Sha256: 5017cff47476d7598317accebdd27a69ce0420ad26cd3b1bb5c257ea31ef8540
Contents?: true
Size: 1.29 KB
Versions: 2
Compression:
Stored size: 1.29 KB
Contents
Feature: Validating annotation files for incorrect names In order to submit genome annotations A user can use the "annotation" command to detect uppercase gene names to ensure that their annotation file contains none of these @disable-bundler Scenario: Validating an annotations file with an uppercase name attribute Given I successfully run `genomer init project` And I cd to "project" And I write to "assembly/scaffold.yml" with: """ --- - sequence: source: contig1 """ And I write to "assembly/sequence.fna" with: """ >contig1 AAAAATTTTTGGGGGCCCCC """ And I write to "assembly/annotations.gff" with: """ ##gff-version 3 contig1 . gene 1 3 . + 1 Name=Uppercase;ID=1 contig1 . gene 4 6 . + 1 Name=lowercase;ID=2 """ And I append to "Gemfile" with: """ gem 'genomer-plugin-validate', :path => '../../../' """ When I run `genomer validate annotations` Then the exit status should be 0 And the output should contain: """ Illegal capitalised Name attribute 'Uppercase' for '1' """ And the output should not contain: """ Illegal capitalised Name attribute 'lowercase' for '2' """
Version data entries
2 entries across 2 versions & 1 rubygems
Version | Path |
---|---|
genomer-plugin-validate-0.0.2 | features/annotations/name.feature |
genomer-plugin-validate-0.0.1 | features/annotations/name.feature |