Feature: Producing a annotation view of a scaffold In order to submit genome annotations A user can use the "table" command to generate the genbank annotation table format @disable-bundler Scenario: Generating a table file from a single annotation Given I successfully run `genomer init project` And I cd to "project" And I write to "assembly/scaffold.yml" with: """ --- - sequence: source: contig1 """ And I write to "assembly/sequence.fna" with: """ >contig1 AAAAATTTTTGGGGGCCCCC """ And I write to "assembly/annotations.gff" with: """ ##gff-version 3 contig1 . gene 1 3 . + 1 . """ And I append to "Gemfile" with: """ gem 'genomer-plugin-view', :path => '../../../' """ When I run `genomer view table --identifier=genome` Then the exit status should be 0 And the output should contain: """ >Feature genome annotation_table 1 3 gene """ @disable-bundler Scenario: Generating a table file from two annotations Given I successfully run `genomer init project` And I cd to "project" And I write to "assembly/scaffold.yml" with: """ --- - sequence: source: contig1 """ And I write to "assembly/sequence.fna" with: """ >contig1 AAAAATTTTTGGGGGCCCCC """ And I write to "assembly/annotations.gff" with: """ ##gff-version 3 contig1 . gene 1 3 . + 1 contig1 . gene 4 6 . + 1 """ And I append to "Gemfile" with: """ gem 'genomer-plugin-view', :path => '../../../' """ When I run `genomer view table --identifier=genome` Then the exit status should be 0 And the output should contain: """ >Feature genome annotation_table 1 3 gene 4 6 gene """ @disable-bundler Scenario: Generating a table file from a gene with ID attribute Given I successfully run `genomer init project` And I cd to "project" And I write to "assembly/scaffold.yml" with: """ --- - sequence: source: contig1 """ And I write to "assembly/sequence.fna" with: """ >contig1 AAAAATTTTTGGGGGCCCCC """ And I write to "assembly/annotations.gff" with: """ ##gff-version 3 contig1 . gene 1 3 . - 1 ID=gene1 """ And I append to "Gemfile" with: """ gem 'genomer-plugin-view', :path => '../../../' """ When I run `genomer view table --identifier=genome` Then the exit status should be 0 And the output should contain: """ >Feature genome annotation_table 3 1 gene locus_tag gene1 """ @disable-bundler Scenario: Generating a table file from a gene with ID and name attributes Given I successfully run `genomer init project` And I cd to "project" And I write to "assembly/scaffold.yml" with: """ --- - sequence: source: contig1 """ And I write to "assembly/sequence.fna" with: """ >contig1 AAAAATTTTTGGGGGCCCCC """ And I write to "assembly/annotations.gff" with: """ ##gff-version 3 contig1 . gene 1 3 . - 1 ID=gene1;Name=abcd """ And I append to "Gemfile" with: """ gem 'genomer-plugin-view', :path => '../../../' """ When I run `genomer view table --identifier=genome` Then the exit status should be 0 And the output should contain: """ >Feature genome annotation_table 3 1 gene locus_tag gene1 gene abcd """ @disable-bundler Scenario: Reseting locus tag numbering at the scaffold origin Given I successfully run `genomer init project` And I cd to "project" And I write to "assembly/scaffold.yml" with: """ --- - sequence: source: contig1 """ And I write to "assembly/sequence.fna" with: """ >contig1 AAAAATTTTTGGGGGCCCCC """ And I write to "assembly/annotations.gff" with: """ ##gff-version 3 contig1 . gene 1 3 . + 1 ID=gene1 contig1 . gene 4 6 . + 1 ID=gene2 """ And I append to "Gemfile" with: """ gem 'genomer-plugin-view', :path => '../../../' """ When I run `genomer view table --identifier=genome --reset_locus_numbering` Then the exit status should be 0 And the output should contain: """ >Feature genome annotation_table 1 3 gene locus_tag 000001 4 6 gene locus_tag 000002 """ @disable-bundler Scenario: Reseting locus tag numbering at specified start value Given I successfully run `genomer init project` And I cd to "project" And I write to "assembly/scaffold.yml" with: """ --- - sequence: source: contig1 """ And I write to "assembly/sequence.fna" with: """ >contig1 AAAAATTTTTGGGGGCCCCC """ And I write to "assembly/annotations.gff" with: """ ##gff-version 3 contig1 . gene 1 3 . + 1 ID=gene1 contig1 . gene 4 6 . + 1 ID=gene2 """ And I append to "Gemfile" with: """ gem 'genomer-plugin-view', :path => '../../../' """ When I run `genomer view table --identifier=genome --reset_locus_numbering=5` Then the exit status should be 0 And the output should contain: """ >Feature genome annotation_table 1 3 gene locus_tag 000005 4 6 gene locus_tag 000006 """ @disable-bundler Scenario: Reseting locus tag at the scaffold origin with unordered annotations Given I successfully run `genomer init project` And I cd to "project" And I write to "assembly/scaffold.yml" with: """ --- - sequence: source: contig1 """ And I write to "assembly/sequence.fna" with: """ >contig1 AAAAATTTTTGGGGGCCCCC """ And I write to "assembly/annotations.gff" with: """ ##gff-version 3 contig1 . gene 10 12 . + 1 ID=gene4 contig1 . gene 4 6 . + 1 ID=gene2 contig1 . gene 1 3 . + 1 ID=gene1 contig1 . gene 7 9 . + 1 ID=gene3 """ And I append to "Gemfile" with: """ gem 'genomer-plugin-view', :path => '../../../' """ When I run `genomer view table --identifier=genome --reset_locus_numbering` Then the exit status should be 0 And the output should contain: """ >Feature genome annotation_table 1 3 gene locus_tag 000001 4 6 gene locus_tag 000002 7 9 gene locus_tag 000003 10 12 gene locus_tag 000004 """ @disable-bundler Scenario: Adding a prefix to annotation locus tags Given I successfully run `genomer init project` And I cd to "project" And I write to "assembly/scaffold.yml" with: """ --- - sequence: source: contig1 """ And I write to "assembly/sequence.fna" with: """ >contig1 AAAAATTTTTGGGGGCCCCC """ And I write to "assembly/annotations.gff" with: """ ##gff-version 3 contig1 . gene 10 12 . + 1 ID=gene4 contig1 . gene 4 6 . + 1 ID=gene2 contig1 . gene 1 3 . + 1 ID=gene1 contig1 . gene 7 9 . + 1 ID=gene3 """ And I append to "Gemfile" with: """ gem 'genomer-plugin-view', :path => '../../../' """ When I run `genomer view table --identifier=genome --prefix=pre_` Then the exit status should be 0 And the output should contain: """ >Feature genome annotation_table 1 3 gene locus_tag pre_gene1 4 6 gene locus_tag pre_gene2 7 9 gene locus_tag pre_gene3 10 12 gene locus_tag pre_gene4 """