Sha256: 7fb6ceebc55eb274cc733de5b9cce8b6359eee232bf977a814c18ccab2b81f23
Contents?: true
Size: 827 Bytes
Versions: 74
Compression:
Stored size: 827 Bytes
Contents
import org.scalatest.{Matchers, FunSuite} /** @version 1.0.0 */ class NucleotideCountTest extends FunSuite with Matchers { test("empty strand") { new DNA("").nucleotideCounts should be (Right(Map('A' -> 0, 'C' -> 0, 'G' -> 0, 'T' -> 0))) } test("strand with repeated nucleotide") { pending new DNA("GGGGGGG").nucleotideCounts should be (Right(Map('A' -> 0, 'C' -> 0, 'G' -> 7, 'T' -> 0))) } test("strand with multiple nucleotides") { pending new DNA("AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC").nucleotideCounts should be (Right(Map('A' -> 20, 'C' -> 12, 'G' -> 17, 'T' -> 21))) } test("strand with invalid nucleotides") { pending new DNA("AGXXACT").nucleotideCounts.isLeft should be (true) } }
Version data entries
74 entries across 74 versions & 1 rubygems