Sha256: 284a3b5304408f21c8d979da59cab30b54dc556eb05e5f706cd3419bee55ad4e
Contents?: true
Size: 1.52 KB
Versions: 3
Compression:
Stored size: 1.52 KB
Contents
require_relative "SNP" require 'bio-samtools' module Bio::PolyploidTools class SNPSequenceException < RuntimeError end class SNPSequence < SNP attr_accessor :sequence_original #Format: #snp name,chromsome from contig,microarray sequence #BS00068396_51,2AS,CGAAGCGATCCTACTACATTGCGTTCCTTTCCCACTCCCAGGTCCCCCTA[T/C]ATGCAGGATCTTGATTAGTCGTGTGAACAACTGAAATTTGAGCGCCACAA def self.parse(reg_str) reg_str.chomp! snp = SNPSequence.new arr = reg_str.split(",") if arr.size == 3 snp.gene, snp.chromosome, snp.sequence_original = reg_str.split(",") elsif arr.size == 2 snp.gene, snp.sequence_original = arr else throw SNPSequenceException.new "Need two or three fields to parse, and got #{arr.size} in #{reg_str}" end #snp.position = snp.position.to_i #snp.original.upcase! #snp.snp.upcase! snp.chromosome. strip! snp.parse_sequence_snp snp.exon_list = Hash.new() snp end def parse_snp end def parse_sequence_snp pos = 0 match_data = /(?<pre>\w*)\[(?<org>[ACGT])\/(?<snp>[ACGT])\](?<pos>\w*)/.match(sequence_original.strip) if match_data @position = Regexp.last_match(:pre).size + 1 @original = Regexp.last_match(:org) @snp = Regexp.last_match(:snp) amb_base = Bio::NucleicAcid.to_IUAPC("#{@original}#{@snp}") @template_sequence = "#{Regexp.last_match(:pre)}#{amb_base}#{Regexp.last_match(:pos)}" end end end end
Version data entries
3 entries across 3 versions & 1 rubygems