Sha256: 21241ffc8ce03582dc9ca2ff2ece076ae1a0bb82b8b2a66707291c8e2615a8c0
Contents?: true
Size: 1.23 KB
Versions: 147
Compression:
Stored size: 1.23 KB
Contents
{
"exercise": "nucleotide-count",
"version": "1.0.0",
"cases": [
{
"description": "count all nucleotides in a strand",
"cases": [
{
"description": "empty strand",
"property": "nucleotideCounts",
"strand": "",
"expected": {
"A": 0,
"C": 0,
"G": 0,
"T": 0
}
},
{
"description": "strand with repeated nucleotide",
"property": "nucleotideCounts",
"strand": "GGGGGGG",
"expected": {
"A": 0,
"C": 0,
"G": 7,
"T": 0
}
},
{
"description": "strand with multiple nucleotides",
"property": "nucleotideCounts",
"strand": "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC",
"expected": {
"A": 20,
"C": 12,
"G": 17,
"T": 21
}
},
{
"description": "strand with invalid nucleotides",
"property": "nucleotideCounts",
"strand": "AGXXACT",
"expected": {
"error": "Invalid nucleotide in strand"
}
}
]
}
]
}
Version data entries
147 entries across 147 versions & 1 rubygems