Sha256: 4ccc3952e9b797255a7cb21dbb0a870f1852082fb375e03c5aab66f787ad3928
Contents?: true
Size: 1.41 KB
Versions: 1
Compression:
Stored size: 1.41 KB
Contents
# bio-velvet_underground [](http://travis-ci.org/wwood/bioruby-velvet_underground) This biogem is aimed at providing Ruby bindings to the velvet assembler's source code. Note: this software is under active development! ## Installation ```sh gem install bio-velvet_underground ``` ## Usage The only thing implemented at this stage is access to the binary sequence file created when velveth is run with the `-create_binary` flag. ```ruby require 'bio-velvet_underground' seqs = Bio::Velvet::Underground::BinarySequenceStore.new '/path/to/velvet/directory/CnyUnifiedSeq' seqs[1] #=> 'CACTTATCTCTACCAAAGATCACGATTTAGAATCAAACTATAAAGTTTTAGAAGATAAAGTAACAACTTATACATGGGGA' seqs.length #=> 77 (there is 77 sequences in the CnyUnifiedSeq) ``` Patches to other parts of velvet welcome. The API doc is online. For more code examples see the test files in the source tree. ## Project home page Information on the source tree, documentation, examples, issues and how to contribute, see http://github.com/wwood/bioruby-velvet_underground The BioRuby community is on IRC server: irc.freenode.org, channel: #bioruby. ## Cite This software is currently unpublished. ## Biogems.info This Biogem is published at (http://biogems.info/index.html#bio-velvet_underground) ## Copyright Copyright (c) 2014 Ben Woodcroft. See LICENSE.txt for further details.
Version data entries
1 entries across 1 versions & 1 rubygems
Version | Path |
---|---|
bio-velvet_underground-0.0.1 | README.md |