Sha256: 81e95f5740d958749b143740246ae099b02bdf28a64250742651316d90ec4010
Contents?: true
Size: 687 Bytes
Versions: 112
Compression:
Stored size: 687 Bytes
Contents
#!/usr/bin/env bats @test "empty strand" { #skip run ./nucleotide_count.sh "" [ "$status" -eq 0 ] [ "$output" = $'A: 0\nC: 0\nG: 0\nT: 0' ] } @test "strand with repeated nucleotide" { skip run ./nucleotide_count.sh "GGGGGGG" [ "$status" -eq 0 ] [ "$output" = $'A: 0\nC: 0\nG: 7\nT: 0' ] } @test "strand with multiple nucleotides" { skip run ./nucleotide_count.sh "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC" [ "$status" -eq 0 ] [ "$output" = $'A: 20\nC: 12\nG: 17\nT: 21' ] } @test "strand with invalid nucleotides" { skip run ./nucleotide_count.sh "AGXXACT" [ "$status" -eq 1 ] [ "$output" = "Invalid nucleotide in strand" ] }
Version data entries
112 entries across 112 versions & 1 rubygems