# # bio/db/soft.rb - Interface for SOFT formatted files # # Author:: Trevor Wennblom # Copyright:: Copyright (c) 2007 Midwinter Laboratories, LLC (http://midwinterlabs.com) # License:: The Ruby License # # $Id:$ # module Bio # # bio/db/soft.rb - Interface for SOFT formatted files # # Author:: Trevor Wennblom # Copyright:: Copyright (c) 2007 Midwinter Laboratories, LLC (http://midwinterlabs.com) # License:: The Ruby License # # # = Description # # "SOFT (Simple Omnibus in Text Format) is a compact, simple, line-based, # ASCII text format that incorporates experimental data and metadata." # -- GEO, National Center for Biotechnology Information # # The Bio::SOFT module reads SOFT Series or Platform formatted files that # contain information # describing one database, one series, one platform, and many samples (GEO # accessions). The data from the file can then be viewed with Ruby methods. # # Bio::SOFT also supports the reading of SOFT DataSet files which contain # one database, one dataset, and many subsets. # # Format specification is located here: # * http://www.ncbi.nlm.nih.gov/projects/geo/info/soft2.html#SOFTformat # # SOFT data files may be directly downloaded here: # * ftp://ftp.ncbi.nih.gov/pub/geo/DATA/SOFT # # NCBI's Gene Expression Omnibus (GEO) is here: # * http://www.ncbi.nlm.nih.gov/geo # # = Usage # # If an attribute has more than one value then the values are stored in an # Array of String objects. Otherwise the attribute is stored as a String. # # The platform and each sample may contain a table of data. A dataset from a # DataSet file may also contain a table. # # Attributes are dynamically created based on the data in the file. # Predefined keys have not been created in advance due to the variability of # SOFT files in-the-wild. # # Keys are generally stored as Symbols. In the case of keys for samples and # table headings may alternatively be accessed with Strings. # The names of samples (geo accessions) are case sensitive. Table headers # are case insensitive. # # require 'bio' # # lines = IO.readlines('GSE3457_family.soft') # soft = Bio::SOFT.new(lines) # # soft.platform[:geo_accession] # => "GPL2092" # soft.platform[:organism] # => "Populus" # soft.platform[:contributor] # => ["Jingyi,,Li", "Olga,,Shevchenko", "Steve,H,Strauss", "Amy,M,Brunner"] # soft.platform[:data_row_count] # => "240" # soft.platform.keys.sort {|a,b| a.to_s <=> b.to_s}[0..2] # => [:contact_address, :contact_city, :contact_country] # soft.platform[:"contact_zip/postal_code"] # => "97331" # soft.platform[:table].header # => ["ID", "GB_ACC", "SPOT_ID", "Function/Family", "ORGANISM", "SEQUENCE"] # soft.platform[:table].header_description # => {"ORGANISM"=>"sequence sources", "SEQUENCE"=>"oligo sequence used", "Function/Family"=>"gene functions and family", "ID"=>"", "SPOT_ID"=>"", "GB_ACC"=>"Gene bank accession number"} # soft.platform[:table].rows.size # => 240 # soft.platform[:table].rows[5] # => ["A039P68U", "AI163321", "", "TF, flowering protein CONSTANS", "P. tremula x P. tremuloides", "AGAAAATTCGATATACTGTCCGTAAAGAGGTAGCACTTAGAATGCAACGGAATAAAGGGCAGTTCACCTC"] # soft.platform[:table].rows[5][4] # => "P. tremula x P. tremuloides" # soft.platform[:table].rows[5][:organism] # => "P. tremula x P. tremuloides" # soft.platform[:table].rows[5]['ORGANISM'] # => "P. tremula x P. tremuloides" # # soft.series[:geo_accession] # => "GSE3457" # soft.series[:contributor] # => ["Jingyi,,Li", "Olga,,Shevchenko", "Ove,,Nilsson", "Steve,H,Strauss", "Amy,M,Brunner"] # soft.series[:platform_id] # => "GPL2092" # soft.series[:sample_id].size # => 74 # soft.series[:sample_id][0..4] # => ["GSM77557", "GSM77558", "GSM77559", "GSM77560", "GSM77561"] # # soft.database[:name] # => "Gene Expression Omnibus (GEO)" # soft.database[:ref] # => "Nucleic Acids Res. 2005 Jan 1;33 Database Issue:D562-6" # soft.database[:institute] # => "NCBI NLM NIH" # # soft.samples.size # => 74 # soft.samples[:GSM77600][:series_id] # => "GSE3457" # soft.samples['GSM77600'][:series_id] # => "GSE3457" # soft.samples[:GSM77600][:platform_id] # => "GPL2092" # soft.samples[:GSM77600][:type] # => "RNA" # soft.samples[:GSM77600][:title] # => "jst2b2" # soft.samples[:GSM77600][:table].header # => ["ID_REF", "VALUE"] # soft.samples[:GSM77600][:table].header_description # => {"ID_REF"=>"", "VALUE"=>"normalized signal intensities"} # soft.samples[:GSM77600][:table].rows.size # => 217 # soft.samples[:GSM77600][:table].rows[5] # => ["A039P68U", "8.19"] # soft.samples[:GSM77600][:table].rows[5][0] # => "A039P68U" # soft.samples[:GSM77600][:table].rows[5][:id_ref] # => "A039P68U" # soft.samples[:GSM77600][:table].rows[5]['ID_REF'] # => "A039P68U" # # # lines = IO.readlines('GDS100.soft') # soft = Bio::SOFT.new(lines) # # soft.database[:name] # => "Gene Expression Omnibus (GEO)" # soft.database[:ref] # => "Nucleic Acids Res. 2005 Jan 1;33 Database Issue:D562-6" # soft.database[:institute] # => "NCBI NLM NIH" # # soft.subsets.size # => 8 # soft.subsets.keys # => ["GDS100_1", "GDS100_2", "GDS100_3", "GDS100_4", "GDS100_5", "GDS100_6", "GDS100_7", "GDS100_8"] # soft.subsets[:GDS100_7] # => {:dataset_id=>"GDS100", :type=>"time", :sample_id=>"GSM548,GSM543", :description=>"60 minute"} # soft.subsets['GDS100_7'][:sample_id] # => "GSM548,GSM543" # soft.subsets[:GDS100_7][:sample_id] # => "GSM548,GSM543" # soft.subsets[:GDS100_7][:dataset_id] # => "GDS100" # # soft.dataset[:order] # => "none" # soft.dataset[:sample_organism] # => "Escherichia coli" # soft.dataset[:table].header # => ["ID_REF", "IDENTIFIER", "GSM549", "GSM542", "GSM543", "GSM547", "GSM544", "GSM545", "GSM546", "GSM548"] # soft.dataset[:table].rows.size # => 5764 # soft.dataset[:table].rows[5] # => ["6", "EMPTY", "0.097", "0.217", "0.242", "0.067", "0.104", "0.162", "0.104", "0.154"] # soft.dataset[:table].rows[5][4] # => "0.242" # soft.dataset[:table].rows[5][:gsm549] # => "0.097" # soft.dataset[:table].rows[5][:GSM549] # => "0.097" # soft.dataset[:table].rows[5]['GSM549'] # => "0.097" # class SOFT attr_accessor :database attr_accessor :series, :platform, :samples attr_accessor :dataset, :subsets LINE_TYPE_ENTITY_INDICATOR = '^' LINE_TYPE_ENTITY_ATTRIBUTE = '!' LINE_TYPE_TABLE_HEADER = '#' # data table row defined by absence of line type character TABLE_COLUMN_DELIMITER = "\t" # Constructor # # --- # *Arguments* # * +lines+: (_required_) contents of SOFT formatted file # *Returns*:: Bio::SOFT def initialize(lines=nil) @database = Database.new @series = Series.new @platform = Platform.new @samples = Samples.new @dataset = Dataset.new @subsets = Subsets.new process(lines) end # Classes for Platform and Series files class Samples < Hash #:nodoc: def [](x) x = x.to_s if x.kind_of?( Symbol ) super(x) end end class Entity < Hash #:nodoc: end class Sample < Entity #:nodoc: end class Platform < Entity #:nodoc: end class Series < Entity #:nodoc: end # Classes for DataSet files class Subsets < Samples #:nodoc: end class Subset < Entity #:nodoc: end class Dataset < Entity #:nodoc: end # Classes important for all types class Database < Entity #:nodoc: end class Table #:nodoc: attr_accessor :header attr_accessor :header_description attr_accessor :rows class Header < Array #:nodoc: # @column_index contains column name => numerical index of column attr_accessor :column_index def initialize @column_index = {} end end class Row < Array #:nodoc: attr_accessor :header_object def initialize( n, header_object=nil ) @header_object = header_object super(n) end def [](x) if x.kind_of?( Fixnum ) super(x) else begin x = x.to_s.downcase.to_sym z = @header_object.column_index[x] unless z.kind_of?( Fixnum ) raise IndexError, "#{x.inspect} is not a valid index. Contents of @header_object.column_index: #{@header_object.column_index.inspect}" end self[ z ] rescue NoMethodError unless @header_object $stderr.puts "Table::Row @header_object undefined!" end raise end end end end def initialize() @header_description = {} @header = Header.new @rows = [] end def add_header( line ) raise "Can only define one header" unless @header.empty? @header = @header.concat( parse_row( line ) ) # beware of clobbering this into an Array @header.each_with_index do |key, i| @header.column_index[key.downcase.to_sym] = i end end def add_row( line ) @rows << Row.new( parse_row( line ), @header ) end def add_header_or_row( line ) @header.empty? ? add_header( line ) : add_row( line ) end protected def parse_row( line ) line.split( TABLE_COLUMN_DELIMITER ) end end ######### protected ######### def process(lines) current_indicator = nil current_class_accessor = nil in_table = false lines.each_with_index do |line, line_number| line.strip! next if line.nil? or line.empty? case line[0].chr when LINE_TYPE_ENTITY_INDICATOR current_indicator, value = split_label_value_in( line[1..-1] ) case current_indicator when 'DATABASE' current_class_accessor = @database when 'DATASET' current_class_accessor = @dataset when 'PLATFORM' current_class_accessor = @platform when 'SERIES' current_class_accessor = @series when 'SAMPLE' @samples[value] = Sample.new current_class_accessor = @samples[value] when 'SUBSET' @subsets[value] = Subset.new current_class_accessor = @subsets[value] else custom_raise( line_number, error_msg(40, line) ) end when LINE_TYPE_ENTITY_ATTRIBUTE if( current_indicator == nil ) custom_raise( line_number, error_msg(30) ) end # Handle lines such as '!platform_table_begin' and '!platform_table_end' if in_table if line =~ %r{table_begin} next elsif line =~ %r{table_end} in_table = false next end end key, value = split_label_value_in( line, true ) key_s = key.to_sym if current_class_accessor.include?( key_s ) if current_class_accessor[ key_s ].class != Array current_class_accessor[ key_s ] = [ current_class_accessor[ key_s ] ] end current_class_accessor[key.to_sym] << value else current_class_accessor[key.to_sym] = value end when LINE_TYPE_TABLE_HEADER if( (current_indicator != 'SAMPLE') and (current_indicator != 'PLATFORM') and (current_indicator != 'DATASET') ) custom_raise( line_number, error_msg(20, current_indicator.inspect) ) end in_table = true # may be redundant, computationally not worth checking # We only expect one table per platform or sample current_class_accessor[:table] ||= Table.new key, value = split_label_value_in( line ) # key[1..-1] -- Remove first character which is the LINE_TYPE_TABLE_HEADER current_class_accessor[:table].header_description[ key[1..-1] ] = value else # Type: No line type - should be a row in a table. if( (current_indicator == nil) or (in_table == false) ) custom_raise( line_number, error_msg(10) ) end current_class_accessor[:table].add_header_or_row( line ) end end end def error_msg( i, extra_info=nil ) case i when 10 x = ["Lines without line-type characters are rows in a table, but", "a line containing an entity indicator such as", "\"#{LINE_TYPE_ENTITY_INDICATOR}SAMPLE\",", "\"#{LINE_TYPE_ENTITY_INDICATOR}PLATFORM\",", "or \"#{LINE_TYPE_ENTITY_INDICATOR}DATASET\" has not been", "previously encountered or it does not appear that this line is", "in a table."] when 20 # tables are allowed inside samples and platforms x = ["Tables are only allowed inside SAMPLE and PLATFORM.", "Current table information found inside #{extra_info}."] when 30 x = ["Entity attribute line (\"#{LINE_TYPE_ENTITY_ATTRIBUTE}\")", "found before entity indicator line (\"#{LINE_TYPE_ENTITY_INDICATOR}\")"] when 40 x = ["Unkown entity indicator. Must be DATABASE, SAMPLE, PLATFORM,", "SERIES, DATASET, or SUBSET."] else raise IndexError, "Unknown error message requested." end x.join(" ") end def custom_raise( line_number_with_0_based_indexing, msg ) raise ["Error processing input line: #{line_number_with_0_based_indexing+1}", msg].join("\t") end def split_label_value_in( line, shift_key=false ) line =~ %r{\s*=\s*} key, value = $`, $' if shift_key key =~ %r{_} key = $' end if( (key == nil) or (value == nil) ) puts line.inspect raise end [key, value] end end # SOFT end # Bio