require 'helper' class TestScaffolder < Test::Unit::TestCase context Scaffolder::Region do context "adding instance methods with attribute method" do setup do @attr = :some_attribute end should "create a single accessor attribute" do Scaffolder::Region.attribute @attr methods = Scaffolder::Region.instance_methods.map{|m| m.to_s} assert(methods.include?(@attr.to_s)) end should "return nil until attribute value is stored" do Scaffolder::Region.attribute @attr region = Scaffolder::Region.new assert_equal(region.send(@attr),nil) region.send(@attr,5) assert_equal(region.send(@attr),5) end should "allow specification of default value" do Scaffolder::Region.attribute @attr, :default => 1 region = Scaffolder::Region.new assert_equal(region.send(@attr),1) region.send(@attr,5) assert_equal(region.send(@attr),5) end should "allow specification of default value using a block" do Scaffolder::Region.attribute @attr, :default => lambda{|s| s.entry_type } region = Scaffolder::Region.new assert_equal(region.send(@attr),region.entry_type) region.send(@attr,5) assert_equal(region.send(@attr),5) end end context "passing the yaml hash to the generate method" do setup do Scaffolder::Region.attribute(:one) Scaffolder::Region.attribute(:two) @tags = {'one' => 1, 'two' => 2} end should "should call each tag in the hash as a method to store the value" do Scaffolder::Region.any_instance.expects(:one).with(1) Scaffolder::Region.any_instance.expects(:two).with(2) Scaffolder::Region.generate(@tags) end should "return an instantiated region object" do region = Scaffolder::Region.generate(@tags) assert_equal(region.one,1) assert_equal(region.two,2) end should "throw UnknownAttributeError for an unknown attribute" do assert_raise Scaffolder::Errors::UnknownAttributeError do Scaffolder::Region.generate({:three => 3}) end end end context "attributes" do should_have_attribute Scaffolder::Region, :start, :stop, :reverse, :raw_sequence should "return the class name as the entry type" do Scaffolder::Region::NewRegion = Class.new(Scaffolder::Region) assert_equal(Scaffolder::Region::NewRegion.new.entry_type,:newregion) end should "return 1 as default value for start attribute" do sequence = Scaffolder::Region.new assert_equal(sequence.start,1) end should "return #raw_sequence length as default value for stop attribute" do length = 5 sequence = Scaffolder::Region.new sequence.raw_sequence 'N' * length assert_equal(sequence.stop,length) end end context "generating the processed sequence" do [:sequence_hook, :raw_sequence].each do |method| context "using the #{method} method" do setup do # Test class to prevent interference with other tests @s = Class.new(Scaffolder::Region).new @s.class.send(:define_method,method,lambda{'ATGCCAGATAACTGACTAGCATG'}) end should "return the sequence when no other options are passed" do assert_equal(@s.sequence,'ATGCCAGATAACTGACTAGCATG') end should "reverse complement sequence when passed the reverse option" do @s.reverse true assert_equal(@s.sequence, 'CATGCTAGTCAGTTATCTGGCAT') end should "create subsequence when passed sequence coordinates" do @s.start 5 @s.stop 20 assert_equal(@s.sequence,'CAGATAACTGACTAGC') end should "raise a CoordinateError when start is less than 1" do @s.start 0 assert_raise(Scaffolder::Errors::CoordinateError){ @s.sequence } end should "raise a CoordinateError when stop is greater than sequence " do @s.stop 24 assert_raise(Scaffolder::Errors::CoordinateError){ @s.sequence } end should "raise a CoordinateError when stop is greater than start " do @s.start 6 @s.stop 5 assert_raise(Scaffolder::Errors::CoordinateError){ @s.sequence } end end end end should "instantiate return corresponding region subclass when requested" do Scaffolder::Region::Type = Class.new assert_equal(Scaffolder::Region['type'],Scaffolder::Region::Type) end end end