INFO bio-gff3: Memory used BaseLine RAM 10M, VMEM 14M
 INFO bio-gff3: ---- Digest DB and store data in mRNA Hash (NoCache) <>
 INFO bio-gff3: Added transcript with component ID Transcript:trans-1 <>
 INFO bio-gff3: Adding exon <Transcript:trans-1> <>
 INFO bio-gff3: Adding exon <Transcript:trans-1> <>
 INFO bio-gff3: Adding exon <Transcript:trans-1> <>
 INFO bio-gff3: Adding CDS <Transcript:trans-1> <>
 INFO bio-gff3: Adding CDS <Transcript:trans-1> <>
 INFO bio-gff3: Adding CDS <Transcript:trans-1> <>
 INFO bio-gff3: Added transcript with component ID Transcript:trans-2 <>
 INFO bio-gff3: Adding exon <Transcript:trans-2> <>
 INFO bio-gff3: Adding exon <Transcript:trans-2> <>
 INFO bio-gff3: Adding exon <Transcript:trans-2> <>
 WARN bio-gff3: Container <Component> has no ID, so using sequence name instead <Contig2 1 2000>
 INFO bio-gff3: Added Component with component ID Contig2 1 2000 <>
 WARN bio-gff3: Container <Component> has no ID, so using sequence name instead <Contig2 2001 5000>
 INFO bio-gff3: Added Component with component ID Contig2 2001 5000 <>
 WARN bio-gff3: Container <Component> has no ID, so using sequence name instead <Contig2 5001 20000>
 INFO bio-gff3: Added Component with component ID Contig2 5001 20000 <>
 WARN bio-gff3: Container <Component> has no ID, so using sequence name instead <Contig2 2001 37450>
 INFO bio-gff3: Added Component with component ID Contig2 2001 37450 <>
 INFO bio-gff3: Added transcript with component ID Transcript:trans-3 <>
 INFO bio-gff3: Added transcript with component ID Transcript:trans-4 <>
 INFO bio-gff3: Added Component with component ID Clone:AL12345.2 <>
 INFO bio-gff3: Adding mRNA <mRNA:trans-8> <>
 INFO bio-gff3: Adding CDS <mRNA:trans-8> <>
 INFO bio-gff3: Adding CDS <mRNA:trans-8> <>
 INFO bio-gff3: Adding CDS <mRNA:trans-8> <>
 INFO bio-gff3: Added Component with component ID Clone:ABC123 <>
 INFO bio-gff3: Added gene with component ID Misc:thing1 <>
 INFO bio-gff3: Adding gene <Misc:thing1> <>
 INFO bio-gff3: Adding mRNA <Misc:thing2> <>
 INFO bio-gff3: Adding CDS <Misc:thing3> <>
 INFO bio-gff3: Added contig with component ID test01 <>
 INFO bio-gff3: Added gene with component ID gene01 <>
 INFO bio-gff3: Adding gene <gene01> <>
 INFO bio-gff3: Adding mRNA <mrna01short> <>
 INFO bio-gff3: Adding mRNA <mrna01> <>
 INFO bio-gff3: Adding mRNA <mrna01a> <>
 INFO bio-gff3: Adding exon <exon01> <>
 INFO bio-gff3: Adding exon <exon02> <>
 INFO bio-gff3: Adding exon <exon02a> <>
 INFO bio-gff3: Adding CDS <cds_short> <>
 INFO bio-gff3: Adding CDS <cds1> <>
 INFO bio-gff3: Adding CDS <cds1> <>
 INFO bio-gff3: Adding CDS <cds2> <>
 INFO bio-gff3: find_component: Matched (long search) column 0 and location <Transcript:trans-1>
 WARN bio-gff3: No sequence information for <Transcript:trans-1>
 INFO bio-gff3: find_component: Matched (long search) column 0 and location <Clone:AL12345.2>
 WARN bio-gff3: No sequence information for <mRNA:trans-8>
 INFO bio-gff3: find_component: Matched (long search) column 0 and location <Clone:ABC123>
 WARN bio-gff3: No sequence information for <Misc:thing3>
 INFO bio-gff3: find_component: Matched seqname <test01>
>cds_short Sequence:test01_1:400 (3:14)
GAAGATTTGTAT
 INFO bio-gff3: find_component: Matched seqname <test01>
>cds1 Sequence:test01_1:400 (164:190, 192:200)
TGGCGACTATCGGTCGAAGTTAAGACATTCATGGGC
 INFO bio-gff3: find_component: Matched seqname <test01>
>cds2 Sequence:test01_1:400 (192:200)
TTCATGGGC
 INFO bio-gff3: Memory used Done RAM 10M, VMEM 14M