.\" generated with Ronn/v0.7.3
.\" http://github.com/rtomayko/ronn/tree/0.7.3
.
.TH "MAF_TILE" "1" "June 2012" "Clayton Wheeler" "BioRuby Manual"
.
.SH "NAME"
\fBmaf_tile\fR \- synthesize an alignment for a given region
.
.SH "SYNOPSIS"
\fBmaf_tile\fR [\fIoptions\fR] \-i BEGIN:END [\-s SPECIES[:NAME] \.\.\.] \fImaf\fR \fIindex\fR
.
.P
\fBmaf_tile\fR [\fIoptions\fR] \-\-bed BED \-o BASE [\-s SPECIES[:NAME] \.\.\.] \fImaf\fR \fIindex\fR
.
.SH "DESCRIPTION"
\fBmaf_tile\fR takes a MAF file with index (generated by maf_index(1)), extracts alignment blocks overlapping the given genomic interval, and constructs a single alignment block covering the entire interval for the specified species\. Optionally, any gaps in coverage of the MAF file\'s reference sequence can be filled in from a FASTA sequence file\.
.
.P
If a single interval is specified, the output will be written to stdout in FASTA format\. If the \fB\-\-output\-base\fR option is specified, \fB_<start>:<end>\.fa\fR will be appended to the given  parameter and used to construct the output path\. If a BED file is specified with \fB\-\-bed\fR, \fB\-\-output\-base\fR is also required\.
.
.P
Species can be renamed for output by specifying them as SPECIES:NAME; the first component will be used to select the species from the MAF file, and the second will be used in the FASTA description line for output\.
.
.SH "OPTIONS"
.
.TP
\fB\-r\fR, \fB\-\-reference SEQ\fR
The FASTA reference sequence file given, which may be gzipped, will be used to fill in any gaps between alignment blocks\.
.
.TP
\fB\-i\fR, \fB\-\-interval BEGIN:END\fR
The given zero\-based genomic interval will be used to select alignment blocks from the MAF file\.
.
.TP
\fB\-s\fR, \fB\-\-species SPECIES[:NAME]\fR
The given species will be selected for output\. If given as \fBspecies:name\fR, it will appear in the FASTA output as \fIname\fR\.
.
.TP
\fB\-b\fR, \fB\-\-bed BED\fR
The given BED file will be used to provide a list of intervals to process\. If present, \fB\-\-interval\fR will be ignored and \fB\-\-output\-base\fR must be given as well\.
.
.TP
\fB\-o\fR, \fB\-\-output\-base BASE\fR
The given path will be used as the base name for output files, as described above\.
.
.SH "EXAMPLES"
Generate an alignment of the \fBhg19\fR, \fBpetMar1\fR, and \fBornAna1\fR sequences from \fBchrY\.maf\fR over the interval 14400 to 15000 on the reference sequence of the MAF file\. Fills in gaps from \fBchrY\.refseq\.fa\.gz\fR\. Writes FASTA output to stdout\.
.
.IP "" 4
.
.nf

$ maf_tile \-\-reference ~/maf/chrY\.refseq\.fa\.gz \e
  \-\-interval 14400:15000 \e
  \-s hg19:human \-s petMar1 \-s ornAna1 \e
  chrY\.maf chrY\.kct
>human
GGGTGACGAAAAGAGCCGA\-\-\-\-\-[\.\.\.]
>petMar1
gagtgccggggagtgccggggagt[\.\.\.]
>ornAna1
AGGGATCTGGGAATTCTGG\-\-\-\-\-[\.\.\.]
.
.fi
.
.IP "" 0
.
.P
Write out a FASTA file for each interval in the given BED file, prefixed with \fB/tmp/mm8\fR, and without filling in data from a reference sequence:
.
.IP "" 4
.
.nf

$ maf_tile \-\-bed /tmp/mm8\.bed \-\-output\-base /tmp/mm8 \e
  \-s mm8:mouse \-s rn4:rat \-s hg18:human \e
  mm8_chr7_tiny\.maf mm8_chr7_tiny\.kct
.
.fi
.
.IP "" 0
.
.SH "FILES"
The output is generated in FASTA format, with one sequence per species\.
.
.P
The input \fImaf\fR file must be a Multiple Alignment Format file\.
.
.P
The \fIindex\fR must be a MAF index built with maf_index(1)\.
.
.P
If \fB\-\-bed\fR \fIbed\fR is specified, its argument must be a BED file\. Only the second and third columns will be used, to specify the zero\-based start and end positions of intervals\.
.
.SH "ENVIRONMENT"
\fBmaf_tile\fR is a Ruby program and relies on ordinary Ruby environment variables\.
.
.SH "COPYRIGHT"
\fBmaf_tile\fR is copyright (C) 2012 Clayton Wheeler\.
.
.SH "SEE ALSO"
maf_index(1), ruby(1)
.
.IP "\(bu" 4
\fIhttps://github\.com/csw/bioruby\-maf/\fR
.
.IP "" 0