Sha256: 4314ea27cc5c7fc72d51f7d1535612205cf43ec00a416c28f50ff6a2d7910433
Contents?: true
Size: 1.05 KB
Versions: 38
Compression:
Stored size: 1.05 KB
Contents
port module Main exposing (..)
import Test.Runner.Node exposing (run)
import Json.Encode exposing (Value)
import Test exposing (..)
import Expect
import NucleotideCount exposing (nucleotideCounts, version)
tests : Test
tests =
describe "NucleotideCount"
[ test "the solution is for the correct version of the test" <|
\() -> Expect.equal 2 version
, test "empty dna strand has no nucleotides" <|
\() ->
Expect.equal { a = 0, t = 0, c = 0, g = 0 }
(nucleotideCounts "")
, test "repetitive-sequence-has-only-guanosine" <|
\() ->
Expect.equal { a = 0, t = 0, c = 0, g = 8 }
(nucleotideCounts "GGGGGGGG")
, test "counts all nucleotides" <|
\() ->
Expect.equal { a = 20, t = 21, c = 12, g = 17 }
(nucleotideCounts "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC")
]
main : Program Value
main =
run emit tests
port emit : ( String, Value ) -> Cmd msg
Version data entries
38 entries across 38 versions & 1 rubygems