# # = test/unit/bio/sequence/test_na.rb - Unit test for Bio::Sequencce::NA # # Copyright:: Copyright (C) 2006 # Mitsuteru C. Nakao # License:: The Ruby License # # $Id:$ # # loading helper routine for testing bioruby require 'pathname' load Pathname.new(File.join(File.dirname(__FILE__), ['..'] * 3, 'bioruby_test_helper.rb')).cleanpath.to_s # libraries needed for the tests require 'test/unit' require 'bio/sequence' require 'bio/sequence/na' module Bio class TestSequenceNANew < Test::Unit::TestCase def test_new str = 'atgcatgcatgcatgcaaaa' assert(Bio::Sequence::NA.new(str)) end def test_new_t str = "atgcatgcatgcatgcaaaa" str_t = "atgcatgcat\tgca\ttgcaaaa" assert_equal(str, Bio::Sequence::NA.new(str_t)) end def test_new_n str = "atgcatgcatgcatgcaaaa" str_n = "atgcatgcat\ngca\ntgcaaaa" assert_equal(str, Bio::Sequence::NA.new(str_n)) end def test_new_r str = "atgcatgcatgcatgcaaaa" str_r = "atgcatgcat\n\rgca\n\rtgcaaaa" assert_equal(str, Bio::Sequence::NA.new(str_r)) end end class TestSequenceNA < Test::Unit::TestCase def setup @obj = Bio::Sequence::NA.new('atgcatgcatgcatgcaaaa') end def test_splicing # 'atgcatgcatgcatgcaaaa' # 12345678901234567890 str = 'atgca catgcatg'.gsub(' ','') assert_equal(str, @obj.splicing("join(1..5,8..15)")) end def test_forward_complement str = 'atgcatgcatgcatgcaaaa' str_fcomp = 'tacgtacgtacgtacgtttt' fcomp = @obj.forward_complement assert_equal(str_fcomp, @obj.forward_complement) assert_equal(str, @obj) assert_equal(str_fcomp, @obj.forward_complement!) assert_equal(str_fcomp, @obj) end def test_reverse_complement str = 'atgcatgcatgcatgcaaaa' str_rcomp = 'tacgtacgtacgtacgtttt'.reverse rcomp = @obj.forward_complement assert_equal(str_rcomp, @obj.reverse_complement) assert_equal(str, @obj) assert_equal(str_rcomp, @obj.reverse_complement!) assert_equal(str_rcomp, @obj) end def test_complement assert(@obj.complement) assert(@obj.complement!) end def test_to_s str = 'atgcatgcatgcatgcaaaa' assert_equal(str, @obj.to_s) end def test_codon_usage usage = {"cat"=>1, "caa"=>1, "tgc"=>1, "gca"=>1, "atg"=>2} assert_equal(usage, @obj.codon_usage) end def test_gc_percent assert_equal(40, @obj.gc_percent) @obj[0, 1] = 'g' assert_equal(45, @obj.gc_percent) end def test_gc_content assert_in_delta(0.4, @obj.gc_content, Float::EPSILON) @obj[0, 1] = 'g' assert_in_delta(0.45, @obj.gc_content, Float::EPSILON) end def test_at_content assert_in_delta(0.6, @obj.at_content, Float::EPSILON) @obj[0, 1] = 'g' assert_in_delta(0.55, @obj.at_content, Float::EPSILON) end def test_gc_skew assert_in_delta(0.0, @obj.gc_skew, Float::EPSILON) @obj[0, 1] = 'g' assert_in_delta(1.0/9.0, @obj.gc_skew, Float::EPSILON) @obj.gsub!(/a/, 'c') assert_in_delta(-3.0/8.0, @obj.gc_skew, Float::EPSILON) end def test_at_skew assert_in_delta(1.0/3.0, @obj.at_skew, Float::EPSILON) @obj[0, 1] = 'g' assert_in_delta(3.0/11.0, @obj.at_skew, Float::EPSILON) end def test_iliegal_bases @obj[0, 1] = 'n' @obj[1, 1] = 'y' assert_equal(['n', 'y'], @obj.illegal_bases) end def test_molecular_weight assert_in_delta(6174.3974, @obj.molecular_weight, 1e-4) end def test_to_re assert_equal(/atgcatgcatgcatgcaaaa/, @obj.to_re) @obj[1,1] = 'n' @obj[2,1] = 'r' @obj[3,1] = 's' @obj[4,1] = 'y' @obj[5,1] = 'w' assert_equal(/a[atgcyrwskmbdhvn][agr][gcs][tcy][atw]gcatgcatgcaaaa/, @obj.to_re) end def test_names ary = ["Adenine", "Thymine", "Guanine"] assert_equal(ary , @obj.splice("1..3").names) end def test_dna @obj[0,1] = 'u' assert_equal('utgcatgcatgcatgcaaaa', @obj) assert_equal('ttgcatgcatgcatgcaaaa', @obj.dna) end def test_dna! @obj[0,1] = 'u' assert_equal('utgcatgcatgcatgcaaaa', @obj) @obj.dna! assert_equal('ttgcatgcatgcatgcaaaa', @obj) end def test_rna assert_equal('atgcatgcatgcatgcaaaa', @obj) assert_equal('augcaugcaugcaugcaaaa', @obj.rna) end def test_rna! assert_equal('atgcatgcatgcatgcaaaa', @obj) @obj.rna! assert_equal('augcaugcaugcaugcaaaa', @obj) end end class TestSequenceNACommon < Test::Unit::TestCase def setup @obj = Bio::Sequence::NA.new('atgcatgcatgcatgcaaaa') end def test_to_s assert_equal('atgcatgcatgcatgcaaaa', @obj.to_s) end def test_to_str assert_equal('atgcatgcatgcatgcaaaa', @obj.to_str) end def test_seq str = "atgcatgcatgcatgcaaaa" assert_equal(str, @obj.seq) end # <<(*arg) def test_push str = "atgcatgcatgcatgcaaaaa" assert_equal(str, @obj << "A") end # concat(*arg) def test_concat str = "atgcatgcatgcatgcaaaaa" assert_equal(str, @obj.concat("A")) end # +(*arg) def test_sum str = "atgcatgcatgcatgcaaaaatgcatgcatgcatgcaaaa" assert_equal(str, @obj + @obj) end # window_search(window_size, step_size = 1) def test_window_search @obj.window_search(4) do |subseq| assert_equal(20, @obj.size) end end #total(hash) def test_total hash = {'a' => 1, 'c' => 2, 'g' => 4, 't' => 3} assert_equal(44.0, @obj.total(hash)) end def test_composition composition = {"a"=>8, "c"=>4, "g"=>4, "t"=>4} assert_equal(composition, @obj.composition) end def test_splicing #(position) assert_equal("atgcatgc", @obj.splicing("join(1..4, 13..16)")) end end class TestSequenceNATranslation < Test::Unit::TestCase def setup str = "aaacccgggttttaa" # K>>P>>G>>F>>*>> # N>>P>>G>>F>> # T>>R>>V>>L>> # P>>G>>F>>*>> # "tttgggcccaaaatt" # <