# # = bio/sequence/na.rb - nucleic acid sequence class # # Copyright:: Copyright (C) 2006 # Toshiaki Katayama , # Ryan Raaum # License:: The Ruby License # # $Id: na.rb,v 1.7 2007/04/23 16:43:51 trevor Exp $ # require 'bio/sequence/common' module Bio autoload :NucleicAcid, 'bio/data/na' autoload :CodonTable, 'bio/data/codontable' class Sequence # = DESCRIPTION # Bio::Sequence::NA represents a bare Nucleic Acid sequence in bioruby. # # = USAGE # # Create a Nucleic Acid sequence. # dna = Bio::Sequence.auto('atgcatgcATGCATGCAAAA') # rna = Bio::Sequence.auto('augcaugcaugcaugcaaaa') # # # What are the names of all the bases? # puts dna.names # puts rna.names # # # What is the GC percentage? # puts dna.gc_percent # puts rna.gc_percent # # # What is the molecular weight? # puts dna.molecular_weight # puts rna.molecular_weight # # # What is the reverse complement? # puts dna.reverse_complement # puts dna.complement # # # Is this sequence DNA or RNA? # puts dna.rna? # # # Translate my sequence (see method docs for many options) # puts dna.translate # puts rna.translate class NA < String include Bio::Sequence::Common # Generate an nucleic acid sequence object from a string. # # s = Bio::Sequence::NA.new("aagcttggaccgttgaagt") # # or maybe (if you have an nucleic acid sequence in a file) # # s = Bio::Sequence:NA.new(File.open('dna.txt').read) # # Nucleic Acid sequences are *always* all lowercase in bioruby # # s = Bio::Sequence::NA.new("AAGcTtGG") # puts s #=> "aagcttgg" # # Whitespace is stripped from the sequence # # seq = Bio::Sequence::NA.new("atg\nggg\ttt\r gc") # puts s #=> "atggggttgc" # --- # *Arguments*: # * (required) _str_: String # *Returns*:: Bio::Sequence::NA object def initialize(str) super self.downcase! self.tr!(" \t\n\r",'') end # Alias of Bio::Sequence::Common splice method, documented there. def splicing(position) #:nodoc: mRNA = super if mRNA.rna? mRNA.tr!('t', 'u') else mRNA.tr!('u', 't') end mRNA end # Returns a new complementary sequence object (without reversing). # The original sequence object is not modified. # # s = Bio::Sequence::NA.new('atgc') # puts s.forward_complement #=> 'tacg' # puts s #=> 'atgc' # --- # *Returns*:: new Bio::Sequence::NA object def forward_complement s = self.class.new(self) s.forward_complement! s end # Converts the current sequence into its complement (without reversing). # The original sequence object is modified. # # seq = Bio::Sequence::NA.new('atgc') # puts s.forward_complement! #=> 'tacg' # puts s #=> 'tacg' # --- # *Returns*:: current Bio::Sequence::NA object (modified) def forward_complement! if self.rna? self.tr!('augcrymkdhvbswn', 'uacgyrkmhdbvswn') else self.tr!('atgcrymkdhvbswn', 'tacgyrkmhdbvswn') end self end # Returns a new sequence object with the reverse complement # sequence to the original. The original sequence is not modified. # # s = Bio::Sequence::NA.new('atgc') # puts s.reverse_complement #=> 'gcat' # puts s #=> 'atgc' # --- # *Returns*:: new Bio::Sequence::NA object def reverse_complement s = self.class.new(self) s.reverse_complement! s end # Converts the original sequence into its reverse complement. # The original sequence is modified. # # s = Bio::Sequence::NA.new('atgc') # puts s.reverse_complement #=> 'gcat' # puts s #=> 'gcat' # --- # *Returns*:: current Bio::Sequence::NA object (modified) def reverse_complement! self.reverse! self.forward_complement! end # Alias for Bio::Sequence::NA#reverse_complement alias complement reverse_complement # Alias for Bio::Sequence::NA#reverse_complement! alias complement! reverse_complement! # Translate into an amino acid sequence. # # s = Bio::Sequence::NA.new('atggcgtga') # puts s.translate #=> "MA*" # # By default, translate starts in reading frame position 1, but you # can start in either 2 or 3 as well, # # puts s.translate(2) #=> "WR" # puts s.translate(3) #=> "GV" # # You may also translate the reverse complement in one step by using frame # values of -1, -2, and -3 (or 4, 5, and 6) # # puts s.translate(-1) #=> "SRH" # puts s.translate(4) #=> "SRH" # puts s.reverse_complement.translate(1) #=> "SRH" # # The default codon table in the translate function is the Standard # Eukaryotic codon table. The translate function takes either a # number or a Bio::CodonTable object for its table argument. # The available tables are # (NCBI[http://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi?mode=t]): # # 1. "Standard (Eukaryote)" # 2. "Vertebrate Mitochondrial" # 3. "Yeast Mitochondorial" # 4. "Mold, Protozoan, Coelenterate Mitochondrial and Mycoplasma/Spiroplasma" # 5. "Invertebrate Mitochondrial" # 6. "Ciliate Macronuclear and Dasycladacean" # 9. "Echinoderm Mitochondrial" # 10. "Euplotid Nuclear" # 11. "Bacteria" # 12. "Alternative Yeast Nuclear" # 13. "Ascidian Mitochondrial" # 14. "Flatworm Mitochondrial" # 15. "Blepharisma Macronuclear" # 16. "Chlorophycean Mitochondrial" # 21. "Trematode Mitochondrial" # 22. "Scenedesmus obliquus mitochondrial" # 23. "Thraustochytrium Mitochondrial" # # If you are using anything other than the default table, you must specify # frame in the translate method call, # # puts s.translate #=> "MA*" (using defaults) # puts s.translate(1,1) #=> "MA*" (same as above, but explicit) # puts s.translate(1,2) #=> "MAW" (different codon table) # # and using a Bio::CodonTable instance in the translate method call, # # mt_table = Bio::CodonTable[2] # puts s.translate(1, mt_table) #=> "MAW" # # By default, any invalid or unknown codons (as could happen if the # sequence contains ambiguities) will be represented by 'X' in the # translated sequence. # You may change this to any character of your choice. # # s = Bio::Sequence::NA.new('atgcNNtga') # puts s.translate #=> "MX*" # puts s.translate(1,1,'9') #=> "M9*" # # The translate method considers gaps to be unknown characters and treats # them as such (i.e. does not collapse sequences prior to translation), so # # s = Bio::Sequence::NA.new('atgc--tga') # puts s.translate #=> "MX*" # --- # *Arguments*: # * (optional) _frame_: one of 1,2,3,4,5,6,-1,-2,-3 (default 1) # * (optional) _table_: Fixnum in range 1,23 or Bio::CodonTable object # (default 1) # * (optional) _unknown_: Character (default 'X') # *Returns*:: Bio::Sequence::AA object def translate(frame = 1, table = 1, unknown = 'X') if table.is_a?(Bio::CodonTable) ct = table else ct = Bio::CodonTable[table] end naseq = self.dna case frame when 1, 2, 3 from = frame - 1 when 4, 5, 6 from = frame - 4 naseq.complement! when -1, -2, -3 from = -1 - frame naseq.complement! else from = 0 end nalen = naseq.length - from nalen -= nalen % 3 aaseq = naseq[from, nalen].gsub(/.{3}/) {|codon| ct[codon] or unknown} return Bio::Sequence::AA.new(aaseq) end # Returns counts of each codon in the sequence in a hash. # # s = Bio::Sequence::NA.new('atggcgtga') # puts s.codon_usage #=> {"gcg"=>1, "tga"=>1, "atg"=>1} # # This method does not validate codons! Any three letter group is a 'codon'. So, # # s = Bio::Sequence::NA.new('atggNNtga') # puts s.codon_usage #=> {"tga"=>1, "gnn"=>1, "atg"=>1} # # seq = Bio::Sequence::NA.new('atgg--tga') # puts s.codon_usage #=> {"tga"=>1, "g--"=>1, "atg"=>1} # # Also, there is no option to work in any frame other than the first. # --- # *Returns*:: Hash object def codon_usage hash = Hash.new(0) self.window_search(3, 3) do |codon| hash[codon] += 1 end return hash end # Calculate the ratio of GC / ATGC bases as a percentage rounded to # the nearest whole number. U is regarded as T. # # s = Bio::Sequence::NA.new('atggcgtga') # puts s.gc_percent #=> 55 # --- # *Returns*:: Fixnum def gc_percent count = self.composition at = count['a'] + count['t'] + count['u'] gc = count['g'] + count['c'] return 0 if at + gc == 0 gc = 100 * gc / (at + gc) return gc end # Calculate the ratio of GC / ATGC bases. U is regarded as T. # # s = Bio::Sequence::NA.new('atggcgtga') # puts s.gc_content #=> 0.555555555555556 # --- # *Returns*:: Float def gc_content count = self.composition at = count['a'] + count['t'] + count['u'] gc = count['g'] + count['c'] return 0.0 if at + gc == 0 return gc.quo(at + gc) end # Calculate the ratio of AT / ATGC bases. U is regarded as T. # # s = Bio::Sequence::NA.new('atggcgtga') # puts s.at_content #=> 0.444444444444444 # --- # *Returns*:: Float def at_content count = self.composition at = count['a'] + count['t'] + count['u'] gc = count['g'] + count['c'] return 0.0 if at + gc == 0 return at.quo(at + gc) end # Calculate the ratio of (G - C) / (G + C) bases. # # s = Bio::Sequence::NA.new('atggcgtga') # puts s.gc_skew #=> 0.6 # --- # *Returns*:: Float def gc_skew count = self.composition g = count['g'] c = count['c'] return 0.0 if g + c == 0 return (g - c).quo(g + c) end # Calculate the ratio of (A - T) / (A + T) bases. U is regarded as T. # # s = Bio::Sequence::NA.new('atgttgttgttc') # puts s.at_skew #=> -0.75 # --- # *Returns*:: Float def at_skew count = self.composition a = count['a'] t = count['t'] + count['u'] return 0.0 if a + t == 0 return (a - t).quo(a + t) end # Returns an alphabetically sorted array of any non-standard bases # (other than 'atgcu'). # # s = Bio::Sequence::NA.new('atgStgQccR') # puts s.illegal_bases #=> ["q", "r", "s"] # --- # *Returns*:: Array object def illegal_bases self.scan(/[^atgcu]/).sort.uniq end # Estimate molecular weight (using the values from BioPerl's # SeqStats.pm[http://doc.bioperl.org/releases/bioperl-1.0.1/Bio/Tools/SeqStats.html] module). # # s = Bio::Sequence::NA.new('atggcgtga') # puts s.molecular_weight #=> 2841.00708 # # RNA and DNA do not have the same molecular weights, # # s = Bio::Sequence::NA.new('auggcguga') # puts s.molecular_weight #=> 2956.94708 # --- # *Returns*:: Float object def molecular_weight if self.rna? Bio::NucleicAcid.weight(self, true) else Bio::NucleicAcid.weight(self) end end # Create a ruby regular expression instance # (Regexp)[http://corelib.rubyonrails.org/classes/Regexp.html] # # s = Bio::Sequence::NA.new('atggcgtga') # puts s.to_re #=> /atggcgtga/ # --- # *Returns*:: Regexp object def to_re if self.rna? Bio::NucleicAcid.to_re(self.dna, true) else Bio::NucleicAcid.to_re(self) end end # Generate the list of the names of each nucleotide along with the # sequence (full name). Names used in bioruby are found in the # Bio::AminoAcid::NAMES hash. # # s = Bio::Sequence::NA.new('atg') # puts s.names #=> ["Adenine", "Thymine", "Guanine"] # --- # *Returns*:: Array object def names array = [] self.each_byte do |x| array.push(Bio::NucleicAcid.names[x.chr.upcase]) end return array end # Returns a new sequence object with any 'u' bases changed to 't'. # The original sequence is not modified. # # s = Bio::Sequence::NA.new('augc') # puts s.dna #=> 'atgc' # puts s #=> 'augc' # --- # *Returns*:: new Bio::Sequence::NA object def dna self.tr('u', 't') end # Changes any 'u' bases in the original sequence to 't'. # The original sequence is modified. # # s = Bio::Sequence::NA.new('augc') # puts s.dna! #=> 'atgc' # puts s #=> 'atgc' # --- # *Returns*:: current Bio::Sequence::NA object (modified) def dna! self.tr!('u', 't') end # Returns a new sequence object with any 't' bases changed to 'u'. # The original sequence is not modified. # # s = Bio::Sequence::NA.new('atgc') # puts s.dna #=> 'augc' # puts s #=> 'atgc' # --- # *Returns*:: new Bio::Sequence::NA object def rna self.tr('t', 'u') end # Changes any 't' bases in the original sequence to 'u'. # The original sequence is modified. # # s = Bio::Sequence::NA.new('atgc') # puts s.dna! #=> 'augc' # puts s #=> 'augc' # --- # *Returns*:: current Bio::Sequence::NA object (modified) def rna! self.tr!('t', 'u') end def rna? self.index('u') end protected :rna? # Example: # # seq = Bio::Sequence::NA.new('gaattc') # cuts = seq.cut_with_enzyme('EcoRI') # # _or_ # # seq = Bio::Sequence::NA.new('gaattc') # cuts = seq.cut_with_enzyme('g^aattc') # --- # See Bio::RestrictionEnzyme::Analysis.cut def cut_with_enzyme(*args) Bio::RestrictionEnzyme::Analysis.cut(self, *args) end alias cut_with_enzymes cut_with_enzyme end # NA end # Sequence end # Bio