Sha256: 893f106ed741a06c4eb214b514f894de8043bf400e2ea71342d6c84c6ed8286d
Contents?: true
Size: 907 Bytes
Versions: 29
Compression:
Stored size: 907 Bytes
Contents
module Tests exposing (..)
import Test exposing (..)
import Expect
import NucleotideCount exposing (nucleotideCounts, version)
tests : Test
tests =
describe "NucleotideCount"
[ test "the solution is for the correct version of the test" <|
\() -> Expect.equal 2 version
, test "empty dna strand has no nucleotides" <|
\() ->
Expect.equal { a = 0, t = 0, c = 0, g = 0 }
(nucleotideCounts "")
, test "repetitive sequence has only guanine" <|
\() ->
Expect.equal { a = 0, t = 0, c = 0, g = 8 }
(nucleotideCounts "GGGGGGGG")
, test "counts all nucleotides" <|
\() ->
Expect.equal { a = 20, t = 21, c = 12, g = 17 }
(nucleotideCounts "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC")
]
Version data entries
29 entries across 29 versions & 1 rubygems