707,0.56204>": 1, "<-0.33640,0.37158,0.55183>": 1, "<-0.32876,0.37513,0.54149>": 1, "<-0.32094,0.37842,0.53133>": 1, "<-0.31336,0.38235,0.52131>": 1, "<-0.30643,0.38749,0.51124>": 1, "<-0.30062,0.39391,0.50132>": 1, "<-0.29621,0.40131,0.49161>": 1, "<-0.29338,0.40945,0.48199>": 1, "<-0.29114,0.41787,0.47259>": 1, "<-0.28754,0.42594,0.46326>": 1, "<-0.28239,0.43329,0.45431>": 1, "<-0.27624,0.44000,0.44521>": 1, "<-0.26447,-0.44277,0.45329>": 1, "<-0.27239,-0.43878,0.46270>": 1, "<-0.27955,-0.43341,0.47180>": 1, "<-0.28533,-0.42658,0.48109>": 1, "<-0.28968,-0.41892,0.49055>": 1, "<-0.29267,-0.41081,0.50030>": 1, "<-0.29579,-0.40287,0.51004>": 1, "<-0.30044,-0.39555,0.52008>": 1, "<-0.30646,-0.38929,0.53023>": 1, "<-0.31337,-0.38432,0.54046>": 1, "<-0.32080,-0.38022,0.55075>": 1, "<-0.32831,-0.37638,0.56101>": 1, "<-0.33551,-0.37206,0.57141>": 1, "<-0.34217,-0.36698,0.58192>": 1, "<-0.34832,-0.36119,0.59231>": 1, "<-0.35423,-0.35479,0.60265>": 1, "<-0.35979,-0.34814,0.61297>": 1, "<-0.36547,-0.34126,0.62331>": 1, "<-0.37168,-0.33455,0.63301>": 1, "<-0.37506,-0.32554,0.64251>": 1, "<-0.38437,-0.32002,0.65340>": 1, "<-0.38162,-0.30489,0.66049>": 1, "<-0.38082,-0.29145,0.66016>": 1, "<-0.38018,-0.27814,0.66008>": 1, "<-0.37951,-0.26494,ZP>": 1, "<-0.37877,-0.25169,ZP>": 1, "<-0.37802,-0.23842,ZP>": 1, "<-0.37738,-0.22527,ZP>": 1, "<-0.37675,-0.21215,ZP>": 1, "<-0.37617,-0.19906,ZP>": 1, "<-0.37566,-0.18602,ZP>": 1, "<-0.37520,-0.17304,ZP>": 1, "<-0.37480,-0.16010,ZP>": 1, "<-0.37446,-0.14719,ZP>": 1, "<-0.37416,-0.13432,ZP>": 1, "<-0.37391,-0.12147,ZP>": 1, "<-0.37370,-0.10864,ZP>": 1, "<-0.37352,-0.09583,ZP>": 1, "<-0.37338,-0.08303,ZP>": 1, "<-0.37326,-0.07025,ZP>": 1, "<-0.37317,-0.05747,ZP>": 1, "<-0.37311,-0.04471,ZP>": 1, "<-0.37307,-0.03196,ZP>": 1, "<-0.37305,-0.01921,ZP>": 1, "<-0.37305,-0.00647,ZP>": 1, "<-0.37306,0.00626,ZP>": 1, "<-0.37310,0.01899,ZP>": 1, "<-0.37315,0.03172,ZP>": 1, "<-0.37322,0.04445,ZP>": 1, "<-0.37332,0.05719,ZP>": 1, "<-0.37343,0.06994,ZP>": 1, "<-0.37356,0.08270,ZP>": 1, "<-0.37372,0.09547,ZP>": 1, "<-0.37390,0.10826,ZP>": 1, "<-0.37411,0.12107,ZP>": 1, "<-0.37435,0.13390,ZP>": 1, "<-0.37461,0.14675,ZP>": 1, "<-0.37491,0.15964,ZP>": 1, "<-0.37526,0.17257,ZP>": 1, "<-0.37567,0.18556,ZP>": 1, "<-0.37617,0.19861,ZP>": 1, "<-0.37674,0.21171,ZP>": 1, "<-0.37738,0.22483,ZP>": 1, "<-0.37805,0.23796,ZP>": 1, "<-0.37884,0.25117,ZP>": 1, "<-0.37965,0.26437,ZP>": 1, "<-0.38038,0.27751,0.66008>": 1, "<-0.38110,0.29075,0.66016>": 1, "<-0.38194,0.30411,0.66049>": 1, "<-0.38486,0.31927,0.65377>": 1, "<-0.37518,0.32507,0.64232>": 1, "<-0.37233,0.33383,0.63332>": 1, "<-0.36614,0.34054,0.62368>": 1, "<-0.36045,0.34747,0.61338>": 1, "<-0.35492,0.35422,0.60306>": 1, "<-0.34911,0.36057,0.59282>": 1, "<-0.34287,0.36638,0.58239>": 1, "<-0.33598,0.37138,0.57199>": 1, "<-0.32868,0.37555,0.56162>": 1, "<-0.32106,0.37932,0.55117>": 1, "<-0.31366,0.38340,0.54093>": 1, "<-0.30682,0.38845,0.53073>": 1, "<-0.30101,0.39468,0.52054>": 1, "<-0.29655,0.40191,0.51051>": 1, "<-0.29359,0.40989,0.50070>": 1, "<-0.29102,0.41811,0.49107>": 1, "<-0.28715,0.42597,0.48164>": 1, "<-0.28183,0.43310,0.47222>": 1, "<-0.27511,0.43886,0.46311>": 1, "<-0.26748,0.44338,0.45376>": 1, "<-0.25475,-0.44219,0.46150>": 1, "<-0.26312,-0.44078,0.47113>": 1, "<-0.27127,-0.43776,0.48053>": 1, "<-0.27857,-0.43289,0.49009>": 1, "<-0.28464,-0.42640,0.49960>": 1, "<-0.28925,-0.41900,0.50930>": 1, "<-0.29263,-0.41111,0.51909>": 1, "<-0.29609,-0.40327,0.52922>": 1, "<-0.30090,-0.39627,0.53947>": 1, "<-0.30688,-0.39038,0.54982>": 1, "<-0.31376,-0.38550,0.56031>": 1, "<-0.32100,-0.38117,0.57078>": 1, "<-0.32817,-0.37678,0.58134>": 1, "<-0.33494,-0.37194,0.59188>": 1, "<-0.34137,-0.36655,0.60232>": 1, "<-0.34753,-0.36053,0.61300>": 1, "<-0.35320,-0.35393,0.62351>": 1, "<-0.35948,-0.34762,0.63352>": 1, "<-0.36594,-0.34104,0.64339>": 1, "<-0.37170,-0.33326,0.65556>": 1, "<-0.36879,-0.31779,0.66039>": 1, "<-0.36810,-0.30431,0.66012>": 1, "<-0.36759,-0.29118,0.66008>": 1, "<-0.36690,-0.27787,ZP>": 1, "<-0.36612,-0.26452,ZP>": 1, "<-0.36549,-0.25131,ZP>": 1, "<-0.36488,-0.23816,ZP>": 1, "<-0.36428,-0.22504,ZP>": 1, "<-0.36370,-0.21194,ZP>": 1, "<-0.36317,-0.19888,ZP>": 1, "<-0.36269,-0.18587,ZP>": 1, "<-0.36227,-0.17290,ZP>": 1, "<-0.36189,-0.15996,ZP>": 1, "<-0.36156,-0.14706,ZP>": 1, "<-0.36128,-0.13418,ZP>": 1, "<-0.36104,-0.12134,ZP>": 1, "<-0.36085,-0.10851,ZP>": 1, "<-0.36068,-0.09571,ZP>": 1, "<-0.36055,-0.08292,ZP>": 1, "<-0.36044,-0.07015,ZP>": 1, "<-0.36036,-0.05739,ZP>": 1, "<-0.36029,-0.04464,ZP>": 1, "<-0.36025,-0.03190,ZP>": 1, "<-0.36023,-0.01917,ZP>": 1, "<-0.36022,-0.00644,ZP>": 1, "<-0.36024,0.00628,ZP>": 1, "<-0.36027,0.01900,ZP>": 1, "<-0.36031,0.03172,ZP>": 1, "<-0.36038,0.04445,ZP>": 1, "<-0.36046,0.05718,ZP>": 1, "<-0.36057,0.06992,ZP>": 1, "<-0.36069,0.08267,ZP>": 1, "<-0.36084,0.09543,ZP>": 1, "<-0.36101,0.10821,ZP>": 1, "<-0.36120,0.12102,ZP>": 1, "<-0.36143,0.13384,ZP>": 1, "<-0.36168,0.14669,ZP>": 1, "<-0.36198,0.15958,ZP>": 1, "<-0.36232,0.17251,ZP>": 1, "<-0.36272,0.18549,ZP>": 1, "<-0.36318,0.19851,ZP>": 1, "<-0.36370,0.21157,ZP>": 1, "<-0.36428,0.22466,ZP>": 1, "<-0.36489,0.23776,ZP>": 1, "<-0.36553,0.25088,ZP>": 1, "<-0.36620,0.26403,ZP>": 1, "<-0.36703,0.27731,ZP>": 1, "<-0.36780,0.29054,0.66008>": 1, "<-0.36838,0.30358,0.66013>": 1, "<-0.36911,0.31692,0.66038>": 1, "<-0.37208,0.33229,0.65615>": 1, "<-0.36663,0.34030,0.64383>": 1, "<-0.36019,0.34688,0.63398>": 1, "<-0.35396,0.35317,0.62403>": 1, "<-0.34824,0.35982,0.61341>": 1, "<-0.34213,0.36583,0.60290>": 1, "<-0.33554,0.37127,0.59238>": 1, "<-0.32865,0.37604,0.58178>": 1, "<-0.32148,0.38035,0.57128>": 1, "<-0.31414,0.38469,0.56080>": 1, "<-0.30724,0.38966,0.55035>": 1, "<-0.30140,0.39561,0.54000>": 1, "<-0.29677,0.40258,0.52973>": 1, "<-0.29353,0.41034,0.51967>": 1, "<-0.29049,0.41828,0.50982>": 1, "<-0.28629,0.42585,0.50014>": 1, "<-0.28071,0.43266,0.49055>": 1, "<-0.27380,0.43804,0.48092>": 1, "<-0.26594,0.44150,0.47152>": 1, "<-0.25768,0.44339,0.46189>": 1, "<-0.24546,-0.43859,0.46927>": 1, "<-0.25343,-0.43953,0.47904>": 1, "<-0.26171,-0.43882,0.48892>": 1, "<-0.26979,-0.43655,0.49880>": 1, "<-0.27740,-0.43222,0.50855>": 1, "<-0.28361,-0.42612,0.51833>": 1, "<-0.28844,-0.41900,0.52827>": 1, "<-0.29226,-0.41135,0.53843>": 1, "<-0.29615,-0.40386,0.54873>": 1, "<-0.30124,-0.39718,0.55914>": 1, "<-0.30748,-0.39154,0.56975>": 1, "<-0.31424,-0.38668,0.58039>": 1, "<-0.32104,-0.38207,0.59103>": 1, "<-0.32788,-0.37750,0.60183>": 1, "<-0.33419,-0.37191,0.61252>": 1, "<-0.34051,-0.36617,0.62326>": 1, "<-0.34685,-0.36022,0.63350>": 1, "<-0.35332,-0.35410,0.64365>": 1, "<-0.35872,-0.34639,0.65641>": 1, "<-0.35595,-0.33081,0.66034>": 1, "<-0.35529,-0.31730,0.66010>": 1, "<-0.35478,-0.30396,ZP>": 1, "<-0.35426,-0.29075,ZP>": 1, "<-0.35349,-0.27735,ZP>": 1, "<-0.35290,-0.26415,ZP>": 1, "<-0.35231,-0.25097,ZP>": 1, "<-0.35174,-0.23785,ZP>": 1, "<-0.35119,-0.22476,ZP>": 1, "<-0.35068,-0.21170,ZP>": 1, "<-0.35020,-0.19868,ZP>": 1, "<-0.34975,-0.18569,ZP>": 1, "<-0.34935,-0.17273,ZP>": 1, "<-0.34900,-0.15980,ZP>": 1, "<-0.34869,-0.14691,ZP>": 1, "<-0.34843,-0.13404,ZP>": 1, "<-0.34821,-0.12121,ZP>": 1, "<-0.34802,-0.10839,ZP>": 1, "<-0.34786,-0.09560,ZP>": 1, "<-0.34774,-0.08282,ZP>": 1, "<-0.34763,-0.07006,ZP>": 1, "<-0.34755,-0.05731,ZP>": 1, "<-0.34749,-0.04458,ZP>": 1, "<-0.34745,-0.03185,ZP>": 1, "<-0.34743,-0.01913,ZP>": 1, "<-0.34742,-0.00642,ZP>": 1, "<-0.34743,0.00629,ZP>": 1, "<-0.34745,0.01900,ZP>": 1, "<-0.34749,0.03172,ZP>": 1, "<-0.34755,0.04443,ZP>": 1, "<-0.34763,0.05715,ZP>": 1, "<-0.34773,0.06988,ZP>": 1, "<-0.34784,0.08263,ZP>": 1, "<-0.34798,0.09538,ZP>": 1, "<-0.34814,0.10816,ZP>": 1, "<-0.34833,0.12095,ZP>": 1, "<-0.34854,0.13377,ZP>": 1, "<-0.34879,0.14661,ZP>": 1, "<-0.34907,0.15950,ZP>": 1, "<-0.34940,0.17241,ZP>": 1, "<-0.34978,0.18537,ZP>": 1, "<-0.35021,0.19836,ZP>": 1, "<-0.35068,0.21138,ZP>": 1, "<-0.35119,0.22443,ZP>": 1, "<-0.35173,0.23750,ZP>": 1, "<-0.35231,0.25059,ZP>": 1, "<-0.35292,0.26371,ZP>": 1, "<-0.35355,0.27684,ZP>": 1, "<-0.35436,0.29015,ZP>": 1, "<-0.35494,0.30325,ZP>": 1, "<-0.35551,0.31648,0.66010>": 1, "<-0.35623,0.32985,0.66032>": 1, "<-0.35900,0.34528,0.65713>": 1, "<-0.35407,0.35337,0.64421>": 1, "<-0.34765,0.35945,0.63409>": 1, "<-0.34132,0.36541,0.62386>": 1, "<-0.33501,0.37118,0.61310>": 1, "<-0.32870,0.37679,0.60234>": 1, "<-0.32172,0.38127,0.59156>": 1, "<-0.31472,0.38597,0.58074>": 1, "<-0.30792,0.39083,0.57015>": 1, "<-0.30175,0.39654,0.55959>": 1, "<-0.29683,0.40322,0.54924>": 1, "<-0.29308,0.41073,0.53886>": 1, "<-0.28949,0.41840,0.52881>": 1, "<-0.28501,0.42562,0.51884>": 1, "<-0.27927,0.43203,0.50894>": 1, "<-0.27219,0.43689,0.49912>": 1, "<-0.26426,0.43975,0.48927>": 1, "<-0.25612,0.44082,0.47947>": 1, "<-0.24807,0.44025,0.46958>": 1, "<-0.23696,-0.43304,0.47686>": 1, "<-0.24435,-0.43550,0.48667>": 1, "<-0.25217,-0.43712,0.49696>": 1, "<-0.26010,-0.43704,0.50701>": 1, "<-0.26840,-0.43519,0.51706>": 1, "<-0.27594,-0.43131,0.52711>": 1, "<-0.28224,-0.42558,0.53730>": 1, "<-0.28727,-0.41870,0.54755>": 1, "<-0.29153,-0.41136,0.55785>": 1, "<-0.29601,-0.40429,0.56828>": 1, "<-0.30145,-0.39816,0.57902>": 1, "<-0.30761,-0.39283,0.58987>": 1, "<-0.31463,-0.38863,0.60070>": 1, "<-0.32100,-0.38337,0.61156>": 1, "<-0.32740,-0.37795,0.62244>": 1, "<-0.33380,-0.37236,0.63295>": 1, "<-0.34028,-0.36664,0.64335>": 1, "<-0.34569,-0.35943,0.65638>": 1, "<-0.34318,-0.34378,0.66034>": 1, "<-0.34266,-0.33030,0.66011>": 1, "<-0.34218,-0.31701,ZP>": 1, "<-0.34154,-0.30361,ZP>": 1, "<-0.34081,-0.29016,ZP>": 1, "<-0.34025,-0.27693,ZP>": 1, "<-0.33969,-0.26375,ZP>": 1, "<-0.33914,-0.25060,ZP>": 1, "<-0.33862,-0.23751,ZP>": 1, "<-0.33813,-0.22445,ZP>": 1, "<-0.33767,-0.21143,ZP>": 1, "<-0.33723,-0.19844,ZP>": 1, "<-0.33683,-0.18548,ZP>": 1, "<-0.33646,-0.17254,ZP>": 1, "<-0.33613,-0.15963,ZP>": 1, "<-0.33585,-0.14676,ZP>": 1, "<-0.33560,-0.13390,ZP>": 1, "<-0.33539,-0.12108,ZP>": 1, "<-0.33521,-0.10827,ZP>": 1, "<-0.33506,-0.09549,ZP>": 1, "<-0.33494,-0.08273,ZP>": 1, "<-0.33484,-0.06998,ZP>": 1, "<-0.33477,-0.05724,ZP>": 1, "<-0.33471,-0.04452,ZP>": 1, "<-0.33467,-0.03181,ZP>": 1, "<-0.33464,-0.01910,ZP>": 1, "<-0.33463,-0.00640,ZP>": 1, "<-0.33464,0.00630,ZP>": 1, "<-0.33466,0.01900,ZP>": 1, "<-0.33470,0.03171,ZP>": 1, "<-0.33475,0.04441,ZP>": 1, "<-0.33482,0.05712,ZP>": 1, "<-0.33491,0.06985,ZP>": 1, "<-0.33502,0.08258,ZP>": 1, "<-0.33515,0.09533,ZP>": 1, "<-0.33530,0.10809,ZP>": 1, "<-0.33548,0.12088,ZP>": 1, "<-0.33568,0.13368,ZP>": 1, "<-0.33592,0.14652,ZP>": 1, "<-0.33619,0.15939,ZP>": 1, "<-0.33650,0.17229,ZP>": 1, "<-0.33685,0.18522,ZP>": 1, "<-0.33724,0.19817,ZP>": 1, "<-0.33767,0.21116,ZP>": 1, "<-0.33812,0.22416,ZP>": 1, "<-0.33860,0.23719,ZP>": 1, "<-0.33912,0.25025,ZP>": 1, "<-0.33967,0.26335,ZP>": 1, "<-0.34025,0.27646,ZP>": 1, "<-0.34084,0.28961,ZP>": 1, "<-0.34163,0.30296,ZP>": 1, "<-0.34233,0.31625,ZP>": 1, "<-0.34288,0.32943,0.66011>": 1, "<-0.34346,0.34277,0.66031>": 1, "<-0.34596,0.35822,0.65724>": 1, "<-0.34112,0.36588,0.64404>": 1, "<-0.33472,0.37153,0.63360>": 1, "<-0.32835,0.37713,0.62290>": 1, "<-0.32189,0.38263,0.61188>": 1, "<-0.31548,0.38794,0.60098>": 1, "<-0.30819,0.39211,0.59025>": 1, "<-0.30194,0.39754,0.57949>": 1, "<-0.29657,0.40376,0.56880>": 1, "<-0.29226,0.41084,0.55831>": 1, "<-0.28812,0.41823,0.54789>": 1, "<-0.28330,0.42519,0.53771>": 1, "<-0.27736,0.43114,0.52757>": 1, "<-0.27017,0.43548,0.51739>": 1, "<-0.26234,0.43786,0.50728>": 1, "<-0.25439,0.43839,0.49719>": 1, "<-0.24666,0.43735,0.48723>": 1, "<-0.23936,0.43482,0.47700>": 1, "<-0.22746,-0.43075,0.48474>": 1, "<-0.23544,-0.43110,0.49424>": 1, "<-0.24337,-0.43221,0.50462>": 1, "<-0.25062,-0.43489,0.51479>": 1, "<-0.25865,-0.43536,0.52516>": 1, "<-0.26652,-0.43382,0.53552>": 1, "<-0.27397,-0.43018,0.54604>": 1, "<-0.28035,-0.42473,0.55650>": 1, "<-0.28561,-0.41813,0.56691>": 1, "<-0.29031,-0.41124,0.57735>": 1, "<-0.29532,-0.40479,0.58816>": 1, "<-0.30098,-0.39910,0.59912>": 1, "<-0.30744,-0.39433,0.61008>": 1, "<-0.31387,-0.38926,0.62108>": 1, "<-0.32035,-0.38399,0.63181>": 1, "<-0.32412,-0.37573,0.64215>": 1, "<-0.33258,-0.37236,0.65551>": 1, "<-0.33019,-0.35654,0.66035>": 1, "<-0.32978,-0.34317,0.66011>": 1, "<-0.32940,-0.32986,ZP>": 1, "<-0.32883,-0.31645,ZP>": 1, "<-0.32813,-0.30298,ZP>": 1, "<-0.32758,-0.28971,ZP>": 1, "<-0.32704,-0.27649,ZP>": 1, "<-0.32652,-0.26333,ZP>": 1, "<-0.32602,-0.25022,ZP>": 1, "<-0.32555,-0.23716,ZP>": 1, "<-0.32510,-0.22414,ZP>": 1, "<-0.32468,-0.21115,ZP>": 1, "<-0.32428,-0.19819,ZP>": 1, "<-0.32392,-0.18525,ZP>": 1, "<-0.32358,-0.17234,ZP>": 1, "<-0.32328,-0.15946,ZP>": 1, "<-0.32302,-0.14660,ZP>": 1, "<-0.32279,-0.13376,ZP>": 1, "<-0.32259,-0.12095,ZP>": 1, "<-0.32242,-0.10816,ZP>": 1, "<-0.32228,-0.09539,ZP>": 1, "<-0.32216,-0.08264,ZP>": 1, "<-0.32207,-0.06990,ZP>": 1, "<-0.32200,-0.05718,ZP>": 1, "<-0.32194,-0.04447,ZP>": 1, "<-0.32190,-0.03177,ZP>": 1, "<-0.32187,-0.01907,ZP>": 1, "<-0.32186,-0.00638,ZP>": 1, "<-0.32187,0.00631,ZP>": 1, "<-0.32189,0.01900,ZP>": 1, "<-0.32192,0.03169,ZP>": 1, "<-0.32197,0.04439,ZP>": 1, "<-0.32204,0.05709,ZP>": 1, "<-0.32212,0.06980,ZP>": 1, "<-0.32222,0.08253,ZP>": 1, "<-0.32234,0.09526,ZP>": 1, "<-0.32249,0.10802,ZP>": 1, "<-0.32265,0.12079,ZP>": 1, "<-0.32285,0.13359,ZP>": 1, "<-0.32307,0.14641,ZP>": 1, "<-0.32333,0.15926,ZP>": 1, "<-0.32362,0.17213,ZP>": 1, "<-0.32394,0.18504,ZP>": 1, "<-0.32429,0.19796,ZP>": 1, "<-0.32467,0.21091,ZP>": 1, "<-0.32508,0.22388,ZP>": 1, "<-0.32551,0.23688,ZP>": 1, "<-0.32597,0.24990,ZP>": 1, "<-0.32647,0.26297,ZP>": 1, "<-0.32700,0.27607,ZP>": 1, "<-0.32756,0.28922,ZP>": 1, "<-0.32815,0.30240,ZP>": 1, "<-0.32890,0.31577,ZP>": 1, "<-0.32954,0.32906,ZP>": 1, "<-0.32997,0.34226,0.66010>": 1, "<-0.33042,0.35548,0.66032>": 1, "<-0.33287,0.37120,0.65654>": 1, "<-0.32521,0.37512,0.64236>": 1, "<-0.32132,0.38319,0.63231>": 1, "<-0.31471,0.38858,0.62140>": 1, "<-0.30826,0.39369,0.61041>": 1, "<-0.30161,0.39838,0.59930>": 1, "<-0.29592,0.40423,0.58872>": 1, "<-0.29100,0.41072,0.57789>": 1, "<-0.28642,0.41766,0.56726>": 1, "<-0.28132,0.42433,0.55680>": 1, "<-0.27525,0.42996,0.54640>": 1, "<-0.26814,0.43395,0.53594>": 1, "<-0.26036,0.43601,0.52540>": 1, "<-0.25259,0.43622,0.51514>": 1, "<-0.24529,0.43403,0.50495>": 1, "<-0.23792,0.43213,0.49476>": 1, "<-0.23018,0.43121,0.48473>": 1, "<-0.21762,-0.43293,0.49253>": 1, "<-0.22556,-0.43124,0.50214>": 1, "<-0.23374,-0.43032,0.51237>": 1, "<-0.24134,-0.43085,0.52240>": 1, "<-0.24906,-0.43278,0.53306>": 1, "<-0.25668,-0.43385,0.54360>": 1, "<-0.26451,-0.43234,0.55437>": 1, "<-0.27173,-0.42879,0.56503>": 1, "<-0.27807,-0.42353,0.57575>": 1, "<-0.28343,-0.41732,0.58641>": 1, "<-0.28859,-0.41102,0.59722>": 1, "<-0.29409,-0.40530,0.60814>": 1, "<-0.29999,-0.40003,0.61944>": 1, "<-0.30647,-0.39515,0.63026>": 1, "<-0.31301,-0.39012,0.64095>": 1, "<-0.31936,-0.38496,0.65332>": 1, "<-0.31718,-0.36933,0.66040>": 1, "<-0.31676,-0.35577,0.66010>": 1, "<-0.31654,-0.34262,ZP>": 1, "<-0.31606,-0.32921,ZP>": 1, "<-0.31544,-0.31577,ZP>": 1, "<-0.31493,-0.30250,ZP>": 1, "<-0.31440,-0.28926,ZP>": 1, "<-0.31388,-0.27606,ZP>": 1, "<-0.31339,-0.26293,ZP>": 1, "<-0.31294,-0.24985,ZP>": 1, "<-0.31251,-0.23682,ZP>": 1, "<-0.31210,-0.22383,ZP>": 1, "<-0.31172,-0.21087,ZP>": 1, "<-0.31136,-0.19793,ZP>": 1, "<-0.31103,-0.18503,ZP>": 1, "<-0.31072,-0.17214,ZP>": 1, "<-0.31045,-0.15928,ZP>": 1, "<-0.31021,-0.14644,ZP>": 1, "<-0.30999,-0.13362,ZP>": 1, "<-0.30981,-0.12082,ZP>": 1, "<-0.30965,-0.10805,ZP>": 1, "<-0.30951,-0.09529,ZP>": 1, "<-0.30940,-0.08256,ZP>": 1, "<-0.30931,-0.06983,ZP>": 1, "<-0.30924,-0.05712,ZP>": 1, "<-0.30919,-0.04442,ZP>": 1, "<-0.30915,-0.03173,ZP>": 1, "<-0.30912,-0.01905,ZP>": 1, "<-0.30911,-0.00637,ZP>": 1, "<-0.30912,0.00631,ZP>": 1, "<-0.30913,0.01899,ZP>": 1, "<-0.30916,0.03167,ZP>": 1, "<-0.30921,0.04436,ZP>": 1, "<-0.30927,0.05706,ZP>": 1, "<-0.30935,0.06976,ZP>": 1, "<-0.30944,0.08247,ZP>": 1, "<-0.30956,0.09520,ZP>": 1, "<-0.30969,0.10794,ZP>": 1, "<-0.30985,0.12070,ZP>": 1, "<-0.31003,0.13348,ZP>": 1, "<-0.31024,0.14629,ZP>": 1, "<-0.31048,0.15912,ZP>": 1, "<-0.31075,0.17197,ZP>": 1, "<-0.31104,0.18484,ZP>": 1, "<-0.31136,0.19773,ZP>": 1, "<-0.31170,0.21065,ZP>": 1, "<-0.31207,0.22359,ZP>": 1, "<-0.31246,0.23656,ZP>": 1, "<-0.31288,0.24956,ZP>": 1, "<-0.31333,0.26259,ZP>": 1, "<-0.31382,0.27568,ZP>": 1, "<-0.31435,0.28882,ZP>": 1, "<-0.31491,0.30198,ZP>": 1, "<-0.31546,0.31517,ZP>": 1, "<-0.31612,0.32849,ZP>": 1, "<-0.31666,0.34179,ZP>": 1, "<-0.31694,0.35483,0.66010>": 1, "<-0.31744,0.36832,0.66038>": 1, "<-0.31995,0.38408,0.65421>": 1, "<-0.31424,0.38921,0.64029>": 1, "<-0.30735,0.39447,0.63069>": 1, "<-0.30084,0.39940,0.61983>": 1, "<-0.29485,0.40469,0.60863>": 1, "<-0.28933,0.41052,0.59773>": 1, "<-0.28430,0.41681,0.58686>": 1, "<-0.27909,0.42311,0.57604>": 1, "<-0.27301,0.42853,0.56532>": 1, "<-0.26602,0.43240,0.55466>": 1, "<-0.25841,0.43442,0.54401>": 1, "<-0.25075,0.43432,0.53334>": 1, "<-0.24339,0.43217,0.52278>": 1, "<-0.23586,0.43087,0.51248>": 1, "<-0.22802,0.43085,0.50267>": 1, "<-0.22010,0.43168,0.49251>": 1, "<-0.21001,-0.44028,0.49977>": 1, "<-0.21646,-0.43604,0.50977>": 1, "<-0.22380,-0.43279,0.52012>": 1, "<-0.23135,-0.43107,0.53039>": 1, "<-0.23945,-0.43073,0.54104>": 1, "<-0.24711,-0.43164,0.55148>": 1, "<-0.25484,-0.43253,0.56231>": 1, "<-0.26226,-0.43098,0.57317>": 1, "<-0.26925,-0.42727,0.58417>": 1, "<-0.27530,-0.42220,0.59514>": 1, "<-0.28099,-0.41660,0.60607>": 1, "<-0.28626,-0.41076,0.61728>": 1, "<-0.29229,-0.40572,0.62843>": 1, "<-0.29876,-0.40108,0.63920>": 1, "<-0.30539,-0.39661,0.65050>": 1, "<-0.30427,-0.38213,0.66050>": 1, "<-0.30375,-0.36855,0.66012>": 1, "<-0.30347,-0.35517,ZP>": 1, "<-0.30319,-0.34191,ZP>": 1, "<-0.30264,-0.32845,ZP>": 1, "<-0.30220,-0.31521,ZP>": 1, "<-0.30173,-0.30198,ZP>": 1, "<-0.30124,-0.28878,ZP>": 1, "<-0.30077,-0.27564,ZP>": 1, "<-0.30032,-0.26254,ZP>": 1, "<-0.29990,-0.24949,ZP>": 1, "<-0.29950,-0.23649,ZP>": 1, "<-0.29913,-0.22352,ZP>": 1, "<-0.29878,-0.21059,ZP>": 1, "<-0.29846,-0.19768,ZP>": 1, "<-0.29816,-0.18480,ZP>": 1, "<-0.29788,-0.17194,ZP>": 1, "<-0.29763,-0.15910,ZP>": 1, "<-0.29741,-0.14628,ZP>": 1, "<-0.29721,-0.13348,ZP>": 1, "<-0.29704,-0.12070,ZP>": 1, "<-0.29689,-0.10794,ZP>": 1, "<-0.29676,-0.09520,ZP>": 1, "<-0.29666,-0.08248,ZP>": 1, "<-0.29657,-0.06977,ZP>": 1, "<-0.29650,-0.05707,ZP>": 1, "<-0.29645,-0.04438,ZP>": 1, "<-0.29641,-0.03170,ZP>": 1, "<-0.29639,-0.01903,ZP>": 1, "<-0.29638,-0.00636,ZP>": 1, "<-0.29638,0.00631,ZP>": 1, "<-0.29640,0.01898,ZP>": 1, "<-0.29642,0.03166,ZP>": 1, "<-0.29647,0.04433,ZP>": 1, "<-0.29652,0.05702,ZP>": 1, "<-0.29660,0.06971,ZP>": 1, "<-0.29668,0.08241,ZP>": 1, "<-0.29679,0.09513,ZP>": 1, "<-0.29692,0.10786,ZP>": 1, "<-0.29707,0.12061,ZP>": 1, "<-0.29724,0.13337,ZP>": 1, "<-0.29743,0.14616,ZP>": 1, "<-0.29765,0.15896,ZP>": 1, "<-0.29789,0.17179,ZP>": 1, "<-0.29816,0.18464,ZP>": 1, "<-0.29844,0.19750,ZP>": 1, "<-0.29876,0.21039,ZP>": 1, "<-0.29909,0.22330,ZP>": 1, "<-0.29944,0.23625,ZP>": 1, "<-0.29983,0.24922,ZP>": 1, "<-0.30025,0.26223,ZP>": 1, "<-0.30069,0.27529,ZP>": 1, "<-0.30117,0.28838,ZP>": 1, "<-0.30168,0.30151,ZP>": 1, "<-0.30218,0.31467,ZP>": 1, "<-0.30264,0.32782,ZP>": 1, "<-0.30324,0.34117,ZP>": 1, "<-0.30359,0.35438,ZP>": 1, "<-0.30404,0.36775,0.66013>": 1, "<-0.30471,0.38121,0.66049>": 1, "<-0.30628,0.39590,0.65106>": 1, "<-0.29970,0.40039,0.63965>": 1, "<-0.29316,0.40509,0.62885>": 1, "<-0.28711,0.41017,0.61768>": 1, "<-0.28190,0.41616,0.60645>": 1, "<-0.27633,0.42183,0.59547>": 1, "<-0.27037,0.42706,0.58449>": 1, "<-0.26370,0.43096,0.57356>": 1, "<-0.25638,0.43309,0.56269>": 1, "<-0.24884,0.43299,0.55187>": 1, "<-0.24125,0.43165,0.54119>": 1, "<-0.23361,0.43129,0.53080>": 1, "<-0.22578,0.43201,0.52045>": 1, "<-0.21821,0.43392,0.51025>": 1, "<-0.21125,0.43717,0.49986>": 1, "<-0.20638,-0.45062,0.50626>": 1, "<-0.21059,-0.44502,0.51674>": 1, "<-0.21590,-0.43994,0.52739>": 1, "<-0.22224,-0.43578,0.53789>": 1, "<-0.22971,-0.43286,0.54872>": 1, "<-0.23737,-0.43173,0.55938>": 1, "<-0.24519,-0.43194,0.57031>": 1, "<-0.25269,-0.43198,0.58118>": 1, "<-0.25998,-0.42983,0.59238>": 1, "<-0.26652,-0.42603,0.60351>": 1, "<-0.27256,-0.42142,0.61477>": 1, "<-0.27787,-0.41569,0.62603>": 1, "<-0.28429,-0.41140,0.63701>": 1, "<-0.29080,-0.40722,0.64818>": 1, "<-0.29145,-0.39493,0.66059>": 1, "<-0.29092,-0.38127,0.66016>": 1, "<-0.29069,-0.36800,0.66008>": 1, "<-0.29033,-0.35462,ZP>": 1, "<-0.28979,-0.34112,ZP>": 1, "<-0.28941,-0.32786,ZP>": 1, "<-0.28900,-0.31465,ZP>": 1, "<-0.28856,-0.30146,ZP>": 1, "<-0.28813,-0.28832,ZP>": 1, "<-0.28770,-0.27522,ZP>": 1, "<-0.28729,-0.26217,ZP>": 1, "<-0.28690,-0.24915,ZP>": 1, "<-0.28654,-0.23617,ZP>": 1, "<-0.28619,-0.22323,ZP>": 1, "<-0.28587,-0.21032,ZP>": 1, "<-0.28558,-0.19743,ZP>": 1, "<-0.28531,-0.18457,ZP>": 1, "<-0.28506,-0.17174,ZP>": 1, "<-0.28483,-0.15892,ZP>": 1, "<-0.28462,-0.14612,ZP>": 1, "<-0.28444,-0.13334,ZP>": 1, "<-0.28428,-0.12058,ZP>": 1, "<-0.28414,-0.10784,ZP>": 1, "<-0.28403,-0.09511,ZP>": 1, "<-0.28393,-0.08240,ZP>": 1, "<-0.28385,-0.06970,ZP>": 1, "<-0.28378,-0.05702,ZP>": 1, "<-0.28373,-0.04434,ZP>": 1, "<-0.28369,-0.03167,ZP>": 1, "<-0.28367,-0.01901,ZP>": 1, "<-0.28366,-0.00635,ZP>": 1, "<-0.28366,0.00631,ZP>": 1, "<-0.28368,0.01897,ZP>": 1, "<-0.28370,0.03164,ZP>": 1, "<-0.28374,0.04430,ZP>": 1, "<-0.28379,0.05698,ZP>": 1, "<-0.28386,0.06966,ZP>": 1, "<-0.28394,0.08235,ZP>": 1, "<-0.28404,0.09506,ZP>": 1, "<-0.28416,0.10777,ZP>": 1, "<-0.28430,0.12051,ZP>": 1, "<-0.28446,0.13326,ZP>": 1, "<-0.28463,0.14602,ZP>": 1, "<-0.28483,0.15881,ZP>": 1, "<-0.28505,0.17161,ZP>": 1, "<-0.28529,0.18443,ZP>": 1, "<-0.28556,0.19728,ZP>": 1, "<-0.28584,0.21014,ZP>": 1, "<-0.28614,0.22303,ZP>": 1, "<-0.28647,0.23595,ZP>": 1, "<-0.28683,0.24890,ZP>": 1, "<-0.28721,0.26188,ZP>": 1, "<-0.28762,0.27490,ZP>": 1, "<-0.28805,0.28796,ZP>": 1, "<-0.28849,0.30104,ZP>": 1, "<-0.28895,0.31416,ZP>": 1, "<-0.28938,0.32730,ZP>": 1, "<-0.28981,0.34050,ZP>": 1, "<-0.29042,0.35393,ZP>": 1, "<-0.29098,0.36733,0.66009>": 1, "<-0.29136,0.38053,0.66017>": 1, "<-0.29194,0.39394,0.66061>": 1, "<-0.29172,0.40659,0.64852>": 1, "<-0.28521,0.41077,0.63737>": 1, "<-0.27874,0.41510,0.62631>": 1, "<-0.27346,0.42101,0.61505>": 1, "<-0.26756,0.42576,0.60372>": 1, "<-0.26115,0.42977,0.59271>": 1, "<-0.25411,0.43229,0.58153>": 1, "<-0.24670,0.43265,0.57067>": 1, "<-0.23920,0.43222,0.55980>": 1, "<-0.23159,0.43264,0.54914>": 1, "<-0.22398,0.43417,0.53841>": 1, "<-0.21681,0.43728,0.52765>": 1, "<-0.21073,0.44153,0.51728>": 1, "<-0.20571,0.44654,0.50655>": 1, "<-0.20649,-0.46182,0.51226>": 1, "<-0.20843,-0.45560,0.52312>": 1, "<-0.21150,-0.44961,0.53422>": 1, "<-0.21586,-0.44409,0.54499>": 1, "<-0.22156,-0.43946,0.55601>": 1, "<-0.22824,-0.43615,0.56710>": 1, "<-0.23576,-0.43433,0.57834>": 1, "<-0.24315,-0.43353,0.58911>": 1, "<-0.25074,-0.43260,0.60058>": 1, "<-0.25742,-0.42959,0.61170>": 1, "<-0.26326,-0.42511,0.62307>": 1, "<-0.26959,-0.42114,0.63432>": 1, "<-0.27594,-0.41723,0.64555>": 1, "<-0.27912,-0.40869,0.65949>": 1, "<-0.27782,-0.39385,0.66018>": 1, "<-0.27765,-0.38058,0.66008>": 1, "<-0.27744,-0.36726,ZP>": 1, "<-0.27697,-0.35381,ZP>": 1, "<-0.27660,-0.34053,ZP>": 1, "<-0.27622,-0.32729,ZP>": 1, "<-0.27583,-0.31410,ZP>": 1, "<-0.27544,-0.30097,ZP>": 1, "<-0.27506,-0.28788,ZP>": 1, "<-0.27467,-0.27482,ZP>": 1, "<-0.27430,-0.26180,ZP>": 1, "<-0.27394,-0.24882,ZP>": 1, "<-0.27360,-0.23587,ZP>": 1, "<-0.27329,-0.22295,ZP>": 1, "<-0.27299,-0.21006,ZP>": 1, "<-0.27272,-0.19720,ZP>": 1, "<-0.27247,-0.18436,ZP>": 1, "<-0.27225,-0.17155,ZP>": 1, "<-0.27204,-0.15875,ZP>": 1, "<-0.27185,-0.14597,ZP>": 1, "<-0.27169,-0.13321,ZP>": 1, "<-0.27154,-0.12047,ZP>": 1, "<-0.27141,-0.10774,ZP>": 1, "<-0.27130,-0.09503,ZP>": 1, "<-0.27121,-0.08233,ZP>": 1, "<-0.27113,-0.06965,ZP>": 1, "<-0.27107,-0.05697,ZP>": 1, "<-0.27102,-0.04430,ZP>": 1, "<-0.27099,-0.03164,ZP>": 1, "<-0.27097,-0.01899,ZP>": 1, "<-0.27096,-0.00634,ZP>": 1, "<-0.27096,0.00631,ZP>": 1, "<-0.27097,0.01896,ZP>": 1, "<-0.27100,0.03162,ZP>": 1, "<-0.27103,0.04428,ZP>": 1, "<-0.27108,0.05694,ZP>": 1, "<-0.27114,0.06961,ZP>": 1, "<-0.27122,0.08229,ZP>": 1, "<-0.27131,0.09498,ZP>": 1, "<-0.27142,0.10769,ZP>": 1, "<-0.27155,0.12041,ZP>": 1, "<-0.27169,0.13314,ZP>": 1, "<-0.27185,0.14589,ZP>": 1, "<-0.27204,0.15865,ZP>": 1, "<-0.27224,0.17143,ZP>": 1, "<-0.27245,0.18423,ZP>": 1, "<-0.27269,0.19705,ZP>": 1, "<-0.27295,0.20990,ZP>": 1, "<-0.27323,0.22276,ZP>": 1, "<-0.27353,0.23566,ZP>": 1, "<-0.27386,0.24858,ZP>": 1, "<-0.27421,0.26154,ZP>": 1, "<-0.27458,0.27453,ZP>": 1, "<-0.27497,0.28754,ZP>": 1, "<-0.27536,0.30059,ZP>": 1, "<-0.27577,0.31367,ZP>": 1, "<-0.27618,0.32680,ZP>": 1, "<-0.27661,0.33999,ZP>": 1, "<-0.27705,0.35324,ZP>": 1, "<-0.27762,0.36665,ZP>": 1, "<-0.27795,0.37993,0.66008>": 1, "<-0.27824,0.39312,0.66018>": 1, "<-0.27955,0.40774,0.65974>": 1, "<-0.27675,0.41671,0.64585>": 1, "<-0.27042,0.42060,0.63456>": 1, "<-0.26425,0.42470,0.62331>": 1, "<-0.25841,0.42930,0.61191>": 1, "<-0.25172,0.43207,0.60076>": 1, "<-0.24452,0.43366,0.58963>": 1, "<-0.23715,0.43425,0.57852>": 1, "<-0.22968,0.43521,0.56746>": 1, "<-0.22256,0.43749,0.55652>": 1, "<-0.21620,0.44125,0.54553>": 1, "<-0.21084,0.44622,0.53461>": 1, "<-0.20664,0.45162,0.52373>": 1, "<-0.20376,0.45753,0.51261>": 1, "<-0.20368,-0.47191,0.51881>": 1, "<-0.20749,-0.46663,0.52958>": 1, "<-0.21101,-0.46066,0.54042>": 1, "<-0.21306,-0.45433,0.55151>": 1, "<-0.21586,-0.44857,0.56284>": 1, "<-0.22101,-0.44372,0.57434>": 1, "<-0.22740,-0.44016,0.58567>": 1, "<-0.23425,-0.43767,0.59660>": 1, "<-0.24230,-0.43742,0.60824>": 1, "<-0.24842,-0.43396,0.61997>": 1, "<-0.25463,-0.43034,0.63124>": 1, "<-0.26093,-0.42664,0.64236>": 1, "<-0.26631,-0.42184,0.65582>": 1, "<-0.26471,-0.40640,0.66024>": 1, "<-0.26458,-0.39310,0.66008>": 1, "<-0.26449,-0.37987,ZP>": 1, "<-0.26413,-0.36646,ZP>": 1, "<-0.26381,-0.35320,ZP>": 1, "<-0.26346,-0.33996,ZP>": 1, "<-0.26309,-0.32675,ZP>": 1, "<-0.26272,-0.31360,ZP>": 1, "<-0.26237,-0.30051,ZP>": 1, "<-0.26202,-0.28745,ZP>": 1, "<-0.26167,-0.27443,ZP>": 1, "<-0.26133,-0.26145,ZP>": 1, "<-0.26100,-0.24850,ZP>": 1, "<-0.26070,-0.23557,ZP>": 1, "<-0.26041,-0.22268,ZP>": 1, "<-0.26014,-0.20982,ZP>": 1, "<-0.25989,-0.19698,ZP>": 1, "<-0.25966,-0.18416,ZP>": 1, "<-0.25946,-0.17136,ZP>": 1, "<-0.25927,-0.15859,ZP>": 1, "<-0.25910,-0.14583,ZP>": 1, "<-0.25895,-0.13309,ZP>": 1, "<-0.25881,-0.12036,ZP>": 1, "<-0.25869,-0.10765,ZP>": 1, "<-0.25859,-0.09495,ZP>": 1, "<-0.25851,-0.08226,ZP>": 1, "<-0.25844,-0.06959,ZP>": 1, "<-0.25838,-0.05693,ZP>": 1, "<-0.25833,-0.04427,ZP>": 1, "<-0.25830,-0.03162,ZP>": 1, "<-0.25828,-0.01897,ZP>": 1, "<-0.25827,-0.00633,ZP>": 1, "<-0.25827,0.00631,ZP>": 1, "<-0.25828,0.01895,ZP>": 1, "<-0.25830,0.03160,ZP>": 1, "<-0.25834,0.04425,ZP>": 1, "<-0.25838,0.05690,ZP>": 1, "<-0.25844,0.06956,ZP>": 1, "<-0.25851,0.08223,ZP>": 1, "<-0.25860,0.09491,ZP>": 1, "<-0.25870,0.10760,ZP>": 1, "<-0.25881,0.12031,ZP>": 1, "<-0.25894,0.13302,ZP>": 1, "<-0.25909,0.14576,ZP>": 1, "<-0.25926,0.15850,ZP>": 1, "<-0.25944,0.17126,ZP>": 1, "<-0.25964,0.18404,ZP>": 1, "<-0.25985,0.19684,ZP>": 1, "<-0.26009,0.20967,ZP>": 1, "<-0.26035,0.22251,ZP>": 1, "<-0.26062,0.23538,ZP>": 1, "<-0.26092,0.24828,ZP>": 1, "<-0.26124,0.26121,ZP>": 1, "<-0.26158,0.27416,ZP>": 1, "<-0.26193,0.28715,ZP>": 1, "<-0.26229,0.30016,ZP>": 1, "<-0.26266,0.31321,ZP>": 1, "<-0.26305,0.32632,ZP>": 1, "<-0.26347,0.33949,ZP>": 1, "<-0.26389,0.35270,ZP>": 1, "<-0.26430,0.36592,ZP>": 1, "<-0.26475,0.37931,ZP>": 1, "<-0.26496,0.39246,0.66008>": 1, "<-0.26518,0.40573,0.66023>": 1, "<-0.26717,0.42107,0.65627>": 1, "<-0.26198,0.42607,0.64239>": 1, "<-0.25551,0.42985,0.63125>": 1, "<-0.24919,0.43351,0.62019>": 1, "<-0.24312,0.43695,0.60857>": 1, "<-0.23538,0.43721,0.59729>": 1, "<-0.22830,0.43904,0.58608>": 1, "<-0.22150,0.44163,0.57461>": 1, "<-0.21565,0.44549,0.56332>": 1, "<-0.21115,0.45045,0.55208>": 1, "<-0.20829,0.45650,0.54088>": 1, "<-0.20623,0.46274,0.52973>": 1, "<-0.20333,0.46859,0.51872>": 1, "<-0.19556,-0.47939,0.52551>": 1, "<-0.20067,-0.47522,0.53661>": 1, "<-0.20579,-0.46996,0.54717>": 1, "<-0.20993,-0.46447,0.55807>": 1, "<-0.21300,-0.45891,0.56953>": 1, "<-0.21604,-0.45267,0.58144>": 1, "<-0.22041,-0.44786,0.59257>": 1, "<-0.22741,-0.44532,0.60387>": 1, "<-0.23347,-0.44220,0.61568>": 1, "<-0.23952,-0.43897,0.62752>": 1, "<-0.24554,-0.43564,0.63887>": 1, "<-0.25174,-0.43244,0.65064>": 1, "<-0.25161,-0.41865,0.66031>": 1, "<-0.25140,-0.40552,0.66009>": 1, "<-0.25148,-0.39240,ZP>": 1, "<-0.25126,-0.37910,ZP>": 1, "<-0.25094,-0.36580,ZP>": 1, "<-0.25066,-0.35259,ZP>": 1, "<-0.25034,-0.33939,ZP>": 1, "<-0.25000,-0.32624,ZP>": 1, "<-0.24967,-0.31313,ZP>": 1, "<-0.24934,-0.30007,ZP>": 1, "<-0.24902,-0.28705,ZP>": 1, "<-0.24870,-0.27407,ZP>": 1, "<-0.24839,-0.26112,ZP>": 1, "<-0.24810,-0.24819,ZP>": 1, "<-0.24782,-0.23530,ZP>": 1, "<-0.24755,-0.22243,ZP>": 1, "<-0.24731,-0.20959,ZP>": 1, "<-0.24708,-0.19677,ZP>": 1, "<-0.24687,-0.18397,ZP>": 1, "<-0.24668,-0.17119,ZP>": 1, "<-0.24651,-0.15843,ZP>": 1, "<-0.24636,-0.14569,ZP>": 1, "<-0.24622,-0.13297,ZP>": 1, "<-0.24610,-0.12026,ZP>": 1, "<-0.24599,-0.10756,ZP>": 1, "<-0.24590,-0.09488,ZP>": 1, "<-0.24582,-0.08220,ZP>": 1, "<-0.24575,-0.06954,ZP>": 1, "<-0.24570,-0.05688,ZP>": 1, "<-0.24566,-0.04424,ZP>": 1, "<-0.24563,-0.03160,ZP>": 1, "<-0.24561,-0.01896,ZP>": 1, "<-0.24560,-0.00632,ZP>": 1, "<-0.24560,0.00631,ZP>": 1, "<-0.24561,0.01894,ZP>": 1, "<-0.24563,0.03158,ZP>": 1, "<-0.24566,0.04422,ZP>": 1, "<-0.24570,0.05686,ZP>": 1, "<-0.24575,0.06952,ZP>": 1, "<-0.24582,0.08217,ZP>": 1, "<-0.24590,0.09484,ZP>": 1, "<-0.24599,0.10752,ZP>": 1, "<-0.24609,0.12021,ZP>": 1, "<-0.24621,0.13291,ZP>": 1, "<-0.24634,0.14563,ZP>": 1, "<-0.24649,0.15836,ZP>": 1, "<-0.24666,0.17110,ZP>": 1, "<-0.24684,0.18386,ZP>": 1, "<-0.24704,0.19665,ZP>": 1, "<-0.24725,0.20945,ZP>": 1, "<-0.24749,0.22227,ZP>": 1, "<-0.24774,0.23512,ZP>": 1, "<-0.24802,0.24799,ZP>": 1, "<-0.24831,0.26089,ZP>": 1, "<-0.24861,0.27382,ZP>": 1, "<-0.24893,0.28677,ZP>": 1, "<-0.24927,0.29976,ZP>": 1, "<-0.24962,0.31279,ZP>": 1, "<-0.24998,0.32586,ZP>": 1, "<-0.25036,0.33898,ZP>": 1, "<-0.25074,0.35215,ZP>": 1, "<-0.25110,0.36533,ZP>": 1, "<-0.25148,0.37859,ZP>": 1, "<-0.25180,0.39184,ZP>": 1, "<-0.25182,0.40495,0.66009>": 1, "<-0.25225,0.41773,0.66047>": 1, "<-0.25269,0.43200,0.65084>": 1, "<-0.24637,0.43520,0.63904>": 1, "<-0.24037,0.43848,0.62784>": 1, "<-0.23434,0.44172,0.61598>": 1, "<-0.22829,0.44488,0.60422>": 1, "<-0.22091,0.44580,0.59287>": 1, "<-0.21513,0.44977,0.58120>": 1, "<-0.21110,0.45508,0.56991>": 1, "<-0.20888,0.46102,0.55861>": 1, "<-0.20574,0.46687,0.54733>": 1, "<-0.20198,0.47247,0.53634>": 1, "<-0.19770,0.47800,0.52537>": 1, "<-0.18403,-0.48026,0.53136>": 1, "<-0.18991,-0.47865,0.54301>": 1, "<-0.19614,-0.47567,0.55376>": 1, "<-0.20165,-0.47168,0.56470>": 1, "<-0.20643,-0.46684,0.57624>": 1, "<-0.21061,-0.46118,0.58823>": 1, "<-0.21386,-0.45546,0.59919>": 1, "<-0.21835,-0.45047,0.61159>": 1, "<-0.22428,-0.44697,0.62236>": 1, "<-0.23041,-0.44390,0.63415>": 1, "<-0.23863,-0.43351,0.65005>": 1, "<-0.23838,-0.43185,0.65998>": 1, "<-0.23804,-0.41742,ZP>": 1, "<-0.23826,-0.40479,ZP>": 1, "<-0.23826,-0.39162,ZP>": 1, "<-0.23800,-0.37834,ZP>": 1, "<-0.23781,-0.36517,ZP>": 1, "<-0.23755,-0.35201,ZP>": 1, "<-0.23726,-0.33887,ZP>": 1, "<-0.23696,-0.32577,ZP>": 1, "<-0.23666,-0.31270,ZP>": 1, "<-0.23635,-0.29967,ZP>": 1, "<-0.23606,-0.28668,ZP>": 1, "<-0.23577,-0.27373,ZP>": 1, "<-0.23549,-0.26080,ZP>": 1, "<-0.23522,-0.24791,ZP>": 1, "<-0.23496,-0.23504,ZP>": 1, "<-0.23472,-0.22219,ZP>": 1, "<-0.23450,-0.20937,ZP>": 1, "<-0.23429,-0.19657,ZP>": 1, "<-0.23410,-0.18379,ZP>": 1, "<-0.23393,-0.17103,ZP>": 1, "<-0.23377,-0.15829,ZP>": 1, "<-0.23363,-0.14557,ZP>": 1, "<-0.23351,-0.13286,ZP>": 1, "<-0.23339,-0.12016,ZP>": 1, "<-0.23330,-0.10748,ZP>": 1, "<-0.23321,-0.09480,ZP>": 1, "<-0.23314,-0.08214,ZP>": 1, "<-0.23308,-0.06949,ZP>": 1, "<-0.23303,-0.05684,ZP>": 1, "<-0.23299,-0.04421,ZP>": 1, "<-0.23296,-0.03157,ZP>": 1, "<-0.23294,-0.01894,ZP>": 1, "<-0.23294,-0.00632,ZP>": 1, "<-0.23294,0.00631,ZP>": 1, "<-0.23295,0.01893,ZP>": 1, "<-0.23296,0.03156,ZP>": 1, "<-0.23299,0.04419,ZP>": 1, "<-0.23303,0.05683,ZP>": 1, "<-0.23308,0.06947,ZP>": 1, "<-0.23314,0.08212,ZP>": 1, "<-0.23321,0.09478,ZP>": 1, "<-0.23329,0.10744,ZP>": 1, "<-0.23339,0.12012,ZP>": 1, "<-0.23349,0.13281,ZP>": 1, "<-0.23361,0.14551,ZP>": 1, "<-0.23375,0.15822,ZP>": 1, "<-0.23390,0.17095,ZP>": 1, "<-0.23406,0.18370,ZP>": 1, "<-0.23424,0.19646,ZP>": 1, "<-0.23444,0.20924,ZP>": 1, "<-0.23466,0.22205,ZP>": 1, "<-0.23489,0.23487,ZP>": 1, "<-0.23514,0.24772,ZP>": 1, "<-0.23540,0.26060,ZP>": 1, "<-0.23568,0.27350,ZP>": 1, "<-0.23598,0.28643,ZP>": 1, "<-0.23629,0.29939,ZP>": 1, "<-0.23661,0.31239,ZP>": 1, "<-0.23695,0.32543,ZP>": 1, "<-0.23729,0.33850,ZP>": 1, "<-0.23764,0.35161,ZP>": 1, "<-0.23796,0.36474,ZP>": 1, "<-0.23823,0.37789,ZP>": 1, "<-0.23857,0.39111,ZP>": 1, "<-0.23869,0.40428,ZP>": 1, "<-0.23835,0.41669,0.66022>": 1, "<-0.23912,0.43123,0.66017>": 1, "<-0.22965,0.44030,0.64230>": 1, "<-0.23254,0.44296,0.63281>": 1, "<-0.22525,0.44652,0.62038>": 1, "<-0.21923,0.44940,0.61111>": 1, "<-0.21374,0.45302,0.59985>": 1, "<-0.20986,0.45842,0.58797>": 1, "<-0.20649,0.46433,0.57654>": 1, "<-0.20276,0.46981,0.56524>": 1, "<-0.19823,0.47490,0.55392>": 1, "<-0.19311,0.47903,0.54276>": 1, "<-0.18760,0.48307,0.53155>": 1, "<-0.17340,-0.47535,0.53624>": 1, "<-0.17864,-0.47567,0.54829>": 1, "<-0.18447,-0.47522,0.55947>": 1, "<-0.19046,-0.47378,0.57074>": 1, "<-0.19631,-0.47083,0.58247>": 1, "<-0.20152,-0.46662,0.59459>": 1, "<-0.20578,-0.46185,0.60594>": 1, "<-0.21011,-0.45623,0.61821>": 1, "<-0.21454,-0.45174,0.62898>": 1, "<-0.22083,-0.44876,0.64137>": 1, "<-0.22574,-0.44548,0.65492>": 1, "<-0.22460,-0.43014,0.66019>": 1, "<-0.22467,-0.41687,ZP>": 1, "<-0.22505,-0.40400,ZP>": 1, "<-0.22493,-0.39075,ZP>": 1, "<-0.22486,-0.37768,ZP>": 1, "<-0.22469,-0.36457,ZP>": 1, "<-0.22447,-0.35146,ZP>": 1, "<-0.22422,-0.33837,ZP>": 1, "<-0.22395,-0.32532,ZP>": 1, "<-0.22367,-0.31229,ZP>": 1, "<-0.22340,-0.29930,ZP>": 1, "<-0.22313,-0.28634,ZP>": 1, "<-0.22286,-0.27341,ZP>": 1, "<-0.22261,-0.26051,ZP>": 1, "<-0.22236,-0.24764,ZP>": 1, "<-0.22213,-0.23479,ZP>": 1, "<-0.22191,-0.22197,ZP>": 1, "<-0.22171,-0.20917,ZP>": 1, "<-0.22152,-0.19639,ZP>": 1, "<-0.22135,-0.18363,ZP>": 1, "<-0.22119,-0.17089,ZP>": 1, "<-0.22105,-0.15816,ZP>": 1, "<-0.22092,-0.14545,ZP>": 1, "<-0.22081,-0.13275,ZP>": 1, "<-0.22070,-0.12007,ZP>": 1, "<-0.22062,-0.10740,ZP>": 1, "<-0.22054,-0.09474,ZP>": 1, "<-0.22047,-0.08209,ZP>": 1, "<-0.22042,-0.06944,ZP>": 1, "<-0.22037,-0.05681,ZP>": 1, "<-0.22034,-0.04418,ZP>": 1, "<-0.22031,-0.03155,ZP>": 1, "<-0.22029,-0.01893,ZP>": 1, "<-0.22029,-0.00631,ZP>": 1, "<-0.22029,0.00630,ZP>": 1, "<-0.22030,0.01892,ZP>": 1, "<-0.22031,0.03154,ZP>": 1, "<-0.22034,0.04417,ZP>": 1, "<-0.22037,0.05679,ZP>": 1, "<-0.22042,0.06943,ZP>": 1, "<-0.22047,0.08207,ZP>": 1, "<-0.22053,0.09471,ZP>": 1, "<-0.22061,0.10737,ZP>": 1, "<-0.22069,0.12003,ZP>": 1, "<-0.22079,0.13271,ZP>": 1, "<-0.22090,0.14540,ZP>": 1, "<-0.22102,0.15810,ZP>": 1, "<-0.22116,0.17081,ZP>": 1, "<-0.22131,0.18354,ZP>": 1, "<-0.22147,0.19629,ZP>": 1, "<-0.22165,0.20905,ZP>": 1, "<-0.22185,0.22184,ZP>": 1, "<-0.22206,0.23464,ZP>": 1, "<-0.22229,0.24747,ZP>": 1, "<-0.22253,0.26032,ZP>": 1, "<-0.22279,0.27320,ZP>": 1, "<-0.22306,0.28610,ZP>": 1, "<-0.22334,0.29904,ZP>": 1, "<-0.22364,0.31201,ZP>": 1, "<-0.22395,0.32501,ZP>": 1, "<-0.22426,0.33804,ZP>": 1, "<-0.22456,0.35109,ZP>": 1, "<-0.22485,0.36417,ZP>": 1, "<-0.22509,0.37727,ZP>": 1, "<-0.22523,0.39029,ZP>": 1, "<-0.22545,0.40353,ZP>": 1, "<-0.22517,0.41642,0.66010>": 1, "<-0.22543,0.42960,0.66019>": 1, "<-0.22676,0.44471,0.65512>": 1, "<-0.22111,0.44888,0.64111>": 1, "<-0.21432,0.45214,0.62776>": 1, "<-0.21055,0.45457,0.61739>": 1, "<-0.20643,0.46030,0.60643>": 1, "<-0.20267,0.46581,0.59457>": 1, "<-0.19853,0.47089,0.58297>": 1, "<-0.19309,0.47519,0.57143>": 1, "<-0.18737,0.47814,0.55990>": 1, "<-0.18176,0.47995,0.54833>": 1, "<-0.17603,0.48133,0.53667>": 1, "<-0.16437,-0.46739,0.54093>": 1, "<-0.16960,-0.46787,0.55281>": 1, "<-0.17448,-0.46911,0.56429>": 1, "<-0.17939,-0.47086,0.57611>": 1, "<-0.18511,-0.47061,0.58782>": 1, "<-0.19072,-0.46832,0.59991>": 1, "<-0.19554,-0.46489,0.61184>": 1, "<-0.20005,-0.45988,0.62421>": 1, "<-0.20510,-0.45608,0.63591>": 1, "<-0.20216,-0.45179,0.65001>": 1, "<-0.21162,-0.44279,0.66045>": 1, "<-0.21138,-0.42933,0.66007>": 1, "<-0.21161,-0.41634,ZP>": 1, "<-0.21178,-0.40320,ZP>": 1, "<-0.21176,-0.39010,ZP>": 1, "<-0.21173,-0.37706,ZP>": 1, "<-0.21159,-0.36399,ZP>": 1, "<-0.21142,-0.35094,ZP>": 1, "<-0.21120,-0.33791,ZP>": 1, "<-0.21097,-0.32490,ZP>": 1, "<-0.21072,-0.31191,ZP>": 1, "<-0.21047,-0.29895,ZP>": 1, "<-0.21023,-0.28602,ZP>": 1, "<-0.20999,-0.27312,ZP>": 1, "<-0.20975,-0.26024,ZP>": 1, "<-0.20953,-0.24739,ZP>": 1, "<-0.20932,-0.23457,ZP>": 1, "<-0.20912,-0.22177,ZP>": 1, "<-0.20894,-0.20898,ZP>": 1, "<-0.20877,-0.19622,ZP>": 1, "<-0.20861,-0.18348,ZP>": 1, "<-0.20847,-0.17075,ZP>": 1, "<-0.20834,-0.15804,ZP>": 1, "<-0.20822,-0.14534,ZP>": 1, "<-0.20812,-0.13266,ZP>": 1, "<-0.20803,-0.11999,ZP>": 1, "<-0.20795,-0.10733,ZP>": 1, "<-0.20788,-0.09468,ZP>": 1, "<-0.20782,-0.08204,ZP>": 1, "<-0.20777,-0.06940,ZP>": 1, "<-0.20773,-0.05677,ZP>": 1, "<-0.20770,-0.04415,ZP>": 1, "<-0.20767,-0.03154,ZP>": 1, "<-0.20766,-0.01892,ZP>": 1, "<-0.20765,-0.00631,ZP>": 1, "<-0.20765,0.00630,ZP>": 1, "<-0.20766,0.01891,ZP>": 1, "<-0.20767,0.03153,ZP>": 1, "<-0.20769,0.04414,ZP>": 1, "<-0.20773,0.05676,ZP>": 1, "<-0.20777,0.06939,ZP>": 1, "<-0.20781,0.08202,ZP>": 1, "<-0.20787,0.09465,ZP>": 1, "<-0.20794,0.10730,ZP>": 1, "<-0.20801,0.11995,ZP>": 1, "<-0.20810,0.13262,ZP>": 1, "<-0.20820,0.14529,ZP>": 1, "<-0.20831,0.15798,ZP>": 1, "<-0.20843,0.17068,ZP>": 1, "<-0.20857,0.18339,ZP>": 1, "<-0.20872,0.19613,ZP>": 1, "<-0.20888,0.20887,ZP>": 1, "<-0.20906,0.22164,ZP>": 1, "<-0.20925,0.23443,ZP>": 1, "<-0.20946,0.24724,ZP>": 1, "<-0.20968,0.26007,ZP>": 1, "<-0.20992,0.27292,ZP>": 1, "<-0.21017,0.28580,ZP>": 1, "<-0.21043,0.29871,ZP>": 1, "<-0.21070,0.31165,ZP>": 1, "<-0.21098,0.32461,ZP>": 1, "<-0.21126,0.33760,ZP>": 1, "<-0.21152,0.35060,ZP>": 1, "<-0.21176,0.36363,ZP>": 1, "<-0.21197,0.37667,ZP>": 1, "<-0.21207,0.38968,ZP>": 1, "<-0.21218,0.40277,ZP>": 1, "<-0.21218,0.41593,ZP>": 1, "<-0.21214,0.42881,ZP>": 1, "<-0.21249,0.44208,0.66040>": 1, "<-0.21545,0.44928,0.64426>": 1, "<-0.20408,0.45660,0.63599>": 1, "<-0.20099,0.45922,0.62433>": 1, "<-0.19694,0.46516,0.61266>": 1, "<-0.19250,0.46959,0.60076>": 1, "<-0.18772,0.47300,0.58873>": 1, "<-0.18189,0.47529,0.57694>": 1, "<-0.17611,0.47622,0.56501>": 1, "<-0.17091,0.47612,0.55317>": 1, "<-0.16608,0.47511,0.54122>": 1, "<-0.15269,-0.46565,0.54660>": 1, "<-0.15835,-0.46527,0.55807>": 1, "<-0.16378,-0.46553,0.56966>": 1, "<-0.16896,-0.46611,0.58143>": 1, "<-0.17444,-0.46687,0.59310>": 1, "<-0.17963,-0.46697,0.60494>": 1, "<-0.18481,-0.46626,0.61739>": 1, "<-0.18924,-0.46305,0.62951>": 1, "<-0.19473,-0.46058,0.64154>": 1, "<-0.19926,-0.45712,0.65587>": 1, "<-0.19825,-0.44179,0.66010>": 1, "<-0.19843,-0.42874,ZP>": 1, "<-0.19868,-0.41581,ZP>": 1, "<-0.19863,-0.40256,ZP>": 1, "<-0.19866,-0.38953,ZP>": 1, "<-0.19863,-0.37650,ZP>": 1, "<-0.19853,-0.36347,ZP>": 1, "<-0.19840,-0.35047,ZP>": 1, "<-0.19822,-0.33748,ZP>": 1, "<-0.19802,-0.32450,ZP>": 1, "<-0.19780,-0.31155,ZP>": 1, "<-0.19758,-0.29862,ZP>": 1, "<-0.19735,-0.28572,ZP>": 1, "<-0.19714,-0.27284,ZP>": 1, "<-0.19693,-0.25999,ZP>": 1, "<-0.19672,-0.24716,ZP>": 1, "<-0.19653,-0.23436,ZP>": 1, "<-0.19635,-0.22158,ZP>": 1, "<-0.19619,-0.20881,ZP>": 1, "<-0.19603,-0.19607,ZP>": 1, "<-0.19589,-0.18334,ZP>": 1, "<-0.19576,-0.17062,ZP>": 1, "<-0.19564,-0.15793,ZP>": 1, "<-0.19554,-0.14524,ZP>": 1, "<-0.19545,-0.13257,ZP>": 1, "<-0.19536,-0.11991,ZP>": 1, "<-0.19529,-0.10726,ZP>": 1, "<-0.19523,-0.09462,ZP>": 1, "<-0.19517,-0.08199,ZP>": 1, "<-0.19513,-0.06936,ZP>": 1, "<-0.19509,-0.05674,ZP>": 1, "<-0.19506,-0.04413,ZP>": 1, "<-0.19504,-0.03152,ZP>": 1, "<-0.19503,-0.01891,ZP>": 1, "<-0.19502,-0.00631,ZP>": 1, "<-0.19502,0.00630,ZP>": 1, "<-0.19503,0.01891,ZP>": 1, "<-0.19504,0.03151,ZP>": 1, "<-0.19506,0.04412,ZP>": 1, "<-0.19509,0.05673,ZP>": 1, "<-0.19512,0.06935,ZP>": 1, "<-0.19517,0.08197,ZP>": 1, "<-0.19522,0.09460,ZP>": 1, "<-0.19528,0.10724,ZP>": 1, "<-0.19535,0.11988,ZP>": 1, "<-0.19543,0.13253,ZP>": 1, "<-0.19552,0.14520,ZP>": 1, "<-0.19562,0.15787,ZP>": 1, "<-0.19573,0.17056,ZP>": 1, "<-0.19585,0.18326,ZP>": 1, "<-0.19598,0.19598,ZP>": 1, "<-0.19613,0.20871,ZP>": 1, "<-0.19629,0.22146,ZP>": 1, "<-0.19647,0.23423,ZP>": 1, "<-0.19666,0.24702,ZP>": 1, "<-0.19686,0.25983,ZP>": 1, "<-0.19707,0.27266,ZP>": 1, "<-0.19730,0.28552,ZP>": 1, "<-0.19754,0.29840,ZP>": 1, "<-0.19779,0.31131,ZP>": 1, "<-0.19803,0.32423,ZP>": 1, "<-0.19828,0.33718,ZP>": 1, "<-0.19851,0.35015,ZP>": 1, "<-0.19870,0.36312,ZP>": 1, "<-0.19887,0.37612,ZP>": 1, "<-0.19899,0.38914,ZP>": 1, "<-0.19905,0.40217,ZP>": 1, "<-0.19921,0.41540,ZP>": 1, "<-0.19896,0.42823,0.66009>": 1, "<-0.19877,0.44128,0.66020>": 1, "<-0.19990,0.45665,0.65627>": 1, "<-0.19568,0.46019,0.64221>": 1, "<-0.19129,0.46244,0.63073>": 1, "<-0.18640,0.46744,0.61833>": 1, "<-0.18165,0.46998,0.60577>": 1, "<-0.17674,0.47137,0.59359>": 1, "<-0.17150,0.47109,0.58173>": 1, "<-0.16629,0.47007,0.56968>": 1, "<-0.16132,0.46933,0.55779>": 1, "<-0.15653,0.46872,0.54611>": 1, "<-0.14237,-0.47192,0.55161>": 1, "<-0.14710,-0.47008,0.56314>": 1, "<-0.15232,-0.46873,0.57486>": 1, "<-0.15769,-0.46799,0.58681>": 1, "<-0.16320,-0.46787,0.59881>": 1, "<-0.16950,-0.47043,0.61094>": 1, "<-0.17429,-0.46865,0.62344>": 1, "<-0.17862,-0.46702,0.63500>": 1, "<-0.18411,-0.46503,0.64774>": 1, "<-0.18533,-0.45502,0.66027>": 1, "<-0.18425,-0.44097,ZP>": 1, "<-0.18495,-0.42772,ZP>": 1, "<-0.18551,-0.41512,ZP>": 1, "<-0.18558,-0.40204,ZP>": 1, "<-0.18561,-0.38902,ZP>": 1, "<-0.18559,-0.37600,ZP>": 1, "<-0.18552,-0.36301,ZP>": 1, "<-0.18541,-0.35004,ZP>": 1, "<-0.18526,-0.33708,ZP>": 1, "<-0.18509,-0.32414,ZP>": 1, "<-0.18490,-0.31122,ZP>": 1, "<-0.18470,-0.29832,ZP>": 1, "<-0.18450,-0.28545,ZP>": 1, "<-0.18431,-0.27259,ZP>": 1, "<-0.18412,-0.25976,ZP>": 1, "<-0.18394,-0.24696,ZP>": 1, "<-0.18376,-0.23417,ZP>": 1, "<-0.18360,-0.22140,ZP>": 1, "<-0.18345,-0.20865,ZP>": 1, "<-0.18331,-0.19592,ZP>": 1, "<-0.18318,-0.18321,ZP>": 1, "<-0.18307,-0.17051,ZP>": 1, "<-0.18296,-0.15782,ZP>": 1, "<-0.18287,-0.14515,ZP>": 1, "<-0.18278,-0.13249,ZP>": 1, "<-0.18271,-0.11984,ZP>": 1, "<-0.18264,-0.10720,ZP>": 1, "<-0.18259,-0.09457,ZP>": 1, "<-0.18254,-0.08195,ZP>": 1, "<-0.18250,-0.06933,ZP>": 1, "<-0.18247,-0.05672,ZP>": 1, "<-0.18244,-0.04411,ZP>": 1, "<-0.18242,-0.03150,ZP>": 1, "<-0.18241,-0.01890,ZP>": 1, "<-0.18240,-0.00630,ZP>": 1, "<-0.18240,0.00630,ZP>": 1, "<-0.18241,0.01890,ZP>": 1, "<-0.18242,0.03150,ZP>": 1, "<-0.18244,0.04410,ZP>": 1, "<-0.18246,0.05671,ZP>": 1, "<-0.18249,0.06932,ZP>": 1, "<-0.18253,0.08193,ZP>": 1, "<-0.18258,0.09455,ZP>": 1, "<-0.18263,0.10718,ZP>": 1, "<-0.18269,0.11981,ZP>": 1, "<-0.18276,0.13246,ZP>": 1, "<-0.18284,0.14511,ZP>": 1, "<-0.18293,0.15777,ZP>": 1, "<-0.18303,0.17045,ZP>": 1, "<-0.18314,0.18314,ZP>": 1, "<-0.18327,0.19584,ZP>": 1, "<-0.18340,0.20856,ZP>": 1, "<-0.18355,0.22130,ZP>": 1, "<-0.18370,0.23405,ZP>": 1, "<-0.18387,0.24682,ZP>": 1, "<-0.18406,0.25961,ZP>": 1, "<-0.18425,0.27243,ZP>": 1, "<-0.18446,0.28526,ZP>": 1, "<-0.18467,0.29812,ZP>": 1, "<-0.18489,0.31099,ZP>": 1, "<-0.18511,0.32389,ZP>": 1, "<-0.18532,0.33680,ZP>": 1, "<-0.18552,0.34973,ZP>": 1, "<-0.18569,0.36267,ZP>": 1, "<-0.18584,0.37564,ZP>": 1, "<-0.18595,0.38864,ZP>": 1, "<-0.18600,0.40164,ZP>": 1, "<-0.18602,0.41468,ZP>": 1, "<-0.18581,0.42766,0.66008>": 1, "<-0.18548,0.44075,0.66012>": 1, "<-0.18602,0.45441,0.66039>": 1, "<-0.18499,0.46473,0.64800>": 1, "<-0.18004,0.46648,0.63559>": 1, "<-0.17551,0.46852,0.62367>": 1, "<-0.17055,0.47002,0.61107>": 1, "<-0.16555,0.46924,0.59882>": 1, "<-0.16055,0.46900,0.58695>": 1, "<-0.15523,0.46860,0.57486>": 1, "<-0.14980,0.46824,0.56311>": 1, "<-0.14478,0.46853,0.55140>": 1, "<-0.13729,-0.48276,0.55536>": 1, "<-0.14016,-0.47973,0.56729>": 1, "<-0.14414,-0.47704,0.57931>": 1, "<-0.14851,-0.47503,0.59131>": 1, "<-0.15466,-0.47551,0.60347>": 1, "<-0.15922,-0.47399,0.61590>": 1, "<-0.16387,-0.47241,0.62854>": 1, "<-0.16866,-0.47072,0.64067>": 1, "<-0.17282,-0.46865,0.65422>": 1, "<-0.17227,-0.45413,0.66015>": 1, "<-0.17233,-0.44110,ZP>": 1, "<-0.17256,-0.42794,ZP>": 1, "<-0.17251,-0.41465,ZP>": 1, "<-0.17259,-0.40160,ZP>": 1, "<-0.17262,-0.38857,ZP>": 1, "<-0.17260,-0.37557,ZP>": 1, "<-0.17254,-0.36260,ZP>": 1, "<-0.17245,-0.34965,ZP>": 1, "<-0.17233,-0.33672,ZP>": 1, "<-0.17219,-0.32381,ZP>": 1, "<-0.17202,-0.31092,ZP>": 1, "<-0.17185,-0.29804,ZP>": 1, "<-0.17168,-0.28519,ZP>": 1, "<-0.17150,-0.27236,ZP>": 1, "<-0.17133,-0.25955,ZP>": 1, "<-0.17117,-0.24676,ZP>": 1, "<-0.17101,-0.23399,ZP>": 1, "<-0.17087,-0.22124,ZP>": 1, "<-0.17073,-0.20851,ZP>": 1, "<-0.17061,-0.19579,ZP>": 1, "<-0.17049,-0.18309,ZP>": 1, "<-0.17039,-0.17041,ZP>": 1, "<-0.17029,-0.15773,ZP>": 1, "<-0.17021,-0.14507,ZP>": 1, "<-0.17013,-0.13242,ZP>": 1, "<-0.17007,-0.11978,ZP>": 1, "<-0.17001,-0.10715,ZP>": 1, "<-0.16996,-0.09452,ZP>": 1, "<-0.16991,-0.08191,ZP>": 1, "<-0.16988,-0.06930,ZP>": 1, "<-0.16985,-0.05669,ZP>": 1, "<-0.16982,-0.04409,ZP>": 1, "<-0.16981,-0.03149,ZP>": 1, "<-0.16980,-0.01889,ZP>": 1, "<-0.16979,-0.00630,ZP>": 1, "<-0.16979,0.00629,ZP>": 1, "<-0.16980,0.01889,ZP>": 1, "<-0.16981,0.03148,ZP>": 1, "<-0.16982,0.04408,ZP>": 1, "<-0.16984,0.05668,ZP>": 1, "<-0.16987,0.06928,ZP>": 1, "<-0.16991,0.08189,ZP>": 1, "<-0.16995,0.09451,ZP>": 1, "<-0.17000,0.10713,ZP>": 1, "<-0.17005,0.11975,ZP>": 1, "<-0.17011,0.13239,ZP>": 1, "<-0.17018,0.14503,ZP>": 1, "<-0.17026,0.15769,ZP>": 1, "<-0.17035,0.17035,ZP>": 1, "<-0.17045,0.18303,ZP>": 1, "<-0.17056,0.19572,ZP>": 1, "<-0.17068,0.20843,ZP>": 1, "<-0.17081,0.22115,ZP>": 1, "<-0.17096,0.23389,ZP>": 1, "<-0.17111,0.24664,ZP>": 1, "<-0.17128,0.25941,ZP>": 1, "<-0.17145,0.27221,ZP>": 1, "<-0.17164,0.28502,ZP>": 1, "<-0.17183,0.29785,ZP>": 1, "<-0.17202,0.31070,ZP>": 1, "<-0.17222,0.32357,ZP>": 1, "<-0.17240,0.33645,ZP>": 1, "<-0.17257,0.34935,ZP>": 1, "<-0.17272,0.36227,ZP>": 1, "<-0.17285,0.37521,ZP>": 1, "<-0.17296,0.38819,ZP>": 1, "<-0.17301,0.40118,ZP>": 1, "<-0.17300,0.41420,ZP>": 1, "<-0.17310,0.42744,ZP>": 1, "<-0.17294,0.44058,ZP>": 1, "<-0.17292,0.45362,0.66013>": 1, "<-0.17356,0.46824,0.65449>": 1, "<-0.16947,0.47043,0.64086>": 1, "<-0.16473,0.47210,0.62875>": 1, "<-0.16010,0.47369,0.61617>": 1, "<-0.15562,0.47521,0.60372>": 1, "<-0.14946,0.47174,0.59192>": 1, "<-0.14434,0.47241,0.57970>": 1, "<-0.13930,0.47365,0.56791>": 1, "<-0.13483,0.47561,0.55594>": 1, "<-0.13307,-0.49386,0.55957>": 1, "<-0.13621,-0.49110,0.57141>": 1, "<-0.13929,-0.48800,0.58343>": 1, "<-0.14198,-0.48444,0.59560>": 1, "<-0.14488,-0.48060,0.60806>": 1, "<-0.14844,-0.47781,0.62050>": 1, "<-0.15316,-0.47598,0.63321>": 1, "<-0.15752,-0.47461,0.64557>": 1, "<-0.15969,-0.46795,0.65939>": 1, "<-0.15918,-0.45364,ZP>": 1, "<-0.15949,-0.44072,ZP>": 1, "<-0.15953,-0.42740,ZP>": 1, "<-0.15958,-0.41427,ZP>": 1, "<-0.15965,-0.40120,ZP>": 1, "<-0.15967,-0.38818,ZP>": 1, "<-0.15966,-0.37519,ZP>": 1, "<-0.15961,-0.36223,ZP>": 1, "<-0.15953,-0.34930,ZP>": 1, "<-0.15943,-0.33639,ZP>": 1, "<-0.15931,-0.32351,ZP>": 1, "<-0.15917,-0.31064,ZP>": 1, "<-0.15902,-0.29779,ZP>": 1, "<-0.15887,-0.28496,ZP>": 1, "<-0.15871,-0.27215,ZP>": 1, "<-0.15856,-0.25936,ZP>": 1, "<-0.15842,-0.24659,ZP>": 1, "<-0.15828,-0.23384,ZP>": 1, "<-0.15815,-0.22110,ZP>": 1, "<-0.15803,-0.20838,ZP>": 1, "<-0.15792,-0.19568,ZP>": 1, "<-0.15781,-0.18299,ZP>": 1, "<-0.15772,-0.17031,ZP>": 1, "<-0.15764,-0.15765,ZP>": 1, "<-0.15756,-0.14500,ZP>": 1, "<-0.15749,-0.13235,ZP>": 1, "<-0.15743,-0.11972,ZP>": 1, "<-0.15738,-0.10710,ZP>": 1, "<-0.15734,-0.09448,ZP>": 1, "<-0.15730,-0.08187,ZP>": 1, "<-0.15726,-0.06927,ZP>": 1, "<-0.15724,-0.05667,ZP>": 1, "<-0.15722,-0.04407,ZP>": 1, "<-0.15720,-0.03148,ZP>": 1, "<-0.15719,-0.01889,ZP>": 1, "<-0.15719,-0.00630,ZP>": 1, "<-0.15719,0.00629,ZP>": 1, "<-0.15719,0.01888,ZP>": 1, "<-0.15720,0.03147,ZP>": 1, "<-0.15721,0.04406,ZP>": 1, "<-0.15723,0.05666,ZP>": 1, "<-0.15726,0.06926,ZP>": 1, "<-0.15729,0.08186,ZP>": 1, "<-0.15733,0.09447,ZP>": 1, "<-0.15737,0.10708,ZP>": 1, "<-0.15742,0.11970,ZP>": 1, "<-0.15747,0.13232,ZP>": 1, "<-0.15754,0.14496,ZP>": 1, "<-0.15761,0.15761,ZP>": 1, "<-0.15769,0.17026,ZP>": 1, "<-0.15778,0.18293,ZP>": 1, "<-0.15787,0.19561,ZP>": 1, "<-0.15798,0.20830,ZP>": 1, "<-0.15810,0.22101,ZP>": 1, "<-0.15823,0.23374,ZP>": 1, "<-0.15837,0.24648,ZP>": 1, "<-0.15851,0.25923,ZP>": 1, "<-0.15867,0.27201,ZP>": 1, "<-0.15883,0.28480,ZP>": 1, "<-0.15900,0.29761,ZP>": 1, "<-0.15917,0.31043,ZP>": 1, "<-0.15934,0.32328,ZP>": 1, "<-0.15950,0.33614,ZP>": 1, "<-0.15965,0.34901,ZP>": 1, "<-0.15979,0.36192,ZP>": 1, "<-0.15991,0.37484,ZP>": 1, "<-0.15999,0.38779,ZP>": 1, "<-0.16005,0.40078,ZP>": 1, "<-0.16007,0.41381,ZP>": 1, "<-0.16009,0.42690,ZP>": 1, "<-0.16012,0.44019,ZP>": 1, "<-0.15987,0.45311,ZP>": 1, "<-0.16042,0.46733,0.65954>": 1, "<-0.15838,0.47434,0.64581>": 1, "<-0.15406,0.47569,0.63346>": 1, "<-0.14954,0.47713,0.62101>": 1, "<-0.14520,0.47848,0.60841>": 1, "<-0.13990,0.47825,0.59627>": 1, "<-0.13560,0.48029,0.58394>": 1, "<-0.13203,0.48286,0.57211>": 1, "<-0.12903,0.48610,0.55971>": 1, "<-0.12189,-0.49974,0.56405>": 1, "<-0.12582,-0.49750,0.57604>": 1, "<-0.12954,-0.49467,0.58806>": 1, "<-0.13281,-0.49131,0.60037>": 1, "<-0.13594,-0.48755,0.61272>": 1, "<-0.13875,-0.48309,0.62516>": 1, "<-0.14217,-0.47938,0.63742>": 1, "<-0.14606,-0.47841,0.65028>": 1, "<-0.14637,-0.46643,0.66019>": 1, "<-0.14634,-0.45331,ZP>": 1, "<-0.14672,-0.44030,ZP>": 1, "<-0.14668,-0.42703,ZP>": 1, "<-0.14675,-0.41395,ZP>": 1, "<-0.14677,-0.40087,ZP>": 1, "<-0.14677,-0.38784,ZP>": 1, "<-0.14676,-0.37486,ZP>": 1, "<-0.14672,-0.36191,ZP>": 1, "<-0.14665,-0.34900,ZP>": 1, "<-0.14657,-0.33611,ZP>": 1, "<-0.14646,-0.32324,ZP>": 1, "<-0.14634,-0.31039,ZP>": 1, "<-0.14621,-0.29756,ZP>": 1, "<-0.14608,-0.28475,ZP>": 1, "<-0.14594,-0.27196,ZP>": 1, "<-0.14581,-0.25919,ZP>": 1, "<-0.14568,-0.24643,ZP>": 1, "<-0.14556,-0.23369,ZP>": 1, "<-0.14544,-0.22097,ZP>": 1, "<-0.14534,-0.20826,ZP>": 1, "<-0.14524,-0.19557,ZP>": 1, "<-0.14515,-0.18289,ZP>": 1, "<-0.14506,-0.17023,ZP>": 1, "<-0.14499,-0.15757,ZP>": 1, "<-0.14492,-0.14493,ZP>": 1, "<-0.14486,-0.13230,ZP>": 1, "<-0.14481,-0.11967,ZP>": 1, "<-0.14476,-0.10705,ZP>": 1, "<-0.14472,-0.09444,ZP>": 1, "<-0.14469,-0.08184,ZP>": 1, "<-0.14466,-0.06924,ZP>": 1, "<-0.14464,-0.05664,ZP>": 1, "<-0.14462,-0.04405,ZP>": 1, "<-0.14460,-0.03147,ZP>": 1, "<-0.14459,-0.01888,ZP>": 1, "<-0.14459,-0.00629,ZP>": 1, "<-0.14459,0.00629,ZP>": 1, "<-0.14459,0.01888,ZP>": 1, "<-0.14460,0.03146,ZP>": 1, "<-0.14461,0.04405,ZP>": 1, "<-0.14463,0.05664,ZP>": 1, "<-0.14465,0.06923,ZP>": 1, "<-0.14468,0.08183,ZP>": 1, "<-0.14471,0.09443,ZP>": 1, "<-0.14475,0.10704,ZP>": 1, "<-0.14479,0.11965,ZP>": 1, "<-0.14484,0.13227,ZP>": 1, "<-0.14490,0.14490,ZP>": 1, "<-0.14496,0.15753,ZP>": 1, "<-0.14503,0.17018,ZP>": 1, "<-0.14511,0.18284,ZP>": 1, "<-0.14520,0.19551,ZP>": 1, "<-0.14529,0.20819,ZP>": 1, "<-0.14540,0.22089,ZP>": 1, "<-0.14551,0.23360,ZP>": 1, "<-0.14564,0.24633,ZP>": 1, "<-0.14577,0.25907,ZP>": 1, "<-0.14591,0.27183,ZP>": 1, "<-0.14605,0.28460,ZP>": 1, "<-0.14620,0.29739,ZP>": 1, "<-0.14635,0.31020,ZP>": 1, "<-0.14650,0.32302,ZP>": 1, "<-0.14664,0.33586,ZP>": 1, "<-0.14677,0.34872,ZP>": 1, "<-0.14689,0.36160,ZP>": 1, "<-0.14700,0.37451,ZP>": 1, "<-0.14709,0.38745,ZP>": 1, "<-0.14717,0.40044,ZP>": 1, "<-0.14723,0.41348,ZP>": 1, "<-0.14724,0.42653,ZP>": 1, "<-0.14736,0.43977,ZP>": 1, "<-0.14707,0.45276,ZP>": 1, "<-0.14714,0.46584,0.66018>": 1, "<-0.14694,0.47813,0.65069>": 1, "<-0.14304,0.47911,0.63785>": 1, "<-0.13865,0.48040,0.62551>": 1, "<-0.13500,0.48300,0.61272>": 1, "<-0.13206,0.48659,0.60047>": 1, "<-0.12998,0.49073,0.58807>": 1, "<-0.12754,0.49396,0.57616>": 1, "<-0.12467,0.49711,0.56386>": 1, "<-0.10977,-0.49675,0.56702>": 1, "<-0.11346,-0.49585,0.57922>": 1, "<-0.11724,-0.49441,0.59144>": 1, "<-0.12098,-0.49223,0.60397>": 1, "<-0.12445,-0.48948,0.61650>": 1, "<-0.12748,-0.48518,0.62915>": 1, "<-0.13079,-0.48259,0.64149>": 1, "<-0.13386,-0.48047,0.65549>": 1, "<-0.13338,-0.46586,0.66007>": 1, "<-0.13356,-0.45302,ZP>": 1, "<-0.13378,-0.43980,ZP>": 1, "<-0.13382,-0.42668,ZP>": 1, "<-0.13389,-0.41361,ZP>": 1, "<-0.13391,-0.40055,ZP>": 1, "<-0.13391,-0.38754,ZP>": 1, "<-0.13390,-0.37457,ZP>": 1, "<-0.13386,-0.36163,ZP>": 1, "<-0.13380,-0.34873,ZP>": 1, "<-0.13373,-0.33585,ZP>": 1, "<-0.13364,-0.32300,ZP>": 1, "<-0.13354,-0.31017,ZP>": 1, "<-0.13343,-0.29736,ZP>": 1, "<-0.13331,-0.28456,ZP>": 1, "<-0.13319,-0.27179,ZP>": 1, "<-0.13308,-0.25903,ZP>": 1, "<-0.13296,-0.24629,ZP>": 1, "<-0.13285,-0.23356,ZP>": 1, "<-0.13275,-0.22085,ZP>": 1, "<-0.13266,-0.20816,ZP>": 1, "<-0.13257,-0.19548,ZP>": 1, "<-0.13249,-0.18281,ZP>": 1, "<-0.13242,-0.17015,ZP>": 1, "<-0.13235,-0.15751,ZP>": 1, "<-0.13229,-0.14487,ZP>": 1, "<-0.13224,-0.13224,ZP>": 1, "<-0.13219,-0.11963,ZP>": 1, "<-0.13215,-0.10701,ZP>": 1, "<-0.13211,-0.09441,ZP>": 1, "<-0.13208,-0.08181,ZP>": 1, "<-0.13206,-0.06922,ZP>": 1, "<-0.13204,-0.05663,ZP>": 1, "<-0.13202,-0.04404,ZP>": 1, "<-0.13201,-0.03146,ZP>": 1, "<-0.13200,-0.01887,ZP>": 1, "<-0.13200,-0.00629,ZP>": 1, "<-0.13200,0.00629,ZP>": 1, "<-0.13200,0.01887,ZP>": 1, "<-0.13201,0.03145,ZP>": 1, "<-0.13202,0.04403,ZP>": 1, "<-0.13204,0.05662,ZP>": 1, "<-0.13205,0.06921,ZP>": 1, "<-0.13208,0.08180,ZP>": 1, "<-0.13211,0.09440,ZP>": 1, "<-0.13214,0.10700,ZP>": 1, "<-0.13218,0.11961,ZP>": 1, "<-0.13222,0.13222,ZP>": 1, "<-0.13227,0.14484,ZP>": 1, "<-0.13233,0.15747,ZP>": 1, "<-0.13239,0.17011,ZP>": 1, "<-0.13246,0.18276,ZP>": 1, "<-0.13253,0.19542,ZP>": 1, "<-0.13262,0.20809,ZP>": 1, "<-0.13271,0.22078,ZP>": 1, "<-0.13281,0.23348,ZP>": 1, "<-0.13292,0.24619,ZP>": 1, "<-0.13304,0.25892,ZP>": 1, "<-0.13316,0.27166,ZP>": 1, "<-0.13328,0.28442,ZP>": 1, "<-0.13341,0.29720,ZP>": 1, "<-0.13354,0.30999,ZP>": 1, "<-0.13367,0.32279,ZP>": 1, "<-0.13380,0.33562,ZP>": 1, "<-0.13392,0.34847,ZP>": 1, "<-0.13403,0.36134,ZP>": 1, "<-0.13413,0.37423,ZP>": 1, "<-0.13422,0.38716,ZP>": 1, "<-0.13429,0.40013,ZP>": 1, "<-0.13436,0.41315,ZP>": 1, "<-0.13438,0.42619,ZP>": 1, "<-0.13442,0.43927,ZP>": 1, "<-0.13429,0.45246,ZP>": 1, "<-0.13415,0.46525,ZP>": 1, "<-0.13468,0.47990,0.65599>": 1, "<-0.13169,0.48235,0.64192>": 1, "<-0.12831,0.48492,0.62976>": 1, "<-0.12617,0.49024,0.61725>": 1, "<-0.12349,0.49427,0.60499>": 1, "<-0.12072,0.49793,0.59254>": 1, "<-0.11756,0.50096,0.58043>": 1, "<-0.11446,0.50365,0.56814>": 1, "<-0.10045,-0.48797,0.56933>": 1, "<-0.10351,-0.48794,0.58166>": 1, "<-0.10657,-0.48820,0.59413>": 1, "<-0.10959,-0.48816,0.60680>": 1, "<-0.11266,-0.48814,0.61963>": 1, "<-0.11587,-0.48640,0.63260>": 1, "<-0.11909,-0.48565,0.64519>": 1, "<-0.12089,-0.47984,0.65914>": 1, "<-0.12051,-0.46547,ZP>": 1, "<-0.12084,-0.45272,ZP>": 1, "<-0.12089,-0.43941,ZP>": 1, "<-0.12100,-0.42637,ZP>": 1, "<-0.12106,-0.41330,ZP>": 1, "<-0.12108,-0.40026,ZP>": 1, "<-0.12109,-0.38727,ZP>": 1, "<-0.12107,-0.37431,ZP>": 1, "<-0.12103,-0.36139,ZP>": 1, "<-0.12098,-0.34849,ZP>": 1, "<-0.12092,-0.33563,ZP>": 1, "<-0.12084,-0.32279,ZP>": 1, "<-0.12075,-0.30997,ZP>": 1, "<-0.12066,-0.29718,ZP>": 1, "<-0.12056,-0.28440,ZP>": 1, "<-0.12046,-0.27164,ZP>": 1, "<-0.12035,-0.25889,ZP>": 1, "<-0.12026,-0.24616,ZP>": 1, "<-0.12016,-0.23345,ZP>": 1, "<-0.12007,-0.22075,ZP>": 1, "<-0.11999,-0.20807,ZP>": 1, "<-0.11991,-0.19539,ZP>": 1, "<-0.11984,-0.18273,ZP>": 1, "<-0.11978,-0.17008,ZP>": 1, "<-0.11972,-0.15745,ZP>": 1, "<-0.11967,-0.14482,ZP>": 1, "<-0.11962,-0.13220,ZP>": 1, "<-0.11958,-0.11959,ZP>": 1, "<-0.11955,-0.10698,ZP>": 1, "<-0.11951,-0.09438,ZP>": 1, "<-0.11949,-0.08179,ZP>": 1, "<-0.11947,-0.06920,ZP>": 1, "<-0.11945,-0.05661,ZP>": 1, "<-0.11943,-0.04403,ZP>": 1, "<-0.11942,-0.03145,ZP>": 1, "<-0.11942,-0.01887,ZP>": 1, "<-0.11941,-0.00629,ZP>": 1, "<-0.11941,0.00629,ZP>": 1, "<-0.11942,0.01886,ZP>": 1, "<-0.11942,0.03144,ZP>": 1, "<-0.11943,0.04402,ZP>": 1, "<-0.11944,0.05660,ZP>": 1, "<-0.11946,0.06919,ZP>": 1, "<-0.11948,0.08178,ZP>": 1, "<-0.11951,0.09437,ZP>": 1, "<-0.11953,0.10697,ZP>": 1, "<-0.11957,0.11957,ZP>": 1, "<-0.11961,0.13218,ZP>": 1, "<-0.11965,0.14479,ZP>": 1, "<-0.11970,0.15742,ZP>": 1, "<-0.11975,0.17005,ZP>": 1, "<-0.11981,0.18269,ZP>": 1, "<-0.11988,0.19534,ZP>": 1, "<-0.11995,0.20801,ZP>": 1, "<-0.12004,0.22068,ZP>": 1, "<-0.12012,0.23337,ZP>": 1, "<-0.12022,0.24607,ZP>": 1, "<-0.12032,0.25879,ZP>": 1, "<-0.12043,0.27152,ZP>": 1, "<-0.12054,0.28427,ZP>": 1, "<-0.12065,0.29703,ZP>": 1, "<-0.12076,0.30980,ZP>": 1, "<-0.12088,0.32260,ZP>": 1, "<-0.12099,0.33541,ZP>": 1, "<-0.12109,0.34825,ZP>": 1, "<-0.12120,0.36111,ZP>": 1, "<-0.12129,0.37399,ZP>": 1, "<-0.12138,0.38691,ZP>": 1, "<-0.12146,0.39987,ZP>": 1, "<-0.12153,0.41286,ZP>": 1, "<-0.12156,0.42588,ZP>": 1, "<-0.12153,0.43888,ZP>": 1, "<-0.12157,0.45214,ZP>": 1, "<-0.12128,0.46487,ZP>": 1, "<-0.12165,0.47907,0.65940>": 1, "<-0.12003,0.48541,0.64570>": 1, "<-0.11709,0.48758,0.63325>": 1, "<-0.11468,0.49275,0.62090>": 1, "<-0.11168,0.49599,0.60835>": 1, "<-0.10848,0.49865,0.59572>": 1, "<-0.10510,0.50048,0.58333>": 1, "<-0.10187,0.50179,0.57086>": 1, "<-0.08792,-0.48681,0.57271>": 1, "<-0.09128,-0.48675,0.58514>": 1, "<-0.09458,-0.48710,0.59758>": 1, "<-0.09820,-0.49030,0.61025>": 1, "<-0.10111,-0.48968,0.62310>": 1, "<-0.10428,-0.48902,0.63580>": 1, "<-0.10715,-0.48850,0.64860>": 1, "<-0.10775,-0.47852,0.66022>": 1, "<-0.10767,-0.46521,ZP>": 1, "<-0.10807,-0.45234,ZP>": 1, "<-0.10806,-0.43911,ZP>": 1, "<-0.10819,-0.42607,ZP>": 1, "<-0.10824,-0.41301,ZP>": 1, "<-0.10827,-0.40000,ZP>": 1, "<-0.10828,-0.38703,ZP>": 1, "<-0.10826,-0.37408,ZP>": 1, "<-0.10823,-0.36117,ZP>": 1, "<-0.10819,-0.34829,ZP>": 1, "<-0.10813,-0.33544,ZP>": 1, "<-0.10806,-0.32261,ZP>": 1, "<-0.10799,-0.30980,ZP>": 1, "<-0.10791,-0.29702,ZP>": 1, "<-0.10782,-0.28425,ZP>": 1, "<-0.10773,-0.27150,ZP>": 1, "<-0.10765,-0.25877,ZP>": 1, "<-0.10756,-0.24605,ZP>": 1, "<-0.10748,-0.23335,ZP>": 1, "<-0.10740,-0.22066,ZP>": 1, "<-0.10733,-0.20798,ZP>": 1, "<-0.10727,-0.19532,ZP>": 1, "<-0.10720,-0.18267,ZP>": 1, "<-0.10715,-0.17003,ZP>": 1, "<-0.10710,-0.15739,ZP>": 1, "<-0.10705,-0.14477,ZP>": 1, "<-0.10701,-0.13216,ZP>": 1, "<-0.10698,-0.11955,ZP>": 1, "<-0.10695,-0.10695,ZP>": 1, "<-0.10692,-0.09435,ZP>": 1, "<-0.10690,-0.08176,ZP>": 1, "<-0.10688,-0.06918,ZP>": 1, "<-0.10686,-0.05660,ZP>": 1, "<-0.10685,-0.04402,ZP>": 1, "<-0.10684,-0.03144,ZP>": 1, "<-0.10684,-0.01886,ZP>": 1, "<-0.10683,-0.00629,ZP>": 1, "<-0.10683,0.00629,ZP>": 1, "<-0.10683,0.01886,ZP>": 1, "<-0.10684,0.03144,ZP>": 1, "<-0.10685,0.04401,ZP>": 1, "<-0.10686,0.05659,ZP>": 1, "<-0.10687,0.06917,ZP>": 1, "<-0.10689,0.08176,ZP>": 1, "<-0.10691,0.09434,ZP>": 1, "<-0.10694,0.10694,ZP>": 1, "<-0.10697,0.11953,ZP>": 1, "<-0.10700,0.13214,ZP>": 1, "<-0.10704,0.14475,ZP>": 1, "<-0.10708,0.15737,ZP>": 1, "<-0.10713,0.16999,ZP>": 1, "<-0.10718,0.18263,ZP>": 1, "<-0.10724,0.19527,ZP>": 1, "<-0.10730,0.20793,ZP>": 1, "<-0.10737,0.22060,ZP>": 1, "<-0.10745,0.23328,ZP>": 1, "<-0.10753,0.24597,ZP>": 1, "<-0.10762,0.25867,ZP>": 1, "<-0.10771,0.27139,ZP>": 1, "<-0.10780,0.28413,ZP>": 1, "<-0.10790,0.29688,ZP>": 1, "<-0.10800,0.30964,ZP>": 1, "<-0.10810,0.32243,ZP>": 1, "<-0.10820,0.33523,ZP>": 1, "<-0.10830,0.34806,ZP>": 1, "<-0.10839,0.36091,ZP>": 1, "<-0.10848,0.37379,ZP>": 1, "<-0.10856,0.38669,ZP>": 1, "<-0.10864,0.39963,ZP>": 1, "<-0.10869,0.41259,ZP>": 1, "<-0.10873,0.42560,ZP>": 1, "<-0.10870,0.43859,ZP>": 1, "<-0.10878,0.45177,ZP>": 1, "<-0.10845,0.46463,ZP>": 1, "<-0.10858,0.47784,0.66021>": 1, "<-0.10813,0.48829,0.64909>": 1, "<-0.10539,0.48883,0.63611>": 1, "<-0.10271,0.49207,0.62360>": 1, "<-0.10003,0.49254,0.61067>": 1, "<-0.09754,0.49280,0.59791>": 1, "<-0.09505,0.49278,0.58522>": 1, "<-0.09251,0.49295,0.57263>": 1, "<-0.07733,-0.49349,0.57531>": 1, "<-0.08025,-0.49249,0.58781>": 1, "<-0.08379,-0.49294,0.60031>": 1, "<-0.08671,-0.49244,0.61302>": 1, "<-0.08948,-0.49194,0.62605>": 1, "<-0.09242,-0.49139,0.63860>": 1, "<-0.09496,-0.49093,0.65199>": 1, "<-0.09487,-0.47800,0.66011>": 1, "<-0.09490,-0.46505,ZP>": 1, "<-0.09523,-0.45193,ZP>": 1, "<-0.09528,-0.43883,ZP>": 1, "<-0.09540,-0.42579,ZP>": 1, "<-0.09544,-0.41275,ZP>": 1, "<-0.09548,-0.39976,ZP>": 1, "<-0.09549,-0.38680,ZP>": 1, "<-0.09548,-0.37388,ZP>": 1, "<-0.09545,-0.36098,ZP>": 1, "<-0.09541,-0.34811,ZP>": 1, "<-0.09536,-0.33527,ZP>": 1, "<-0.09530,-0.32245,ZP>": 1, "<-0.09524,-0.30966,ZP>": 1, "<-0.09517,-0.29688,ZP>": 1, "<-0.09510,-0.28413,ZP>": 1, "<-0.09503,-0.27139,ZP>": 1, "<-0.09495,-0.25866,ZP>": 1, "<-0.09488,-0.24595,ZP>": 1, "<-0.09481,-0.23326,ZP>": 1, "<-0.09475,-0.22058,ZP>": 1, "<-0.09468,-0.20791,ZP>": 1, "<-0.09463,-0.19526,ZP>": 1, "<-0.09457,-0.18261,ZP>": 1, "<-0.09453,-0.16997,ZP>": 1, "<-0.09448,-0.15735,ZP>": 1, "<-0.09444,-0.14473,ZP>": 1, "<-0.09441,-0.13212,ZP>": 1, "<-0.09438,-0.11952,ZP>": 1, "<-0.09435,-0.10692,ZP>": 1, "<-0.09433,-0.09433,ZP>": 1, "<-0.09431,-0.08175,ZP>": 1, "<-0.09429,-0.06916,ZP>": 1, "<-0.09428,-0.05658,ZP>": 1, "<-0.09427,-0.04401,ZP>": 1, "<-0.09426,-0.03143,ZP>": 1, "<-0.09426,-0.01886,ZP>": 1, "<-0.09426,-0.00629,ZP>": 1, "<-0.09426,0.00628,ZP>": 1, "<-0.09426,0.01886,ZP>": 1, "<-0.09426,0.03143,ZP>": 1, "<-0.09427,0.04400,ZP>": 1, "<-0.09428,0.05658,ZP>": 1, "<-0.09429,0.06916,ZP>": 1, "<-0.09431,0.08174,ZP>": 1, "<-0.09432,0.09432,ZP>": 1, "<-0.09434,0.10691,ZP>": 1, "<-0.09437,0.11951,ZP>": 1, "<-0.09440,0.13210,ZP>": 1, "<-0.09443,0.14471,ZP>": 1, "<-0.09446,0.15732,ZP>": 1, "<-0.09451,0.16994,ZP>": 1, "<-0.09455,0.18257,ZP>": 1, "<-0.09460,0.19521,ZP>": 1, "<-0.09466,0.20786,ZP>": 1, "<-0.09472,0.22052,ZP>": 1, "<-0.09478,0.23319,ZP>": 1, "<-0.09485,0.24588,ZP>": 1, "<-0.09492,0.25858,ZP>": 1, "<-0.09500,0.27129,ZP>": 1, "<-0.09508,0.28401,ZP>": 1, "<-0.09517,0.29675,ZP>": 1, "<-0.09526,0.30951,ZP>": 1, "<-0.09534,0.32228,ZP>": 1, "<-0.09543,0.33508,ZP>": 1, "<-0.09552,0.34790,ZP>": 1, "<-0.09561,0.36074,ZP>": 1, "<-0.09569,0.37361,ZP>": 1, "<-0.09577,0.38650,ZP>": 1, "<-0.09583,0.39942,ZP>": 1, "<-0.09588,0.41237,ZP>": 1, "<-0.09593,0.42535,ZP>": 1, "<-0.09590,0.43835,ZP>": 1, "<-0.09593,0.45139,ZP>": 1, "<-0.09570,0.46450,ZP>": 1, "<-0.09575,0.47741,0.66010>": 1, "<-0.09591,0.49063,0.65253>": 1, "<-0.09346,0.49119,0.63894>": 1, "<-0.09073,0.49170,0.62649>": 1, "<-0.08832,0.49216,0.61347>": 1, "<-0.08582,0.49262,0.60077>": 1, "<-0.08302,0.49016,0.58815>": 1, "<-0.08042,0.49019,0.57560>": 1, "<-0.07158,-0.50487,0.57772>": 1, "<-0.07319,-0.50292,0.59029>": 1, "<-0.07455,-0.50042,0.60294>": 1, "<-0.07613,-0.49768,0.61566>": 1, "<-0.07786,-0.49459,0.62870>": 1, "<-0.08035,-0.49372,0.64118>": 1, "<-0.08235,-0.49198,0.65530>": 1, "<-0.08210,-0.47764,ZP>": 1, "<-0.08223,-0.46491,ZP>": 1, "<-0.08242,-0.45159,ZP>": 1, "<-0.08251,-0.43858,ZP>": 1, "<-0.08262,-0.42553,ZP>": 1, "<-0.08267,-0.41252,ZP>": 1, "<-0.08270,-0.39955,ZP>": 1, "<-0.08271,-0.38661,ZP>": 1, "<-0.08271,-0.37369,ZP>": 1, "<-0.08269,-0.36081,ZP>": 1, "<-0.08265,-0.34796,ZP>": 1, "<-0.08261,-0.33513,ZP>": 1, "<-0.08256,-0.32232,ZP>": 1, "<-0.08251,-0.30953,ZP>": 1, "<-0.08245,-0.29677,ZP>": 1, "<-0.08239,-0.28402,ZP>": 1, "<-0.08233,-0.27129,ZP>": 1, "<-0.08227,-0.25857,ZP>": 1, "<-0.08221,-0.24587,ZP>": 1, "<-0.08215,-0.23318,ZP>": 1, "<-0.08210,-0.22051,ZP>": 1, "<-0.08204,-0.20785,ZP>": 1, "<-0.08200,-0.19520,ZP>": 1, "<-0.08195,-0.18256,ZP>": 1, "<-0.08191,-0.16993,ZP>": 1, "<-0.08187,-0.15731,ZP>": 1, "<-0.08184,-0.14470,ZP>": 1, "<-0.08181,-0.13209,ZP>": 1, "<-0.08179,-0.11949,ZP>": 1, "<-0.08176,-0.10690,ZP>": 1, "<-0.08175,-0.09431,ZP>": 1, "<-0.08173,-0.08173,ZP>": 1, "<-0.08172,-0.06915,ZP>": 1, "<-0.08170,-0.05657,ZP>": 1, "<-0.08170,-0.04400,ZP>": 1, "<-0.08169,-0.03143,ZP>": 1, "<-0.08168,-0.01886,ZP>": 1, "<-0.08168,-0.00629,ZP>": 1, "<-0.08168,0.00628,ZP>": 1, "<-0.08168,0.01885,ZP>": 1, "<-0.08169,0.03142,ZP>": 1, "<-0.08169,0.04400,ZP>": 1, "<-0.08170,0.05657,ZP>": 1, "<-0.08171,0.06914,ZP>": 1, "<-0.08172,0.08172,ZP>": 1, "<-0.08174,0.09430,ZP>": 1, "<-0.08176,0.10689,ZP>": 1, "<-0.08178,0.11948,ZP>": 1, "<-0.08180,0.13208,ZP>": 1, "<-0.08183,0.14468,ZP>": 1, "<-0.08186,0.15729,ZP>": 1, "<-0.08189,0.16990,ZP>": 1, "<-0.08193,0.18253,ZP>": 1, "<-0.08197,0.19516,ZP>": 1, "<-0.08202,0.20780,ZP>": 1, "<-0.08207,0.22046,ZP>": 1, "<-0.08212,0.23312,ZP>": 1, "<-0.08218,0.24580,ZP>": 1, "<-0.08225,0.25849,ZP>": 1, "<-0.08231,0.27119,ZP>": 1, "<-0.08238,0.28391,ZP>": 1, "<-0.08245,0.29664,ZP>": 1, "<-0.08253,0.30939,ZP>": 1, "<-0.08260,0.32216,ZP>": 1, "<-0.08268,0.33495,ZP>": 1, "<-0.08276,0.34776,ZP>": 1, "<-0.08284,0.36059,ZP>": 1, "<-0.08291,0.37345,ZP>": 1, "<-0.08298,0.38633,ZP>": 1, "<-0.08304,0.39924,ZP>": 1, "<-0.08309,0.41218,ZP>": 1, "<-0.08313,0.42513,ZP>": 1, "<-0.08311,0.43814,ZP>": 1, "<-0.08311,0.45110,ZP>": 1, "<-0.08303,0.46439,ZP>": 1, "<-0.08298,0.47706,ZP>": 1, "<-0.08331,0.49152,0.65578>": 1, "<-0.08139,0.49333,0.64152>": 1, "<-0.07893,0.49374,0.62913>": 1, "<-0.07653,0.49412,0.61592>": 1, "<-0.07398,0.49451,0.60312>": 1, "<-0.07116,0.49430,0.59049>": 1, "<-0.06864,0.49515,0.57801>": 1, "<-0.06005,-0.51011,0.58040>": 1, "<-0.06180,-0.50799,0.59308>": 1, "<-0.06346,-0.50522,0.60567>": 1, "<-0.06500,-0.50207,0.61834>": 1, "<-0.06631,-0.49748,0.63115>": 1, "<-0.06809,-0.49543,0.64350>": 1, "<-0.06950,-0.49185,0.65780>": 1, "<-0.06936,-0.47730,ZP>": 1, "<-0.06959,-0.46470,ZP>": 1, "<-0.06967,-0.45132,ZP>": 1, "<-0.06977,-0.43835,ZP>": 1, "<-0.06985,-0.42529,ZP>": 1, "<-0.06991,-0.41231,ZP>": 1, "<-0.06994,-0.39936,ZP>": 1, "<-0.06995,-0.38643,ZP>": 1, "<-0.06995,-0.37354,ZP>": 1, "<-0.06993,-0.36067,ZP>": 1, "<-0.06991,-0.34782,ZP>": 1, "<-0.06987,-0.33500,ZP>": 1, "<-0.06983,-0.32221,ZP>": 1, "<-0.06979,-0.30943,ZP>": 1, "<-0.06974,-0.29667,ZP>": 1, "<-0.06970,-0.28393,ZP>": 1, "<-0.06965,-0.27120,ZP>": 1, "<-0.06960,-0.25850,ZP>": 1, "<-0.06955,-0.24580,ZP>": 1, "<-0.06950,-0.23312,ZP>": 1, "<-0.06945,-0.22045,ZP>": 1, "<-0.06941,-0.20780,ZP>": 1, "<-0.06937,-0.19515,ZP>": 1, "<-0.06933,-0.18252,ZP>": 1, "<-0.06930,-0.16989,ZP>": 1, "<-0.06927,-0.15728,ZP>": 1, "<-0.06924,-0.14467,ZP>": 1, "<-0.06922,-0.13207,ZP>": 1, "<-0.06920,-0.11947,ZP>": 1, "<-0.06918,-0.10688,ZP>": 1, "<-0.06916,-0.09430,ZP>": 1, "<-0.06915,-0.08172,ZP>": 1, "<-0.06914,-0.06914,ZP>": 1, "<-0.06913,-0.05656,ZP>": 1, "<-0.06912,-0.04399,ZP>": 1, "<-0.06912,-0.03142,ZP>": 1, "<-0.06911,-0.01885,ZP>": 1, "<-0.06911,-0.00628,ZP>": 1, "<-0.06911,0.00628,ZP>": 1, "<-0.06911,0.01885,ZP>": 1, "<-0.06912,0.03142,ZP>": 1, "<-0.06912,0.04399,ZP>": 1, "<-0.06913,0.05656,ZP>": 1, "<-0.06913,0.06913,ZP>": 1, "<-0.06915,0.08171,ZP>": 1, "<-0.06916,0.09429,ZP>": 1, "<-0.06917,0.10687,ZP>": 1, "<-0.06919,0.11946,ZP>": 1, "<-0.06921,0.13205,ZP>": 1, "<-0.06923,0.14465,ZP>": 1, "<-0.06926,0.15726,ZP>": 1, "<-0.06928,0.16987,ZP>": 1, "<-0.06932,0.18249,ZP>": 1, "<-0.06935,0.19512,ZP>": 1, "<-0.06939,0.20776,ZP>": 1, "<-0.06943,0.22041,ZP>": 1, "<-0.06947,0.23306,ZP>": 1, "<-0.06952,0.24574,ZP>": 1, "<-0.06958,0.25842,ZP>": 1, "<-0.06963,0.27112,ZP>": 1, "<-0.06969,0.28383,ZP>": 1, "<-0.06975,0.29656,ZP>": 1, "<-0.06981,0.30930,ZP>": 1, "<-0.06988,0.32206,ZP>": 1, "<-0.06995,0.33484,ZP>": 1, "<-0.07002,0.34765,ZP>": 1, "<-0.07009,0.36047,ZP>": 1, "<-0.07015,0.37332,ZP>": 1, "<-0.07021,0.38619,ZP>": 1, "<-0.07027,0.39909,ZP>": 1, "<-0.07031,0.41201,ZP>": 1, "<-0.07034,0.42495,ZP>": 1, "<-0.07034,0.43796,ZP>": 1, "<-0.07033,0.45090,ZP>": 1, "<-0.07037,0.46422,ZP>": 1, "<-0.07021,0.47676,ZP>": 1, "<-0.07043,0.49122,0.65820>": 1, "<-0.06911,0.49521,0.64394>": 1, "<-0.06704,0.49549,0.63133>": 1, "<-0.06562,0.49876,0.61825>": 1, "<-0.06433,0.50151,0.60544>": 1, "<-0.06323,0.50431,0.59277>": 1, "<-0.06192,0.50622,0.58018>": 1, "<-0.04767,-0.50707,0.58132>": 1, "<-0.04941,-0.50584,0.59413>": 1, "<-0.05125,-0.50372,0.60685>": 1, "<-0.05286,-0.50148,0.61976>": 1, "<-0.05426,-0.49706,0.63267>": 1, "<-0.05571,-0.49691,0.64547>": 1, "<-0.05661,-0.49117,0.65928>": 1, "<-0.05659,-0.47696,ZP>": 1, "<-0.05689,-0.46439,ZP>": 1, "<-0.05693,-0.45108,ZP>": 1, "<-0.05704,-0.43813,ZP>": 1, "<-0.05710,-0.42508,ZP>": 1, "<-0.05715,-0.41213,ZP>": 1, "<-0.05719,-0.39919,ZP>": 1, "<-0.05720,-0.38628,ZP>": 1, "<-0.05720,-0.37340,ZP>": 1, "<-0.05719,-0.36054,ZP>": 1, "<-0.05717,-0.34771,ZP>": 1, "<-0.05715,-0.33490,ZP>": 1, "<-0.05712,-0.32211,ZP>": 1, "<-0.05708,-0.30934,ZP>": 1, "<-0.05705,-0.29659,ZP>": 1, "<-0.05701,-0.28385,ZP>": 1, "<-0.05697,-0.27114,ZP>": 1, "<-0.05693,-0.25843,ZP>": 1, "<-0.05689,-0.24574,ZP>": 1, "<-0.05686,-0.23307,ZP>": 1, "<-0.05682,-0.22040,ZP>": 1, "<-0.05678,-0.20775,ZP>": 1, "<-0.05675,-0.19511,ZP>": 1, "<-0.05672,-0.18248,ZP>": 1, "<-0.05670,-0.16986,ZP>": 1, "<-0.05667,-0.15725,ZP>": 1, "<-0.05665,-0.14464,ZP>": 1, "<-0.05663,-0.13205,ZP>": 1, "<-0.05661,-0.11945,ZP>": 1, "<-0.05660,-0.10687,ZP>": 1, "<-0.05659,-0.09428,ZP>": 1, "<-0.05657,-0.08170,ZP>": 1, "<-0.05656,-0.06913,ZP>": 1, "<-0.05656,-0.05656,ZP>": 1, "<-0.05655,-0.04399,ZP>": 1, "<-0.05655,-0.03142,ZP>": 1, "<-0.05654,-0.01885,ZP>": 1, "<-0.05654,-0.00628,ZP>": 1, "<-0.05654,0.00628,ZP>": 1, "<-0.05654,0.01885,ZP>": 1, "<-0.05655,0.03142,ZP>": 1, "<-0.05655,0.04398,ZP>": 1, "<-0.05656,0.05655,ZP>": 1, "<-0.05656,0.06912,ZP>": 1, "<-0.05657,0.08170,ZP>": 1, "<-0.05658,0.09428,ZP>": 1, "<-0.05659,0.10686,ZP>": 1, "<-0.05660,0.11944,ZP>": 1, "<-0.05662,0.13203,ZP>": 1, "<-0.05664,0.14463,ZP>": 1, "<-0.05666,0.15723,ZP>": 1, "<-0.05668,0.16984,ZP>": 1, "<-0.05671,0.18246,ZP>": 1, "<-0.05673,0.19508,ZP>": 1, "<-0.05676,0.20772,ZP>": 1, "<-0.05680,0.22036,ZP>": 1, "<-0.05683,0.23302,ZP>": 1, "<-0.05687,0.24568,ZP>": 1, "<-0.05691,0.25836,ZP>": 1, "<-0.05696,0.27106,ZP>": 1, "<-0.05701,0.28376,ZP>": 1, "<-0.05706,0.29649,ZP>": 1, "<-0.05711,0.30923,ZP>": 1, "<-0.05717,0.32198,ZP>": 1, "<-0.05723,0.33476,ZP>": 1, "<-0.05728,0.34755,ZP>": 1, "<-0.05734,0.36037,ZP>": 1, "<-0.05740,0.37321,ZP>": 1, "<-0.05746,0.38607,ZP>": 1, "<-0.05750,0.39896,ZP>": 1, "<-0.05754,0.41188,ZP>": 1, "<-0.05757,0.42480,ZP>": 1, "<-0.05759,0.43781,ZP>": 1, "<-0.05757,0.45073,ZP>": 1, "<-0.05762,0.46397,ZP>": 1, "<-0.05740,0.47651,ZP>": 1, "<-0.05749,0.49054,0.65950>": 1, "<-0.05674,0.49679,0.64593>": 1, "<-0.05531,0.49765,0.63325>": 1, "<-0.05435,0.50279,0.62055>": 1, "<-0.05314,0.50619,0.60793>": 1, "<-0.05174,0.50898,0.59521>": 1, "<-0.05021,0.51123,0.58267>": 1, "<-0.03844,-0.49817,0.58190>": 1, "#ifndef": 2, "Stripes": 3, "Gamma": 3, ".5": 1, "#default": 1, "TestRed": 4, "<0.5,0.1,0.1>": 1, "TestGreen": 3, "<0.1,0.5,0.1>": 1, "TestBlue": 4, "<0.1,0.1,0.5>": 1, "CameraFocus": 3, "<0,0.5,0>": 1, "CameraDist": 1, "CameraDepth": 1, "CameraTilt": 1, "<0,0,0>": 2, "z*CameraDepth": 1, "<0,0,-CameraDist>": 2, "x*CameraTilt": 2, "LightSource": 4, "Pos": 9, "Color": 2, "spotlight": 1, "point_at": 1, "radius": 1, "/vlength": 2, "falloff": 1, "x*vlength": 1, "/10": 2, "y*vlength": 1, "adaptive": 1, "<-500,500,-500>": 1, "<0.2,0.2,0.2>": 3, "DarkStripeBW": 1, "TargetBrightness": 4, "#else": 5, "TargetBrightness*2": 2, "BrightStripeBW": 1, "DarkStripeRGB": 2, "TargetColor": 9, "": 1, "BrightStripeRGB": 2, "": 1, "StripedPigment": 2, "mod": 1, "image_height*CameraDepth*y/z": 1, "T_Stone11": 1, "GammaAdjust": 3, "C": 1, "G": 1, "C2": 2, "rgbft": 1, "": 1, "TestSphere": 7, "Radius": 3, "Split": 2, "y*Radius": 2, "x*0.001": 1, "<-2,0,1>": 1, "Steps": 2, "#for": 2, "I": 6, "/Steps": 5, "Color2": 2, "P": 2, "*2": 1, "": 1, "*TestGreen": 1, "P*Color2": 1, "": 1, "": 1, "*Gamma": 1, "false": 1, "P_Clouds": 2, "gradient": 3, "pigment_map": 2, "lambda": 3, "omega": 2, "octaves": 3, "<0.4,0.4,0.15>": 2, "Tex_Sky": 2, "<0,>": 1, "<1000000,>": 1, "1000000": 1, "300000": 1, "no_shadow": 1, "hollow": 3, "collect": 1, "Tex_Dark_Wood2": 2, "wood": 1, "<0.6431,>": 1, "3176": 1, "0824": 1, "<0.6196,>": 1, "2824": 1, "0588": 1, "<0.7137,>": 1, "3725": 1, "1529": 1, "<0.7529,>": 1, "4157": 1, "1922": 1, "<0.8157,>": 1, "4941": 1, "2588": 1, "<0.7686,>": 1, "4745": 1, "2196": 1, "<0.8471,>": 1, "5647": 1, "2980": 1, "<0.8627,>": 2, "5843": 1, "3137": 1, "<0.8902,>": 1, "6314": 1, "3529": 1, "6118": 1, "3294": 1, "<0.8392,>": 1, "5922": 1, "3098": 1, "<0.075,>": 1, "075": 1, "65": 1, "<0.04,>": 1, "04": 1, "<0.02,>": 2, "02": 1, "06": 2, "Table_Height": 6, "Table": 2, "sturm": 1, "z*": 4, "z*Table_Height": 1, "z*0.01": 3, "z*0.63": 3, "z*0.03": 3, "<0.97,>": 2, "97": 3, "99": 1, "00": 1, "<3.3,2.52,0>": 2, "ClCol01": 7, "<0.8,>": 1, "7": 1, "ClCol02": 13, "<0.07,>": 1, "12": 1, "CPig1": 7, "triangle_wave": 2, "CPig2": 2, "Table_Cloth": 2, "mesh2": 1, "uv_mapping": 1, "quilted": 1, "<0.4,0.4,0.8>": 1, "Tex_Box_Metal": 2, "<0.5,0.45,0.4>": 1, "Box_Iso": 3, "f_superellipsoid": 1, "Box": 2, "Round_Box_Merge": 2, "<-1.1,-1.1,1.6>": 2, "<1.1,1.1,-0.1>": 1, "<1.1,1.1,2.2>": 1, "<1,1,0.6>": 1, "target": 2, "<-0.16,-0.1,0>": 1, "<-0.1,0.2,0>": 1, "<3.3,2.52,Table_Height>": 1, "Tex_Vegetation": 2, "<0.20,0.35,0.1>": 1, "*0.9": 1, "<0.12,0.35,0.1>": 1, "*0.7": 1, "brilliance": 1, "Tex_Terrain": 2, "slope": 1, "texture_map": 1, "Terrain": 3, "height_field": 1, "z*z": 1, "<0.5,0,0.5>": 1, "/3": 1, "water_level": 1, "<4,>": 1, "<130,>": 1, "368": 1, "10": 1, "<90,>": 1, "RMF": 2, "f_ridged_mf": 1, "M_Watx4": 2, "<0.2,>": 1, "22": 1, "21": 1, "94": 1, "20": 1 }, "Pan": { "object": 1, "template": 1, "pantest": 1, ";": 32, "E10": 1, "variable": 4, "TEST": 2, "to_string": 1, "(": 8, ")": 8, "+": 2, "value": 1, "undef": 1, "null": 1, "e": 1, "error": 1, "include": 1, "{": 5, "}": 5, "pkg_repl": 2, "PKG_ARCH_DEFAULT": 1, "function": 1, "show_things_view_for_stuff": 1, "thing": 2, "ARGV": 1, "[": 2, "]": 2, "foreach": 1, "i": 1, "mything": 2, "STUFF": 1, "if": 1, "return": 2, "true": 2, "else": 1, "SELF": 1, "false": 2, "HERE": 1, "<<": 1, "EOF": 2, "This": 1, "example": 1, "demonstrates": 1, "an": 1, "in": 1, "-": 1, "line": 1, "heredoc": 1, "style": 1, "config": 1, "file": 1, "main": 1, "awesome": 1, "small": 1, "#This": 1, "should": 1, "be": 1, "highlighted": 1, "normally": 1, "again.": 1 }, "Papyrus": { "Scriptname": 3, "CAMTEST_OverShoulderME": 1, "extends": 3, "activemagiceffect": 1, "{": 2, "Play": 1, "with": 1, "camera": 1, "effects": 1, "}": 2, ";": 13, "-": 42, "Imports": 2, "Import": 4, "Utility": 2, "Game": 2, "Properties": 2, "Actor": 9, "Property": 7, "PlayerRef": 3, "Auto": 7, "ActorBase": 1, "CAMTEST_CameraActor": 2, "Variables": 2, "Player": 6, "Camera": 3, "Target": 1, "Float": 11, "PosX": 1, "PosY": 1, "PosZ": 1, "SpeedMult": 1, "ObjectReference": 2, "Mist": 1, "Fog": 1, "Events": 2, "Event": 7, "OnInit": 2, "(": 74, ")": 74, "EndEvent": 7, "onEffectStart": 1, "akTarget": 2, "akCaster": 2, "Player.PlaceActorAtMe": 1, "Camera.EnableAI": 1, "False": 8, "Camera.SetScale": 1, "Camera.TranslateTo": 1, "Player.X": 3, "+": 18, "Player.Y": 3, "Player.Z": 3, "DisablePlayerControls": 1, "abMovement": 1, "true": 7, "abFighting": 1, "abCamSwitch": 1, "abLooking": 1, "abSneaking": 1, "abMenu": 1, "abActivate": 1, "abJournalTabs": 1, "false": 1, "SetPlayerAIDriven": 2, "True": 7, "ForceThirdPerson": 1, "SetHUDCartMode": 2, "SetInChargen": 2, "SetCameraTarget": 2, "ForceFirstPerson": 1, "Wait": 4, "Camera.SplineTranslateTo": 2, "Camera.GetHeadingAngle": 2, "Camera.GetAngleZ": 2, "Camera.SetLookAt": 1, "EnablePlayerControls": 1, "onUpdate": 1, "onEffectFinish": 1, "Functions": 2, "vMFX_FXPlugin": 1, "Quest": 2, "vSCM_MetaQuestScript": 1, "Do": 1, "initialization": 1, "and": 1, "track": 1, "variables": 1, "for": 1, "scripts": 1, "ModVersion": 10, "Hidden": 2, "String": 4, "ModName": 3, "Message": 2, "vSCM_ModLoadedMSG": 1, "vSCM_ModUpdatedMSG": 1, "_CurrentVersion": 10, "_sCurrentVersion": 3, "Bool": 2, "_Running": 4, "_ScriptLatency": 1, "_StartTime": 1, "_EndTime": 1, "If": 7, "DoUpkeep": 2, "EndIf": 7, "OnReset": 1, "Debug.Trace": 18, "OnGameReloaded": 1, "Function": 6, "DelayedStart": 2, "FIXME": 1, "CHANGE": 1, "THIS": 1, "WHEN": 1, "UPDATING": 1, "GetVersionString": 3, "sErrorMessage": 1, "RandomFloat": 1, "DoInit": 2, "Else": 3, "ElseIf": 1, "<": 3, "DoUpgrade": 2, "Debug.MessageBox": 1, "vSCM_ModUpdatedMSG.Show": 1, "CheckForOrphans": 1, "CheckForExtras": 2, "UpdateConfig": 2, "EndFunction": 6, "vSCM_ModLoadedMSG.Show": 1, "fVersion": 3, "Int": 4, "Major": 4, "Math.Floor": 1, "as": 3, "Minor": 4, "*": 1, "Return": 2 }, "Parrot Assembly": { "SHEBANG#!parrot": 1, ".pcc_sub": 1, "main": 2, "say": 1, "end": 1 }, "Parrot Internal Representation": { "SHEBANG#!parrot": 1, ".sub": 1, "main": 1, "say": 1, ".end": 1 }, "Pascal": { "Program": 1, "BullCow": 1, ";": 608, "{": 33, "mode": 3, "objFPC": 1, "}": 32, "uses": 8, "Math": 1, "SysUtils": 3, "type": 4, "TFourDigit": 13, "array": 4, "[": 108, "]": 108, "of": 11, "integer": 9, "Procedure": 12, "WriteFourDigit": 2, "(": 247, "fd": 2, ")": 248, "Write": 10, "out": 1, "a": 153, "with": 1, "no": 1, "line": 1, "break": 1, "following.": 1, "var": 55, "i": 213, "begin": 137, "for": 60, "to": 60, "do": 63, "end": 141, "Function": 12, "WellFormed": 3, "Tentative": 3, "Boolean": 5, "Does": 2, "the": 18, "avoid": 1, "repeating": 1, "digits": 1, "current": 5, "check": 3, "Result": 40, "True": 5, "+": 37, "if": 37, "then": 39, "False": 2, "MakeNumber": 3, "Make": 2, "random": 1, "keeping": 1, "trying": 1, "until": 3, "it": 3, "is": 3, "well": 2, "-": 49, "formed.": 1, "RandomRange": 1, "not": 6, "StrToFourDigit": 3, "s": 15, "string": 8, "Convert": 1, "an": 46, "input": 5, "TFourDigit.": 1, "Length": 74, "StrToInt": 1, "Wins": 2, "Num": 9, "Guess": 9, "guess": 3, "win": 1, "<": 10, "Exit": 10, "GuessScore": 2, "Represent": 1, "score": 2, "as": 3, "string.": 1, "j": 26, "bulls": 5, "cows": 6, "Count": 2, "and": 13, "bulls.": 1, "If": 5, "indices": 1, "are": 1, "same": 1, "that": 2, "would": 1, "be": 3, "bull.": 1, "else": 11, "Format": 2, "result": 8, "sentence.": 1, "IntToStr": 3, "GetGuess": 4, "Get": 1, "formed": 1, "user": 3, "supplied": 1, "guess.": 2, "WriteLn": 13, "ReadLn": 1, "Must": 1, "digits.": 1, "Turns": 5, "Initialize": 1, "randymnity.": 1, "Randomize": 1, "secred": 1, "number.": 1, "gets": 1, "it.": 1, "While": 1, "each": 1, "turn.": 1, "won": 1, "tell": 1, "them": 1, "ditch.": 1, "Otherwise": 1, "get": 1, "new": 1, "end.": 7, "unit": 3, "custforms": 1, "objfpc": 2, "H": 2, "interface": 2, "Classes": 2, "Forms": 2, "Type": 3, "TCustomFormDescr": 13, "Class": 2, "private": 2, "FAuthor": 3, "String": 28, "FCaption": 4, "FCategory": 4, "FDescription": 4, "FFormClass": 4, "TFormClass": 10, "FLazPackage": 4, "FUnitName": 4, "public": 1, "Constructor": 3, "Create": 5, "AFormClass": 12, "const": 7, "APackage": 12, "Const": 5, "ACaption": 3, "ADescription": 3, "AUnit": 3, "Property": 8, "FormClass": 1, "Read": 8, "Caption": 1, "Description": 1, "UnitName": 1, "Category": 1, "Author": 1, "LazPackage": 1, "RegisterCustomForm": 8, "Descr": 3, "AUnitName": 3, "Register": 2, "implementation": 2, "ProjectIntf": 1, "NewItemIntf": 1, "contnrs": 1, "SAppFrameWork": 2, "SInstanceOf": 2, "constructor": 3, "TCustomFormDescr.Create": 4, "Var": 5, "N": 5, "U": 5, "AFormClass.ClassName": 1, "Upcase": 1, "Delete": 1, "TCustomFormFileDescriptor": 3, "TFileDescPascalUnitWithResource": 1, "FFormDescr": 3, "Public": 1, "ADescr": 3, "FormDescr": 1, "GetLocalizedName": 1, "override": 4, "GetLocalizedDescription": 1, "GetInterfaceUsesSection": 2, "TCustomFormFileDescriptor.Create": 2, "Inherited": 1, "ResourceClass": 1, "FFormDescr.FFormClass": 1, "Name": 1, "FFormDescr.Caption": 2, "RequiredPackages": 2, "ADescr.LazPackage": 1, "//Writeln": 1, "function": 21, "TCustomFormFileDescriptor.GetLocalizedName": 1, "TCustomFormFileDescriptor.GetLocalizedDescription": 1, "FFormDescr.Description": 1, "FFormDescr.Author": 2, "LineEnding": 1, "TCustomFormFileDescriptor.GetInterfaceUsesSection": 1, "inherited": 2, "FFormDescr.UnitName": 1, "CustomFormList": 5, "TObjectList": 1, "CustomFormList.Add": 1, "D": 8, "D.UnitName": 1, "L": 3, "TStringList": 2, "I": 4, "Integer": 55, "TStringList.Create": 5, "Try": 1, "L.Sorted": 1, "L.Duplicates": 1, "dupIgnore": 1, "For": 3, "CustomFormList.Count": 2, "L.Add": 1, ".Category": 1, "L.Count": 1, "RegisterNewItemCategory": 1, "TNewIDEItemCategory.Create": 1, "Finally": 1, "L.Free": 1, "RegisterProjectFileDescriptor": 1, "D.Category": 1, "InitCustomForms": 2, "TObjectList.Create": 1, "DoneCustomForms": 2, "FreeAndNil": 1, "Initialization": 2, "Finalization": 2, "cwindirs": 1, "windows": 1, "strings": 1, "CSIDL_PROGRAMS": 1, "CSIDL_PERSONAL": 1, "CSIDL_FAVORITES": 1, "CSIDL_STARTUP": 1, "CSIDL_RECENT": 1, "CSIDL_SENDTO": 1, "CSIDL_STARTMENU": 1, "B": 4, "CSIDL_MYMUSIC": 1, "CSIDL_MYVIDEO": 1, "E": 3, "CSIDL_DESKTOPDIRECTORY": 1, "CSIDL_NETHOOD": 1, "CSIDL_TEMPLATES": 1, "CSIDL_COMMON_STARTMENU": 1, "CSIDL_COMMON_PROGRAMS": 1, "CSIDL_COMMON_STARTUP": 1, "CSIDL_COMMON_DESKTOPDIRECTORY": 1, "CSIDL_APPDATA": 1, "A": 2, "CSIDL_PRINTHOOD": 1, "CSIDL_LOCAL_APPDATA": 1, "C": 1, "CSIDL_COMMON_FAVORITES": 1, "CSIDL_INTERNET_CACHE": 1, "CSIDL_COOKIES": 1, "CSIDL_HISTORY": 1, "CSIDL_COMMON_APPDATA": 1, "CSIDL_WINDOWS": 1, "CSIDL_SYSTEM": 1, "CSIDL_PROGRAM_FILES": 1, "CSIDL_MYPICTURES": 1, "CSIDL_PROFILE": 1, "CSIDL_PROGRAM_FILES_COMMON": 1, "CSIDL_COMMON_TEMPLATES": 1, "CSIDL_COMMON_DOCUMENTS": 1, "CSIDL_COMMON_ADMINTOOLS": 1, "CSIDL_ADMINTOOLS": 1, "CSIDL_COMMON_MUSIC": 1, "CSIDL_COMMON_PICTURES": 1, "CSIDL_COMMON_VIDEO": 1, "CSIDL_CDBURN_AREA": 1, "CSIDL_PROFILES": 1, "CSIDL_FLAG_CREATE": 2, "GetWindowsSpecialDir": 1, "ID": 2, "sysutils": 1, "PFNSHGetFolderPath": 2, "Ahwnd": 1, "HWND": 1, "Csidl": 1, "Token": 1, "THandle": 2, "Flags": 1, "DWord": 1, "Path": 1, "PChar": 2, "HRESULT": 1, "stdcall": 1, "SHGetFolderPath": 4, "Nil": 2, "CFGDLLHandle": 3, "InitDLL": 2, "pathBuf": 1, "MAX_PATH": 1, "char": 1, "pathLength": 1, "Load": 1, "shfolder.dll": 2, "using": 1, "full": 1, "path": 1, "in": 7, "order": 1, "prevent": 1, "spoofing": 1, "Mantis": 1, "#18185": 1, "Don": 1, "SHGetFolderPathA": 1, "Could": 1, "determine": 1, "or": 5, "@APATH": 1, "S_OK": 1, "IncludeTrailingPathDelimiter": 1, "StrPas": 1, "@APath": 1, "FreeLibrary": 1, "CFGDllHandle": 1, "GetUnixMangaImageURL": 1, "l": 3, "manager.container.PageContainerLinks": 1, "workCounter": 2, "GetPage": 1, "TObject": 1, "manager.container.Manager.retryConnect": 1, "Self.Terminated": 1, "l.Free": 2, "parse.Free": 2, "parse": 4, "Parser": 1, "THTMLParser.Create": 1, "l.Text": 1, "Parser.OnFoundTag": 1, "OnTag": 1, "Parser.OnFoundText": 1, "OnText": 1, "Parser.Exec": 1, "Parser.Free": 1, "parse.Count": 2, "Pos": 4, "manager.container.PageLinks": 1, "Trim": 3, "GetVal": 1, "Break": 1, "program": 3, "large": 1, "max": 4, "tlist": 2, "longint": 8, "data": 16, "while": 1, "Writeln": 1, "This": 2, "file": 2, "part": 1, "Free": 2, "Component": 1, "Library": 1, "FCL": 1, "Copyright": 2, "c": 16, "by": 2, "Pascal": 1, "development": 1, "team": 1, "BIOS": 1, "functions": 1, "Nintendo": 1, "DS": 1, "Francesco": 1, "Lombardi": 1, "See": 1, "COPYING.FPC": 1, "included": 1, "this": 1, "distribution": 1, "details": 1, "about": 1, "copyright.": 1, "distributed": 1, "hope": 1, "will": 1, "useful": 1, "but": 1, "WITHOUT": 1, "ANY": 1, "WARRANTY": 1, "without": 1, "even": 1, "implied": 1, "warranty": 1, "MERCHANTABILITY": 1, "FITNESS": 1, "FOR": 1, "PARTICULAR": 1, "PURPOSE.": 1, "*****************************************************************************": 1, "__errno": 1, "plongint": 1, "cdecl": 1, "export": 1, "S_ISBLK": 1, "m": 28, "boolean": 7, "inline": 8, "_IFMT": 7, "_IFBLK": 1, "S_ISCHR": 1, "_IFCHR": 1, "S_ISDIR": 1, "_IFDIR": 1, "S_ISFIFO": 1, "_IFIFO": 1, "S_ISREG": 1, "_IFREG": 1, "S_ISLNK": 1, "_IFLNK": 1, "S_ISSOCK": 1, "_IFSOCK": 1, "gmail": 1, "Unit2": 1, "Form2": 2, "R": 1, "*.res": 1, "Application.Initialize": 1, "Application.MainFormOnTaskbar": 1, "Application.CreateForm": 1, "TForm2": 1, "Application.Run": 1, "SHEBANG#!instantfpc": 1, "defined": 1, "fpc": 1, "fpc_fullversion": 1, "error": 1, "FPC": 1, "greater": 1, "required": 1, "endif": 1, "gvector": 1, "ghashmap": 1, "TStrHashCaseInsensitive": 1, "class": 4, "hash": 1, "n": 125, "TStrHashCaseInsensitive.hash": 1, "x": 4, "Char": 1, "UpCase": 3, "Inc": 2, "Ord": 1, "mod": 18, "TConfigValues": 1, "specialize": 2, "TVector": 56, "": 1, "TConfigStorage": 2, "THashMap": 1, "": 1, "destructor": 2, "Destroy": 2, "TConfigStorage.Destroy": 1, "It": 2, "TIterator": 1, "Size": 1, "Iterator": 1, "repeat": 1, "It.Value.Free": 1, "It.Next": 1, "It.Free": 1, "ConfigStrings": 3, "ConfigValues": 3, "TStrings": 1, "ConfigStorage": 8, "ConfigLine": 10, "ConfigName": 6, "ConfigValue": 3, "SeparatorPos": 8, "ConfigValues.Delimiter": 1, "ConfigValues.StrictDelimiter": 1, "true": 3, "TConfigStorage.Create": 1, "ConfigStrings.LoadFromFile": 1, "case": 4, "//": 1, "ignore": 1, "Copy": 2, "ConfigValues.DelimitedText": 1, "ConfigStorage.Contains": 3, "TConfigValues.Create": 1, ".PushBack": 1, "BoolToStr": 2, "ConfigStorage.Free": 1, "ConfigValues.Free": 1, "ConfigStrings.Free": 1, "uw27294": 1, "p": 4, "procedure": 3, "test": 2, "@test": 1, "writeln": 1, "global": 2, "nil": 6, "uw27294.global": 1, "operator": 37, "b": 123, "res": 142, "bn": 25, "rn": 23, "math.max": 5, "SetLength": 42, "Double": 23, "operator*": 3, "*": 12, "operator/": 3, "/": 3, "operator**": 4, "IsNan": 2, "NaN": 3, "Infinity": 3, "NegInfinity": 4, "sign": 4, "power": 1, "**": 3, "<(a:>": 4, "TMatrix": 69, "0": 36, "math": 1, "1": 22, "matrix": 15, "vector": 5, ".VType": 1, "vtInteger": 1, ".VInteger": 1, "vtExtended": 1, ".VExtended": 1, "vtCurrency": 1, ".VCurrency": 1, "vtInt64": 1, ".VInt64": 1, "nrow": 11, "ncol": 12, "byrow": 4, "div": 2, "rep": 3, "times": 4, "trunc": 2, "len": 6 }, "Perl": { "package": 18, "App": 131, "Ack": 136, ";": 1419, "use": 94, "warnings": 18, "strict": 21, "File": 56, "Next": 27, "Plugin": 2, "Basic": 11, "head1": 31, "NAME": 5, "-": 1067, "A": 2, "container": 1, "for": 83, "functions": 2, "the": 141, "ack": 38, "program": 7, "VERSION": 15, "Version": 1, "cut": 27, "our": 34, "COPYRIGHT": 6, "BEGIN": 8, "{": 1417, "}": 1429, "fh": 28, "*STDOUT": 6, "%": 82, "types": 26, "type_wanted": 20, "mappings": 29, "ignore_dirs": 12, "input_from_pipe": 8, "output_to_pipe": 12, "dir_sep_chars": 10, "is_cygwin": 6, "is_windows": 12, "Spec": 14, "(": 1153, ")": 1152, "Glob": 4, "Getopt": 6, "Long": 6, "_MTN": 2, "blib": 2, "CVS": 5, "RCS": 2, "SCCS": 2, "_darcs": 2, "_sgbak": 2, "_build": 2, "actionscript": 2, "[": 202, "qw": 36, "as": 36, "mxml": 2, "]": 198, "ada": 4, "adb": 2, "ads": 2, "asm": 4, "s": 35, "batch": 2, "bat": 2, "cmd": 2, "binary": 3, "q": 5, "Binary": 2, "files": 41, "defined": 54, "by": 14, "Perl": 6, "T": 2, "op": 2, "default": 16, "off": 4, "tt": 4, "tt2": 2, "ttml": 2, "vb": 4, "bas": 2, "cls": 2, "frm": 2, "ctl": 2, "resx": 2, "verilog": 2, "v": 19, "vh": 2, "sv": 2, "vhdl": 4, "vhd": 2, "vim": 4, "yaml": 4, "yml": 2, "xml": 6, "dtd": 2, "xsl": 2, "xslt": 2, "ent": 2, "while": 33, "my": 461, "type": 69, "exts": 6, "each": 14, "if": 324, "ref": 35, "ext": 14, "@": 54, "push": 37, "_": 105, "mk": 2, "mak": 2, "not": 55, "t": 21, "p": 10, "STDIN": 3, "O": 4, "eq": 62, "/MSWin32/": 2, "quotemeta": 5, "catfile": 4, "SYNOPSIS": 5, "If": 14, "you": 33, "want": 5, "to": 93, "know": 4, "about": 3, "F": 24, "": 13, "see": 4, "file": 49, "itself.": 2, "No": 4, "user": 5, "serviceable": 1, "parts": 1, "inside.": 1, "is": 67, "all": 27, "that": 29, "should": 8, "this.": 1, "FUNCTIONS": 1, "head2": 32, "read_ackrc": 4, "Reads": 1, "contents": 2, "of": 58, ".ackrc": 1, "and": 83, "returns": 4, "arguments.": 1, "sub": 242, "@files": 12, "ENV": 43, "ACKRC": 2, "@dirs": 4, "HOME": 4, "USERPROFILE": 2, "dir": 27, "grep": 17, "bsd_glob": 4, "GLOB_TILDE": 2, "filename": 72, "&&": 84, "e": 21, "open": 11, "or": 50, "die": 41, "@lines": 21, "/./": 2, "/": 84, "s*#/": 2, "<$fh>": 4, "chomp": 4, "close": 22, "s/": 30, "+": 127, "//": 10, "return": 174, "get_command_line_options": 4, "Gets": 3, "command": 15, "line": 27, "arguments": 2, "does": 11, "specific": 1, "tweaking.": 1, "opt": 291, "pager": 19, "ACK_PAGER_COLOR": 7, "||": 53, "ACK_PAGER": 5, "getopt_specs": 6, "m": 17, "after_context": 16, "before_context": 18, "shift": 173, "val": 26, "break": 14, "c": 6, "count": 23, "color": 38, "ACK_COLOR_MATCH": 5, "ACK_COLOR_FILENAME": 5, "ACK_COLOR_LINENO": 4, "column": 4, "#": 108, "ignore": 7, "this": 18, "option": 7, "it": 27, "handled": 2, "beforehand": 2, "f": 25, "flush": 8, "follow": 7, "G": 11, "heading": 18, "h": 6, "H": 6, "i": 31, "invert_file_match": 8, "lines": 20, "l": 22, "regex": 42, "n": 20, "o": 17, "output": 40, "undef": 17, "passthru": 9, "print0": 7, "Q": 7, "show_types": 4, "smart_case": 3, "sort_files": 11, "u": 10, "w": 7, "remove_dir_sep": 7, "delete": 10, "print_version_statement": 2, "exit": 20, "show_help": 3, "@_": 49, "show_help_types": 2, "require": 14, "Pod": 4, "Usage": 4, "pod2usage": 2, "verbose": 2, "exitval": 2, "dummy": 2, "wanted": 4, "no//": 2, "must": 7, "be": 33, "later": 2, "exists": 32, "else": 72, "qq": 18, "Unknown": 2, "unshift": 4, "@ARGV": 12, "split": 15, "ACK_OPTIONS": 5, "def_types_from_ARGV": 5, "filetypes_supported": 5, "parser": 12, "Parser": 4, "new": 56, "configure": 4, "getoptions": 4, "to_screen": 10, "defaults": 16, "eval": 8, "Win32": 9, "Console": 2, "ANSI": 3, "key": 20, "value": 14, "<": 15, "join": 7, "map": 10, "@ret": 10, "from": 20, "warn": 23, "..": 7, "uniq": 4, "@uniq": 2, "sort": 9, "a": 84, "<=>": 2, "b": 6, "keys": 19, "numerical": 2, "occurs": 2, "only": 11, "once": 4, "Go": 1, "through": 10, "look": 2, "I": 67, "<--type-set>": 1, "foo=": 1, "bar": 3, "<--type-add>": 1, "xml=": 1, ".": 162, "Remove": 1, "them": 5, "add": 8, "supported": 1, "filetypes": 8, "i.e.": 2, "into": 8, "etc.": 1, "@typedef": 8, "td": 6, "set": 11, "Builtin": 4, "cannot": 4, "changed.": 4, "ne": 11, "delete_type": 5, "Type": 2, "exist": 5, "creating": 2, "with": 28, "...": 2, "unless": 40, "@exts": 8, ".//": 2, "Cannot": 4, "append": 2, "Removes": 1, "internal": 1, "structures": 1, "containing": 5, "information": 1, "type_wanted.": 1, "Internal": 3, "error": 4, "builtin": 2, "ignoredir_filter": 5, "Standard": 1, "filter": 12, "pass": 1, "L": 18, "": 1, "descend_filter.": 1, "It": 2, "true": 3, "directory": 8, "any": 3, "ones": 1, "we": 9, "ignore.": 1, "path": 29, "This": 24, "removes": 1, "trailing": 1, "separator": 4, "there": 6, "one": 9, "its": 2, "argument": 1, "Returns": 10, "list": 10, "<$filename>": 1, "could": 2, "be.": 1, "For": 5, "example": 5, "": 1, "The": 20, "filetype": 1, "will": 7, "C": 48, "": 1, "can": 26, "skipped": 2, "something": 2, "avoid": 1, "searching": 6, "even": 4, "under": 4, "a.": 1, "constant": 2, "TEXT": 16, "basename": 9, ".*": 5, "is_searchable": 8, "lc_basename": 8, "lc": 5, "r": 18, "B": 75, "header": 17, "SHEBANG#!#!": 2, "ruby": 3, "|": 31, "lua": 2, "erl": 2, "hp": 2, "ython": 2, "d": 9, "d.": 2, "*": 8, "b/": 4, "ba": 2, "k": 6, "z": 2, "sh": 2, "/i": 2, "search": 11, "false": 1, "regular": 3, "expression": 9, "found.": 4, "www": 2, "U": 2, "y": 8, "tr/": 2, "x": 12, "w/": 3, "nOo_/": 2, "_thpppt": 3, "_get_thpppt": 3, "print": 47, "_bar": 3, "<<": 6, "&": 36, "*I": 2, "g": 7, "#.": 6, ".#": 4, "I#": 2, "#I": 6, "#7": 4, "results.": 2, "on": 27, "when": 18, "used": 12, "interactively": 6, "no": 21, "Print": 6, "between": 3, "results": 8, "different": 3, "files.": 6, "group": 2, "Same": 8, "nogroup": 2, "noheading": 2, "nobreak": 2, "Highlight": 2, "matching": 15, "text": 6, "redirected": 2, "Windows": 4, "colour": 2, "COLOR": 6, "match": 24, "lineno": 2, "Set": 3, "filenames": 7, "matches": 7, "numbers.": 2, "Flush": 2, "immediately": 2, "non": 2, "goes": 2, "pipe": 4, "finding": 2, "Only": 7, "found": 9, "without": 3, "searching.": 2, "PATTERN": 8, "specified.": 4, "REGEX": 2, "but": 4, "REGEX.": 2, "Sort": 2, "lexically.": 3, "invert": 2, "Print/search": 2, "handle": 2, "do": 15, "g/": 2, "G.": 2, "show": 3, "Show": 2, "which": 6, "has.": 2, "inclusion/exclusion": 2, "All": 5, "searched": 5, "Ignores": 2, ".svn": 3, "other": 6, "ignored": 6, "directories": 9, "unrestricted": 2, "name": 60, "Add/Remove": 2, "dirs": 2, "R": 2, "recurse": 2, "Recurse": 3, "subdirectories": 2, "END_OF_HELP": 2, "VMS": 2, "vd": 2, "Term": 6, "ANSIColor": 8, "black": 3, "on_yellow": 3, "bold": 5, "green": 3, "yellow": 3, "printing": 2, "qr/": 13, "last_output_line": 6, "any_output": 10, "keep_context": 8, "@before": 16, "before_starts_at_line": 10, "after": 18, "number": 3, "still": 4, "res": 59, "next_text": 8, "has_lines": 4, "scalar": 3, "m/": 12, "regex/": 9, "next": 9, "print_match_or_context": 13, "elsif": 26, "last": 17, "max": 12, "nmatches": 61, "show_filename": 35, "context_overall_output_count": 6, "print_blank_line": 2, "is_binary": 4, "search_resource": 7, "is_match": 7, "starting_line_no": 1, "match_start": 5, "match_end": 3, "Prints": 4, "out": 3, "context": 1, "around": 5, "match.": 3, "opts": 2, "array": 7, "line_no": 12, "show_column": 4, "display_filename": 8, "colored": 6, "print_first_filename": 2, "sep": 8, "output_func": 8, "print_separator": 2, "print_filename": 2, "display_line_no": 4, "print_line_no": 2, "regex/go": 2, "regex/Term": 2, "substr": 2, "/eg": 2, "z/": 2, "K/": 2, "z//": 2, "print_column_no": 2, "scope": 4, "TOTAL_COUNT_SCOPE": 2, "total_count": 10, "get_total_count": 4, "reset_total_count": 4, "search_and_list": 8, "Optimized": 1, "version": 2, "lines.": 3, "ors": 11, "record": 3, "show_total": 6, "print_count": 4, "print_count0": 2, "filetypes_supported_set": 9, "True/False": 1, "are": 25, "print_files": 4, "iter": 23, "returned": 2, "iterator": 3, "<$regex>": 1, "<$one>": 1, "stop": 1, "first.": 1, "<$ors>": 1, "<\"\\n\">": 1, "defines": 1, "what": 15, "filename.": 1, "print_files_with_matches": 4, "where": 4, "was": 2, "repo": 18, "Repository": 11, "next_resource": 6, "print_matches": 4, "tarballs_work": 4, ".tar": 2, ".gz": 2, "Tar": 4, "XXX": 4, "Error": 2, "checking": 2, "needs_line_scan": 14, "reset": 5, "filetype_setup": 4, "Minor": 1, "housekeeping": 1, "before": 1, "go": 1, "expand_filenames": 7, "reference": 8, "expanded": 3, "globs": 1, "EXPAND_FILENAMES_SCOPE": 4, "argv": 12, "attr": 6, "foreach": 13, "pattern": 10, "@results": 14, "didn": 2, "ve": 2, "tried": 2, "load": 2, "GetAttributes": 2, "end": 10, "attributes": 4, "got": 2, "get_starting_points": 4, "starting": 2, "@what": 14, "reslash": 4, "Assume": 2, "current": 6, "start_point": 4, "_match": 8, "target": 6, "invert_flag": 4, "get_iterator": 4, "Return": 2, "starting_point": 10, "g_regex": 4, "file_filter": 12, "g_regex/": 6, "Maybe": 2, "is_interesting": 4, "descend_filter": 11, "error_handler": 5, "msg": 5, "follow_symlinks": 6, "set_up_pager": 3, "Unable": 2, "going": 1, "pipe.": 1, "exit_from_ack": 5, "Exit": 1, "application": 10, "correct": 1, "code.": 2, "otherwise": 2, "handed": 1, "in": 34, "argument.": 1, "rc": 11, "LICENSE": 3, "Copyright": 2, "Andy": 2, "Lester.": 2, "free": 3, "software": 3, "redistribute": 3, "and/or": 3, "modify": 3, "terms": 3, "Artistic": 2, "License": 2, "v2.0.": 2, "End": 3, "SHEBANG#!perl": 6, "##": 79, "configuration": 3, "options": 8, "BASE_DIR": 1, "CONFIG_FILE": 2, "Config": 1, "location": 5, "DEBUG_LOG_FILE": 2, "Specify": 2, "create": 3, "log": 4, "writable": 2, "nagios": 3, "DEBUGLEVEL": 3, "Nothing": 1, "Errors": 1, "Warnings": 1, "Debug": 1, "DEBUGOUTPUT": 8, "STDERR": 5, "STDOUT": 1, "cgi": 4, "Global": 1, "vars": 1, "DEBUG_TIMESTAMP": 5, "Find": 1, "how": 2, "run": 2, "ARGV": 5, "test": 1, "errors": 4, "console": 1, "read_config": 4, "abort": 23, "parse": 3, "performance": 2, "data": 5, "started": 1, "parse_perfdata": 2, "CGI": 9, "script": 1, "web": 6, "browser": 1, "run_as_cgi": 2, "some": 1, "help": 3, "info": 1, "logfile": 1, "write": 4, "blank": 2, "wrote": 1, "anything...": 1, "debug": 39, "Program": 1, "called": 4, "graph_name": 18, "param": 10, "graph_iteration": 6, "config": 67, "display": 2, "index": 2, "graphs": 3, "display_htmltemplate": 3, "graph": 4, "Display": 3, "HTML": 6, "page": 1, "generate": 1, "call": 3, "rrdtool_cmdline": 11, ".join": 4, "expand": 1, "variables": 1, "rrdarchive": 1, "f/": 1, "rrdarchive/g": 1, "t_start": 4, "t_start/g": 1, "t_end": 4, "e/": 1, "t_end/g": 1, "t_descr": 3, "d/": 1, "t_descr/g": 1, "Call": 1, "rrdtool": 3, "probably": 1, "fixed": 1, "better": 1, "way": 3, "like": 13, "exec": 1, "template": 3, "variable": 3, "substitution": 1, "stuff": 1, "": 1, "big": 2, "regex..": 1, "/my": 1, "varname": 8, "date": 3, "time": 6, "localtime": 2, "code": 9, "return_html": 4, "gn": 2, "return_html.": 2, "escape": 1, "slash": 1, "since": 2, "were": 2, "inside": 1, "an": 12, "displaying": 1, "actual": 1, "images": 1, "iteration_id": 2, "unknown": 1, "/eig": 1, "thought": 1, "would": 4, "never": 2, "Process": 1, "incoming": 1, "check": 3, "plugin": 1, "insert": 1, "values": 7, "rrd": 3, "archives": 2, "rrd_updates": 12, "Provide": 1, "more": 3, "symbolic": 1, "names": 3, "same": 3, "macros": 1, "LASTCHECK": 1, "HOSTNAME": 2, "SERVICEDESCR": 2, "SERVICESTATE": 1, "OUTPUT": 2, "PERFDATA": 2, "host_and_descr_found": 3, "Loop": 4, "host_regexes": 1, "host_regex": 5, "service_description_regexes": 1, "service_regex": 4, "host_regex/i": 1, "service_regex/i": 1, "InsertValue": 1, "host": 1, "service_description": 1, "insert_value": 10, "regexes": 4, "output/perfdata": 1, "regex_string": 1, "regex_string/": 2, "Insert": 1, "RRD": 3, "calling": 1, "may": 4, "several": 1, "archive": 8, "rrdarchive_filename": 3, "Create": 1, "Archive": 1, "according": 1, "rrdarchive_filename.": 3, "rrdtool_cmdline.": 1, "Check": 1, "wheter": 1, "Assemle": 1, "result": 3, "Read": 1, "CONFIG": 2, "line_counter": 2, "": 1, "@args": 11, "shellwords": 1, "orig_confline": 1, "args": 37, "uc": 1, "INSERTVALUE": 1, "rrd_filename": 2, "rrdcreatetemplate": 4, "hostname_regex": 4, "servicedescr_regex": 4, "regex_template": 3, "verify": 3, "hostname": 2, "service": 1, "description": 2, "s*": 1, "#/": 1, "comment": 1, "row": 1, "nuthin": 1, "RRDToolPath": 1, "PlotTemplate": 1, "htmltemplate": 2, "parameters..": 2, "@params": 7, "GraphTimeTemplate": 1, "time_template": 2, "@t_descr": 2, "workaround": 1, "string": 6, "RRDCreateTemplate": 1, "ValueRegexTemplate": 1, "template_name": 3, "@regexes": 2, "perfdata": 1, "regex_what": 2, "dsa_name": 2, "RRDARCHIVEPATH": 1, "HTMLTemplatePath": 1, "GraphIndexTemplate": 1, "GRAPH": 1, "rrdfilename": 1, "graphtimetemplate": 1, "plottemplate": 1, "Write": 1, "output/logging": 1, "level": 3, "timestamp": 1, "msg.": 2, "exception_handler": 1, "sigtrap": 2, "normal": 2, "signals": 1, "IO": 2, "Handle": 2, "Carp": 18, "Basename": 3, "Data": 1, "Dumper": 2, "tm_die": 4, "CarpLevel": 3, "How": 1, "many": 1, "extra": 1, "levels": 1, "skip": 1, "carp.": 1, "*CORE": 1, "GLOBAL": 1, "main": 4, "SIG": 4, "__DIE__": 1, "error_fd": 1, "TM_ERROR_FD": 3, "autoflush": 1, "realwarn": 1, "CORE": 6, "realdie": 2, "longmess": 3, "arg": 7, "@rest": 6, "local": 7, "Heavy": 1, "INC": 1, "call_pack": 3, "caller": 3, "CarpInternal": 1, "longmess_heavy": 3, "don": 3, "url": 3, "exception_report": 1, "framed": 1, "exception": 1, "txmt": 2, "//open": 2, "": 1, "": 2, "": 1, "nbsp": 1, "display_name": 1, "at": 4, "tid_msg": 1, "": 1, "": 1, "": 1, "": 1, "mess": 1, "ineval": 3, "MOD_PERL": 1, "S": 2, "/eval": 1, "/m": 1, "htmlize": 1, "amp": 1, "/g": 2, "": 1, "gt": 1, "SHEBANG#!#! perl": 4, "examples/benchmarks/fib.pl": 1, "Fibonacci": 2, "Benchmark": 1, "DESCRIPTION": 4, "Calculates": 1, "Number": 1, "": 1, "unspecified": 1, "fib": 4, "N": 2, "SEE": 3, "ALSO": 3, "": 1, "MAIN": 1, "env_is_usable": 3, "th": 1, "pt": 1, "env": 76, "@keys": 2, "ACK_/": 1, "@ENV": 1, "load_colors": 1, "ACK_SWITCHES": 1, "Unbuffer": 1, "mode": 1, "build_regex": 3, "nargs": 2, "Resource": 5, "file_matching": 2, "check_regex": 2, "finder": 1, "FILE...": 1, "DIRECTORY...": 1, "designed": 1, "replacement": 1, "uses": 2, "": 5, "searches": 1, "named": 3, "input": 9, "FILEs": 1, "standard": 1, "given": 10, "PATTERN.": 1, "By": 2, "prints": 2, "also": 7, "actually": 1, "let": 1, "take": 5, "advantage": 1, ".wango": 1, "won": 1, "throw": 1, "away": 1, "because": 3, "times": 2, "symlinks": 1, "than": 5, "whatever": 1, "specified": 3, "line.": 4, "default.": 2, "item": 42, "": 11, "paths": 3, "included": 1, "search.": 1, "entire": 2, "matched": 1, "against": 1, "shell": 4, "glob.": 1, "<-i>": 5, "<-w>": 2, "<-v>": 3, "<-Q>": 4, "apply": 2, "relative": 1, "convenience": 1, "shortcut": 2, "<-f>": 6, "<--group>": 2, "<--nogroup>": 2, "groups": 1, "with.": 1, "interactively.": 1, "per": 1, "grep.": 2, "redirected.": 1, "<-H>": 1, "<--with-filename>": 1, "<-h>": 1, "<--no-filename>": 1, "Suppress": 1, "prefixing": 1, "multiple": 5, "searched.": 1, "<--help>": 1, "short": 1, "statement.": 1, "<--ignore-case>": 1, "Ignore": 3, "case": 3, "strings.": 1, "applies": 3, "<-g>": 5, "<-G>": 3, "options.": 4, "": 2, "etc": 2, "May": 2, "directories.": 2, "mason": 1, "users": 4, "wish": 1, "include": 1, "<--ignore-dir=data>": 1, "<--noignore-dir>": 1, "allows": 2, "normally": 1, "perhaps": 1, "research": 1, "<.svn/props>": 1, "always": 5, "simple": 2, "name.": 1, "Nested": 1, "": 1, "NOT": 1, "supported.": 1, "You": 3, "need": 3, "specify": 1, "<--ignore-dir=foo>": 1, "then": 3, "foo": 6, "taken": 1, "account": 1, "explicitly": 1, "": 2, "file.": 2, "Multiple": 1, "<--line>": 1, "comma": 1, "separated": 2, "<--line=3,5,7>": 1, "<--line=4-7>": 1, "works.": 1, "ascending": 1, "order": 2, "matter": 1, "<-l>": 2, "<--files-with-matches>": 1, "instead": 4, "text.": 1, "<-L>": 1, "<--files-without-matches>": 1, "": 2, "equivalent": 2, "specifying": 1, "explicitly.": 1, "helpful": 2, "": 1, "via": 1, "": 4, "": 4, "environment": 2, "variables.": 1, "Using": 3, "suppress": 3, "grouping": 3, "coloring": 3, "piping": 3, "does.": 2, "<--passthru>": 1, "whether": 1, "they": 1, "expression.": 1, "Highlighting": 1, "work": 1, "though": 1, "so": 3, "highlight": 1, "seeing": 1, "tail": 1, "/access.log": 1, "<--print0>": 1, "works": 1, "conjunction": 1, "null": 1, "byte": 1, "usual": 1, "newline.": 1, "dealing": 1, "contain": 2, "whitespace": 1, "e.g.": 1, "html": 1, "xargs": 2, "rm": 1, "<--literal>": 1, "Quote": 1, "metacharacters": 2, "treated": 1, "literal.": 1, "<-r>": 1, "<-R>": 1, "<--recurse>": 1, "just": 2, "here": 2, "compatibility": 2, "turning": 1, "<--no-recurse>": 1, "off.": 1, "<--smart-case>": 1, "<--no-smart-case>": 1, "strings": 1, "contains": 1, "uppercase": 1, "characters.": 1, "similar": 1, "": 1, "vim.": 1, "overrides": 2, "option.": 1, "<--sort-files>": 1, "Sorts": 1, "Use": 6, "your": 13, "listings": 1, "deterministic": 1, "runs": 1, "<--show-types>": 1, "Outputs": 1, "associates": 1, "Works": 1, "<--thpppt>": 1, "important": 1, "Bill": 1, "Cat": 1, "logo.": 1, "Note": 4, "exact": 1, "spelling": 1, "<--thpppppt>": 1, "important.": 1, "make": 3, "perl": 9, "php": 2, "python": 1, "looks": 1, "location.": 1, "specifies": 1, "placed": 1, "front": 1, "explicit": 1, "Specifies": 4, "recognized": 1, "clear": 2, "dark": 1, "underline": 1, "underscore": 2, "blink": 1, "reverse": 1, "concealed": 1, "red": 1, "blue": 1, "magenta": 1, "on_black": 1, "on_red": 1, "on_green": 1, "on_blue": 1, "on_magenta": 1, "on_cyan": 1, "on_white.": 1, "Case": 1, "significant.": 1, "Underline": 1, "reset.": 1, "alone": 1, "sets": 4, "foreground": 1, "on_color": 1, "background": 1, "color.": 2, "<--color-filename>": 1, "printed": 1, "<--color>": 1, "mode.": 1, "<--color-lineno>": 1, "See": 1, "": 1, "specifications.": 1, "such": 5, "": 1, "": 1, "": 1, "send": 1, "output.": 1, "except": 1, "assume": 1, "support": 2, "both": 1, "understands": 1, "sequences.": 1, "back": 3, "ACK": 2, "OTHER": 1, "TOOLS": 1, "Vim": 3, "integration": 3, "integrates": 1, "easily": 2, "editor.": 1, "<.vimrc>": 1, "grepprg": 1, "That": 3, "examples": 1, "<-a>": 1, "flags.": 1, "Now": 1, "step": 1, "perllib": 1, "Emacs": 1, "Phil": 1, "Jackson": 1, "put": 1, "together": 1, "": 1, "extension": 1, "": 1, "TextMate": 2, "Pedro": 1, "Melo": 1, "who": 1, "writes": 1, "Shell": 2, "Code": 1, "greater": 1, "<$?=256>": 1, "": 1, "backticks.": 1, "used.": 1, "least": 1, "returned.": 1, "DEBUGGING": 1, "PROBLEMS": 1, "gives": 2, "re": 3, "expecting": 1, "forgotten": 1, "<--noenv>": 1, "<.ackrc>": 1, "remember.": 1, "Put": 1, "definitions": 1, "it.": 1, "smart": 1, "too.": 1, "there.": 1, "working": 1, "codesets": 1, "tree": 2, "ideal": 1, "sending": 1, "": 1, "prefer": 1, "doubt": 1, "day": 1, "find": 1, "trouble": 1, "spots": 1, "website": 1, "visitor.": 1, "had": 1, "problem": 1, "loading": 1, "": 1, "took": 1, "access": 2, "scanned": 1, "twice.": 1, "aa.bb.cc.dd": 1, "/path/to/access.log": 1, "B5": 1, "troublesome.gif": 1, "first": 1, "finds": 2, "Apache": 2, "IP.": 1, "second": 1, "troublesome": 1, "GIF": 1, "shows": 1, "previous": 1, "five": 1, "case.": 1, "Share": 1, "knowledge": 1, "Join": 1, "mailing": 1, "list.": 1, "Send": 1, "me": 1, "tips": 1, "here.": 1, "FAQ": 1, "Why": 2, "isn": 1, "doesn": 8, "behavior": 3, "driven": 1, "filetype.": 1, "": 1, "kind": 1, "ignores": 1, "switch": 1, "you.": 1, "source": 2, "compiled": 1, "object": 6, "control": 1, "metadata": 1, "wastes": 1, "lot": 1, "those": 2, "well": 2, "returning": 1, "things": 1, "great": 1, "did": 1, "replace": 3, "read": 6, "only.": 1, "has": 2, "perfectly": 1, "good": 2, "using": 2, "<-p>": 1, "<-n>": 1, "switches.": 1, "certainly": 2, "select": 1, "update.": 1, "change": 1, "PHP": 1, "Unix": 1, "Can": 1, "recognize": 1, "<.xyz>": 1, "already": 2, "program/package": 1, "ack.": 2, "Yes": 1, "know.": 1, "nothing": 1, "suggest": 1, "symlink": 1, "points": 1, "": 1, "crucial": 1, "benefits": 1, "having": 1, "Regan": 1, "Slaven": 1, "ReziE": 1, "<0x107>": 1, "Mark": 1, "Stosberg": 1, "David": 1, "Alan": 1, "Pisoni": 1, "Adriano": 1, "Ferreira": 1, "James": 1, "Keenan": 1, "Leland": 1, "Johnson": 1, "Ricardo": 1, "Signes": 1, "Pete": 1, "Krawczyk.": 1, "files_defaults": 3, "skip_dirs": 3, "curdir": 1, "updir": 1, "__PACKAGE__": 1, "parms": 15, "@queue": 8, "_setup": 2, "fullpath": 12, "splice": 2, "wantarray": 3, "_candidate_files": 2, "sort_standard": 2, "cmp": 2, "sort_reverse": 1, "@parts": 3, "passed_parms": 6, "copy": 4, "parm": 1, "hash": 11, "badkey": 1, "start": 6, "dh": 4, "opendir": 1, "@newfiles": 5, "sort_sub": 4, "readdir": 1, "has_stat": 3, "catdir": 3, "closedir": 1, "": 1, "these": 1, "updated": 1, "update": 1, "message": 1, "bak": 1, "core": 1, "swp": 1, "min": 3, "js": 1, "1": 1, "str": 12, "regex_is_lc": 2, ".*//": 1, "_my_program": 3, "FAIL": 12, "confess": 2, "@ISA": 2, "class": 8, "self": 141, "bless": 7, "could_be_binary": 4, "opened": 1, "id": 6, "*STDIN": 2, "size": 5, "_000": 1, "buffer": 9, "sysread": 1, "regex/m": 1, "seek": 4, "readline": 1, "nexted": 3, "POSIX": 1, "#line": 1, "getchar": 1, "usage": 1, "getc": 1, "Fast": 3, "XML": 2, "Hash": 11, "XS": 2, "FindBin": 1, "Bin": 3, "#use": 1, "lib": 2, "_stop": 4, "request": 11, "nginx": 2, "external": 2, "fcgi": 2, "Ext_Request": 1, "FCGI": 1, "Request": 11, "*STDERR": 1, "int": 2, "conv": 2, "use_attr": 1, "indent": 1, "xml_decl": 1, "tmpl_path": 2, "tmpl": 5, "nick": 1, "parent": 5, "third_party": 1, "artist_name": 2, "venue": 2, "event": 2, "zA": 1, "Z0": 1, "Content": 2, "application/xml": 1, "charset": 2, "utf": 2, "hash2xml": 1, "text/html": 1, "nError": 1, "M": 1, "system": 1, "Foo": 11, "Bar": 1, "@array": 1, "Plack": 25, "_001": 1, "HTTP": 16, "Headers": 8, "MultiValue": 9, "Body": 2, "Upload": 2, "TempBuffer": 2, "URI": 11, "Escape": 6, "_deprecated": 8, "alt": 1, "method": 7, "carp": 2, "croak": 3, "required": 2, "address": 2, "REMOTE_ADDR": 1, "remote_host": 2, "REMOTE_HOST": 1, "protocol": 1, "SERVER_PROTOCOL": 1, "REQUEST_METHOD": 1, "port": 1, "SERVER_PORT": 2, "REMOTE_USER": 1, "request_uri": 1, "REQUEST_URI": 2, "path_info": 4, "PATH_INFO": 3, "script_name": 1, "SCRIPT_NAME": 2, "scheme": 3, "secure": 2, "body": 30, "content_length": 4, "CONTENT_LENGTH": 3, "content_type": 5, "CONTENT_TYPE": 2, "session": 1, "session_options": 1, "logger": 1, "cookies": 9, "HTTP_COOKIE": 3, "@pairs": 2, "pair": 4, "uri_unescape": 1, "query_parameters": 3, "uri": 11, "query_form": 2, "content": 8, "_parse_request_body": 4, "cl": 10, "raw_body": 1, "headers": 56, "field": 2, "HTTPS": 1, "_//": 1, "CONTENT": 1, "COOKIE": 1, "content_encoding": 5, "referer": 3, "user_agent": 3, "body_parameters": 3, "parameters": 8, "query": 4, "flatten": 3, "uploads": 5, "url_scheme": 1, "params": 1, "query_params": 1, "body_params": 1, "cookie": 6, "get_all": 2, "upload": 13, "raw_uri": 1, "base": 10, "path_query": 1, "_uri_base": 3, "path_escape_class": 2, "uri_escape": 3, "QUERY_STRING": 3, "canonical": 2, "HTTP_HOST": 1, "SERVER_NAME": 1, "new_response": 4, "Response": 16, "ct": 3, "cleanup": 1, "spin": 2, "chunk": 4, "length": 1, "rewind": 1, "from_mixed": 2, "@uploads": 3, "@obj": 3, "_make_upload": 2, "__END__": 2, "Portable": 2, "PSGI": 6, "app_or_middleware": 1, "req": 28, "finalize": 5, "": 2, "provides": 1, "consistent": 1, "API": 2, "objects": 2, "across": 1, "server": 1, "environments.": 1, "CAVEAT": 1, "module": 2, "intended": 1, "middleware": 1, "developers": 3, "framework": 2, "rather": 2, "Writing": 1, "directly": 1, "possible": 1, "recommended": 1, "yet": 1, "too": 1, "low": 1, "level.": 1, "encouraged": 1, "frameworks": 2, "": 1, "modules": 1, "": 1, "provide": 1, "higher": 1, "top": 1, "PSGI.": 1, "METHODS": 2, "Some": 1, "methods": 3, "earlier": 1, "versions": 1, "deprecated": 1, "Take": 1, "": 1, "Unless": 1, "noted": 1, "": 1, "passing": 1, "accessor": 1, "set.": 1, "": 2, "request.": 1, "uploads.": 2, "": 2, "": 1, "objects.": 1, "Shortcut": 6, "content_encoding.": 1, "content_length.": 1, "content_type.": 1, "header.": 2, "referer.": 1, "user_agent.": 1, "GET": 1, "POST": 1, "CGI.pm": 2, "compatible": 1, "method.": 1, "alternative": 1, "accessing": 1, "parameters.": 3, "Unlike": 1, "": 1, "allow": 1, "setting": 1, "modifying": 1, "@values": 1, "convenient": 1, "@fields": 1, "Creates": 2, "": 3, "object.": 4, "Handy": 1, "remove": 2, "dependency": 1, "easy": 1, "subclassing": 1, "duck": 1, "typing": 1, "overriding": 1, "generation": 1, "middlewares.": 1, "Parameters": 1, "": 1, "": 1, "": 1, "": 1, "store": 1, "means": 2, "plain": 2, "": 1, "scalars": 1, "references": 1, "ARRAY": 1, "twice": 1, "efficiency.": 1, "DISPATCHING": 1, "wants": 1, "dispatch": 1, "route": 1, "actions": 1, "based": 1, "sure": 1, "": 1, "virtual": 1, "regardless": 1, "mounted.": 1, "hosted": 1, "mod_perl": 1, "scripts": 1, "multiplexed": 1, "tools": 1, "": 1, "idea": 1, "subclass": 1, "define": 1, "uri_for": 2, "So": 1, "say": 1, "link": 1, "signoff": 1, "": 1, "empty.": 1, "older": 1, "instead.": 1, "Cookie": 2, "handling": 1, "simplified": 1, "encoding": 2, "decoding": 1, "totally": 1, "up": 1, "framework.": 1, "Also": 1, "": 1, "now": 1, "": 1, "Simple": 1, "longer": 1, "have": 2, "wacky": 1, "simply": 1, "AUTHORS": 1, "Tatsuhiko": 2, "Miyagawa": 2, "Kazuhiro": 1, "Osawa": 1, "Tokuhiro": 2, "Matsuno": 2, "": 1, "": 1, "library": 1, "Util": 3, "Accessor": 1, "status": 17, "Scalar": 2, "redirect": 1, "clone": 1, "_finalize_cookies": 2, "/chr": 1, "/ge": 1, "LWS": 1, "single": 1, "SP": 1, "//g": 1, "CR": 1, "LF": 1, "char": 1, "invalid": 1, "header_field_names": 1, "_body": 2, "blessed": 1, "overload": 1, "Method": 1, "_bake_cookie": 2, "push_header": 1, "@cookie": 7, "domain": 3, "_date": 2, "expires": 7, "httponly": 1, "@MON": 1, "Jan": 1, "Feb": 1, "Mar": 1, "Apr": 1, "Jun": 1, "Jul": 1, "Aug": 1, "Sep": 1, "Oct": 1, "Nov": 1, "Dec": 1, "@WDAY": 1, "Sun": 1, "Mon": 1, "Tue": 1, "Wed": 1, "Thu": 1, "Fri": 1, "Sat": 1, "sec": 2, "hour": 2, "mday": 2, "mon": 2, "year": 3, "wday": 2, "gmtime": 1, "sprintf": 1, "WDAY": 1, "MON": 1, "response": 5, "psgi_handler": 1, "API.": 1, "over": 1, "Sets": 2, "gets": 2, "": 1, "alias.": 2, "response.": 1, "Setter": 2, "either": 2, "headers.": 1, "body_str": 1, "io": 1, "body.": 1, "": 1, "X": 2, "text/plain": 1, "gzip": 1, "normalize": 1, "string.": 1, "Users": 1, "responsible": 1, "properly": 1, "": 1, "their": 1, "corresponding": 1, "": 2, "everything": 1, "": 1, "": 2, "": 1, "": 1, "": 1, "integer": 1, "epoch": 1, "": 1, "convert": 1, "formats": 1, "<+3M>": 1, "reference.": 1, "AUTHOR": 1, "DZT": 1, "Sample": 1, "return_arrayref_of_values_passed": 1, "invocant": 1, "Test": 3, "Base": 1, "More": 1, "__DATA__": 1, "Strict": 1, "Mojolicious": 1, "Lite": 1, "experimental": 1 }, "Perl6": { "use": 54, "v6": 13, ";": 1161, "Test": 11, "begin": 6, "pod": 106, "handling": 1, "of": 108, "-": 577, "I.": 1, "Multiple": 1, "C": 22, "<-I>": 1, "switches": 1, "are": 12, "supposed": 1, "to": 46, "prepend": 1, "left": 2, "right": 2, "Ifoo": 1, "Ibar": 1, "should": 6, "make": 1, "<@*INC>": 3, "look": 1, "like": 3, "foo": 6, "bar": 1, "...": 7, "Duplication": 1, "directories": 1, "on": 12, "the": 33, "command": 9, "line": 5, "is": 277, "mirrored": 1, "in": 25, "variable": 4, "so": 3, "": 1, "Ilib": 2, "will": 4, "have": 2, "B": 7, "": 1, "entries": 1, "": 1, ".": 27, "end": 7, "my": 347, "fragment": 1, "@tests": 2, "(": 1022, ")": 1043, "plan": 8, "@tests*2": 1, "diag": 3, "pugs": 25, "redir": 2, "*EXECUTABLE_NAME": 1, "if": 116, "*OS": 1, "eq": 17, "any": 3, "": 1, "mingw": 1, "msys": 1, "cygwin": 1, "{": 711, "}": 707, "sub": 124, "nonce": 2, "return": 77, ".pick": 1, "run_pugs": 3, "c": 52, "tempfile": 3, "run": 1, "res": 5, "slurp": 3, "unlink": 1, "for": 119, "t": 21, "@dirs": 9, "split": 2, "join": 5, "map": 5, "qq": 11, "[": 105, "]": 104, "got": 24, "chomp": 2, "substr": 4, "@got": 8, "EVAL": 8, "@expected": 4, "I": 3, "BEGIN": 3, "@*INC.push": 2, "JSON": 4, "Tiny": 3, "Grammar": 1, "@t": 5, "Q": 29, "<<": 30, "true": 5, "false": 3, "null": 1, "E66": 1, "controls": 1, "b": 39, "f": 13, "n": 31, "r": 20, "slash": 4, "/": 54, "&": 31, "alpha": 1, "abcdefghijklmnopqrstuvwyz": 1, "ALPHA": 1, "ABCDEFGHIJKLMNOPQRSTUVWYZ": 1, "digit": 2, "special": 1, "@#": 1, "%": 130, "*": 20, "_": 81, "+": 113, "./": 1, "<": 22, "A": 12, "key": 7, "can": 2, "be": 10, "string": 14, "rosebud": 1, "Not": 1, "too": 1, "deep": 1, "Pattern": 1, "pass3": 1, "The": 7, "outermost": 1, "value": 30, "must": 2, "an": 8, "object": 4, "or": 4, "array.": 1, "In": 2, "this": 4, "test": 2, "It": 2, "object.": 2, "glossary": 2, "title": 14, "example": 1, "GlossDiv": 1, "S": 1, "GlossList": 1, "GlossEntry": 1, "ID": 1, "SGML": 3, "SortAs": 1, "GlossTerm": 1, "Standard": 1, "Generalized": 1, "Markup": 1, "Language": 1, "Acronym": 1, "Abbrev": 1, "ISO": 1, "GlossDef": 1, "para": 1, "meta": 1, "markup": 3, "language": 5, "used": 8, "create": 3, "languages": 1, "such": 2, "as": 8, "DocBook.": 1, "GlossSeeAlso": 1, "GML": 1, "XML": 1, "GlossSee": 1, "menu": 1, "id": 1, "file": 18, "File": 1, "popup": 1, "menuitem": 1, "New": 1, "onclick": 3, "CreateNewDoc": 1, "Open": 1, "OpenDoc": 1, "Close": 1, "CloseDoc": 1, "widget": 1, "debug": 3, "window": 1, "Sample": 1, "Konfabulator": 1, "Widget": 1, "name": 42, "main_window": 1, "width": 3, "height": 3, "image": 1, "src": 1, "Images/Sun.png": 1, "sun1": 1, "hOffset": 2, "vOffset": 2, "alignment": 2, "center": 2, "text": 5, "data": 1, "Click": 1, "Here": 2, "size": 14, "style": 1, "bold": 3, "text1": 1, "onMouseUp": 1, "sun1.opacity": 2, "a": 63, "implement": 1, "no": 5, "stinkin": 1, "single": 2, "quote": 2, "<[\"\\ttab\\tcharacter>": 1, "e": 14, "unquoted_key": 1, "@n": 2, "i": 15, "desc": 6, "m/": 6, "n/": 3, "subst": 3, "n.*": 2, "parsed": 10, "try": 12, "Grammar.parse": 2, "and": 21, "ok": 14, "nok": 6, "module": 4, "weather": 4, "given": 9, "when": 20, "default": 6, "Any": 7, "probability": 4, "fib": 4, "Int": 12, "class": 34, "Card": 2, "method": 98, "bend": 1, "fold": 1, "mutilate": 1, "punch": 2, "card": 2, "new": 10, "actions": 5, ".bend": 1, ".fold": 1, ".mutilate": 1, "@list": 5, "castle": 2, "full": 2, "vowels": 2, "<[aeiou]>": 1, "/phantom/": 1, "#Test": 1, "DNA": 1, "one": 4, "liner": 1, "at": 4, "result": 5, "": 1, "CG": 1, ".pick.comb.pick": 1, "d": 17, "sort": 6, "*sin": 1, "_/2": 1, "sprintf": 1, "Can": 6, "handle": 3, "done": 2, "Term": 4, "ANSIColor": 4, "RESET": 2, "export": 21, "BOLD": 3, "UNDERLINE": 2, "INVERSE": 2, "BOLD_OFF": 3, "UNDERLINE_OFF": 2, "INVERSE_OFF": 2, "attrs": 10, "reset": 2, "underline": 2, "inverse": 2, "black": 2, "red": 2, "green": 2, "yellow": 2, "blue": 2, "magenta": 2, "cyan": 2, "white": 2, "on_black": 2, "on_red": 2, "on_green": 2, "on_yellow": 2, "on_blue": 2, "on_magenta": 2, "on_cyan": 2, "on_white": 2, "on_default": 2, "color": 9, "Str": 30, "what": 15, "@res": 3, "@a": 45, "what.split": 1, "attr": 3, "attrs.exists": 2, "@res.push": 3, "else": 25, "die": 12, "@res.join": 3, "colored": 4, "how": 2, "colorvalid": 2, "el": 2, "False": 6, "unless": 27, "True": 6, "colorstrip": 2, "str": 25, "str.subst": 1, "<[0..9;]>": 1, "g": 3, "uncolor": 2, "what.comb": 1, "elem": 13, "attrs.reverse.exists": 1, "attrs.reverse": 1, "head1": 4, "NAME": 1, "Color": 1, "screen": 1, "output": 13, "using": 3, "ANSI": 1, "escape": 5, "sequences": 3, "SYNOPSIS": 1, "say": 46, "DESCRIPTION": 2, "provides": 2, "interface": 1, "terminals.": 1, "following": 4, "functions": 1, "available": 5, "head2": 5, "": 4, "Given": 2, "with": 27, "names": 11, "produced": 1, "by": 28, "sets": 1, "terminal": 1, "printed": 1, "after": 3, "it": 9, "specified.": 1, "recognised": 1, "on_*": 1, "family": 1, "colors": 2, "correspond": 1, "background": 1, "colors.": 1, "": 2, "similar": 1, "takes": 1, "two": 1, "arguments": 3, "where": 3, "first": 8, "second": 4, "colored.": 1, "": 1, "sequence": 2, "automagically": 1, "placed": 1, "string.": 1, "": 2, "gets": 1, "array": 1, "specifications": 1, "those": 1, "passed": 1, "returns": 2, "all": 6, "them": 1, "valid": 1, "otherwise.": 1, "": 1, "": 1, "removes": 1, "leaving": 1, "plain": 2, "without": 2, "effects.": 1, "": 2, "readable": 1, "names.": 1, "E.g.": 1, "passing": 1, "Constants": 1, "": 1, "constants": 2, "which": 2, "just": 1, "strings": 2, "appropriate": 1, "sequences.": 1, "Bailador": 7, "App": 1, "Request": 2, "Response": 1, "Context": 1, "HTTP": 2, "Easy": 2, "PSGI": 1, "app": 1, "App.current": 1, "our": 4, "import": 2, "callframe": 1, ".file": 1, "file.rindex": 2, "app.location": 2, "file.substr": 1, "route_to_regex": 2, "route": 5, "route.split": 1, ".map": 10, "_.substr": 1, "q": 8, "<-[\\/\\.]>": 1, ".join": 5, "multi": 36, "parse_route": 4, ".eval": 1, "get": 2, "Pair": 2, "x": 40, "p": 15, "x.key": 2, "x.value": 2, "app.add_route": 2, "post": 3, "request": 1, "app.context.request": 1, "content_type": 1, "type": 31, "app.response.headers": 2, "": 4, "header": 3, "Cool": 1, "status": 6, "code": 4, "app.response.code": 1, "template": 2, "tmpl": 2, "*@params": 1, "app.template": 1, "@params": 1, "dispatch_request": 1, "dispatch": 5, "r.env": 1, "env": 5, "app.context.env": 1, "match": 6, "app.find_route": 1, "app.response.content": 2, "r.value.": 2, "|": 33, "match.list": 1, "app.response": 1, "psgi": 2, ".psgi": 1, "baile": 1, "PSGI.new": 1, "port": 5, ".app": 1, ".run": 1, "test_lines": 3, "@lines": 8, "SHEBANG#!#!rakudo": 1, "@lines.elems": 1, "#": 53, "niecza": 6, "skip": 12, "fh": 6, "open": 5, "count": 4, "while": 15, "fh.eof": 1, "fh.get": 1, "x.defined": 1, "defined": 6, "fh.lines": 2, "push": 22, "date": 95, "year": 36, "month": 27, "day": 4, "Date.new": 1, "dtim": 36, "DateTime.new": 2, "hour": 2, "minute": 1, ".truncated": 15, "week": 50, "dt": 3, "truncated": 1, "dt.truncated": 1, "truncated.gist": 1, ".day": 56, ".week.join": 18, ".week": 12, "number": 6, ".weekday": 13, ".days": 6, ".is": 9, "leap": 9, "ContainsUnicode": 1, "uc": 1, "@things": 2, "separator": 4, ".uc.join": 1, "Failure": 1, "role": 5, "X": 53, "Comp": 12, "ControlFlow": 2, "Exception": 13, "has": 49, "ex": 16, "backtrace": 1, "Backtrace.new": 1, "self": 45, "D": 20, "self.": 3, "message.Str": 1, "//": 7, "gist": 6, "message": 24, "self.backtrace": 1, "throw": 2, "hidden_from_backtrace": 10, "nqp": 97, "bindattr": 3, "newexception": 1, "isconcrete": 1, "setpayload": 2, "decont": 2, "msg": 5, "setmessage": 1, "unbox_s": 1, "msg.Str": 1, "msg.defined": 1, "rethrow": 2, "resumable": 1, "p6bool": 3, "istrue": 1, "atkey": 2, "resume": 5, "Mu": 26, "fail": 14, "self.throw": 1, "Failure.new": 1, "getlexcaller": 1, "isnull": 1, "compile": 2, "time": 11, "AdHoc": 1, ".payload": 1, ".payload.Str": 1, "Numeric": 2, ".payload.Numeric": 1, "Method": 4, "NotFound": 1, ".method": 4, ".typename": 2, "Bool": 7, ".private": 2, "InvalidQualifier": 1, ".invocant": 1, ".qualifier": 1, "EXCEPTION": 1, "vm_ex": 5, "shift": 9, "p6argvmarray": 5, "payload": 6, "getpayload": 1, "istype": 10, "int": 2, "getextype": 1, "parrot": 2, "pir": 1, "const": 1, "EXCEPTION_METHOD_NOT_FOUND": 1, "&&": 16, "endif": 2, "p6box_s": 1, "getmessage": 1, ".*": 2, "do": 2, "NQPRoutine": 1, "eval": 2, "@END_PHASERS": 1, "last": 11, "loop": 5, "construct": 4, "next": 11, "redo": 1, "proceed": 1, "clause": 2, "succeed": 1, "take": 14, "gather": 13, "perl6": 1, "exception": 1, "control": 1, ".from": 3, ".to": 3, ".name": 20, ".target": 4, ".path": 7, "o": 19, ".mode.fmt": 2, "MSWin32": 4, "unknown": 1, "trait": 1, ".declaring": 1, "declaration.": 1, ".type": 2, ".subtype": 1, "Argument": 2, "": 2, ".directive": 1, ".char": 1, ".placeholder": 1, "Variable": 2, ".symbol": 4, "@.suggestions": 3, "s": 17, "@s.join": 1, "symbol": 5, "call": 7, ".new": 1, "collides": 1, "constructor": 1, ".when": 1, "Parameter": 6, "Default": 1, "does": 24, ".how": 1, ".parameter": 7, "Placeholder": 1, ".right": 2, "Twigil": 1, ".twigil": 2, "MultipleTypeConstraints": 1, "WrongOrder": 1, ".misplaced": 1, ".after": 1, "InvalidType": 1, "@.suggestions.join": 1, "Signature": 1, "NameClash": 1, "Private": 2, "Permission": 1, ".source": 2, "package": 5, ".calling": 1, "Unqualified": 1, "Bind": 5, ".target.defined": 1, "NativeType": 1, "Slice": 2, "ZenSlice": 1, "Value": 1, "Dynamic": 1, ".what": 6, "Syntax": 8, "Name": 1, "Null": 2, "UnlessElse": 1, "KeywordAsFunction": 1, ".word": 1, ".needparens": 2, "Malformed": 2, "Elsif": 1, "Perl": 3, "please": 2, ".reserved": 1, "reserved": 1, ".instead": 1, "not": 14, "allowed": 5, "negated": 1, "pair": 1, "Cannot": 14, "declare": 3, "numeric": 1, "twigil": 1, ".scope": 3, "augment": 2, ".package": 2, "because": 3, "closed": 1, "give": 1, ".macro": 1, "operator": 9, "only": 3, "supply": 1, "initialization": 1, "public": 1, "attribute": 3, "but": 6, "case": 1, "Opening": 1, "bracket": 1, "required": 1, "comment": 3, "Missing": 1, "*PID": 1, "*GID": 1, "*EGID": 1, "<'>": 1, ".ors": 1, "Unsupported": 2, "v": 12, "m": 4, "Virtual": 1, ".call": 1, "may": 1, "partially": 1, "constructed": 1, "objects": 1, ".variable": 1, "Radix": 1, ".radix": 1, "out": 5, "range": 5, "Operators": 1, "non": 3, "associative": 1, "require": 1, "parenthesis": 1, "Adverb": 1, ".adverb": 1, ".construct": 1, "Unrecognized": 1, "regex": 8, "metacharacter": 1, ".metachar": 1, "quoted": 2, "literally": 1, "invocant": 1, "marker": 1, "signature": 1, "parameter": 2, "add": 2, "tokens": 1, "category": 1, "Preceding": 1, "context": 1, "expects": 1, "term": 1, "found": 1, "infix": 11, ".infix": 1, "instead": 2, "kind": 13, "cannot": 4, "attributes": 1, "you": 4, "tried": 1, "You": 1, "here": 1, "maybe": 2, "routine": 8, "PRE": 2, "Precondition": 1, "Postcondition": 1, ".condition.trim": 1, "Unable": 1, "deduce": 1, ".sequence": 1, "Routine": 2, "Attempt": 1, "outside": 1, ".expected.": 5, ".got.": 5, "binding": 1, "returning": 1, "assignment": 1, "Calling": 1, "requires": 1, "never": 1, "work": 3, "argument": 1, "types": 3, "Type": 1, "check": 1, "failed": 1, ".action": 2, "expected": 10, "modify": 1, "immutable": 2, ".redispatcher": 1, "dynamic": 2, "scope": 1, "dispatcher": 5, "container": 1, "mix": 1, "composable": 1, ".rolish.": 1, "into": 1, ".target.": 2, "inherit": 2, "from": 17, "unknown.": 1, "nDid": 2, "mean": 2, "these": 3, "itself.": 1, "already": 2, "been": 1, "exported": 1, "Lists": 1, "both": 1, "side": 1, "dwimmy": 1, "hyperop": 1, ".operator.name": 1, "same": 1, "length": 2, ".left": 1, "elems": 19, "elements": 2, "coerce": 1, ".thing.": 1, "Set.": 1, "To": 2, "element": 1, "set": 1, "pass": 5, "function": 1, "Invalid": 1, ".format": 1, "Cannnot": 1, "unit": 1, ".unit": 1, "Date.delta": 1, "No": 3, "compiler": 1, "Trying": 1, "symbols": 1, "missing": 2, "convert": 1, ".reason": 1, "Divide": 1, "zero": 1, ".using": 1, "pseudo": 1, ".pseudo": 1, "index": 7, ".aggregate.": 1, ".index": 1, "Ambiguous": 1, "signatures": 2, "none": 2, "access": 1, "through": 1, "CALLER": 1, "declared": 2, "c_ex": 10, "TypeCheck": 4, "Binding.new": 1, ".throw": 10, "": 1, "Assignment.new": 1, "Return.new": 2, "": 1, "Assignment": 1, "RO.new.throw": 1, "redispatcher": 2, "NoDispatcher.new": 1, "@ambiguous": 2, "Multi": 2, "Ambiguous.new": 1, "NoMatch.new": 1, "parrot_c_ex": 2, "getattr": 3, "EnumMap": 1, "bindcurhllsym": 1, "emit": 5, "MONKEY_TYPING": 1, "description": 2, "Tests": 2, "statement": 2, "This": 3, "attempts": 1, "many": 1, "variations": 1, "possible": 1, "##": 6, "foreach": 1, "times_run": 2, "eval_dies_ok": 8, "old": 1, "w/out": 2, "parens": 4, "..": 21, "todo": 15, "@b": 7, "zip": 1, "y": 10, ".sign": 1, "now": 4, "around": 2, ".lc": 2, "variables": 1, "topic": 4, "j": 4, "@array": 9, "@array_k": 2, "k": 12, "@array_l": 2, "l": 9, "@array_o": 2, "@array_p": 2, "@elems": 8, "": 6, "@e": 6, "<1>": 9, "2": 12, "3": 10, "4": 9, "<->": 2, "<2>": 3, "5": 8, "<3>": 1, "6": 3, "@array_s": 3, "@s": 4, "@array_t": 3, "val": 17, "rw": 12, "@array_v": 2, "@v": 2, "@array_v.values": 1, "@array_kv": 2, "@kv": 2, "@array_kv.kv": 1, "hash_v": 2, "hash_v.values": 1, "hash_kv": 2, "kv": 3, "hash_kv.kv": 1, "TestClass": 1, ".key": 5, "@array1": 6, "TestClass.new": 6, "sum1": 6, "@array1.map": 3, "_.key": 4, "#L": 1, "S04/The": 1, "": 1, "statement/implicit": 1, "block": 18, "read/write": 1, "_.WHAT.gist": 3, "Int.gist": 1, "Array.gist": 2, "h": 4, "grep": 6, "@array.sort": 2, "#my": 1, "#is": 1, "#diag": 1, "rakudo": 3, "x*": 2, "<4>": 1, "Z": 7, "w": 4, "q*": 1, "w*": 1, "e*": 1, "r*": 1, "Inf": 4, "/C": 1, "style/": 1, "/for/": 1, "/loop/": 1, "rt71268": 3, "lives_ok": 2, "#OK": 1, "**": 3, "@rt113026": 3, "iter": 4, "@rt113026.push": 1, "7": 2, "8": 1, "9": 3, "10": 1, "1": 3, "dies_ok": 2, "fmt": 2, "Foo": 1, "@.items": 3, "check_items": 1, "item": 12, "self.check_items": 1, ".say": 1, "Foo.new": 1, "items": 17, ".foo": 1, "token": 6, "pod_formatting_code": 1, "": 1, "<[A..Z]>": 3, "*POD_IN_FORMATTINGCODE": 1, "": 1, "": 1, "N*": 1, "skip_rest": 2, "exit": 2, "q/": 1, "My": 1, "Hash": 1, "ref": 2, "@_": 5, "bless": 1, "hash": 5, "my_keys": 1, "keys": 2, "my_exists": 1, "idx": 6, "exists": 2, "fetch": 2, "store": 3, "lang": 2, "": 2, "p5ha": 2, "p5hash": 1, "rethash": 1, "p5hash.hash": 1, "@keys": 1, "hash.keys.sort": 1, "@p5keys": 2, "p5hash.my_keys": 1, "doesn": 1, "bug": 1, "nonexists": 1, "SHEBANG#!perl": 2, "Pod": 18, "HTML": 1, "URI": 3, "Escape": 1, "lib": 1, "Perl6": 7, "TypeGraph": 4, "Viz": 1, "Documentable": 2, "Registry": 1, "*DEBUG": 5, "tg": 3, "methods": 8, "footer": 4, "html": 7, "head": 2, "": 2, "rel=": 2, "href=": 3, "type=": 2, "media=": 1, "title=": 1, "url": 21, "munge": 2, "<[a..z]>": 2, "<[[\\w'-]>": 1, "p2h": 9, "pod2html": 1, "Block": 10, "level": 11, "leading": 2, "confs": 3, "@chunks": 5, "": 1, "caption": 1, "thing": 3, "pod.": 2, "Iterable": 2, "thing.perl": 1, "thing.Str": 1, "confs.perl": 1, "pod.content.list": 1, "@chunks.push": 3, "elsif": 6, "c.indent": 1, "Positional": 2, "c.map": 1, "*.": 1, "@chunks.join": 1, "recursive": 2, "dir": 6, "@todo": 2, "@todo.shift": 1, "f.f": 1, "@todo.push": 1, "f.path": 1, "@pod": 3, "Code": 1, ".content.grep": 1, "MAIN": 2, "typegraph": 2, "": 2, "images": 3, "op": 10, "prefix": 2, "postfix": 1, "circumfix": 1, "postcircumfix": 1, "listop": 2, "mkdir": 1, ".IO": 1, "@source": 5, ".grep": 5, ".f": 1, "rx": 2, ".pod": 2, ".path.subst": 1, ".subst": 2, "TypeGraph.new": 1, "tg.sorted.kv.flat.reverse": 1, "dr": 17, "Registry.new": 1, "num": 2, "podname": 12, ".value": 1, "printf": 1, "file.path": 2, "write": 20, "dr.compose": 1, "disambiguation": 4, "files": 6, "graph": 2, "force": 3, "search": 2, "seen": 9, "dr.lookup": 11, "": 10, ".list": 6, "d.name": 2, "print": 3, "spurt": 10, "chunks": 4, "pod.content": 2, "Heading": 4, ".level": 2, "b.level": 2, "<=>": 6, "chunk": 13, "heading": 10, ".content": 4, "pre": 1, "circum": 1, "postcircum": 1, "fix": 2, "heading.split": 1, "dr.add": 4, "": 1, "subkind": 6, "complete": 4, "": 1, "pod.content.push": 11, "Named.new": 3, "content": 25, "link": 24, "@mro": 2, "t.mro": 1, "@mro.shift": 1, "current": 13, "taken": 1, "care": 1, "t.roles": 1, "r.name": 2, "c.name": 2, "c.roles": 1, "s/": 2, ".push": 4, "counter": 4, ".lines": 1, "ms/": 1, "counter.keys": 1, "": 1, "qualified": 2, "": 1, "origin": 1, "*@elems": 3, "@current": 8, "||": 10, "@current.push": 2, "*@blocks": 1, "Array.new": 1, "Para.new": 3, "@blocks.flat": 1, "@content": 4, "FormattingCode.new": 1, "Item.new": 1, "Heading.new": 1, "dest": 1, "dest.e": 1, "dest.modified": 1, ".path.modified": 1, "tg.sorted": 1, "viz": 6, "Viz.new": 2, "viz.to": 4, "format": 6, "group": 9, "tg.sorted.classify": 1, "": 1, "tg.types": 2, "": 1, "group.kv": 1, "@types": 2, "dot": 1, "hints": 3, "rank": 1, "type.name": 2, "@items": 1, "raw": 1, "raw.substr": 1, "@items.push": 4, ".sort": 6, "s.trans": 1, "": 1, "<\\\\/>": 1, "label": 1, "@items.join": 1, "template.subst": 1, "operator_disambiguation_file_written": 3, "dr.grouped": 1, ".kv": 2, "copy": 4, "p.elems": 1, "p.": 1, "Array": 1, "p.origin": 2, "p.url": 4, "o.human": 4, "o.name": 4, "o.url": 4, "p.map": 1, ".origin": 2, ".human": 4, ".url": 7, ".kind": 2, ".classify": 1, "@ops": 3, "@ops.map": 1, "doc": 1, "doc.subkind": 1, "doc.name": 1, "@": 22, "doc.pod": 1, "@docs": 2, "": 1, "@subkinds": 4, ".subkind": 1, ".defined": 1, "@docs.map": 1, ".origin.name": 2, ".origin.url": 1, ".pod.list": 1, "state": 4, "DateTime.now": 1, "": 1, "Supply": 1, "combinations": 5, "@result": 3, "@stack": 3, "@stack.push": 2, "@stack.pop": 1, "fake": 1, "permutations": 4, "@i": 2, "List": 27, "BOOTSTRAP": 1, "args": 4, "p6list": 6, "self.WHAT": 2, "self.gimme": 11, ".Bool": 1, "self.elems": 13, "self.join": 1, "self.end": 1, "Nil": 4, "self.map": 1, ".fmt": 1, "flat": 2, "self.flattens": 2, "list": 10, "lol": 1, "rpa": 11, "clone": 3, "nextiter": 5, "nextiter.defined": 4, "LoL": 2, "flattens": 3, "Capture": 1, "self.DEFINITE": 1, "p6listitems": 5, "pop": 4, "parcel": 1, "islist": 1, "existspos": 1, "list_push": 1, "*@values": 3, "@values.infinite": 2, "self.of": 4, "TypeCheck.new": 3, "operation": 3, "@values": 13, "splice": 3, "iscont": 1, "not_i": 2, "Parcel": 1, "nextiter.DEFINITE": 1, "fixes": 1, "#121994": 1, "unshift": 7, "callsame": 1, "@values.pop": 2, "rev": 3, "orig": 3, "rlist": 3, "rotate": 2, "offset": 4, "Callable": 2, "OutOfRange.new": 2, ".fail": 3, "min": 4, "@ret": 2, "o..": 1, "@values.eager": 1, "o.Int": 1, "s.Int": 1, "": 2, "self.infinite": 2, "#MMD": 1, "Range.new": 1, "excludes": 1, "max": 2, ".reify": 1, "finished": 6, "overlap": 2, "elem.gist": 1, "perl": 1, "SELF": 1, "FLATTENABLE_HASH": 1, "DUMP": 2, "indent": 3, "step": 3, "ctx": 3, "flags": 2, "self.DUMP": 1, "OBJECT": 1, "ATTRS": 1, "self.values.map": 2, "self.values": 1, "values": 14, "pairs": 1, "reduce": 2, "with.arity": 1, "DEFINITE": 3, "vals": 3, "sink": 2, "gimme": 1, "remnant": 1, "previous": 1, "implementation": 1, "apparently": 1, "Please": 1, "remove": 1, "longer": 1, "necessary": 1, "STORE_AT_POS": 1, "pos": 2, "bindpos": 1, "unbox_i": 1, "proto": 6, "eager": 2, "Range": 1, "0": 3, "self.combinations": 1, ".eager": 2, "p6parcel": 2, "": 7, "thunked": 2, "Whatever": 3, "n.Int": 2, "GatherIter.new": 3, "x.": 2, "infinite": 3, ".flat": 3, "setelems": 2, "@a.pop": 1, "@a.shift": 1, "a.unshift": 2, "a.push": 2, "reverse": 1, "@a.reverse": 1, "@a.rotate": 1, "*@list": 1, "@list.reduce": 1, "@arr": 1, "@arr.splice": 1, "Zcmp": 1, ".first": 1, "": 1, "kwid": 2, "that": 3, "quoting": 1, "parser": 1, "properly": 2, "ignores": 1, "whitespace": 6, "lists.": 1, "becomes": 1, "important": 1, "your": 1, "endings": 1, "x0d": 1, "x0a.": 1, "Characters": 1, "ignored": 1, "x20": 1, "Most": 1, "likely": 1, "there": 2, "more.": 1, "James": 1, "tells": 1, "me": 1, "maximum": 1, "Unicode": 1, "char": 1, "x10FFFF": 1, "we": 1, "simply": 1, "re": 1, "via": 1, "IsSpace": 1, "fly.": 1, "Of": 1, "course": 1, "contain": 1, "whitespace.": 1, "<\\xA0>": 1, "specifically": 1, "": 1, "character": 1, "thus": 1, "": 1, "break": 1, "list.": 1, "PUGS_BACKEND": 1, "ne": 6, "@separators": 1, "@nonseparators": 1, "xa0": 3, "<$sep\">": 1, "sep": 3, "<\">": 1, "really": 1, "empty": 1, "@results": 3, "x1": 4, "x2": 4, "x3": 4, "x4": 5, "x5": 4, "results": 6, "Math": 2, "Model": 1, "RungeKutta": 1, "SVG": 3, "Plot": 1, ".derivatives": 2, ".variables": 4, ".initials": 4, "@.captures": 3, "inv": 2, "derivatives.invert": 1, "deriv": 7, "inv.keys": 1, "keying": 1, ".results": 1, "@.time": 1, ".numeric": 2, "error": 2, "param": 3, "c.signature.params": 1, ".substr": 1, "params": 3, ".hash": 1, "topo": 6, "@vars": 4, "@order": 2, "inv.exists": 2, ".variables.exists": 2, "@order.push": 1, "integrate": 2, "resolution": 2, "verbose": 2, "d.key": 2, ".initials.exists": 1, "d.value": 1, "
": 1, "id=": 1, "

": 2, "Generated": 1, "sources": 1, "perl6/doc": 1, "github": 1, "": 1, "

": 2, "progress": 1, "document": 1, "known": 1, "incomplete.": 1, "Your": 1, "contribution": 1, "appreciated.": 1, "
": 2, "SettingsSingleFileGenerator": 1, "My": 1, "Settings.Designer.vb": 1, "Win32": 2, "BF6EED48": 1, "BF18": 1, "C54": 1, "BBF19EEDC7C": 1, "": 1, "ManagedCProj": 1, "": 1, "vcxprojsample": 1, "": 2, "Application": 2, "": 2, "": 2, "": 2, "": 2, "": 2, "": 2, "Unicode": 2, "": 2, "": 4, "": 4, "": 2, "": 2, "": 2, "": 8, "Level3": 2, "": 1, "Disabled": 1, "": 1, "": 2, "WIN32": 2, "_DEBUG": 1, "PreprocessorDefinitions": 2, "": 2, "": 4, "": 4, "": 6, "": 2, "": 2, "": 2, "": 2, "": 2, "": 2, "": 2, "": 2, "NDEBUG": 1, "": 4, "": 2, "Create": 2, "": 2, "": 10, "": 3, "C737F1": 1, "C7A5": 1, "A066": 1, "A32D752A2FF": 1, "": 3, "": 3, "cpp": 1, "c": 1, "cc": 1, "cxx": 1, "def": 1, "odl": 1, "idl": 1, "hpj": 1, "bat": 1, "asm": 1, "asmx": 1, "": 3, "": 10, "BD": 1, "b04": 1, "EB": 1, "BE52EBFB": 1, "h": 1, "hh": 1, "hpp": 1, "hxx": 1, "hm": 1, "inl": 1, "inc": 1, "xsd": 1, "DA6AB6": 1, "F800": 1, "c08": 1, "B7A": 1, "BB121AAD01": 1, "rc": 1, "ico": 1, "cur": 1, "bmp": 1, "dlg": 1, "rc2": 1, "rct": 1, "rgs": 1, "gif": 1, "jpg": 1, "jpeg": 1, "jpe": 1, "tiff": 1, "tif": 1, "png": 1, "wav": 1, "mfcribbon": 1, "ms": 1, "Header": 2, "Files": 7, "": 2, "Resource": 2, "": 1, "Source": 3, "": 1, "": 1, "": 30, "": 30, "iVBORw0KGgoAAAANSUhEUgAAACAAAAAQCAYAAAB3AH1ZAAABYklEQVR42tVVq47DMBDsp/hHDxQcOFBwwMAgwMDEIKAgoCAgUqBhqH8l50126lHaq9TrQ7pKq8TOemd2dtfd7f7rz3TTbNpibpyNT/N7gUOxSHbKs": 1, "mLlW": 1, "vAwaQJ1B5ulQN": 1, "kYkIJ3GhwkVwyFRABvKbEkKvfI0TOGYkha9nDe4AiqfqIHZUoznbTfURwYA1agn": 1, "rvAL2VRpuX8ym1Rw9QUpIiB/WLQilRZXfgXuVziro51hr69HxtPZUAlk3ui9ErZYNvvLeEplAU7MAx00tj3mVEhkMuWYdVeZGQTrtCZTDqz8IsAotleqCCDcUZ7aQUduSsanKjnVDe44yx9Qogdvj1k21m08KDiltqllAdnwX": 1, "xgvRzNqvLuaUQ4EDSCgB8oQtb4GxIBDfvxeOE9ApO7mUjltWl5HvQfiMy": 1, "kXhXBjGP8DhsF2rTYa6/kQKPFV7Sf3vinFLQX3Np0f43zA259mZw6IuSNAAAAAElFTkSuQmCC": 1, "": 30, "": 30, "iVBORw0KGgoAAAANSUhEUgAAACAAAAAQCAYAAAB3AH1ZAAAB/0lEQVR42tVVLYvDQBBduTJy5drIyMrY/oOTFScrKioqKioiwhFxcBWFVhQaU0JEOCIKPXFQGVmbvzI3M/vRlIM7ev2AKwwNk7Bv3nvzEiH": 1, "S/dQG/dg2gVQZRpeBiuro": 1, "g8yPI": 1, "R7E8A3EQEC0jkDPNdf9gLcIvGtBr/Efr4k9lUoVxGUMYaJAZaaofzvgvAG9ahhUl1gfLYisADEpQE6ksWFrFIgWEcixhHAVXq": 1, "IXlhQKsuae3gtZoVnT/47QGKvZwEPxCqMBPcvUoQ9rh0wAr42BpjkTw": 1, "gp": 1, "j985IVoIOZ5VhAv": 1, "p7sF5p": 1, "kES": 1, "Gd": 1, "HYSkZYnnFjQ5GGDLmu/htRhtEBBruGRgqi6QnEkPqKxFdN/1SLEzaxjYSe2qwl5ltp2BP1szGJbCfSALeJCRjSKmgOQncAKL85j3g/qcELLFPuOG8eqdlq0zQN7xnodpQZVmmKBq2ALHjBgFCECH0y7wXmwjz5R6POQ8hLiKvQo/x622rEsbvcrETybvIJ4w": 1, "PibMlUYsAJWE0VD": 1, "Ei6Qa5OBU8QG6TQPJnDQTpnv0PUwti2bLvC8OMpBdDYVJCqbhJHHdmT8TASK9Ty8hGjpmujN": 1, "Ayj1N4": 1, "vfiHRCyjB5Ru88Oazv1l48hR7DLwIOYb3": 1, "xiMlp4d": 1, "U5yx3Xs4/ewjxLtQfcl89dzvgD75hkn04cPugAAAABJRU5ErkJggg": 1, "iVBORw0KGgoAAAANSUhEUgAAACAAAAAQCAYAAAB3AH1ZAAACjElEQVR42r1VIY/iYBTkZ6ysrURWYpFIJBKLRJJTVZsUQcKKTajZEAQhCBIqmrSCpAiSIhCfQFQgKk5UnHk3876W3Iq7bLjdJXkp/dow8": 1, "bNPFqtBz": 1, "d2EgSjaQs5pKfJtL6ro93rqR7EuluS": 1, "lFpSTpWMx5ItlxjPpCIs5bLm5UiLcrZVmI": 1, "BcB": 1, "ATgvlQ/F5LEI1UiP40/VxEnzMR5QYGAd6jEOxvx3ox0VoVk6L4s50ogO0CJSyCb9UC/a0GV/W74GBlnZkG1Xu316TmR7nQv3bQSY5bo1FcgksgxBnPhfaPERJZhX58X1": 1, "DjJJwtwLYNMEg8o0hmZ6Q9y2WwrmR5E1WABmSHSTqSqlwoENUgGZ5xLMYEksMbfC/HuP4OHBlxVgCd1qA/EgvMogJryB5VMkD14IN": 1, "Kiq3zh6ABNZRANiOw1dTFte5ktlH9fnZqvYeuJG6KYA5a1zD3JJKC3Ffclu4J3j/INJbGZFfSy0CslOmoqiV4YhYJEm/6LUmV1AZPLMmQ6YpsYKz42ndNa": 1, "hBW6/Gn3G": 1, "I0ZQ4BT8rIIABjc5eYZKz": 1, "OLQGSIvDRArM226ESfRdb7bZRIPzDfFuj8WunpQzOkL1EBAsrP": 1, "Uk0F1eyk4/YBQkRflz3RETu7Rudmnx7J95VxPG1hNubMGfZkgAZq8RDCG9bDR2/PEstbNVJVKbAhvPOVTx9ayJ5sfTQAIYjwupvXUhvRjOBwEXY1A5jTUTu": 1, "G8lYiqMcT96L6gtOv/2ZAuuu2gYRdjGR5FFWBH9": 1, "xj7kZ3QKCxJClrzD3eWXzeRuTy8a9wP/xAiRtD6UzZPRfOJagN94X/Cb24VBC6mPJmBxKwbv/Wf0Wu3PK2UKdT/kd/5zeaE2gm63UKTAAAAABJRU5ErkJggg": 1, "iVBORw0KGgoAAAANSUhEUgAAACAAAAAQCAYAAAB3AH1ZAAABvklEQVR42tVVr2/CQBTmb0XWVlZW1lZWoicWMkECgqQIklY0acVEBeIEomICe3vfd33H0Y1kY0AykpfCcbzv17tjNvuvr7ZLbbmL7fJlbodjYZ8GbA65rQS42ie2f88Izs91IpU": 1, "jki5jW3f57YVkPUqssYU4oC838Qkge/bJpVK": 1, "LwbsCqFOnMoaDvKgWEtF2LZ6Ehul69zvmeJKzcDAxRqoRSK2yZjEUwInD4Wjgyc6TKCYX9Irto5IiD5K2DU8i2y5SaixVQjzQCkmQMsdOY0LEhuEMI6oNPYWvn99akWxuWYJxV0yDfywLBX1VWBM8NQuGEUAn4gJ7GhB/pxvXNxBYq/5oYnWJOEgKAR1kFovYp9HFCI5krCRZCQXDiY6kSvJGSvgTNN4Mh3thGodg2MEIW9aKBOADiMiarVAVEK9XQJZCbuXp/60TZjcj6x2ZFJSQJk1AmAaEzqhq7r6UCVI6kL639y7n3jiW3lNmJsdGokyH114qPi3IxD2/7lgro4FTt32zkw54qS4PrmrLStEw7mXe9": 1, "r7o5Dyczrd1waUQPvZL1uOpwVXsQyPycPO1PCTkPxwUHFUf51j6f/7okyrolgPYAAAAASUVORK5CYII": 1, "iVBORw0KGgoAAAANSUhEUgAAACAAAAAQCAYAAAB3AH1ZAAACUklEQVR42tWVr2/qUBTHJ5FIZC2yEomdRCKRtVUvVUsz8dLMMUHSiSXMEDJBGgRJESRFkBRB0oknEE8gJvgXzjufU": 1, "eZsl7": 1, "Vsyclt77m73": 1, "/5nu8pFxff9a991xZ/5EvzuinJYiBfBty6aUk060k4uZR4NZDhNpDw8VIg1LnvfB4R79aT1nXLgCAQzfoSKInurCvZLpJ40RfOuPi4in": 1, "hACgcdUQb": 1, "SJf": 1, "NJ8NCV6TqU6aYOiBj4VVP8e19Qiva8GXj/K5FqG8vhkEq": 1, "CMSf1JdWu0TSdWCgibYA2WlB9NizM5BwZFjJ/5ciABPZvAbNl6GUm0jKdWQEqB5iUyWRK4lcc7G2BJB42TfAYhtJtgqMAHewWqhqrwJXu1gKBTs": 1, "p8Jz9RQreCCNHw3ZPyUmZ61AnYNENO9Ze9gnkuXAgMcajhSEjMht21b": 1, "hyLOKh5KNhtYlUhZKnueAeAC5C/1mYsgFDzUcpODGN4ghyJjzac6kuYZVSOcdF": 1, "IEJxJ533DQQ2K": 1, "AVlWoqYpVKPv90AjQb1b2Dkr0qH6AHOfoP7nOqG3nbX9XFzFVBVAjcW3AtHddI8UUQfDVVlDtcBOo": 1, "YZy": 1, "J1KpqydGpBAapTIF6HKWVdDDpKstJB9fMQ7gOcj/M9m5EKMZ6tWx4UHlFFVCq2MtplSJz84tx": 1, "fx0ac1tIiqseI7xrHUo3HVBRKyPmhPKkCCT5MvBeniWG/Ui8dj": 1, "OP": 1, "yBR6UvVSsiZ06ZCVwdsiun7p32SM519KnUfJ6SutsnJtPHX/ShhxPN": 1, "v/WeP": 1, "Pal6x1OIpVAAAAAElFTkSuQmCC": 1, "iVBORw0KGgoAAAANSUhEUgAAACAAAAAQCAYAAAB3AH1ZAAACTElEQVR42tVUr2vrUBSenKyMjI28MjI2MrIyMjYyaoSJEepSUWhEoc": 1, "UMlFKRaAVhUwUOvFgExMVT0Q80X/hvO876X2rGlvf9mCBQ27Opff7cb7bq6vv": 1, "qw3iRx/T6X9NUaV8t": 1, "Al7tUmk0q6zqRfBsr": 1, "H6Xy9Mj6mf": 1, "dUSennNZLmI5HEoFIoE9QNNZCCfG0jyk4g5dabap9j8N": 1, "PBSyB6Ay1UCkEwP9ye": 1, "vgmY1311Ib0PlRh7XuXBkUyOx": 1, "nlRFQJAPW9y4REWqhvtok6oT26AWem6K0xGhLjKOYPiWT3fYnrUMzAFTMz7ydCZeUukbYtNWDnituXUrrwjcUZOB34JlYXSJTquTcHmRC/MZVRN9h3bh1dvzljzpEHqTINVaFlVVvFtDutIx2JP/K0T0cIzL1s1ZfiRIzkvYGna": 1, "x7dw5r0SyRaTAnB9LlbdjDRn3qJyq13WqB3ezLnBQLMkkgNWR3obmGePC3OMfgSSLUIH5e6veTEzXm0VKwoyMBvjVAYDzetFCrglkU22tVdvPg3YoJMahcQVQHBbOfAmrDsgC85wSmTBDT4JFoH3m4s3Us5h6hufc2jlGoXmA9UusUygMoCw8qck3nUNqOwhmGBOLoAQP4M67w5itIs2BHQfJdA4UmvJ": 1, "BeWrUMuH8ilGQmBabYvf3OP74uvIwLBI4PrmWtxRZ2ECNTy4d9v7m3AqdW96SL": 1, "nZLn3aX9I51fJqqKt/O4BlD0lcKov": 1, "mMmt1": 1, "Ygc4BZwrcT": 1, "xeqPPgT0ht399kbexcB/AEhbiVW/ps4pAAAAAElFTkSuQmCC": 1, "iVBORw0KGgoAAAANSUhEUgAAACAAAAAQCAYAAAB3AH1ZAAACOUlEQVR42tWVrW/bUBTF": 1, "cEhhoaGpoGBgYamhoaWgOTFeaCSS6IlJEoKoiiAksNiJSASimIlIACgwKDAoOB0bv7u3bc7qPSlq2VFunpfeTl3XPPOffm4uJ//RyOiWy2kSyvA0lXI3m3wNVjJjsNvLuLpXxIpX7Km/19rCN5OyCbdSRlmclBg9wWoVRVrgzoehU1IBRQ/7Iv3Dvs/yGQU6ZkVz3mRjuDIAwYKcvUALAHhK2Vkbqeng8kXQWWLZmS8WGf2rBgCuDrl2kDBmaOqczXoXgTz34z34YGJF4MxR33xZ25vw": 1, "EbBnLm1A2q9AoJqPdNrZA0A24cOJLfDPsmGFNUL6f30UdEOfKsfPeh56tX3e10rdp9TR6j": 1, "gbdoHLh8wyZk/WnQnrvJ2nnSFhgzOAZLqOZ0ML3hs3IHofe89AkmIky0XQZMm4j1sNWxBKP1lyD0Bkyx66mfmtmVPvDj65kq4Dkw3qgyvPZIgmA3EnrjHnjB0DkRaBTPW9n": 1, "r6pdtNd505q5SBuso7OQBzW0RK/chkiq4HBpLAxpiOZDGy80ylcC8d8Re": 1, "ycGd113falpVmc0Aa8AkBgKtYYWHYAEgyENAHiY77kAzhuUeg": 1, "D": 1, "Z1/": 1, "qO5/1LuCGWWFMx6FKXQ1/6xPzSg22qGb7L2ZZ0DPLsfvqmLbdDuCYTACnMrPzlUKPABgfPBXfeBXvb8z3P7ZnFYxOhOUeqc/vGlLPpUrAKwnFDSstPPJu/0pYb76aWpGxYTnvvMN/STd514e0SYAAAAASUVORK5CYII": 1, "iVBORw0KGgoAAAANSUhEUgAAACAAAAAQCAYAAAB3AH1ZAAABjklEQVR42tVVsWrDMBDNp": 1, "i7": 1, "gnZO3UqoUMoHQL1YKgHgbWYoKEUD4Z4CHhUN636FVV30knnkBYSnEADRwKS7r179": 1, "yWv3Xj": 1, "itFzpEPXkhjb8vsArRsRicf1d7jNsBJyAhCyh": 1, "Yfvq3f9wcksN6": 1, "vXzZjkiQhkvGhPBQHKZwAMwKAHg7ThlApvdRyYBal0PXJsisYwgAJAVOAFv9ddMhYfHp0i4t5cRoQcROJDYJYmHklxUBoMDcxUyAZVUg": 1, "jCm9H9TgQO8WIVQcXLFGU": 1, "TFJjORUJEZndI7gTXyLisFvzcgoNjXY46ObmQpJyEgGKoMqITlXAXssbfYCEQeysztkWMoPcXTniLCxUqz3w5SrbEczr7JK4InsOaWQhGZTI2P8PW49YwkPPx0SIZkpCZxRxbxVdDd7gaq": 1, "yIzwQKVJgErfUmsakwnM5j9Uimr1xRMIPrgFxpHk206lTckrBE6uJ3A0dWcXXEhjUkQXf": 1, "TNqJl/tMG47UpWbLT4ipb2jn9KKnmhjvvi2jw/5gK11tLQbjMAAAAASUVORK5CYII": 1, "iVBORw0KGgoAAAANSUhEUgAAACAAAAAQCAYAAAB3AH1ZAAACOElEQVR42tWVr2/bQBzF": 1, "ycMBoYaFgaGBhoGGoYaGgZN0cCkDERKQaWGBBhEVUGkBVRywCQHRDqDAIOAAwUHCgxG3t73e7nVqbQf6tpKi/TV2U7k97n3np2Li//1Y6oxim2K2zyBe5jj3YTtcYqSwuW3DPVhouJ6vss447cDKe5T1PUUhiJf1yNYO6cDPN6kCiHfm/2Yk": 1, "n6asJhp7I7e5yr7TJeTK5NCTY5OTLF7SrRYx268mLhXm4x2AHxIzDcNxSb6KgYAZrHGw8jzlQTFRN32nDl1oMI5F8Ld": 1, "MZPoU7W8d4gOQNdCby42cu1EAOW870/C6wDlGEwr6PDZD0F8Lb2p0c4NoZtBbcve5Q39NgIoOfAdGRyCxQEpX1HoKyU2dm/syEuBnIZ/FJk4IlF6vfFznwktzPqsavY1TF3pbH8Xw4DDY0w1GktTQOGSHcvMA4SPIFK5dzOBEHSD4WyvO7FuOdBctgHB8bdD5WODyzjKOBjFdESBxIqEzqayMaESoEXxX9HEMIkfvkoy4IVDaj": 1, "o3T4kKSw/ufSTdWakwceU7ITCJA4": 1, "tuhTTjf7OR5XUDYaMagwfWXhCilMsZ9b/sYwCsPDinSuun0qEJ": 1, "NDXrKcjT/fcF0RhhAiPhCQB66O1wmnu/6XF5Q6sD71hHGEmDrXJaJlrQ5FVwaXa6sdESBxYyAQhH21F5KWVRzJT/34UqLzudCOhJjaxX2zV3IoabR4KqxEIjHJvNufUpSfIGT3s5cL/wB3sgL2s65DmgAAAABJRU5ErkJggg": 1, "iVBORw0KGgoAAAANSUhEUgAAACAAAAAQCAYAAAB3AH1ZAAACYUlEQVR42tVVoW7jUBDsJwQGmhoaGpoWBhoGhgYGGp2igpN6IFICItUkqgKiKiBSDCo5IJIDLNkg4IECgwKDAwYlc7P77F7InapeW": 1, "kirTZ5D8zszOzL1dX/": 1, "vGTAulhguppjof1EF8HXDYIn4HBocGoBIpyyoqQnSas6POIOHEBZ8tKDIYkMMwBY": 1, "aoqjman3dIH8co8og10f5hwL3ZHv3vKYSA": 1, "jg5TX8Y43BETp1/TwnkalWdpzgYTPUrsX79088y9BfZOgtUvT53VkX7Clc9rEB/F2FQSW9Zg5uYWiFAKaHTokI93GoROT": 1, "zcDuhpOynFWhwP2bVBXwdgbukndLA39TIUgaS4CZcI8V1anQ1HdWjfNUiYgtxtyiYDb2u5Hm5c/AW2On/JFp9QgsKjgLS8TjxN6KJGiFTO2faoxqZoF1zUyM2cMz1JKM4DK5EJEtETL7pD0rrVW/pWaoZNrLcjfGqhC3Zy0xISBEglOD4NzYPLAPSGAiRI7cEG5G": 1, "AINp5ARFaQyrqz2jpgok18o8gq2ugBeWvCOlJdQ6q2oYNQKb0VVaIe3rXB9qGlLDYdBlTUVYjKtKKAqUAEhpPko/7IlFqxQzwX81RrJA7PQ": 1, "aGUraCBBU8b7TL9O6hQiRqPNEe/sbLvX0n2s14": 1, "xZwEifOrBKU37nJtAuozQTDSFBnYc/EmgEBAyoxJnjITbn0/p/W0dnZnMhGdDb1l5Zcp4ooEPB19NZU5MTpSUI8/7iXMGkVaTOh2yLg3bbwzGcGAtrhU4XPe5LbkLrxZWDtoyX1ZX9K8iIqCZl": 1, "n7gXyTF4JLCnrXHAAAAAElFTkSuQmCC": 1, "iVBORw0KGgoAAAANSUhEUgAAACAAAAAQCAYAAAB3AH1ZAAACQ0lEQVR42tVVoW7jQBDtp5gaGhqaGgYGGpoaBgaGBvbASSmpTgVRFWCpAZFiYMkGkRxgsKDAIGBBgMGRd29mbQdVV7W9ShdpNJvx23nvza6Tu7v/9ePtGvg7A/": 1, "hgfezwvcR5yR9MvAem1uw5u0ZFPXviIWIJAHJ/S1zaTX7PxqETx3CbXcT85VCpKmOmTnYk": 1, "jcI6itEsskgrxDVPRILeAXFl7RwWfNO3xSiCcE28Et3QmR/2AQ5hbhwSJi": 1, "CQLBhEhI9gxKCI4OIz7zn0U827ikO7iVyA": 1, "gSQ9oi0bPRp1HnM9z4G0BeZ8PiuJI2Zecy01iTOQFMzsMROMAcKSU5O7QzFvE7e9kkqzhHnBjSmbROKYEbGWGEeado5oxojqHlnvBCWCN66HiJH9ijs5Q7HgmWU6E7Fp13jeJgqoygWaekkQxbQOKOpnV2D5mwStcxoPbkVQwvqsc8SZdfWA05Je/XWD5rxEc1pifiGWz": 1, "NymBS/R": 1, "w9CRHgschwPGQwZq1CmtNKszQTkv76S9eCk6bW3uNln6IqFlo37YrrTNcV93WvfJ6nsJd7HPeZZtknXG8exbix69aa1UHtXHSclggU0pecQs": 1, "rYZ0qYVUvpmci3hgXx1EU492XUYjEmebBXSeTYePjIdVj00kNAhVXLyYRIk5CXdfLj7": 1, "OQizxvEvpxI3WkbmpjCK0vr85bSjE2s3X/SAJyeSaxOPY9UyHezIeUfUZx38VcnJOx8tVlSJgNd2Tb/tTknO2l41eVHmVP9rnD/NFCxuaQAv3AAAAAElFTkSuQmCC": 1, "iVBORw0KGgoAAAANSUhEUgAAACAAAAAQCAYAAAB3AH1ZAAACIUlEQVR42tWVrW/jQBDFCwsPFi41NDQ0NQwMLCy9vyLgwIGCgIAAEwMD62RgEGCpAZEcUCkFAQYFhgYHDI5M35vZ9VWV7qT22koXabRrOTvvN1/ri4v/9efqk7gStr4Tt": 1, "kc4VzWHGSqO7NdoO4XS9893HCEKRIVMDKXuLDaGuOZwCp4dk17wzi8k7cpjPnFcT2AwziG8vCbChH1CITbW": 1, "l": 1, "deMuHU3O3Zbi46iIdIYMGkvktSDLM4iiyP2u1GS4yRxC0C81/P16XUg4YBGRDGARACIGfU37FedgXgYdwvQAJsbrFvdGUDu/QQYZOXPwj51KriG4HcY6p3UiKqBHSaNNuW": 1, "GXSvZQnCKJOu7AH6IDzBS": 1, "sRLV/ty1g": 1, "y4jWqnhRT3Y2ROJq0DU6jupMo4aDGF1PxwTkBLD2armHYZ9QnA1a2JkwMZqhrS9t/mx8w2iFiFSoMoG49SBwkJwndUxxXZkNwnpAhSp8": 1, "TYWuVrjA/UAfx": 1, "kdBaoozyqKfnc6j6FeFK3y6V92cLbf5fWdoiV/TjBHmPEE3pwBJykGyBj2AkqTsdFiKTLAfUvYI": 1, "iHZ2/": 1, "ZEb2kcO5L1clVdZLL2x9vH0cVwZgpTAGA/WRiAYSrLwXf8XnxIBIdrEnf7UKK0YgZZvx6FLn5KXJ9NlvuRbJ20rtg": 1, "Yj9AyDux4": 1, "kimU4dJZEgAgX38hOxDNDqIZ": 1, "LSPEtO8uIdRePf2iJ8AkT7BKeWMTHEAAAAASUVORK5CYII": 1, "iVBORw0KGgoAAAANSUhEUgAAACAAAAAQCAYAAAB3AH1ZAAAAhklEQVR42mNgGKpgztI5/5Ex3S2u7mxGwTR3CC6Lae4QYi1Gx1GZSWBMscVAJhjDDCTBYjAmOUTQfUysQ3BZTHTUEApqXA4hZDHBNEJqHKM7hFiLCTqEUBzj8impaYVg4kQ3gNggJuQQknMFqXFLyCF0LweoXiCRUQ7QBhBRDtAHYCkHyAIATRZdO8VgYzoAAAAASUVORK5CYII": 1, "iVBORw0KGgoAAAANSUhEUgAAACAAAAAQCAYAAAB3AH1ZAAACNElEQVR42tWVrY/bQBTEAwMNDU0NAw8eDQwMDDQNDIwKqqisBZbOINKZRJGBZRlY2gORHHCSD0TaggJD/xuvM2": 1, "zl6hqq7b3ITXSUxwr8fx2ZnYzGv2vr7DoJCqsxFsr44": 1, "VvJtwd1xJVS4k3HYSl71MT4OEpZWg7GSct28Hss/n0h6WUtULud/OpHtcyb5I5KYeJM6tRBmAil6CXSejzLweCFdrHpxwd1zLfjfXMXUipklk0gxyexwkSNtnJ4IMTtCN9AXRtF4UK": 1, "WKTbPUoQv7Yi79t42DgTM3DwN6YCRCH2JcTzCEGH8yzo2/AaEwRe7SqdznMxWvigVE6UQi9rRWAMJ5Z": 1, "LMukLu8I44psWgUGHq3Bh/MYCpnCu/etFOCtqntXs4P0PcC7eHlbMe96": 1, "d6fvPMkEZ2QWKx4jjtmQvepmgE4RSkPQMghld7xq/Wgox78u4jO": 1, "ymQrynjqSXeLQCOCG/bpR17SIEIwfBxUn1PQJbhwAB8gwx075ULn5EYRiPlPfdooQhMJ0oKM7APFOMI7rmPg70ywkAgRd4RkR1xBmNE2vMYWA/O254dtOi7nnKeQb72PwTrQA9DF5N3hfhTm564ZGA1ei2v55GZ8fmDsBLacCLfUeY2uPS9eJs0s": 1, "Pl4H2JLRoddOBLv2Zdvx0hPXfsJpR": 1, "DMTyFYXHyPW/XVDiQt5HnVVe12iIfguA64iAj5ZkcyxTSC7LxldbWJQhHy3f6U9Mw4bVDWta78X5/zHZ1ZvLB/eOxTAAAAAElFTkSuQmCC": 1, "iVBORw0KGgoAAAANSUhEUgAAACAAAAAQCAYAAAB3AH1ZAAACSUlEQVR42tVVLW/jQBTsT1lquNAw1NDw4MHQwEKjKjqWgkgpqFSTgoCAAEs1iBSDSDaw5IACg4IFAYamrzNvN70rqO7UL": 1, "kijXbzIc": 1, "efNeLi7": 1, "ZdmLWwHIv5raWbyOOyl7MfSfR2p963zmJmgFn/3VClBDk0T2wASqnIuKNk0kxyKQEDqPERwBiPs/qvBZzU/tqaTmqNUUvNge2TuJdIIYAklsK2Pn7BHg/8bLWClmtuQ3kN506YAunhIkT": 1, "XEUmVQgoxCe7SjJIz7vAXxPEe5p8e9CTAESWG1Lpw9NylER48HxEp9fd2IhgrYnu1HSSvSkC2kQM21F3": 1, "n7hXRNJg/FVLrj/G0h7K/ZgByVm2tUf1VLvPb9jYEIVdvQc62": 1, "raTSFuB36QgnopIehCtugaxe1pJXV2CPJP6cCk9RPB8TRzSfE63ksEB2s/TIlQWbYgA7W8zauhiEvMOy9NB5Cdsn55EhtMdsFIHujZ7caI/i3ici6Mz7R": 1, "OmPy3iJc7e7/1ghRM/wHEaAExgRusPml81dqSxtvv3AJYyUM59WLKmZ4URDfebgWJuWQw0xo8JF5FBEERgmhJvAntKLwLtJ9tmZ98MAeQ9/1csa9mWvkr6/8aRgrIw/ghE": 1, "aXzwZFkJzLh6N4DiNd0Gy0fgJsOyi5Vt1kHxtHdYFCrvY": 1, "F2H": 1, "mRcVUPgpoAiK4fhlCCPFfN5CKoMja58PToi2IHd6TxlEWM8tyF3wdX9CIaRRWE5cSpyS80L6vn9DuBGdhSCY733OM8S85MLHyAKwAAAAAElFTkSuQmCC": 1, "iVBORw0KGgoAAAANSUhEUgAAACAAAAAQCAYAAAB3AH1ZAAACUElEQVR42tWVr4/icBDF90/BViIrschKZGVtJbKyFsmKS8CsQJANgoSKJosgAdGkFYgKxFcgKlZUnHn33rTcj": 1, "Tukg27myzJZL5pE": 1, "Yzb958": 1, "/DwVX9eXsNb1xg8HjH4dsSnFfZPDYYbh": 1, "HWwc8ay17uMMgIsyk/DkSFgiswqYDgDPhFi2FGiJXDaNvAXzsD8/aNwbxb4Rhd0dABowIYXxg8T3iWAqN9izFhgopAVMdnttHcq0h9TlGeEqTfgbhhMEeXXwoEVa9C37kvFTSSvIGnsQjiqTSIN4GosOJ5E": 1, "Eli7DLYhwPU4QESF8JcaICWWtgAc": 1, "SXmMY8zwh2Chv4T/WnU96rwxuMP8bTVkkLBijuc4tu8vc4rifoq5SO6ccx5wR0Qth3SmhEajokBBDFpIqgtKzUa": 1, "Ktyw7RRQrgix/25qySPGyjyEAhXMzBiHy2ELvd9sIDZ9JifI0tWft6wLhpRvLWN5Q508svGZRjkHFBSejevtuU7xVr0T": 1, "FxD9uTpVluyCUtcah0DcefYT4gbcNHPLET0SUZGw6sx5U8WUkFkPrSljAMvS4t": 1, "jqLqOZUABlFViZ1OHEILZyRvb2IAnGoU2hF2PtRFLZ/m2mjYCSq8NeZMZ3WVm81dBU4dKuHpm8r/kEfQ": 1, "pAeStjNjzDxip/KFyX5g8XO3mt4998IfW0GgI9UwqJsqBJm6zpC2CUV/UfX3wbtdSCr2vA5RmwqJjUkQzi2QoAdQcZoy4Fg": 1, "Eo2BWhS2wyubKS7Ad3FFBT4vI": 1, "SjNhcF2bU8I6OfwC3fgnHe4r96AAAAABJRU5ErkJggg": 1, "iVBORw0KGgoAAAANSUhEUgAAACAAAAAQCAYAAAB3AH1ZAAACP0lEQVR42tWVoW/qUBjF96dgkZWVtUjkZGVt5WQlFgnuzSAQhCCagGgCgqQIklYgKhAVExUTFc": 1, "cd853C1u2ZAvLtuTd5MulN4Tf": 1, "c53brm7": 1, "XUSbY7mIs5yHCCvg1cH0eIyc43z": 1, "gOo0QPQMRgGHJOv6gkG0Wo6rGKA4J1mmEup7QgQTRGUgk4AQMKGDI5": 1, "F3OnLpNCe4Pk/MdlVxTKwEe6g7AQfg/ug": 1, "WL/qL6uhBB1a06VcfFcWRVVSMbQfv8ByFBSUsgwTH3YN8a3NvU6O9r": 1, "KcW3qFBf3ODEIFVy1WE7SbCeuPmne/oRDlC8zQxmED3ZWc7HQiyBoNdi8FjbXuQNvAXFLFpzAmJ6K0KfGj1ljABzF6mfE0BF3B1Gl": 1, "t1zi8FUFnZ3vUsDiKsHQjCCQga01AwGd918voypwiHgurVx2PsVyErkvVwe2y30TQfgF1LkHrNL6OI6C9yoBcGAg4I3DBzumGHJAQ6z4lWHURsGDNJSTHu3v9Ou0G4q6zmkIb5sGc6pxomsm1W2/OLgnzj13nOptV1n1vRtiqctC34Hej6NJe12PbJUwiwr/AiHdeYi5OKHw2Z8LtBpzgrJ86cJ8C5EBPJRG3hFEgzV9BiznjmAJ05/WsAOrFo249ChDMV": 1, "gYOC9zoTPLVy54H4bvsxXDBStU0jVrBa92ZwJqBAPZrquXujKbP0v9rUv2D59eHLDuBZ0WNmsl3Cr9ZvDb5TP5dq3Slztu3XbJ/rU/pX7WBWyaW331d/4B": 1, "NMC1rjos6YAAAAASUVORK5CYII": 1, "iVBORw0KGgoAAAANSUhEUgAAACAAAAAQCAYAAAB3AH1ZAAAB/klEQVR42tVVLU/DUBTlp9RWPln57CRykv/BD0AiEBMTFTUVFRUVT1Q02QRJJ0geAlGBmEBM1l7Oue9t3QKEAIOEJSdru6Tn4577dnHxXz": 1, "J85JUwGIlSd7LnxGn3VZSEKfNIEnpAxyuW6DxvyeEhGkL8gLk9SBmsxPjtkign7AXc04hhsTlIFkLQgjIHkd1m": 1, "ZeTMM0hjAKkjOFLt7/NJH5g4i9H5U4c0AH1FsxAMnoPtuMYiCAiSQQlCCdpPaTIKLxXxOSIdr5KDJ7BNaj2HonlgLg3BZbsTlEFENAOUGToAAKuVkF8iKKUUG9pvIx8RMI4Mg2ELARmTvRa5JbprAOCdh21BRMHZxrN5jCnpwduAPZMvaCz3hdHYkpjrbGPOzk6kU0UkZOzF9CAiTht30OYmbdKJe4T10YhfYAwnQzulBQdc0e7AUcp1BFkfl7QjhTvExFIHoWTIFnhEUnMvxmMIqT": 1, "FlEjmDpA": 1, "Gyn0axOHLu4tpGAR": 1, "OYob4OW8S0Wm6DiIOZYTzzEVxFMAk3DA5u169Xc0ypvKVMnI0PHA0mQpkOVaxjNFzLdEXjiAtYtylP0UXV/Kn54I6Zho8fBb": 1, "UDyeCdp8kt/2U": 1, "v3rtsQ": 1, "flOQo6CxC4Qq3tGftufJlD1it87kqvhICCph": 1, "n4/axcZ/83LOKOL0LpvvueV8nivBN16X1tAAAAAElFTkSuQmCC": 1, "iVBORw0KGgoAAAANSUhEUgAAACAAAAAQCAYAAAB3AH1ZAAACQklEQVR42tVUr4vjQBTePyV25MjI2pGRKyPXVlZWHeXEQc1CKwoXU46IslQELiLQiEAiFhKxYkTFiBURJ2Lffe9NuqUcy": 1, "t3YMrPObHy/u": 1, "v6M3N//pruzkdyik9pDH1zyv6Z8TuuKQaxHU1I/u0EHI5NzPE/POEHIopWbukFiQ/sztybgUHsM": 1, "nIoLz7eMcMZP1asTSqV1Id": 1, "Ets5PBnfLX1eHFnSwy6WvQRc": 1, "TBxVBHdOqJJM1DUEMgWEkIGATT8EBJxplu8CGJxYdmTeSQK85506Ujl9v1C": 1, "ONJNwjAbUd094QVAnTTy8yHX98pRm76TBRb5DmOOBORacaakZwjQt4AQ2cQUrnXhXBSui2JogLgCFNACM6mHASIhbAb8dETRQBmoVHnv2FCgxy7x2Fy1FcDTYCjcwjYW4kgqc9CAnQcpC0F25ZUaiksejgA68cuWH004Jz1XhyfIWbCOQCHEM3fh52/03uHPe53jvTWkt7ZC3KFu2DTes4LIYkXcRKiuBBgGvNUGfYF9hCnKggEuMlAkjovmDtMrIRKfK0QrWtPhHMADMHf": 1, "Hh1FPLRHlGMznChKIcwiFTrlnTqxYkLbDG7hRmHuDNJL/fsgNr4ZgST8fbt": 1, "jFMAiKb7H": 1, "rWWlUHFVjgjXbPN6XmMvAppMUb2l8R/CGHyk31fDhckMiKMQW/8/kUsr7mvudofkgCyIzxffiNrPw71rZb17EAt8Wl/yULCD/b0wLbjO3nrcV1dCLvBpPcHsf2jOL8BAQzkc/Yiwa4AAAAASUVORK5CYII": 1, "iVBORw0KGgoAAAANSUhEUgAAACAAAAAQCAYAAAB3AH1ZAAACN0lEQVR42tVUr4vjQBjdPyU2MjKyNjKyMjI2srKyticWeuJga1ZUlFIRaEShEYVUFFJREVExomLEidjv3vsmuestt": 1, "zt0j24wGPIJOT9": 1, "iYPD//rVZ/GsiszWS0SsdeZ/DNic5lKBeJqP5LmPFFyvT": 1, "MgPHnCdltM2maqdQg2eSpGDNDAiPZFJmK4PP6OAZGut6NuHdKd": 1, "Yy09gJR8a9KYRNukSmslomP58xlQ8Tk5Ru6ZSO6": 1, "NEoWQQ0H5/cmKYzGmiZHz/Vlx0FIkakcGplXcRE6t1Krsi1YjprkLcJOo7J9ltMq19UnFZK5LsgatIDAFhaSXctxLkRoKjfV0IFe": 1, "PtUBpnwDAT0x4": 1, "dVTfJWDtzwwgByQWEcJucRTE8AFhTiBlAzABCvEUt3rz6JeRlbMZMf4ud5CrkMNJ1k2e6zwr4LgXzwynIh3R": 1, "AlHZSrgwEkFAWFjxSyNe3oi/aMR7hoCt": 1, "YOQ7lzfTnvfO/cMErAQxjpINkbUKd3ZziW6jvJWBrlVQSHWaIv7A": 1, "IvDERYR/7N4fWp7zq9Pd9OzFhiOIpLAC4jkMRwPARx0rq9AdwmhUhAp18r8ee1I1XX2FvXfz": 1, "M/fmmY/aZwbXGzMlmtMdWBUWIm": 1, "CQMWKNfN1IcLAu6vydxC8vuoyvzmGMiOOz67hH8Ixuv8DtEqRriJh3PRduvdsPiY5CdMl": 1, "dBHjwHIgsdaSSmA8BaV4tN": 1, "yXTlE": 1, "x32bllzG8N192F4Agp6eMO": 1, "LjjH9KwCMHNaVe4AAAAAElFTkSuQmCC": 1, "iVBORw0KGgoAAAANSUhEUgAAACAAAAAQCAYAAAB3AH1ZAAACS0lEQVR42tWVrY/bQBDF708oDDQNLDQMDTQMDDQNDAyqogOVUlApB066kFNlUBAQKQaRHBDJBpEcELDggMGBBQELSqbvza7dkqq9T6mRVjMZW57fvHlxrq7": 1, "/0tRSe/qqWflbLuzXu3ZTC8yEDAJpH97VCtPmbNY73jQyOTuLcaiNO3/tUSO9zIdGX0tcygiDPzeuBDCuR4aNIckLMnQyPIh83jfRvPET/3kjvNgDwAErjxuj1Zzeuq5nYx6XEBo2tkzEghoAYPYjElZX4e6NAcdZIcna6EsLye3Tt16QgVGT3BEXKairlYSrFbiL1aSbNw0JSNJ2Jbz42TtUYACIBHFcywHrGFsqssaY96ifXrUnXAoBo/RePsBmbc": 1, "oS0xNgu0kBsBRznisUr4/ggxQw6QUwZ5FJgwigMSJ9kmQEcgoTXRedObsY8l": 1, "Nj74ZH25Oc6H0rLUQxX4ixsxVCR5jFmrGFBMPDk5ssxBx33RqrQUFqFD/tvZeWQU16JnMeH9QldVvHmkBOGkbGzQrA5CCBV9Ye6eqWLuUbZ5qznsmlVeCKxv9CMbdI9/hHJDvCAZ1APfnVRznOjVXwmmZl/upfrfNUtVwAOBqFKxVC/c1UENVRG3qAHAOigBoAFXio/13M1JuNSNhQiPNK": 1, "VzqyoucsdIP2qOAAPvZJcvAoJlHnRz7Ez5TrtDMlIheowMUF4j9G1ecVYf7UXkkp98A9ujanmPczUK9vcK8UV8PqbvZKpRvueoCGpQFvj9O/2p6QK5JMg9/zZjX8CTEsEAZI": 1, "lIoAAAAASUVORK5CYII": 1, "iVBORw0KGgoAAAANSUhEUgAAACAAAAAQCAYAAAB3AH1ZAAABfElEQVR42tVVoW7DQAw9WFhYGBoYGBg2RQVTpIJWChgoKCgYGBgYGNh33": 1, "Zfo6jVZuqtJtW6ZSrk/g9Pz9fUvqvv": 1, "a4yt3zWlZb9r8H/JQyloC/bHK90z3jdwPuATYmXfuUh7cq91glPrxXEmtGXYjdvOL2vM7Vg17xHyBC6lH3iEENEMEziIPMoooJHsGkSiMEHwCUpHgPRBGnQlcpcglY9pYM": 1, "GjFhB6AUT6181U/W56nx6R575TREBLIoJLT01WVigKWGIkrLZJgU36ejt5wL1R7uEqhJHfMGbAsYdIgORkLjFUaNXENpCcE9wnrz7mxfN471CUi36CkrO5FnkL2/akgN5bEjCJmbCxieBe5I/KnVZfvMF8P7reWzJOQKiAxGKlVMKNauZ0HwRvXDd": 1, "RoDyM4bKOH4wJ/ZSrfUYvujCO7i/6ByIhoqOjj3mNOAqbTRv3O4kLJV2Z03uUzLqFMzGDa0oz971W": 1, "BngynDNjR/8VGSM2HB2f8JRvClN9IGbE8AAAAASUVORK5CYII": 1, "iVBORw0KGgoAAAANSUhEUgAAACAAAAAQCAYAAAB3AH1ZAAACO0lEQVR42tVVLW/CUBRFIpGVWGRlZW1lJRJZ26CqlmZiaeaKICmChBlCEM2CIAGxpAiSIkiKmKhAIBD8hbt77uN1H8m": 1, "P5ItuenbbXPPueect9Vq//XHvG6SOTBV8fnPgJu9JqHaU5vMsUnNiwaZQ5N0/9eAraFFxrUh1bo0yGYC1tQi9HFGT79H78eAHR6GzVqDFvljl8y": 1, "hbbA6h": 1, "UVdKcK9x2SDjypBvG6wMyHwZuLyPqNiEdDgktJh7VGwjqbKMKkLugBXotSictylIXQHEu3q3TgYrohX6lCIARt3OPMqWngzO1wHlq4CiZYdOx4TPvpCL": 1, "XdUtg1psgvkDGLIBYgAGKogIwjrm4oUPCRb": 1, "gKAc7ELacEEAFzuQCqmDMD8Ln": 1, "izGTLxFiBZOWR0": 1, "c8MFBn6kghGyBgpzbVujW5LahnYcXg27QjWyZzfm4COWNDkOiwzABEH4QWc7": 1, "yI7vzheDplJC2zLuxyR1blKxZvZlbWYOs2DO7sg": 1, "EnNR5JAIwbIihZRkrAls1FL3ojuXnrUFOKwHgOG0zMV/6IAF75MyqhWwJVIKqL9V91QqRd5": 1, "wxLE88bEiw33YwGS0EgDRNmk1vIEt/cM": 1, "lsCisjMp1IfDqAfK87zdAcqI9J7YhuunCcp3sO9sleSGS7behN": 1, "jtWtWAWSBwWmVBG7diqYCduhNy02yMbo5/4gAQRbCyADx1O3IoENAaotyr": 1, "z8btEztdVhytfg0BU5eTP/inB59NxJEHFVf7qnAcPbLZlMU2ZQwAAAABJRU5ErkJggg": 1, "iVBORw0KGgoAAAANSUhEUgAAACAAAAAQCAYAAAB3AH1ZAAACPUlEQVR42tVVLY/iUBSdn4KtrKzEVlYikVgkshKLZMUmjBmBaAiChIomVJC0okkRiCdGPIF4YkTFmrP33DclzSa7yczOTDKT3DwohPN1z5uHh": 1, "/6115SnMo5dtsp4nOHLwO2zytUAlydFzDXJeIGGBsgbByC3HwekVMxhzErtHWK42EGa9fiQIqkBiYXIM47RLlDdJGz": 1, "SBHCNQrrQTYPq/Vdk7bpDp0JCoc5r": 1, "E5xIIomuHUb79v1ECEq1VEoibbPUMWapEXQvG0": 1, "GzlyWGJcdEnEiIYHS6fsgM0riTUQIzNntZzjlMxxzn3dVLhTI3dZKgOSGzpBQIvsQZhbx1qkr0cEikAlzOTMh8q8doZ0nASOA2itbfhQCPbC5ru7WVwNnnFsrkc5tMC46hGdRf/Az": 1, "tEi3BpMhFh89c6MtkLkscJA8Qq7bOpVcmp/UqGS4B7UqT4noeNhfo": 1, "D9pOgkpBo4jO0kvFNwPai": 1, "lEI7L0LwV7iYCQ/Wz9/Eul7Pdx2BZKTz6wQdaKa5Pg9RkPgPqaJtCHtPDCryTjYjqnzSxkUFqOn9k7gr1H0mVq70pPEPJlUSZDMMBp9LZ/HrKPYnEj": 1, "Y9ZRiESZ9YtI4MK8bRl7e/V8raKlM2r9TGOjU3w": 1, "swIs4KFYzZNkWMNA9mF0MP9fx3sryoWq9dV7dUWcSgrpv9isVZQ9UNWFV/6hd3": 1, "vmsD9cmpE4gprp9dyLaqz9vOu5L6uWkHeCbXfDV7JdODL/ilx": 1, "dxto0Pw9/7Ob7W/DzcYBXyyAAAAAElFTkSuQmCC": 1, "iVBORw0KGgoAAAANSUhEUgAAACAAAAAQCAYAAAB3AH1ZAAACK0lEQVR42tVVr2/CQBTmT5hEYpGVSCwSOYmsPVnZTF3mOrGkCBIUIROEIEiKICmCpAiSTiAqJhAT/Rfevu/BwUZGlv2AZCSXu757fe/7cVcqlf/6C0dt8bqeDju9las1rj3UhMProfnAk3DS1nW9W5dGr3E5ICxeva/qqN9VJVr60p8ZiScdCWe3YnpN3XMA/5wxGQ4XRrxHT8xTS9nzebg0umYsgC2dbkNzCebm7ubnQIqNlXwVynYbSzL1wbIj/bkvASQnoLQIZTzzZTiFAjgDjHGOMey8o8/NUVOyZSDbl0i": 1, "ZhjPPElRYMEMrNItgjA2BcLIHxOwJwKsGn2bCXZhMq8BOD8OZQUe": 1, "ncSFFESoQkcuSdbZyv8RKala8ogDWLJADAxmxSbCKVlXsZlUFh9R97jCfI57vZYgeYJJhHW1iD9TQOEJyP1wkFxqMdK/qYrQJdEzVlJHIWYpyAkqnRovnaKkMWL8tYnGU8D7SNYLivgNkYgAsHArkkwBpHBT6RjQmcGdtCAcrLAsxjYTZ2NvH5ABY55WtfZz0veP9U3bNWqLwvMVhEOo/hu1ODIMygeVCCcppBS1XgNc3U612czYrC6kj3tnyQ/qufk1fnE9lS3AbapkqBjVPJSc0Y7XRAuP": 1, "r63i4FQCUuWaYeS1dQ43PjkzzFc9G/": 1, "SGxyYP3Ob/V07zstcuAu9kl215UA9NotCcDuD214vT8lHkSedItDym/ET": 1, "u8AfUc39TwIyvtAAAAAElFTkSuQmCC": 1, "iVBORw0KGgoAAAANSUhEUgAAACAAAAAQCAYAAAB3AH1ZAAACV0lEQVR42tWVr4/iUBDHV1YiK7HISmQtElmJrCUnLlWbZsWlwbHiEhAkrCEXREMQJEVsAoKkiE1YsQKBqFjBvzA3n": 1, "k": 1, "cifuR/Z2NzmSyXt9fW": 1, "P2Zeubr6X39p3pVgHNQxaMqHATdvm0IEEwWeBdK8btjcrb8bcHvSFn/gW7RufAnnobTnbWGdOWvuPWtvrrg1bon3yZPga60W9QB5155k9z2ZrnvSuGlIb9yWRMvTUGcg80/AALjR2W0ODFpGKJl1ZJhH8m3XN9D": 1, "vGNxeEilWMVSVSM57FM5PmV/TyS8CyXMw4tK5iRNV5EsFChVpZ28I/Gk3sN6pjHcxeJ/8c0NiHGmWPfleBxKpCWCxOHxN0ToZBI6cJIxYisgHEatA13sE/E": 1, "ewJhR/D8PJKO3op0GRlgqeqrk7rwmFqUu0S4PYwXYJI4qwHDYutqtRtrqSnkim1fFmorNcfuQpOwP5nr/CmVZNk1uzdbBVnXZDb3dWkYceL4QgJylT4fHn5wBMXUFQeC25YpQsF0HctIlWNtqQfZM1KFhZI7nDJzCqtxgXfltp4DCiF6wcjoHkb6Azd": 1, "WQqS": 1, "HqlUFGq7XVzdQ3IqWLPcBapaiWiBEtVzTpjsVK1eq46qeJjZrFRUij/yfo//WhArI/vaKDhxbbRqqdgsSzyntmKGsoCgUjLVe5riwFzpHDi1deRZMRiGRsZymKJdcSlukFTey5feoC9pVp9Pk/f7oMEiFNNw1JbAN2dR3GlTjly7/ZJBpCGcs1V7pTEPjObefdhf0o03/l5Ktk2th55bZ7vlm2RtXeU/5AAAAAASUVORK5CYII": 1, "iVBORw0KGgoAAAANSUhEUgAAACAAAAAQCAYAAAB3AH1ZAAACSElEQVR42tVVr4vjQBReWVkZGRsZGRlbWVkZOXY4FU4sYcUR1nVFIRWFrikloiwVhVQUuqLQioWuOBGxIuLE/gvfve": 1, "ls": 1, "yJ": 1, "e3CFIdOZl/f9mDcvV1f/6y": 1, "RGOQ9j7HqqnFP8M2L/zwRFOQoSzEP51V": 1, "du/WLA0SSCd": 1, "vpCG48xGWMbJUgLfsodkbX3D5jPwzYlj2kyz6CcYDOp44Cci1bD5CTwKKPh4PVNc69L57GmvtY185S7GwlqLObCpk43wn4rAczoRMDBZ": 1, "uDQqZH58yHfvHFPtdiuZliL8C5lyBOS8juL3eogWeP1pMNwZakBJHEq9NgeNzJkQSbDcWdT3E8ZChWhmJN/hlcTERrXVWcq1701VLOSco96g43yTIZ33UzVATM9773NZAthyg/ppjL8CMpxMkRTfq51yfb8CpBDtlBGMCrepTdSfjCFnZgpIA/89F9VzUzUXlgzyPYvFWriKVbgWsERdevxXqAI/COVELiam8Q3KN/B9u3jlC9SQRL2KEd4GScsqdxXrWUpBWzn66TtQtKq/WtlUnie2sLT4qbV4KtV7JSAyfWh9C5Lf33AHTQnuq/EpedjfCjOU4xD0jZNiMqJJWVyt7AhfFda6jWCZK8Afr/6ThENTdax6PI": 1, "WPfCSjqK0DGcYROKR6Y0ia75CIqj5kOKvzMRmPhiRYF60rbS/gvtaNtGV1TBzSYxyF6tTHdUJew1GgyQnqOl8sDed9S2YMYy/6LXjrDXRGWjIBO9edy34LfvpREjLn9P7vqg9kQ79shN4AAAAASUVORK5CYII": 1, "iVBORw0KGgoAAAANSUhEUgAAACAAAAAQCAYAAAB3AH1ZAAACMUlEQVR42tVVrW/bQBTvnzBYGDpoaBgaaGhoaHrw0HTQKkuZByK5JKoCLCsgkg0iOSBSAiI5YMCgwKDAYKD07f3e": 1, "bwUbNW6dNIsPeWcD/8": 1, "Jz879ezdlQvVNUrCJS": 1, "Yz": 1, "GXD3NKcDAx/2mtpvCfXPqb0/ah7zcUTqrSK9DqhhkHITU9el7ACvKyUk8HlzMjxaXq8G7JRCXfeUiu2Yx50FhCNtmwyOzKnII1nLsCvvBvYXPk3uJ1SwonQdMVhCejkTF9RqRi/fM0uGlbfnRMDgTj0Qy6qYo7FEQPKPgPU6FHCsvaVn1yufHKmkiiheTIUMnEk2Ib30mTjRczSuoEKunY": 1, "xNUz0l8B4sHc3EQAMVMZQzANAlQcUfvUpePBlrRgUD": 1, "JaRCbhCGhZwGVu2jYWUxHS2cb0Cdsrihynd3t2St2DVXz6RqUJKlgGVUMM/KtnWYh1LHBgohM2OhI1AS0Evi": 1, "mcaB0J/m7H98UlEad": 1, "mk/Ju/8spAyr1Kw2Yrs7FOxoM3U5A7hmUvNVOD543KKsFOrFJZAZdovslLP5fRRuQAqOmDzkCSjdKy5XJPGUG1u": 1, "ciibcwPvF0zC7Q5MPZB6Zf1bl": 1, "tBynmiZI87tv": 1, "oButj2W5SMFYj1m/dYWSjAjmMqP6bAwq2YhAF8j2MYEbsRExSMLxf/VTaHLUU86pn/6j6ZLeVIwGFst": 1, "J47cx/0JnaxSV67DHgTsDrjqEfzWhZz750yajiP4vc/5ASZt46J2q67KAAAAAElFTkSuQmCC": 1, "iVBORw0KGgoAAAANSUhEUgAAACAAAAAQCAYAAAB3AH1ZAAAAF0lEQVR42mNgGAWjYBSMglEwCkbBSAcACBAAAb475JcAAAAASUVORK5CYII": 2, "": 1, "title": 9, "element": 4, "INCLUDE": 8, "title.element": 1, "PCDATA": 1, "qname": 15, "": 4, "attlist": 4, "title.attlist": 1, "": 4, "XHTML": 7, "attrib": 11, "I18n": 3, "head": 9, "head.element": 1, "HeadOpts": 2, "mix": 3, "head.attlist": 1, "profile": 4, "datatype": 2, "body": 9, "body.element": 1, "Block": 1, "body.attlist": 1, "Common": 1, "html": 8, "html.element": 1, "html.attlist": 1, "FPI": 1, "FIXED": 1, "": 1, "compatVersion=": 1, "": 1, "FreeMedForms": 1, "": 1, "": 1, "C": 1, "Eric": 1, "MAEKER": 1, "MD": 1, "": 1, "": 1, "GPLv3": 1, "": 1, "Patient": 1, "": 1, "XML": 1, "loader/saver": 1, "FreeMedForms.": 1, "": 1, "//www.freemedforms.com/": 1, "": 1, "": 1, "": 1, "": 1 }, "XPages": { "": 2, "version=": 3, "encoding=": 2, "": 1, "": 1, "": 1, "http": 1, "//www.ibm.com/xsp/custom": 1, "": 1, "": 1, "xc": 1, "": 1, "": 1, "": 1, "": 1, "navbar": 2, "": 1, "": 1, "": 1, "": 1, "/navbar.xsp": 1, "": 1, "": 1, "": 1, "": 1, "true": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "class=": 1, "maintenanceversion=": 1, "replicaid=": 1, "xmlns=": 1, "": 1, "noteid=": 1, "sequence=": 1, "unid=": 1, "": 1, "": 5, "T175632": 1, "-": 5, "": 5, "": 1, "": 1, "T194407": 3, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "T162153": 1, "": 1, "": 1, "": 1, "": 2, "CN": 2, "Eric": 4, "McCormick/O": 2, "McCormick": 2, "": 2, "": 1, "": 1, "": 1, "": 4, "name=": 4, "": 4, "gC": 1, ";": 1, "": 4, "": 4, "navbar.xsp": 2, "sign=": 1, "": 1 }, "XProc": { "": 1, "version=": 2, "encoding=": 1, "": 1, "xmlns": 2, "p=": 1, "c=": 1, "": 1, "port=": 2, "": 1, "": 1, "Hello": 1, "world": 1, "": 1, "": 1, "": 1, "": 1, "": 1, "": 1 }, "XQuery": { "(": 38, "-": 486, "xproc.xqm": 1, "core": 1, "xqm": 1, "contains": 1, "entry": 2, "points": 1, "primary": 1, "eval": 3, "step": 5, "function": 3, "and": 3, "control": 1, "functions.": 1, ")": 38, "xquery": 1, "version": 1, "encoding": 1, ";": 25, "module": 6, "namespace": 8, "xproc": 17, "declare": 24, "namespaces": 5, "p": 2, "c": 1, "err": 1, "imports": 1, "import": 4, "util": 1, "at": 4, "const": 1, "parse": 8, "u": 2, "options": 2, "boundary": 1, "space": 1, "preserve": 1, "option": 1, "saxon": 1, "output": 1, "functions": 1, "variable": 13, "run": 2, "run#6": 1, "choose": 1, "try": 1, "catch": 1, "group": 1, "for": 1, "each": 1, "viewport": 1, "library": 1, "pipeline": 8, "list": 1, "all": 1, "declared": 1, "enum": 3, "{": 5, "": 1, "name=": 1, "ns": 1, "": 1, "}": 5, "": 1, "": 1, "point": 1, "stdin": 1, "dflag": 1, "tflag": 1, "bindings": 2, "STEP": 3, "I": 1, "preprocess": 1, "let": 6, "validate": 1, "explicit": 3, "AST": 2, "name": 1, "type": 1, "ast": 1, "element": 1, "parse/@*": 1, "sort": 1, "parse/*": 1, "II": 1, "eval_result": 1, "III": 1, "serialize": 1, "return": 2, "results": 1, "serialized_result": 2 }, "XS": { "#define": 4, "PERL_NO_GET_CONTEXT": 1, "#include": 5, "": 1, "": 1, "#if": 2, "CMARK_VERSION": 3, "<": 2, "#error": 1, "libcmark": 1, "is": 1, "required.": 1, "#endif": 2, "cmark_node_render_html": 2, "cmark_render_html": 1, "cmark_node_render_xml": 2, "cmark_render_xml": 1, "cmark_node_render_man": 2, "cmark_render_man": 1, "static": 5, "SV*": 4, "S_create_or_incref_node_sv": 5, "(": 155, "pTHX_": 5, "cmark_node": 24, "*node": 14, ")": 155, "{": 29, "SV": 19, "*new_obj": 1, "NULL": 3, ";": 108, "while": 1, "node": 21, "*obj": 4, "HV": 1, "*stash": 1, "obj": 17, "cmark_node_get_user_data": 2, "if": 19, "SvREFCNT_inc_simple_void_NN": 2, "new_obj": 5, "}": 29, "break": 1, "newSViv": 3, "PTR2IV": 1, "cmark_node_set_user_data": 2, "SvOBJECT_on": 1, "PERL_VERSION": 1, "PL_sv_objcount": 1, "+": 2, "SvUPGRADE": 1, "SVt_PVMG": 1, "stash": 2, "gv_stashpvn": 1, "GV_ADD": 1, "SvSTASH_set": 1, "HV*": 1, "SvREFCNT_inc": 1, "cmark_node_parent": 6, "return": 5, "void": 18, "S_decref_node_sv": 8, "croak": 6, "SvREFCNT_dec_NN": 1, "S_node2sv": 1, "&": 1, "PL_sv_undef": 1, "aTHX_": 14, "newRV_noinc": 2, "S_transfer_refcount": 4, "*from": 1, "*to": 1, "from": 2, "to": 2, "void*": 2, "S_sv2c": 1, "*sv": 1, "const": 10, "char": 7, "*class_name": 1, "STRLEN": 4, "len": 11, "CV": 1, "*cv": 1, "*var_name": 1, "SvROK": 1, "sv": 3, "||": 1, "sv_derived_from_pvn": 1, "class_name": 2, "*sub_name": 1, "GvNAME": 4, "CvGV": 4, "cv": 4, "sub_name": 1, "var_name": 1, "INT2PTR": 1, "SvIV": 1, "SvRV": 1, "MODULE": 4, "CommonMark": 8, "PACKAGE": 4, "PREFIX": 4, "cmark_": 1, "PROTOTYPES": 1, "DISABLE": 1, "BOOT": 1, "cmark_version": 3, "warn": 1, "CMARK_VERSION_STRING": 2, "cmark_version_string": 3, "char*": 5, "cmark_markdown_to_html": 2, "package": 18, "string": 5, "*package": 9, "NO_INIT": 9, "*string": 3, "PREINIT": 8, "*buffer": 3, "CODE": 14, "buffer": 6, "SvPVutf8": 3, "RETVAL": 23, "OUTPUT": 10, "cmark_node*": 6, "cmark_parse_document": 2, "cmark_parse_file": 2, "file": 2, "*file": 1, "PerlIO": 1, "*perl_io": 1, "FILE": 1, "*stream": 1, "perl_io": 3, "IoIFP": 1, "sv_2io": 1, "stream": 3, "PerlIO_findFILE": 1, "int": 7, "cmark_compile_time_version": 1, "cmark_compile_time_version_string": 1, "Node": 1, "cmark_node_": 1, "new": 1, "type": 3, "cmark_node_type": 1, "cmark_node_new": 1, "DESTROY": 3, "*parent": 1, "parent": 2, "else": 4, "cmark_node_free": 1, "cmark_iter*": 1, "iterator": 1, "cmark_iter_new": 1, "interface_get_node": 1, "INTERFACE": 7, "cmark_node_next": 1, "cmark_node_previous": 1, "cmark_node_first_child": 1, "cmark_node_last_child": 1, "interface_get_int": 1, "cmark_node_get_type": 1, "cmark_node_get_header_level": 1, "cmark_node_get_list_type": 1, "cmark_node_get_list_delim": 1, "cmark_node_get_list_start": 1, "cmark_node_get_list_tight": 1, "cmark_node_get_start_line": 1, "cmark_node_get_start_column": 1, "cmark_node_get_end_line": 1, "cmark_node_get_end_column": 1, "NO_OUTPUT": 3, "interface_set_int": 1, "value": 1, "cmark_node_set_header_level": 1, "cmark_node_set_list_type": 1, "cmark_node_set_list_delim": 1, "cmark_node_set_list_start": 1, "cmark_node_set_list_tight": 1, "POSTCALL": 4, "interface_get_utf8": 1, "cmark_node_get_type_string": 1, "cmark_node_get_literal": 1, "cmark_node_get_title": 1, "cmark_node_get_url": 1, "cmark_node_get_fence_info": 1, "interface_set_utf8": 1, "*value": 1, "cmark_node_set_literal": 1, "cmark_node_set_title": 1, "cmark_node_set_url": 1, "cmark_node_set_fence_info": 1, "cmark_node_unlink": 1, "*old_parent": 2, "INIT": 3, "old_parent": 4, "interface_move_node": 1, "*other": 1, "*new_parent": 1, "other": 2, "cmark_node_insert_before": 1, "cmark_node_insert_after": 1, "cmark_node_prepend_child": 1, "cmark_node_append_child": 1, "new_parent": 2, "interface_render": 1, "*root": 1, "long": 1, "options": 1, "Iterator": 1, "cmark_iter_": 1, "cmark_iter": 5, "*iter": 5, "cmark_iter_get_node": 5, "iter": 8, "cmark_iter_get_root": 1, "cmark_iter_free": 1, "cmark_iter_next": 2, "I32": 1, "gimme": 4, "*old_node": 2, "cmark_event_type": 3, "ev_type": 5, "PPCODE": 1, "GIMME_V": 1, "old_node": 7, "CMARK_EVENT_DONE": 1, "ST": 3, "sv_2mortal": 3, "IV": 2, "G_ARRAY": 2, "XSRETURN": 3, "XSRETURN_EMPTY": 1, "cmark_iter_get_event_type": 1, "cmark_iter_reset": 1, "event_type": 2, "Parser": 1, "cmark_parser_": 1, "cmark_parser*": 1, "cmark_parser_new": 2, "cmark_parser": 3, "*parser": 3, "cmark_parser_free": 1, "parser": 2, "cmark_parser_feed": 2, "cmark_parser_finish": 1 }, "XSLT": { "": 1, "version=": 2, "": 1, "xmlns": 1, "xsl=": 1, "": 1, "match=": 1, "": 1, "": 1, "

": 1, "My": 1, "CD": 1, "Collection": 1, "

": 1, "": 1, "border=": 1, "": 2, "bgcolor=": 1, "": 2, "Artist": 1, "": 2, "": 1, "select=": 3, "": 2, "": 1, "
": 2, "Title": 1, "
": 2, "": 2, "
": 1, "": 1, "": 1, "
": 1, "
": 1 }, "Xojo": { "#tag": 88, "Class": 3, "Protected": 1, "App": 1, "Inherits": 1, "Application": 1, "Constant": 3, "Name": 31, "kEditClear": 1, "Type": 34, "String": 3, "Dynamic": 3, "False": 14, "Default": 9, "Scope": 4, "Public": 3, "#Tag": 5, "Instance": 5, "Platform": 5, "Windows": 2, "Language": 5, "Definition": 5, "Linux": 2, "EndConstant": 3, "kFileQuit": 1, "kFileQuitShortcut": 1, "Mac": 1, "OS": 1, "ViewBehavior": 2, "EndViewBehavior": 2, "End": 27, "EndClass": 1, "Report": 2, "Begin": 23, "BillingReport": 1, "Compatibility": 2, "Units": 1, "Width": 3, "PageHeader": 1, "Height": 5, "Body": 1, "PageFooter": 1, "EndReport": 1, "ReportCode": 1, "EndReportCode": 1, "Dim": 3, "dbFile": 3, "As": 4, "FolderItem": 1, "db": 1, "New": 1, "SQLiteDatabase": 1, "GetFolderItem": 1, "(": 7, ")": 7, "db.DatabaseFile": 1, "If": 4, "db.Connect": 1, "Then": 1, "db.SQLExecute": 2, "_": 1, "+": 5, "db.Error": 1, "then": 1, "MsgBox": 3, "db.ErrorMessage": 2, "db.Rollback": 1, "Else": 2, "db.Commit": 1, "Menu": 2, "MainMenuBar": 1, "MenuItem": 11, "FileMenu": 1, "SpecialMenu": 13, "Text": 13, "Index": 14, "-": 14, "AutoEnable": 13, "True": 46, "Visible": 41, "QuitMenuItem": 1, "FileQuit": 1, "ShortcutKey": 6, "Shortcut": 6, "EditMenu": 1, "EditUndo": 1, "MenuModifier": 5, "EditSeparator1": 1, "EditCut": 1, "EditCopy": 1, "EditPaste": 1, "EditClear": 1, "EditSeparator2": 1, "EditSelectAll": 1, "UntitledSeparator": 1, "AppleMenuItem": 1, "AboutItem": 1, "EndMenu": 1, "Toolbar": 2, "MyToolbar": 1, "ToolButton": 2, "FirstItem": 1, "Caption": 3, "HelpTag": 3, "Style": 2, "SecondItem": 1, "EndToolbar": 1, "Window": 2, "Window1": 1, "BackColor": 1, "&": 1, "cFFFFFF00": 1, "Backdrop": 1, "CloseButton": 1, "Composite": 1, "Frame": 1, "FullScreen": 1, "FullScreenButton": 1, "HasBackColor": 1, "ImplicitInstance": 1, "LiveResize": 1, "MacProcID": 1, "MaxHeight": 1, "MaximizeButton": 1, "MaxWidth": 1, "MenuBar": 1, "MenuBarVisible": 1, "MinHeight": 1, "MinimizeButton": 1, "MinWidth": 1, "Placement": 1, "Resizeable": 1, "Title": 1, "PushButton": 1, "HelloWorldButton": 2, "AutoDeactivate": 1, "Bold": 1, "ButtonStyle": 1, "Cancel": 1, "Enabled": 1, "InitialParent": 1, "Italic": 1, "Left": 1, "LockBottom": 1, "LockedInPosition": 1, "LockLeft": 1, "LockRight": 1, "LockTop": 1, "TabIndex": 1, "TabPanelIndex": 1, "TabStop": 1, "TextFont": 1, "TextSize": 1, "TextUnit": 1, "Top": 1, "Underline": 1, "EndWindow": 1, "WindowCode": 1, "EndWindowCode": 1, "Events": 1, "Event": 1, "Sub": 2, "Action": 1, "total": 4, "Integer": 2, "For": 1, "i": 2, "To": 1, "Next": 1, "Str": 1, "EndEvent": 1, "EndEvents": 1, "ViewProperty": 28, "true": 26, "Group": 28, "InitialValue": 23, "EndViewProperty": 28, "EditorType": 14, "EnumValues": 2, "EndEnumValues": 2 }, "Xtend": { "package": 2, "example2": 1, "import": 7, "org.junit.Test": 2, "static": 4, "org.junit.Assert.*": 2, "class": 4, "BasicExpressions": 2, "{": 14, "@Test": 7, "def": 7, "void": 7, "literals": 5, "(": 42, ")": 42, "//": 11, "string": 1, "work": 1, "with": 2, "single": 1, "or": 1, "double": 2, "quotes": 1, "assertEquals": 14, "number": 1, "big": 1, "decimals": 1, "in": 2, "this": 1, "case": 1, "+": 6, "*": 1, "bd": 3, "boolean": 1, "true": 1, "false": 1, "getClass": 1, "typeof": 1, "}": 13, "collections": 2, "There": 1, "are": 1, "various": 1, "methods": 2, "to": 1, "create": 1, "and": 1, "numerous": 1, "extension": 2, "which": 1, "make": 1, "working": 1, "them": 1, "convenient.": 1, "val": 9, "list": 1, "newArrayList": 2, "list.map": 1, "[": 9, "toUpperCase": 1, "]": 9, ".head": 1, "set": 1, "newHashSet": 1, "set.filter": 1, "it": 2, ".size": 2, "map": 1, "newHashMap": 1, "-": 5, "map.get": 1, "controlStructures": 1, "looks": 1, "like": 1, "Java": 1, "if": 1, ".length": 1, "but": 1, "foo": 1, "bar": 1, "Never": 2, "happens": 3, "text": 2, "never": 1, "s": 1, "cascades.": 1, "Object": 1, "someValue": 2, "switch": 1, "Number": 1, "String": 2, "loops": 1, "for": 2, "loop": 2, "var": 1, "counter": 8, "i": 4, "..": 1, "while": 2, "iterator": 1, ".iterator": 2, "iterator.hasNext": 1, "iterator.next": 1, "example6": 1, "java.io.FileReader": 1, "java.util.Set": 1, "com.google.common.io.CharStreams.*": 1, "Movies": 1, "numberOfActionMovies": 1, "movies.filter": 2, "categories.contains": 1, "yearOfBestMovieFrom80ies": 1, ".contains": 1, "year": 2, ".sortBy": 1, "rating": 3, ".last.year": 1, "sumOfVotesOfTop2": 1, "long": 2, "movies": 3, "movies.sortBy": 1, ".take": 1, ".map": 1, "numberOfVotes": 2, ".reduce": 1, "a": 2, "b": 2, "|": 2, "_229": 1, "new": 2, "FileReader": 1, ".readLines.map": 1, "line": 1, "segments": 1, "line.split": 1, "return": 1, "Movie": 2, "segments.next": 4, "Integer": 1, "parseInt": 1, "Double": 1, "parseDouble": 1, "Long": 1, "parseLong": 1, "segments.toSet": 1, "@Data": 1, "title": 1, "int": 1, "Set": 1, "": 1, "categories": 1 }, "YAML": { "-": 84, "name": 18, "Ansible": 1, "scopeName": 2, "source.ansible": 1, "fileTypes": 2, "[": 7, "]": 7, "uuid": 2, "ae642": 1, "b4ae": 1, "b1": 1, "e9": 1, "f935bec43a8f": 1, "patterns": 4, "comment.line.number": 2, "sign.ansible": 2, "match": 10, "(": 15, "*": 5, "|": 6, "G": 1, ")": 15, "#": 1, ".*": 2, "captures": 6, "{": 12, "}": 12, "punctuation.definition.comment.line.ansible": 1, "storage.type.ansible": 1, "+": 5, "keyword.other.ansible": 1, "include": 3, "s*": 1, "w": 2, "string.quoted.double.ansible": 2, "variable.complex.ansible": 1, "contentName": 1, "string.other.ansible": 1, "begin": 2, "beginCaptures": 2, "entity.other.attribute": 1, "name.ansible": 1, "text": 1, "end": 2, "s": 1, "self": 1, "constant.other.ansible": 1, ".": 1, "a": 1, "zA": 1, "Z_": 1, "children": 1, "variable.parameter.ansible": 1, "BasedOnStyle": 1, "LLVM": 1, "IndentWidth": 1, "Language": 3, "Cpp": 1, "DerivePointerAlignment": 1, "false": 1, "PointerAlignment": 1, "Left": 1, "JavaScript": 1, "ColumnLimit": 1, "Proto": 1, "DisableFormat": 1, "true": 4, "...": 1, "gem": 1, "local": 1, "gen": 1, "rdoc": 2, "run": 1, "tests": 1, "inline": 1, "source": 1, "line": 1, "numbers": 1, "gempath": 1, "/usr/local/rubygems": 1, "/home/gavin/.rubygems": 1, "%": 1, "YAML": 1, "Hex": 1, "Inspect": 1, "file_extensions": 1, "hidden": 1, "scope": 2, "source.inspect": 1, "contexts": 1, "main": 1, "support.function.key.inspect": 1, "support.function.punctuation.inspect": 1, "push": 2, "meta_scope": 2, "item.inspect": 2, "data.inspect": 1, "pop": 2, "keyword.title.inspect": 1, "keyword.title": 1, "punctuation.inspect": 1, "title": 1, "info.inspect": 1, "R": 2, "Console": 1, "source.r": 2, "console": 3, "F629C7F3": 1, "B": 1, "A4C": 1, "EEE": 1, "C5710": 1, "source.r.embedded.r": 1, "punctuation.section.embedded.r": 1, "n": 1, "z": 1, "keyEquivalent": 1, "http_interactions": 1, "request": 1, "method": 1, "get": 1, "uri": 1, "http": 1, "//example.com/": 1, "body": 3, "headers": 2, "response": 2, "status": 1, "code": 1, "message": 1, "OK": 1, "Content": 2, "Type": 1, "text/html": 1, ";": 1, "charset": 1, "utf": 1, "Length": 1, "This": 1, "is": 1, "the": 1, "http_version": 1, "recorded_at": 1, "Tue": 1, "Nov": 1, "GMT": 1, "recorded_with": 1, "VCR": 1 }, "YANG": { "module": 2, "sfc": 3, "-": 35, "lisp": 3, "impl": 3, "{": 14, "yang": 1, "version": 1, ";": 18, "namespace": 1, "prefix": 5, "import": 3, "config": 8, "revision": 4, "date": 3, "}": 14, "rpc": 3, "context": 1, "rpcx": 1, "opendaylight": 1, "md": 1, "sal": 1, "binding": 3, "mdsal": 3, "description": 2, "identity": 3, "base": 1, "type": 3, "java": 1, "name": 1, "SfcLisp": 1, "augment": 1, "case": 1, "when": 1, "//wires": 1, "in": 1, "the": 1, "data": 3, "broker": 3, "service": 3, "container": 2, "uses": 2, "ref": 2, "refine": 2, "mandatory": 2, "false": 1, "required": 2, "async": 1, "registry": 2, "true": 1 }, "Zephir": { "%": 10, "{": 56, "#define": 1, "MAX_FACTOR": 3, "}": 50, "namespace": 3, "Test": 2, ";": 86, "#include": 1, "static": 1, "long": 3, "fibonacci": 4, "(": 55, "n": 5, ")": 53, "if": 39, "<": 1, "return": 25, "else": 11, "-": 25, "+": 5, "class": 2, "Cblock": 1, "public": 22, "function": 22, "testCblock1": 1, "int": 3, "a": 6, "testCblock2": 1, "Router": 1, "Route": 1, "protected": 9, "_pattern": 3, "_compiledPattern": 3, "_paths": 3, "_methods": 5, "_hostname": 3, "_converters": 3, "_id": 2, "_name": 3, "_beforeMatch": 3, "__construct": 1, "pattern": 37, "paths": 7, "null": 11, "httpMethods": 6, "this": 28, "reConfigure": 2, "let": 51, "compilePattern": 2, "var": 4, "idPattern": 6, "memstr": 10, "str_replace": 6, ".": 5, "via": 1, "extractNamedParams": 2, "string": 6, "char": 1, "ch": 27, "tmp": 4, "matches": 5, "boolean": 1, "notValid": 5, "false": 3, "cursor": 4, "cursorVar": 5, "marker": 4, "bracketCount": 7, "parenthesesCount": 5, "foundPattern": 6, "intermediate": 4, "numberMatches": 4, "route": 12, "item": 7, "variable": 5, "regexp": 7, "strlen": 1, "<=>": 5, "0": 9, "for": 4, "in": 4, "1": 3, "substr": 3, "break": 9, "&&": 6, "z": 2, "Z": 2, "true": 2, "<='9')>": 1, "_": 1, "2": 2, "continue": 1, "[": 14, "]": 14, "moduleName": 5, "controllerName": 7, "actionName": 4, "parts": 9, "routePaths": 5, "realClassName": 1, "namespaceName": 1, "pcrePattern": 4, "compiledPattern": 4, "extracted": 4, "typeof": 2, "throw": 1, "new": 1, "Exception": 1, "explode": 1, "switch": 1, "count": 1, "case": 3, "controller": 1, "action": 1, "array": 1, "The": 1, "contains": 1, "invalid": 1, "#": 1, "array_merge": 1, "//Update": 1, "the": 1, "s": 1, "name": 5, "*": 2, "@return": 1, "*/": 1, "getName": 1, "setName": 1, "beforeMatch": 1, "callback": 2, "getBeforeMatch": 1, "getRouteId": 1, "getPattern": 1, "getCompiledPattern": 1, "getPaths": 1, "getReversedPaths": 1, "reversed": 4, "path": 3, "position": 3, "setHttpMethods": 1, "getHttpMethods": 1, "setHostname": 1, "hostname": 2, "getHostname": 1, "convert": 1, "converter": 2, "getConverters": 1 }, "Zimpl": { "#": 2, "param": 1, "columns": 2, ";": 7, "set": 3, "I": 3, "{": 2, "..": 1, "}": 2, "IxI": 6, "*": 2, "TABU": 4, "[": 8, "": 3, "in": 5, "]": 8, "": 2, "with": 1, "(": 6, "m": 4, "i": 8, "or": 3, "n": 4, "j": 8, ")": 6, "and": 1, "abs": 2, "-": 3, "var": 1, "x": 4, "binary": 1, "maximize": 1, "queens": 1, "sum": 2, "subto": 1, "c1": 1, "forall": 1, "do": 1, "card": 2 }, "desktop": { "[": 3, "Desktop": 3, "Entry": 1, "]": 3, "Version": 1, "Type": 1, "Application": 1, "Name": 3, "Foo": 3, "Viewer": 1, "Comment": 1, "The": 1, "best": 1, "viewer": 1, "for": 1, "objects": 1, "available": 1, "TryExec": 1, "fooview": 6, "Exec": 3, "%": 1, "F": 1, "Icon": 2, "MimeType": 1, "image/x": 1, "-": 7, "foo": 1, ";": 3, "Actions": 1, "Gallery": 3, "Create": 3, "Action": 2, "gallery": 1, "Browse": 1, "create": 1, "new": 3, "a": 1 }, "eC": { "import": 1, "class": 1, "Designer": 2, "DesignerBase": 1, "{": 62, "(": 138, ")": 139, "if": 37, "GetActiveDesigner": 1, "this": 6, "SetActiveDesigner": 1, "null": 9, ";": 110, "}": 62, "classDesigner": 13, "delete": 3, "void": 19, "ModifyCode": 1, "codeEditor.ModifyCode": 1, "UpdateProperties": 1, "codeEditor.DesignerModifiedObject": 1, "CodeAddObject": 1, "Instance": 14, "instance": 29, "ObjectInfo": 12, "*": 5, "object": 21, "codeEditor.AddObject": 1, "SheetAddObject": 1, "codeEditor.sheet.AddObject": 1, "object.name": 1, "typeData": 1, "true": 15, "//className": 1, "AddToolBoxClass": 1, "Class": 3, "_class": 5, "IDEWorkSpace": 1, "master": 1, ".toolBox.AddControl": 1, "AddDefaultMethod": 1, "classInstance": 2, "instance._class": 1, "Method": 4, "defaultMethod": 4, "for": 5, "_class.base": 1, "method": 6, "int": 1, "minID": 3, "MAXINT": 1, "_class.methods.first": 1, "BTNode": 1, ".next": 1, "method.type": 1, "virtualMethod": 1, "method.dataType": 2, "ProcessTypeString": 1, "method.dataTypeString": 1, "false": 11, "method.vid": 2, "<": 1, "&&": 12, "||": 4, "method.dataType.thisClass": 1, "eClass_IsDerived": 1, "classInstance._class": 1, "method.dataType.thisClass.registered": 1, "break": 3, "codeEditor.AddMethod": 1, "bool": 15, "ObjectContainsCode": 1, "object.instCode": 1, "MembersInit": 1, "members": 4, "object.instCode.members": 2, "-": 1, "first": 1, "members.next": 1, "members.type": 1, "methodMembersInit": 1, "//if": 2, "Code_IsFunctionEmpty": 1, "members.function": 1, "return": 12, "DeleteObject": 1, "codeEditor": 5, "codeEditor.DeleteObject": 1, "RenameObject": 1, "const": 2, "char": 2, "name": 3, "object.classDefinition": 1, "codeEditor.RenameObject": 1, "FindObject": 1, "string": 3, "classObject": 4, "codeEditor.classes.first": 1, "classObject.next": 1, "check": 5, "classObject.name": 2, "strcmp": 2, "*object": 2, "classObject.instance": 1, "classObject.instances.first": 1, "check.next": 1, "check.name": 2, "check.instance": 1, "SelectObjectFromDesigner": 1, "codeEditor.SelectObjectFromDesigner": 1, "borderStyle": 1, "sizable": 1, "isActiveClient": 1, "hasVertScroll": 1, "hasHorzScroll": 1, "hasClose": 1, "hasMaximize": 1, "hasMinimize": 1, "text": 1, "menu": 2, "Menu": 2, "anchor": 1, "Anchor": 2, "left": 2, "right": 2, "top": 2, "bottom": 2, "ToolBox": 1, "toolBox": 1, "CodeEditor": 1, "fileMenu": 3, "f": 1, "MenuItem": 4, "fileSaveItem": 1, "s": 1, "ctrlS": 1, "NotifySelect": 2, "selection": 4, "Modifiers": 2, "mods": 4, "codeEditor.MenuFileSave": 1, "fileSaveAsItem": 1, "a": 1, "codeEditor.MenuFileSaveAs": 1, "debugClosing": 5, "OnClose": 1, "parentClosing": 2, "codeEditor.inUseDebug": 1, "closing": 1, "CloseConfirmation": 1, "visible": 3, "modifiedDocument": 3, "OnFileModified": 1, "modified": 1, "codeEditor.closing": 1, "codeEditor.visible": 1, "codeEditor.Destroy": 1, "else": 3, "OnActivate": 1, "active": 2, "Window": 1, "previous": 1, "goOnWithActivation": 1, "direct": 1, "codeEditor.EnsureUpToDate": 1, "codeEditor.fixCaret": 1, "OnKeyHit": 1, "Key": 1, "key": 2, "unichar": 1, "ch": 2, "codeEditor.sheet.OnKeyHit": 1, "watch": 1, "fileSaveItem.disabled": 1, "codeEditor.fileName": 1, "Reset": 1, "classDesigner.Reset": 1, "classDesigner.SelectObject": 3, "classDesigner.Destroy": 2, "FillToolBox": 1, "classDesigner.ListToolBoxClasses": 1, "SelectObject": 1, "ClassDesignerBase": 7, "this.classDesigner": 3, "#ifdef": 1, "_DEBUG": 1, "instance._class.module.application": 1, "codeEditor.privateModule": 1, "printf": 1, "#endif": 1, "classDesigner._class": 1, "eInstance_GetDesigner": 8, "eInstance_New": 1, "incref": 1, "classDesigner.parent": 2, "classDesigner.anchor": 1, "classDesigner.Create": 1, "AddObject": 1, "classDesigner.AddObject": 1, "Activate": 1, "codeEditor.Activate": 1, "CreateObject": 1, "isClass": 6, "iclass": 6, "subclass": 6, "designerClass": 12, "designerClass.CreateObject": 1, "PostCreateObject": 1, "designerClass.PostCreateObject": 1, "DroppedObject": 1, "designerClass.DroppedObject": 1, "PrepareTestObject": 1, "designerClass.PrepareTestObject": 1, "DestroyObject": 1, "designerClass.DestroyObject": 1, "FixProperty": 1, "Property": 1, "prop": 2, "designerClass.FixProperty": 1 }, "edn": { "[": 24, "{": 22, "db/id": 22, "#db/id": 22, "db.part/db": 6, "]": 24, "db/ident": 3, "object/name": 18, "db/doc": 4, "db/valueType": 3, "db.type/string": 2, "db/index": 3, "true": 3, "db/cardinality": 3, "db.cardinality/one": 3, "db.install/_attribute": 3, "}": 22, "object/meanRadius": 18, "db.type/double": 1, "data/source": 2, "db.part/tx": 2, "db.part/user": 17 }, "fish": { "#": 18, "set": 49, "-": 102, "g": 1, "IFS": 4, "n": 5, "t": 2, "l": 15, "configdir": 2, "/.config": 1, "if": 21, "q": 9, "XDG_CONFIG_HOME": 2, "end": 33, "not": 8, "fish_function_path": 4, "configdir/fish/functions": 1, "__fish_sysconfdir/functions": 1, "__fish_datadir/functions": 3, "contains": 4, "[": 13, "]": 13, "fish_complete_path": 4, "configdir/fish/completions": 1, "__fish_sysconfdir/completions": 1, "__fish_datadir/completions": 3, "test": 7, "d": 3, "/usr/xpg4/bin": 3, "PATH": 6, "path_list": 4, "/bin": 1, "/usr/bin": 1, "/usr/X11R6/bin": 1, "/usr/local/bin": 1, "__fish_bin_dir": 1, "switch": 3, "USER": 1, "case": 9, "root": 1, "/sbin": 1, "/usr/sbin": 1, "/usr/local/sbin": 1, "for": 1, "i": 5, "in": 2, "function": 6, "fish_sigtrap_handler": 1, "on": 2, "signal": 1, "TRAP": 1, "no": 2, "scope": 1, "shadowing": 1, "description": 2, "breakpoint": 1, "__fish_on_interactive": 2, "event": 1, "fish_prompt": 1, "__fish_config_interactive": 1, "functions": 5, "e": 6, "eval": 5, "S": 1, "If": 2, "we": 2, "are": 1, "an": 1, "interactive": 8, "shell": 1, "should": 2, "enable": 1, "full": 4, "job": 5, "control": 5, "since": 1, "it": 1, "behave": 1, "like": 2, "the": 1, "real": 1, "code": 1, "was": 1, "executed.": 1, "don": 1, "do": 1, "this": 1, "commands": 1, "that": 1, "expect": 1, "to": 1, "be": 1, "used": 1, "interactively": 1, "less": 1, "wont": 1, "work": 1, "using": 1, "eval.": 1, "mode": 5, "status": 7, "is": 3, "else": 3, "none": 1, "echo": 3, "|": 3, ".": 2, "<": 1, "&": 1, "res": 2, "return": 6, "funced": 3, "editor": 7, "EDITOR": 1, "funcname": 14, "while": 2, "argv": 9, "h": 1, "help": 1, "__fish_print_help": 1, "set_color": 4, "red": 2, "printf": 3, "(": 7, "_": 3, ")": 7, "normal": 2, "begin": 2, ";": 7, "or": 3, "init": 5, "nend": 2, "editor_cmd": 2, "type": 1, "f": 3, "/dev/null": 2, "fish": 3, "z": 1, "fish_indent": 2, "indent": 1, "prompt": 2, "read": 1, "p": 1, "c": 1, "s": 1, "cmd": 2, "TMPDIR": 2, "/tmp": 1, "tmpname": 8, "%": 2, "self": 2, "random": 2, "stat": 2, "rm": 1 }, "reStructuredText": { "Contributing": 2, "to": 45, "SciPy": 12, "This": 4, "document": 2, "aims": 1, "give": 1, "an": 4, "overview": 1, "of": 26, "how": 5, "contribute": 4, "SciPy.": 5, "It": 3, "tries": 1, "answer": 1, "commonly": 1, "asked": 1, "questions": 1, "and": 30, "provide": 1, "some": 4, "insight": 1, "into": 5, "the": 63, "community": 3, "process": 2, "works": 2, "in": 20, "practice.": 1, "Readers": 1, "who": 1, "are": 9, "familiar": 1, "with": 7, "experienced": 1, "Python": 9, "coders": 1, "may": 5, "want": 4, "jump": 1, "straight": 1, "git": 6, "workflow": 3, "_": 8, "documentation.": 1, "new": 9, "code": 21, "-": 78, "If": 2, "you": 24, "have": 9, "been": 1, "working": 1, "scientific": 2, "toolstack": 1, "for": 17, "a": 22, "while": 3, "probably": 2, "lying": 1, "around": 1, "which": 2, "think": 1, ".": 3, "Perhaps": 1, "it": 9, "s": 4, "potentially": 1, "useful": 1, "multiple": 2, "domains": 1, "fits": 1, "scope": 1, "existing": 3, "scipy": 13, "submodules.": 1, "In": 3, "principle": 2, "submodules": 1, "can": 16, "be": 10, "added": 2, "too": 1, "but": 3, "this": 11, "is": 24, "far": 1, "less": 1, "common.": 1, "For": 1, "that": 21, "specific": 3, "single": 1, "application": 1, "there": 3, "project": 1, "use": 9, "code.": 2, "Some": 2, "scikits": 2, "(": 9, "scikit": 1, "learn": 2, "image": 2, "statsmodels": 1, "etc.": 1, ")": 10, "good": 2, "examples": 1, "here": 3, ";": 1, "they": 1, "narrower": 1, "focus": 1, "because": 1, "more": 2, "domain": 1, "than": 3, "Now": 3, "if": 3, "would": 1, "like": 1, "see": 4, "included": 1, "do": 7, "go": 2, "about": 1, "After": 1, "checking": 1, "your": 15, "distributed": 1, "under": 1, "compatible": 1, "license": 3, "FAQ": 1, "details": 2, "first": 1, "step": 1, "discuss": 2, "on": 16, "dev": 8, "mailing": 6, "list.": 2, "All": 2, "features": 1, "as": 4, "well": 2, "changes": 3, "discussed": 1, "decided": 1, "there.": 1, "You": 2, "should": 5, "already": 2, "start": 2, "discussion": 2, "before": 2, "finished.": 1, "Assuming": 2, "outcome": 1, "list": 4, "positive": 2, "function": 1, "or": 8, "piece": 1, "does": 2, "what": 2, "need": 2, "next": 1, "Before": 1, "at": 2, "least": 1, "has": 3, "documentation": 5, "unit": 2, "tests": 5, "correct": 2, "style.": 1, "Unit": 1, "aim": 1, "create": 3, "exercise": 1, "all": 1, "adding.": 1, "gives": 1, "degree": 1, "confidence": 1, "runs": 1, "correctly": 1, "also": 4, "versions": 1, "hardware": 1, "OSes": 1, "don": 1, "t": 5, "work": 1, "described": 1, "section": 1, "NumPy": 1, "Github": 4, "help": 2, "pages.": 1, "When": 1, "send": 2, "PR": 4, "feature": 1, "sure": 1, "mention": 1, "prompt": 1, "interested": 1, "people": 1, "review": 6, "PR.": 1, "got": 1, "feedback": 1, "general": 1, "idea": 1, "code/feature": 1, "purpose": 1, "ensure": 1, "efficient": 1, "meets": 1, "requirements": 2, "outlined": 1, "above.": 1, "many": 3, "cases": 1, "happens": 1, "relatively": 1, "quickly": 1, "perfectly": 1, "fine": 1, "ask": 2, "again": 1, "after": 1, "reasonable": 1, "amount": 1, "time": 1, "say": 1, "couple": 1, "weeks": 1, "passed": 1, "Once": 2, "completed": 1, "merged": 2, "branch": 2, "The": 7, "above": 3, "describes": 1, "adding": 2, "doesn": 3, "t.": 1, "fix": 1, "so": 4, "test": 3, "pass.": 1, "That": 1, "enough": 1, "issue.": 1, "Unlike": 1, "when": 1, "discussing": 1, "not": 2, "necessary": 3, "old": 1, "behavior": 1, "clearly": 1, "incorrect": 1, "no": 2, "one": 1, "will": 1, "object": 1, "having": 1, "fixed.": 1, "add": 4, "warning": 1, "deprecation": 1, "message": 1, "changed": 1, "behavior.": 1, "part": 1, "process.": 1, "Other": 1, "ways": 2, "There": 1, "other": 3, "contributing": 1, "Participating": 1, "discussions": 1, "user": 1, "*mailing": 1, "lists*": 1, "contribution": 1, "itself.": 1, "scipy.org": 2, "*website*": 1, "contains": 1, "lot": 1, "information": 1, "always": 1, "pair": 1, "hands.": 1, "A": 1, "redesign": 1, "website": 2, "ongoing": 1, "scipy.github.com": 1, "_.": 3, "redesigned": 1, "static": 1, "site": 4, "based": 1, "Sphinx": 1, "sources": 1, "*documentation*": 1, "constantly": 1, "being": 1, "improved": 1, "by": 4, "developers": 1, "users.": 1, "sending": 1, "improves": 1, "require": 1, "knowledge": 1, "Anyone": 1, "register": 1, "username": 1, "wiki": 4, "edit": 3, "rights": 1, "make": 2, "edits.": 1, "updated": 1, "every": 1, "day": 1, "latest": 1, "master": 1, "edits": 1, "regularly": 1, "reviewed": 1, "master.": 1, "Another": 1, "advantage": 1, "immediately": 2, "reStructuredText": 1, "reST": 1, "docstrings": 1, "docs": 1, "rendered": 1, "html": 1, "easily": 1, "catch": 1, "formatting": 1, "errors.": 1, "Code": 2, "yourself": 1, "OK.": 1, "GPL": 1, "licensed": 1, "clear": 1, "requires": 1, "citation": 1, "free": 1, "academic": 1, "only": 2, "included.": 1, "See": 1, "compatibility": 2, "*How": 2, "I": 5, "set": 5, "up": 7, "files": 1, "run": 2, "commits": 1, "*": 3, "simplest": 1, "method": 1, "setting": 1, "place": 4, "build.": 1, "To": 2, "local": 2, "repo": 1, "build": 3, "clone": 1, "https": 6, "//github.com/scipy/scipy.git": 1, "cd": 1, "python": 3, "setup.py": 1, "build_ext": 1, "i": 1, "Then": 1, "either": 1, "symlink": 3, "packages": 3, "directory": 1, "PYTHONPATH": 2, "environment": 3, "variable": 1, "find": 1, "it.": 1, "IDEs": 1, "Spyder": 1, "example": 3, "utilities": 1, "manage": 1, "PYTHONPATH.": 1, "On": 1, "Linux": 1, "OS": 1, "X": 1, ".bash_login": 1, "file": 2, "automatically": 1, "dir": 3, "startup": 1, "terminal.": 1, "Add": 1, "line": 1, "export": 1, "Alternatively": 1, "prefix": 2, "instead": 1, "global": 1, "setupegg.py": 1, "develop": 1, "{": 1, "HOME": 1, "}": 1, "everything": 1, "interpreter": 1, "inside": 1, "scipy/": 1, "source": 2, "import": 1, "sp": 1, "sp.test": 1, "editing": 1, "allows": 1, "simply": 1, "restarting": 1, "interpreter.": 1, "Note": 1, "procedure": 1, "most": 1, "straightforward": 1, "way": 2, "get": 1, "started": 1, "look": 1, "using": 2, "Bento": 1, "numscons": 1, "faster": 1, "flexible": 1, "building": 1, "virtualenv": 3, "maintain": 1, "development": 4, "environments": 1, "versions.": 1, "version": 5, "parallel": 1, "released": 2, "my": 2, "job/research": 1, "One": 1, "simple": 1, "achieve": 1, "install": 4, "binary": 1, "installer": 1, "pip": 1, "virtualenv.": 1, "First": 1, "virtualenvwrapper": 1, "then": 1, "named": 1, "mkvirtualenv": 1, "whenever": 1, "switch": 1, "virtual": 2, "command": 2, "workon": 1, "deactivate": 1, "exits": 1, "from": 1, "brings": 1, "back": 1, "previous": 1, "shell.": 1, "With": 1, "activated": 1, "follow": 1, "actually": 1, "*Can": 1, "programming": 1, "language": 1, "speed": 1, "Yes.": 1, "languages": 1, "used": 1, "Cython": 1, "C": 2, "+": 4, "Fortran.": 1, "these": 1, "their": 1, "pros": 1, "cons.": 1, "really": 1, "reasons": 2, "why": 1, "C/C": 1, "/Fortran": 1, "preferred": 1, "please": 1, "those": 1, "first.": 1, "*There": 1, "anymore.": 1, "Use": 1, "Trac": 1, "bug": 1, "reports": 1, "patches.": 1, "..": 22, "_scikit": 1, "http": 17, "//scikit": 1, "learn.org": 1, "_scikits": 1, "//scikits": 1, "image.org/": 1, "_statsmodels": 1, "//statsmodels.sourceforge.net/": 1, "_testing": 1, "guidelines": 1, "//github.com/numpy/numpy/blob/master/doc/TESTS.rst.txt": 1, "_how": 1, "//github.com/numpy/numpy/blob/master/doc/HOWTO_DOCUMENT.rst.txt": 1, "_PEP8": 1, "//www.python.org/dev/peps/pep": 1, "/": 1, "_pep8": 1, "package": 1, "//pypi.python.org/pypi/pep8": 1, "_pyflakes": 1, "//pypi.python.org/pypi/pyflakes": 1, "_SciPy": 2, "API": 1, "//docs.scipy.org/doc/scipy/reference/api.html": 1, "_git": 1, "//docs.scipy.org/doc/numpy/dev/gitwash/index.html": 1, "_maintainers": 1, "//github.com/scipy/scipy/blob/master/doc/MAINTAINERS.rst.txt": 1, "_Trac": 1, "//projects.scipy.org/scipy/timeline": 1, "_Github": 1, "//github.com/scipy/scipy": 1, "_scipy.org": 2, "//scipy.org/": 1, "_scipy.github.com": 1, "//scipy.github.com/": 1, "//github.com/scipy/scipy.org": 1, "_documentation": 1, "//docs.scipy.org/scipy/Front": 1, "%": 1, "Page/": 1, "Central": 1, "//scipy": 1, "central.org/": 1, "_license": 1, "//www.scipy.org/License_Compatibility": 1, "_doctest": 1, "//www.doughellmann.com/PyMOTW/doctest/": 1, "_virtualenv": 1, "//www.virtualenv.org/": 1, "_virtualenvwrapper": 1, "//www.doughellmann.com/projects/virtualenvwrapper/": 1 }, "wisp": { ";": 199, "#": 2, "wisp": 6, "Wisp": 13, "is": 20, "homoiconic": 1, "JS": 17, "dialect": 1, "with": 6, "a": 24, "clojure": 2, "syntax": 2, "s": 7, "-": 33, "expressions": 6, "and": 9, "macros.": 1, "code": 3, "compiles": 1, "to": 21, "human": 1, "readable": 1, "javascript": 1, "which": 3, "one": 3, "of": 16, "they": 3, "key": 3, "differences": 1, "from": 2, "clojurescript.": 1, "##": 2, "data": 1, "structures": 1, "nil": 4, "just": 3, "like": 2, "js": 1, "undefined": 1, "differenc": 1, "that": 7, "it": 10, "shortcut": 1, "for": 5, "void": 2, "(": 77, ")": 75, "in": 16, "JS.": 2, "Booleans": 1, "booleans": 2, "true": 6, "/": 1, "false": 2, "are": 14, "Numbers": 1, "numbers": 2, "Strings": 2, "strings": 3, "can": 13, "be": 15, "multiline": 1, "Characters": 2, "sugar": 1, "single": 1, "char": 1, "Keywords": 3, "symbolic": 2, "identifiers": 2, "evaluate": 2, "themselves.": 1, "keyword": 1, "Since": 1, "string": 1, "constats": 1, "fulfill": 1, "this": 2, "purpose": 2, "keywords": 1, "compile": 3, "equivalent": 2, "strings.": 1, "window.addEventListener": 1, "load": 1, "handler": 1, "invoked": 2, "as": 4, "functions": 8, "desugars": 1, "plain": 2, "associated": 2, "value": 2, "access": 1, "bar": 4, "foo": 6, "[": 22, "]": 22, "Vectors": 1, "vectors": 1, "arrays.": 1, "Note": 3, "Commas": 2, "white": 1, "space": 1, "&": 6, "used": 1, "if": 7, "desired": 1, "Maps": 2, "hash": 1, "maps": 1, "objects.": 1, "unlike": 1, "keys": 1, "not": 4, "arbitary": 1, "types.": 1, "{": 4, "beep": 1, "bop": 1, "}": 4, "optional": 2, "but": 7, "come": 1, "handy": 1, "separating": 1, "pairs.": 1, "b": 5, "In": 5, "future": 2, "JSONs": 1, "may": 1, "made": 2, "compatible": 1, "map": 3, "syntax.": 1, "Lists": 1, "You": 1, "up": 1, "lists": 1, "representing": 1, "expressions.": 1, "The": 1, "first": 4, "item": 2, "the": 9, "expression": 6, "function": 7, "being": 1, "rest": 7, "items": 2, "arguments.": 2, "baz": 2, "Conventions": 1, "puts": 1, "lot": 2, "effort": 1, "making": 1, "naming": 1, "conventions": 3, "transparent": 1, "by": 2, "encouraning": 1, "lisp": 1, "then": 1, "translating": 1, "them": 1, "dash": 1, "delimited": 1, "dashDelimited": 1, "predicate": 1, "isPredicate": 1, "__privates__": 1, "list": 2, "vector": 1, "listToVector": 1, "As": 1, "side": 2, "effect": 1, "some": 2, "names": 1, "expressed": 3, "few": 1, "ways": 1, "although": 1, "third": 2, "expression.": 1, "<": 1, "number": 3, "Else": 1, "missing": 1, "conditional": 1, "evaluates": 2, "result": 2, "will": 6, ".": 6, "monday": 1, "today": 1, "Compbining": 1, "everything": 1, "an": 1, "sometimes": 1, "might": 1, "want": 2, "compbine": 1, "multiple": 1, "into": 2, "usually": 3, "evaluating": 1, "have": 2, "effects": 1, "do": 4, "console.log": 2, "+": 9, "Also": 1, "special": 4, "form": 10, "many.": 1, "If": 2, "evaluation": 1, "nil.": 1, "Bindings": 1, "Let": 1, "containing": 1, "lexical": 1, "context": 1, "simbols": 1, "bindings": 1, "forms": 1, "bound": 1, "their": 2, "respective": 1, "results.": 1, "let": 2, "c": 1, "Functions": 1, "fn": 15, "x": 22, "named": 1, "similar": 2, "increment": 1, "also": 2, "contain": 1, "documentation": 1, "metadata.": 1, "Docstring": 1, "metadata": 1, "presented": 1, "compiled": 2, "yet": 1, "comments": 1, "function.": 1, "incerement": 1, "added": 1, "makes": 1, "capturing": 1, "arguments": 7, "easier": 1, "than": 1, "argument": 1, "follows": 1, "simbol": 1, "capture": 1, "all": 4, "args": 1, "array.": 1, "rest.reduce": 1, "sum": 3, "Overloads": 1, "overloaded": 1, "depending": 1, "on": 1, "take": 2, "without": 2, "introspection": 1, "version": 1, "y": 6, "more": 3, "more.reduce": 1, "does": 1, "has": 2, "variadic": 1, "overload": 1, "passed": 1, "throws": 1, "exception.": 1, "Other": 1, "Special": 1, "Forms": 1, "Instantiation": 1, "type": 2, "instantiation": 1, "consice": 1, "needs": 1, "suffixed": 1, "character": 1, "Type.": 1, "options": 2, "More": 1, "verbose": 1, "there": 1, "new": 2, "Class": 1, "Method": 1, "calls": 3, "method": 2, "no": 1, "different": 1, "Any": 1, "quoted": 1, "prevent": 1, "doesn": 1, "t": 1, "unless": 5, "or": 2, "macro": 7, "try": 1, "implemting": 1, "understand": 1, "use": 2, "case": 1, "We": 1, "execute": 1, "body": 4, "condition": 4, "defn": 2, "Although": 1, "following": 2, "log": 1, "anyway": 1, "since": 1, "exectued": 1, "before": 1, "called.": 1, "Macros": 2, "solve": 1, "problem": 1, "because": 1, "immediately.": 1, "Instead": 1, "you": 1, "get": 2, "choose": 1, "when": 1, "evaluated.": 1, "return": 1, "instead.": 1, "defmacro": 3, "less": 1, "how": 1, "build": 1, "implemented.": 1, "define": 4, "name": 2, "def": 1, "@body": 1, "Now": 1, "we": 2, "above": 1, "defined": 1, "expanded": 2, "time": 1, "resulting": 1, "diff": 1, "program": 1, "output.": 1, "print": 1, "message": 2, ".log": 1, "console": 1, "Not": 1, "macros": 2, "via": 2, "templating": 1, "language": 1, "available": 1, "at": 1, "hand": 1, "assemble": 1, "form.": 1, "For": 2, "instance": 1, "ease": 1, "functional": 1, "chanining": 1, "popular": 1, "chaining.": 1, "example": 1, "API": 1, "pioneered": 1, "jQuery": 1, "very": 2, "common": 1, "open": 2, "target": 1, "keypress": 2, "filter": 2, "isEnterKey": 1, "getInputText": 1, "reduce": 3, "render": 2, "Unfortunately": 1, "though": 1, "requires": 1, "need": 1, "methods": 1, "dsl": 1, "object": 1, "limited.": 1, "Making": 1, "party": 1, "second": 1, "class.": 1, "Via": 1, "achieve": 1, "chaining": 1, "such": 1, "tradeoffs.": 1, "operations": 3, "operation": 3, "cons": 2, "tagret": 1, "enter": 1, "input": 1, "text": 1 }, "xBase": { "#ifndef": 4, "__HARBOUR__": 4, "__XPP__": 1, "__CLIP__": 1, "FlagShip": 1, "#define": 6, "__CLIPPER__": 2, "#endif": 7, "FC_NORMAL": 1, "FC_READONLY": 1, "FC_HIDDEN": 1, "FC_SYSTEM": 1, "#command": 4, "SET": 2, "DELETED": 2, "": 1, "Set": 3, "(": 237, "_SET_DELETED": 2, "<(x)>": 1, ")": 237, "": 6, "@": 3, "": 2, "": 2, "SAY": 2, "": 2, "[": 29, "PICTURE": 1, "": 2, "]": 29, "COLOR": 1, "": 2, ";": 74, "DevPos": 1, "DevOutPict": 1, "ENDIF": 3, "<*x*>": 1, "endif": 20, "#ifdef": 2, "#xtranslate": 4, "hb_MemoWrit": 1, "": 1, "MemoWrit": 1, "hb_dbExists": 1, "": 2, "File": 1, "hb_dbPack": 1, "__dbPack": 1, "hb_default": 1, "": 3, "iif": 1, "StrTran": 2, "ValType": 2, "#require": 1, "#pragma": 1, "linenumber": 1, "on": 1, "#include": 2, "#stdout": 1, "#warning": 1, "MYCONST": 2, "#undef": 1, "#else": 1, "#if": 1, "defined": 2, ".OR.": 1, ".T.": 7, "#elif": 1, "THREAD": 1, "STATIC": 3, "t_var": 1, "REQUEST": 1, "AllTrim": 1, "ANNOUNCE": 1, "my_module": 1, "PROCEDURE": 5, "Main": 1, "MEMVAR": 1, "p_var": 2, "m_var": 2, "FIELD": 1, "fld": 1, "s_test": 1, "LOCAL": 4, "o": 6, "TTest": 3, "New": 10, "tmp": 19, "oError": 2, "bBlock": 1, "{": 95, "|": 12, "QOut": 2, "}": 95, "hHash": 3, "PUBLIC": 1, "PRIVATE": 1, "PARAMETERS": 1, "p1": 2, "_SET_DATEFORMAT": 1, "CLS": 1, "hb_ValToExp": 1, "m": 1, "-": 153, "FOR": 2, "TO": 1, "STEP": 1, "NEXT": 2, "EACH": 1, "IN": 1, "DESCEND": 1, "+": 163, "/": 1, "*": 3, "**": 1, "<": 6, "#": 1, "%": 1, "DO": 2, "WHILE": 2, "ENDDO": 2, "IF": 2, "LOOP": 2, "EXIT": 3, "NIL": 1, "ELSEIF": 1, ".F.": 13, "d19800101": 1, "ELSE": 1, "CASE": 3, "OTHERWISE": 2, "ENDCASE": 1, "SWITCH": 1, "ENDSWITCH": 1, "BEGIN": 1, "SEQUENCE": 1, "WITH": 1, "__BreakBlock": 1, "BREAK": 1, "RECOVER": 1, "USING": 1, "END": 1, "local_func": 2, "@hHash": 1, "RETURN": 10, "INIT": 1, "init_proc": 1, "exit_proc": 1, "returning_nothing": 1, "FUNCTION": 3, "pub_func": 1, "CREATE": 2, "CLASS": 4, "INHERIT": 1, "TParent": 3, "VAR": 2, "One": 6, "Two": 1, "METHOD": 7, "Test": 1, "INLINE": 1, "MethProc": 2, "ENDCLASS": 2, "super": 1, "Self": 2, "This": 4, "is": 4, "a": 7, "comment": 4, "&&": 1, "NOTE": 2, "note": 1, "pub_func2": 1, "hello": 1, "world": 1, "#Include": 6, "////////////////////////": 2, "//": 12, "User": 4, "Function": 4, "FA280": 1, "//Executado": 1, "uma": 1, "vez": 1, "para": 3, "cada": 2, "parcela": 2, "If": 11, "cEmpAnt": 2, "SE5": 11, "dbSelectArea": 5, "cSet3Filter": 3, "dbSetFilter": 1, "||": 1, "&": 1, "dbGoTOP": 1, "aOrig06Tit": 8, "Todos": 1, "os": 3, "Titulos": 2, "que": 3, "ser": 3, "reparcelados": 1, "nTotal": 4, "While": 7, "EOF": 4, "AADD": 9, "E5_PREFIXO": 1, "E5_NUMERO": 1, "E5_VALOR": 2, "dbSkip": 1, "End": 5, "aNovoTitulo": 4, "SE1ORIG": 60, "E1_FILIAL": 19, "Nil": 74, "SE1": 64, "E1_PREFIXO": 10, "E1_NUM": 10, "E1_TIPO": 10, "E1_PARCELA": 9, "E1_NATUREZ": 2, "E1_CLIENTE": 1, "E1_LOJA": 1, "E1_NRDOC": 1, "E1_EMISSAO": 1, "E1_VENCTO": 1, "E1_VENCREA": 1, "E1_VALOR": 7, "E1_SALDO": 1, "E1_VLCRUZ": 1, "E1_PORTADO": 1, "E1_FATURA": 4, "E1_X_DTPAV": 1, "E1_X_DTSAV": 1, "E1_X_DTTAV": 1, "E1_X_DTSPC": 1, "E1_X_DTPRO": 1, "E1_NUMBCO": 1, "E1_X_DUDME": 1, "E1_X_TIPOP": 1, "E1_X_DTCAN": 1, "E1_X_MOTIV": 1, "E1_X_DESPC": 1, "E1_NUMNOTA": 1, "E1_SERIE": 1, "E1_X_DEPRO": 1, "E1_X_TPPAI": 1, "E1_X_CGC": 1, "E1_XTPEMP": 1, "E1_X_CTRIM": 1, "StartJob": 2, "getenvserver": 3, "dbClearFilter": 1, "EndIf": 2, "Return": 4, "nil": 2, "FA280_01": 1, "cE1PREFIXO": 5, "cE1NUM": 6, "cE1TIPO": 2, "nE1Valor": 4, "cE1PARCELA": 2, "Local": 2, "nValPar": 8, "aTit05": 5, "RpcSetType": 2, "Nao": 2, "consome": 2, "licensa": 2, "//Prepare": 1, "Environment": 4, "Empresa": 1, "Filial": 1, "Muda": 1, "de": 4, "empresa": 1, "RpcSetEnv": 3, "GetEnvServer": 3, "Sleep": 3, "nFileLog": 47, "u_OpenLog": 2, "dToS": 2, "dDataBase": 3, "fWrite": 43, "CRLF": 54, "nParcelas": 4, "round": 2, "nTotal/nE1Valor": 1, "cUltima": 2, "chr": 1, "cvaltochar": 8, "n0102total": 6, "n0105total": 6, "//Loop": 4, "entre": 4, "todos": 1, "Reparcelados": 1, "For": 5, "nI": 30, "To": 5, "len": 5, "cQuery": 9, "select": 4, "DbCloseArea": 4, "TcQuery": 4, "Alias": 4, "DBGOTOP": 3, "as": 4, "duas": 1, "filiais": 3, "cFilAnt": 4, "//Faz": 1, "baixa": 2, "if": 10, "alltrim": 1, "E1_STATUS": 1, "aBaixa": 6, "E1_DESCONT": 2, "E1_JUROS": 2, "E1_MULTA": 2, "E1_VLRREAL": 2, "date": 4, "lMsErroAuto": 12, "//reseta": 2, "MSExecAuto": 5, "x": 10, "y": 10, "FINA070": 3, "MSErroString": 5, "tojson": 5, "return": 6, "else": 7, "RECLOCK": 4, "E5_FATURA": 1, "E5_FATPREF": 1, "//E5_LA": 1, "S": 1, "//E5_MOEDA": 1, "//E5_TXMOEDA": 1, "MSUNLOCK": 4, "E1_FATPREF": 3, "E1_TIPOFAT": 2, "E1_FLAGFAT": 2, "E1_DTFATUR": 2, "//calcula": 1, "valor": 3, "total": 1, "filial": 1, "poder": 1, "calcular": 1, "Fatura": 2, "elseif": 4, "dbskip": 3, "Next": 5, "n0102val": 5, "n0102total/nTotal": 1, "n0105val": 4, "aFili": 22, "PARC": 5, "//verificamos": 1, "se": 1, "estamos": 1, "na": 1, "ultima": 1, "QUANT": 1, "//QUANT": 1, "quantidade": 1, "parcelas": 3, "incluida": 1, "//o": 1, "desta": 1, "resta": 1, "TOTALINC": 3, "/////////////////": 1, "aTitulo": 10, "ACLONE": 1, "FINA040": 3, "//Inclusao": 2, "cValToChar": 1, "//StartJob": 1, "//fWrite": 1, "Reset": 3, "fClose": 1, "F280PCAN": 1, "cPrefCan": 4, "cFatCan": 5, "cTipoCan": 4, "JOBF280C": 1, "todas": 2, "e": 2, "dbselectarea": 2, "dbSetOrder": 2, "dbSeek": 2, "Alert": 2, "aFatura": 3, "//Exclus": 1, "end": 2, "/////////////////////////////////////////////": 1, "///////": 1, "Cancela": 1, "baixas": 1, "///": 1, "nSE5Recno": 2, "u_RetSQLOne": 1, "//Removemos": 1, "Flags": 1, "conseguirmos": 1, "cancelar": 1, "pelo": 1, "StoD": 1, "DbGoTo": 1, "E5_MOTBX": 1, "//E5_FATURA": 1, "//E5_FATPREF": 1 } }, "language_tokens": { "1C Enterprise": 907, "ABAP": 1614, "ABNF": 1150, "AGS Script": 2717, "AMPL": 377, "API Blueprint": 539, "APL": 562, "ASN.1": 119, "ATS": 5857, "Agda": 353, "Alloy": 1071, "Alpine Abuild": 145, "Ant Build System": 300, "ApacheConf": 1482, "Apex": 4408, "Apollo Guidance Computer": 2352, "AppleScript": 1840, "Arduino": 241, "AsciiDoc": 109, "AspectJ": 324, "Assembly": 10203, "AutoHotkey": 3, "Awk": 544, "BitBake": 43, "Blade": 88, "BlitzBasic": 2058, "BlitzMax": 40, "Bluespec": 1298, "Brainfuck": 2722, "Brightscript": 579, "C": 68222, "C#": 1304, "C++": 41219, "CLIPS": 3289, "CMake": 678, "COBOL": 90, "CSON": 272, "CSS": 43867, "CSV": 8, "CartoCSS": 11767, "Ceylon": 49, "Chapel": 9713, "Charity": 17, "Cirru": 244, "Clarion": 1233, "Clean": 1554, "Click": 950, "Clojure": 1951, "CoffeeScript": 3078, "ColdFusion": 131, "ColdFusion CFC": 611, "Common Lisp": 9652, "Component Pascal": 825, "Cool": 352, "Coq": 33097, "Creole": 134, "Crystal": 1506, "Csound": 498, "Csound Document": 515, "Csound Score": 14, "Cuda": 290, "Cycript": 251, "D": 1064, "DIGITAL Command Language": 4291, "DM": 169, "DNS Zone": 67, "DTrace": 968, "Dart": 74, "Diff": 16, "Dockerfile": 202, "Dogescript": 30, "E": 1076, "EBNF": 184, "ECL": 281, "ECLiPSe": 201, "EJS": 341, "EQ": 2604, "Eagle": 30063, "Eiffel": 334, "Elixir": 43, "Elm": 624, "Emacs Lisp": 3838, "EmberScript": 45, "Erlang": 7011, "F#": 3281, "FLUX": 1392, "FORTRAN": 203, "Filebench WML": 109, "Filterscript": 143, "Formatted": 5103, "Forth": 4308, "FreeMarker": 131, "Frege": 4373, "G-code": 142, "GAMS": 363, "GAP": 11117, "GAS": 241, "GCC Machine Description": 9310, "GDB": 974, "GDScript": 1958, "GLSL": 4395, "GN": 19716, "Game Maker Language": 9969, "Gnuplot": 1023, "Go": 4013, "Golo": 4006, "Gosu": 1008, "Grace": 1381, "Gradle": 80, "Grammatical Framework": 10133, "Graph Modeling Language": 21, "GraphQL": 256, "Graphviz (DOT)": 575, "Groff": 5862, "Groovy": 177, "Groovy Server Pages": 91, "HCL": 18, "HLSL": 945, "HTML": 1896, "HTML+Django": 96, "HTML+ECR": 11, "HTML+EEX": 89, "HTML+ERB": 213, "Hack": 3249, "Haml": 121, "Handlebars": 69, "Haskell": 915, "Hy": 155, "HyPhy": 24716, "IDL": 417, "IGOR Pro": 97, "INI": 156, "Idris": 148, "Inform 7": 457, "Inno Setup": 478, "Ioke": 2, "Isabelle": 136, "Isabelle ROOT": 1046, "J": 107, "JFlex": 1780, "JSON": 37197, "JSON5": 60, "JSONLD": 18, "JSONiq": 151, "JSX": 49, "Jade": 24, "Jasmin": 1137, "Java": 15181, "JavaScript": 78302, "Julia": 377, "Jupyter Notebook": 20, "KRL": 25, "KiCad": 20433, "Kit": 6, "Kotlin": 155, "LFE": 1711, "LOLCODE": 2783, "LSL": 396, "Lasso": 9849, "Latte": 759, "Lean": 749, "Less": 39, "Lex": 908, "Limbo": 341, "Linker Script": 950, "Linux Kernel Module": 159, "Liquid": 633, "Literate Agda": 455, "Literate CoffeeScript": 275, "LiveScript": 123, "Logos": 93, "Logtalk": 36, "LookML": 99, "LoomScript": 623, "Lua": 805, "M": 23615, "M4": 128, "M4Sugar": 1229, "MAXScript": 581, "MQL4": 2458, "MQL5": 17126, "MTML": 93, "MUF": 1246, "Makefile": 3112, "Markdown": 1, "Mask": 74, "Mathematica": 3659, "Matlab": 11915, "Maven POM": 504, "Max": 714, "MediaWiki": 1656, "Mercury": 31693, "Metal": 813, "Modelica": 12637, "Modula-2": 1338, "Module Management System": 8409, "Monkey": 207, "Moocode": 5234, "MoonScript": 2429, "NCL": 8516, "NL": 1748, "NSIS": 724, "Nemerle": 17, "NetLinx": 356, "NetLinx+ERB": 104, "NetLogo": 243, "NewLisp": 2411, "Nginx": 782, "Nimrod": 1, "Nit": 8703, "Nix": 198, "Nu": 116, "OCaml": 15264, "Objective-C": 28101, "Objective-C++": 6021, "Objective-J": 2475, "Omgrofl": 57, "Opa": 28, "Opal": 20, "OpenCL": 144, "OpenEdge ABL": 762, "OpenRC runscript": 35, "OpenSCAD": 67, "Org": 358, "Ox": 1006, "Oxygene": 157, "Oz": 116, "PAWN": 3778, "PHP": 22119, "PLSQL": 902, "PLpgSQL": 2752, "POV-Ray SDL": 7169, "Pan": 127, "Papyrus": 560, "Parrot Assembly": 6, "Parrot Internal Representation": 5, "Pascal": 4757, "Perl": 20591, "Perl6": 13943, "Pic": 152, "Pickle": 119, "PicoLisp": 589, "PigLatin": 30, "Pike": 1848, "Pod": 1140, "PogoScript": 250, "Pony": 2118, "PostScript": 107, "PowerBuilder": 6438, "PowerShell": 562, "Processing": 74, "Prolog": 7469, "Propeller Spin": 13501, "Protocol Buffer": 63, "Public Key": 403, "Puppet": 846, "PureBasic": 867, "PureScript": 1818, "Python": 10494, "QML": 304, "QMake": 119, "R": 1790, "RAML": 83, "RDoc": 279, "REXX": 1643, "RMarkdown": 19, "RPM Spec": 2855, "RUNOFF": 28475, "Racket": 331, "Ragel in Ruby Host": 593, "Rascal": 1348, "Rebol": 533, "Red": 813, "Ren'Py": 1497, "RenderScript": 1298, "RobotFramework": 483, "Ruby": 5321, "Rust": 12851, "SAS": 1777, "SCSS": 39, "SMT": 25205, "SPARQL": 253, "SQF": 196, "SQL": 1594, "SQLPL": 503, "SRecode Template": 174, "STON": 100, "Sage": 477, "SaltStack": 179, "Sass": 28, "Scala": 750, "Scaml": 4, "Scheme": 3848, "Scilab": 67, "Shell": 5827, "ShellSession": 233, "Shen": 3472, "Slash": 187, "Slim": 77, "Smali": 43075, "Smalltalk": 6241, "SourcePawn": 8301, "Squirrel": 130, "Stan": 368, "Standard ML": 6561, "Stata": 3133, "Stylus": 76, "SubRip Text": 508, "Sublime Text Config": 2586, "SuperCollider": 1987, "Swift": 1128, "SystemVerilog": 541, "TI Program": 3773, "TLA": 492, "TXL": 213, "Tcl": 1424, "TeX": 8890, "Tea": 3, "Terra": 1294, "Text": 13637, "Thrift": 6, "Turing": 3053, "Turtle": 569, "TypeScript": 172, "Unity3D Asset": 841, "Uno": 1267, "UnrealScript": 2873, "UrWeb": 576, "VCL": 545, "VHDL": 37, "Verilog": 3778, "VimL": 4284, "Visual Basic": 581, "Volt": 387, "Vue": 103, "Wavefront Material": 92, "Wavefront Object": 5217, "Web Ontology Language": 4619, "WebIDL": 146, "World of Warcraft Addon Data": 81, "X10": 6479, "XC": 24, "XML": 16718, "XPages": 120, "XProc": 22, "XQuery": 801, "XS": 1194, "XSLT": 44, "Xojo": 807, "Xtend": 399, "YAML": 374, "YANG": 176, "Zephir": 1026, "Zimpl": 123, "desktop": 70, "eC": 1080, "edn": 227, "fish": 636, "reStructuredText": 1466, "wisp": 1363, "xBase": 2556 }, "languages": { "1C Enterprise": 6, "ABAP": 1, "ABNF": 1, "AGS Script": 4, "AMPL": 2, "API Blueprint": 3, "APL": 3, "ASN.1": 1, "ATS": 9, "Agda": 1, "Alloy": 3, "Alpine Abuild": 1, "Ant Build System": 2, "ApacheConf": 4, "Apex": 6, "Apollo Guidance Computer": 1, "AppleScript": 7, "Arduino": 2, "AsciiDoc": 3, "AspectJ": 2, "Assembly": 6, "AutoHotkey": 1, "Awk": 1, "BitBake": 2, "Blade": 2, "BlitzBasic": 3, "BlitzMax": 1, "Bluespec": 2, "Brainfuck": 5, "Brightscript": 1, "C": 55, "C#": 6, "C++": 41, "CLIPS": 2, "CMake": 7, "COBOL": 4, "CSON": 4, "CSS": 2, "CSV": 1, "CartoCSS": 1, "Ceylon": 1, "Chapel": 5, "Charity": 1, "Cirru": 9, "Clarion": 4, "Clean": 9, "Click": 2, "Clojure": 9, "CoffeeScript": 10, "ColdFusion": 1, "ColdFusion CFC": 2, "Common Lisp": 9, "Component Pascal": 2, "Cool": 2, "Coq": 13, "Creole": 1, "Crystal": 3, "Csound": 3, "Csound Document": 3, "Csound Score": 3, "Cuda": 2, "Cycript": 1, "D": 1, "DIGITAL Command Language": 4, "DM": 1, "DNS Zone": 2, "DTrace": 3, "Dart": 1, "Diff": 1, "Dockerfile": 1, "Dogescript": 1, "E": 7, "EBNF": 4, "ECL": 1, "ECLiPSe": 1, "EJS": 2, "EQ": 3, "Eagle": 2, "Eiffel": 3, "Elixir": 1, "Elm": 3, "Emacs Lisp": 10, "EmberScript": 1, "Erlang": 13, "F#": 8, "FLUX": 4, "FORTRAN": 5, "Filebench WML": 1, "Filterscript": 2, "Formatted": 3, "Forth": 16, "FreeMarker": 2, "Frege": 4, "G-code": 2, "GAMS": 1, "GAP": 9, "GAS": 2, "GCC Machine Description": 1, "GDB": 2, "GDScript": 4, "GLSL": 10, "GN": 11, "Game Maker Language": 11, "Gnuplot": 6, "Go": 3, "Golo": 27, "Gosu": 5, "Grace": 2, "Gradle": 2, "Grammatical Framework": 41, "Graph Modeling Language": 1, "GraphQL": 2, "Graphviz (DOT)": 2, "Groff": 6, "Groovy": 6, "Groovy Server Pages": 4, "HCL": 2, "HLSL": 4, "HTML": 6, "HTML+Django": 1, "HTML+ECR": 1, "HTML+EEX": 1, "HTML+ERB": 2, "Hack": 28, "Haml": 2, "Handlebars": 2, "Haskell": 5, "Hy": 2, "HyPhy": 8, "IDL": 4, "IGOR Pro": 2, "INI": 3, "Idris": 1, "Inform 7": 2, "Inno Setup": 1, "Ioke": 1, "Isabelle": 1, "Isabelle ROOT": 1, "J": 2, "JFlex": 2, "JSON": 9, "JSON5": 3, "JSONLD": 1, "JSONiq": 2, "JSX": 1, "Jade": 2, "Jasmin": 8, "Java": 9, "JavaScript": 31, "Julia": 2, "Jupyter Notebook": 1, "KRL": 1, "KiCad": 4, "Kit": 1, "Kotlin": 1, "LFE": 4, "LOLCODE": 1, "LSL": 2, "Lasso": 4, "Latte": 2, "Lean": 2, "Less": 1, "Lex": 1, "Limbo": 3, "Linker Script": 3, "Linux Kernel Module": 3, "Liquid": 2, "Literate Agda": 1, "Literate CoffeeScript": 1, "LiveScript": 1, "Logos": 1, "Logtalk": 1, "LookML": 1, "LoomScript": 2, "Lua": 4, "M": 29, "M4": 1, "M4Sugar": 3, "MAXScript": 4, "MQL4": 3, "MQL5": 3, "MTML": 1, "MUF": 2, "Makefile": 11, "Markdown": 1, "Mask": 1, "Mathematica": 12, "Matlab": 39, "Maven POM": 1, "Max": 3, "MediaWiki": 2, "Mercury": 10, "Metal": 1, "Modelica": 12, "Modula-2": 1, "Module Management System": 5, "Monkey": 1, "Moocode": 3, "MoonScript": 1, "NCL": 16, "NL": 2, "NSIS": 2, "Nemerle": 1, "NetLinx": 2, "NetLinx+ERB": 2, "NetLogo": 1, "NewLisp": 3, "Nginx": 2, "Nimrod": 1, "Nit": 24, "Nix": 1, "Nu": 2, "OCaml": 10, "Objective-C": 22, "Objective-C++": 2, "Objective-J": 3, "Omgrofl": 1, "Opa": 2, "Opal": 1, "OpenCL": 2, "OpenEdge ABL": 5, "OpenRC runscript": 1, "OpenSCAD": 2, "Org": 1, "Ox": 3, "Oxygene": 1, "Oz": 1, "PAWN": 2, "PHP": 18, "PLSQL": 6, "PLpgSQL": 6, "POV-Ray SDL": 12, "Pan": 1, "Papyrus": 3, "Parrot Assembly": 1, "Parrot Internal Representation": 1, "Pascal": 10, "Perl": 20, "Perl6": 22, "Pic": 3, "Pickle": 4, "PicoLisp": 1, "PigLatin": 1, "Pike": 3, "Pod": 2, "PogoScript": 1, "Pony": 6, "PostScript": 1, "PowerBuilder": 6, "PowerShell": 3, "Processing": 1, "Prolog": 9, "Propeller Spin": 10, "Protocol Buffer": 1, "Public Key": 7, "Puppet": 5, "PureBasic": 2, "PureScript": 4, "Python": 22, "QML": 1, "QMake": 4, "R": 7, "RAML": 1, "RDoc": 1, "REXX": 4, "RMarkdown": 1, "RPM Spec": 3, "RUNOFF": 4, "Racket": 2, "Ragel in Ruby Host": 3, "Rascal": 4, "Rebol": 6, "Red": 2, "Ren'Py": 1, "RenderScript": 2, "RobotFramework": 3, "Ruby": 31, "Rust": 3, "SAS": 3, "SCSS": 1, "SMT": 4, "SPARQL": 2, "SQF": 2, "SQL": 11, "SQLPL": 6, "SRecode Template": 1, "STON": 7, "Sage": 1, "SaltStack": 6, "Sass": 1, "Scala": 4, "Scaml": 1, "Scheme": 3, "Scilab": 3, "Shell": 43, "ShellSession": 3, "Shen": 3, "Slash": 1, "Slim": 1, "Smali": 7, "Smalltalk": 10, "SourcePawn": 6, "Squirrel": 1, "Stan": 3, "Standard ML": 5, "Stata": 7, "Stylus": 1, "SubRip Text": 1, "Sublime Text Config": 12, "SuperCollider": 5, "Swift": 43, "SystemVerilog": 4, "TI Program": 4, "TLA": 2, "TXL": 1, "Tcl": 4, "TeX": 7, "Tea": 1, "Terra": 3, "Text": 23, "Thrift": 1, "Turing": 2, "Turtle": 2, "TypeScript": 3, "Unity3D Asset": 5, "Uno": 3, "UnrealScript": 2, "UrWeb": 2, "VCL": 2, "VHDL": 1, "Verilog": 13, "VimL": 5, "Visual Basic": 3, "Volt": 1, "Vue": 2, "Wavefront Material": 4, "Wavefront Object": 5, "Web Ontology Language": 1, "WebIDL": 2, "World of Warcraft Addon Data": 3, "X10": 18, "XC": 1, "XML": 41, "XPages": 2, "XProc": 1, "XQuery": 1, "XS": 1, "XSLT": 1, "Xojo": 6, "Xtend": 2, "YAML": 6, "YANG": 1, "Zephir": 2, "Zimpl": 1, "desktop": 1, "eC": 1, "edn": 1, "fish": 3, "reStructuredText": 1, "wisp": 1, "xBase": 3 }, "md5": "0d91f3255a64f5c5e8a5d721297ef8e1" }