Sha256: 72bd0fa5e17febccdaccabadb0399d88bbad2be3d03162129ef6255879e80ae6
Contents?: true
Size: 655 Bytes
Versions: 42
Compression:
Stored size: 655 Bytes
Contents
#!/usr/bin/env bats @test "empty strand" { run ./nucleotide_count.sh "" [ "$status" -eq 0 ] [ "$output" = $'A: 0\nC: 0\nG: 0\nT: 0' ] } @test "strand with repeated nucleotide" { run ./nucleotide_count.sh "GGGGGGG" [ "$status" -eq 0 ] [ "$output" = $'A: 0\nC: 0\nG: 7\nT: 0' ] } @test "strand with multiple nucleotides" { run ./nucleotide_count.sh "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC" [ "$status" -eq 0 ] [ "$output" = $'A: 20\nC: 12\nG: 17\nT: 21' ] } @test "strand with invalid nucleotides" { run ./nucleotide_count.sh "AGXXACT" [ "$status" -eq 1 ] [ "$output" = "Invalid nucleotide in strand" ] }
Version data entries
42 entries across 42 versions & 1 rubygems