Sha256: 3094e915a928180ba0ef921a47bd0a92a09b01173c7dfbfe89577cce15ca74d4
Contents?: true
Size: 1.99 KB
Versions: 119
Compression:
Stored size: 1.99 KB
Contents
extern crate nucleotide_count as dna;
use std::collections::HashMap;
fn check_dna(s: &str, pairs: &[(char, usize)]) {
// The reason for the awkward code in here is to ensure that the failure
// message for assert_eq! is as informative as possible. A simpler
// solution would simply check the length of the map, and then
// check for the presence and value of each key in the given pairs vector.
let mut m: HashMap<char, usize> = dna::nucleotide_counts(s).unwrap();
for &(k, v) in pairs.iter() {
assert_eq!((k, m.remove(&k)), (k, Some(v)));
}
// may fail with a message that clearly shows all extra pairs in the map
assert_eq!(m.iter().collect::<Vec<(&char,&usize)>>(), vec!());
}
#[test]
fn count_returns_result() {
assert!(dna::count('A', "").is_ok());
}
#[test]
#[ignore]
fn test_count_empty() {
assert_eq!(dna::count('A', ""), Ok(0));
}
#[test]
#[ignore]
fn count_invalid_nucleotide() {
assert!(dna::count('X', "A").is_err());
}
#[test]
#[ignore]
fn count_invalid_dna() {
assert!(dna::count('A', "AX").is_err());
}
#[test]
#[ignore]
fn test_count_repetitive_cytosine() {
assert_eq!(dna::count('C', "CCCCC"), Ok(5));
}
#[test]
#[ignore]
fn test_count_only_thymine() {
assert_eq!(dna::count('T', "GGGGGTAACCCGG"), Ok(1));
}
#[test]
#[ignore]
fn counts_returns_result() {
assert!(dna::nucleotide_counts("ACGT").is_ok());
}
#[test]
#[ignore]
fn test_nucleotide_count_empty() {
check_dna(
"",
&[('A', 0), ('T', 0), ('C', 0), ('G', 0)]);
}
#[test]
#[ignore]
fn test_nucleotide_count_only_guanine() {
check_dna(
"GGGGGGGG",
&[('A', 0), ('T', 0), ('C', 0), ('G', 8)]);
}
#[test]
#[ignore]
fn test_nucleotide_count_counts_all() {
check_dna(
"AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAA\
GAGTGTCTGATAGCAGC",
&[('A', 20), ('T', 21), ('C', 12), ('G', 17)]);
}
#[test]
#[ignore]
fn counts_invalid_nucleotide_results_in_err() {
assert!(dna::nucleotide_counts("GGXXX").is_err());
}
Version data entries
119 entries across 119 versions & 1 rubygems