Sha256: 7f6b7ea459fee79bff1f7ecad78f1d68823323abf2ea1b0c0787ae02c06f1b3e
Contents?: true
Size: 821 Bytes
Versions: 71
Compression:
Stored size: 821 Bytes
Contents
import NucleotideCounts from './nucleotide-count'; describe('count all nucleotides in a strand', () => { test('empty strand', () => { expect(NucleotideCounts.parse('')).toEqual('0 0 0 0'); }); xtest('can count one nucleotide in single-character input', () => { expect(NucleotideCounts.parse('G')).toEqual('0 0 1 0'); }); xtest('strand with repeated nucleotide', () => { expect(NucleotideCounts.parse('GGGGGGG')).toEqual('0 0 7 0'); }); xtest('strand with multiple nucleotides', () => { expect(NucleotideCounts.parse('AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC')).toEqual('20 12 17 21'); }); xtest('strand with invalid nucleotides', () => { expect(() => NucleotideCounts.parse('AGXXACT')).toThrow(new Error('Invalid nucleotide in strand')); }); });
Version data entries
71 entries across 71 versions & 1 rubygems