# # = bio/sequence.rb - biological sequence class # # Copyright:: Copyright (C) 2000-2006 # Toshiaki Katayama <k@bioruby.org>, # Yoshinori K. Okuji <okuji@enbug.org>, # Naohisa Goto <ng@bioruby.org>, # Ryan Raaum <ryan@raaum.org>, # Jan Aerts <jan.aerts@bbsrc.ac.uk> # License:: The Ruby License # # $Id: sequence.rb,v 0.58.2.12 2008/06/17 15:25:22 ngoto Exp $ # require 'bio/sequence/compat' module Bio # = DESCRIPTION # Bio::Sequence objects represent annotated sequences in bioruby. # A Bio::Sequence object is a wrapper around the actual sequence, # represented as either a Bio::Sequence::NA or a Bio::Sequence::AA object. # For most users, this encapsulation will be completely transparent. # Bio::Sequence responds to all methods defined for Bio::Sequence::NA/AA # objects using the same arguments and returning the same values (even though # these methods are not documented specifically for Bio::Sequence). # # = USAGE # # Create a nucleic or amino acid sequence # dna = Bio::Sequence.auto('atgcatgcATGCATGCAAAA') # rna = Bio::Sequence.auto('augcaugcaugcaugcaaaa') # aa = Bio::Sequence.auto('ACDEFGHIKLMNPQRSTVWYU') # # # Print it out # puts dna.to_s # puts aa.to_s # # # Get a subsequence, bioinformatics style (first nucleotide is '1') # puts dna.subseq(2,6) # # # Get a subsequence, informatics style (first nucleotide is '0') # puts dna[2,6] # # # Print in FASTA format # puts dna.output(:fasta) # # # Print all codons # dna.window_search(3,3) do |codon| # puts codon # end # # # Splice or otherwise mangle your sequence # puts dna.splicing("complement(join(1..5,16..20))") # puts rna.splicing("complement(join(1..5,16..20))") # # # Convert a sequence containing ambiguity codes into a # # regular expression you can use for subsequent searching # puts aa.to_re # # # These should speak for themselves # puts dna.complement # puts dna.composition # puts dna.molecular_weight # puts dna.translate # puts dna.gc_percent class Sequence autoload :Common, 'bio/sequence/common' autoload :NA, 'bio/sequence/na' autoload :AA, 'bio/sequence/aa' autoload :Generic, 'bio/sequence/generic' autoload :Format, 'bio/sequence/format' autoload :Adapter, 'bio/sequence/adapter' include Format # Create a new Bio::Sequence object # # s = Bio::Sequence.new('atgc') # puts s #=> 'atgc' # # Note that this method does not intialize the contained sequence # as any kind of bioruby object, only as a simple string # # puts s.seq.class #=> String # # See Bio::Sequence#na, Bio::Sequence#aa, and Bio::Sequence#auto # for methods to transform the basic String of a just created # Bio::Sequence object to a proper bioruby object # --- # *Arguments*: # * (required) _str_: String or Bio::Sequence::NA/AA object # *Returns*:: Bio::Sequence object def initialize(str) @seq = str end # Pass any unknown method calls to the wrapped sequence object. see # http://www.rubycentral.com/book/ref_c_object.html#Object.method_missing def method_missing(sym, *args, &block) #:nodoc: begin seq.__send__(sym, *args, &block) rescue NoMethodError => evar lineno = __LINE__ - 2 file = __FILE__ bt_here = [ "#{file}:#{lineno}:in \`__send__\'", "#{file}:#{lineno}:in \`method_missing\'" ] if bt_here == evar.backtrace[0, 2] then bt = evar.backtrace[2..-1] evar = evar.class.new("undefined method \`#{sym.to_s}\' for #{self.inspect}") evar.set_backtrace(bt) end #p lineno #p file #p bt_here #p evar.backtrace raise(evar) end end # The sequence identifier (String). For example, for a sequence # of Genbank origin, this is the locus name. # For a sequence of EMBL origin, this is the primary accession number. attr_accessor :entry_id # A String with a description of the sequence (String) attr_accessor :definition # Features (An Array of Bio::Feature objects) attr_accessor :features # References (An Array of Bio::Reference objects) attr_accessor :references # Comments (String or an Array of String) attr_accessor :comments # Keywords (An Array of String) attr_accessor :keywords # Links to other database entries. # (An Array of Bio::Sequence::DBLink objects) attr_accessor :dblinks # Bio::Sequence::NA/AA attr_accessor :moltype # The sequence object, usually Bio::Sequence::NA/AA, # but could be a simple String attr_accessor :seq #--- # Attributes below have been added during BioHackathon2008 #+++ # Version number of the sequence (String or Integer). # Unlike <tt>entry_version</tt>, <tt>sequence_version</tt> will be changed # when the submitter of the sequence updates the entry. # Normally, the same entry taken from different databases (EMBL, GenBank, # and DDBJ) may have the same sequence_version. attr_accessor :sequence_version # Topology (String). "circular", "linear", or nil. attr_accessor :topology # Strandedness (String). "single" (single-stranded), # "double" (double-stranded), "mixed" (mixed-stranded), or nil. attr_accessor :strandedness # molecular type (String). "DNA" or "RNA" for nucleotide sequence. attr_accessor :molecule_type # Data Class defined by EMBL (String) # See http://www.ebi.ac.uk/embl/Documentation/User_manual/usrman.html#3_1 attr_accessor :data_class # Taxonomic Division defined by EMBL/GenBank/DDBJ (String) # See http://www.ebi.ac.uk/embl/Documentation/User_manual/usrman.html#3_2 attr_accessor :division # Primary accession number (String) attr_accessor :primary_accession # Secondary accession numbers (Array of String) attr_accessor :secondary_accessions # Created date of the sequence entry (Date, DateTime, Time, or String) attr_accessor :date_created # Last modified date of the sequence entry (Date, DateTime, Time, or String) attr_accessor :date_modified # Release information when created (String) attr_accessor :release_created # Release information when last-modified (String) attr_accessor :release_modified # Version of the entry (String or Integer). # Unlike <tt>sequence_version</tt>, <tt>entry_version</tt> is a database # maintainer's internal version number. # The version number will be changed when the database maintainer # modifies the entry. # The same enrty in EMBL, GenBank, and DDBJ may have different # entry_version. attr_accessor :entry_version # Organism species (String). For example, "Escherichia coli". attr_accessor :species # Organism classification, taxonomic classification of the source organism. # (Array of String) attr_accessor :classification alias taxonomy classification # (not well supported) Organelle information (String). attr_accessor :organelle # Namespace of the sequence IDs described in entry_id, primary_accession, # and secondary_accessions methods (String). # For example, 'EMBL', 'GenBank', 'DDBJ', 'RefSeq'. attr_accessor :id_namespace # Sequence identifiers which are not described in entry_id, # primary_accession,and secondary_accessions methods # (Array of Bio::Sequence::DBLink objects). # For example, NCBI GI number can be stored. # Note that only identifiers of the entry itself should be stored. # For database cross references, <tt>dblinks</tt> should be used. attr_accessor :other_seqids # Guess the type of sequence, Amino Acid or Nucleic Acid, and create a # new sequence object (Bio::Sequence::AA or Bio::Sequence::NA) on the basis # of this guess. This method will change the current Bio::Sequence object. # # s = Bio::Sequence.new('atgc') # puts s.seq.class #=> String # s.auto # puts s.seq.class #=> Bio::Sequence::NA # --- # *Returns*:: Bio::Sequence::NA/AA object def auto @moltype = guess if @moltype == NA @seq = NA.new(seq) else @seq = AA.new(seq) end end # Given a sequence String, guess its type, Amino Acid or Nucleic Acid, and # return a new Bio::Sequence object wrapping a sequence of the guessed type # (either Bio::Sequence::AA or Bio::Sequence::NA) # # s = Bio::Sequence.auto('atgc') # puts s.seq.class #=> Bio::Sequence::NA # --- # *Arguments*: # * (required) _str_: String *or* Bio::Sequence::NA/AA object # *Returns*:: Bio::Sequence object def self.auto(str) seq = self.new(str) seq.auto return seq end # Guess the class of the current sequence. Returns the class # (Bio::Sequence::AA or Bio::Sequence::NA) guessed. In general, used by # developers only, but if you know what you are doing, feel free. # # s = Bio::Sequence.new('atgc') # puts s.guess #=> Bio::Sequence::NA # # There are three parameters: `threshold`, `length`, and `index`. # # The `threshold` value (defaults to 0.9) is the frequency of # nucleic acid bases [AGCTUagctu] required in the sequence for this method # to produce a Bio::Sequence::NA "guess". In the default case, if less # than 90% of the bases (after excluding [Nn]) are in the set [AGCTUagctu], # then the guess is Bio::Sequence::AA. # # s = Bio::Sequence.new('atgcatgcqq') # puts s.guess #=> Bio::Sequence::AA # puts s.guess(0.8) #=> Bio::Sequence::AA # puts s.guess(0.7) #=> Bio::Sequence::NA # # The `length` value is how much of the total sequence to use in the # guess (default 10000). If your sequence is very long, you may # want to use a smaller amount to reduce the computational burden. # # s = Bio::Sequence.new(A VERY LONG SEQUENCE) # puts s.guess(0.9, 1000) # limit the guess to the first 1000 positions # # The `index` value is where to start the guess. Perhaps you know there # are a lot of gaps at the start... # # s = Bio::Sequence.new('-----atgcc') # puts s.guess #=> Bio::Sequence::AA # puts s.guess(0.9,10000,5) #=> Bio::Sequence::NA # --- # *Arguments*: # * (optional) _threshold_: Float in range 0,1 (default 0.9) # * (optional) _length_: Fixnum (default 10000) # * (optional) _index_: Fixnum (default 1) # *Returns*:: Bio::Sequence::NA/AA def guess(threshold = 0.9, length = 10000, index = 0) str = seq.to_s[index,length].to_s.extend Bio::Sequence::Common cmp = str.composition bases = cmp['A'] + cmp['T'] + cmp['G'] + cmp['C'] + cmp['U'] + cmp['a'] + cmp['t'] + cmp['g'] + cmp['c'] + cmp['u'] total = str.length - cmp['N'] - cmp['n'] if bases.to_f / total > threshold return NA else return AA end end # Guess the class of a given sequence. Returns the class # (Bio::Sequence::AA or Bio::Sequence::NA) guessed. In general, used by # developers only, but if you know what you are doing, feel free. # # puts .guess('atgc') #=> Bio::Sequence::NA # # There are three optional parameters: `threshold`, `length`, and `index`. # # The `threshold` value (defaults to 0.9) is the frequency of # nucleic acid bases [AGCTUagctu] required in the sequence for this method # to produce a Bio::Sequence::NA "guess". In the default case, if less # than 90% of the bases (after excluding [Nn]) are in the set [AGCTUagctu], # then the guess is Bio::Sequence::AA. # # puts Bio::Sequence.guess('atgcatgcqq') #=> Bio::Sequence::AA # puts Bio::Sequence.guess('atgcatgcqq', 0.8) #=> Bio::Sequence::AA # puts Bio::Sequence.guess('atgcatgcqq', 0.7) #=> Bio::Sequence::NA # # The `length` value is how much of the total sequence to use in the # guess (default 10000). If your sequence is very long, you may # want to use a smaller amount to reduce the computational burden. # # # limit the guess to the first 1000 positions # puts Bio::Sequence.guess('A VERY LONG SEQUENCE', 0.9, 1000) # # The `index` value is where to start the guess. Perhaps you know there # are a lot of gaps at the start... # # puts Bio::Sequence.guess('-----atgcc') #=> Bio::Sequence::AA # puts Bio::Sequence.guess('-----atgcc',0.9,10000,5) #=> Bio::Sequence::NA # --- # *Arguments*: # * (required) _str_: String *or* Bio::Sequence::NA/AA object # * (optional) _threshold_: Float in range 0,1 (default 0.9) # * (optional) _length_: Fixnum (default 10000) # * (optional) _index_: Fixnum (default 1) # *Returns*:: Bio::Sequence::NA/AA def self.guess(str, *args) self.new(str).guess(*args) end # Transform the sequence wrapped in the current Bio::Sequence object # into a Bio::Sequence::NA object. This method will change the current # object. This method does not validate your choice, so be careful! # # s = Bio::Sequence.new('RRLE') # puts s.seq.class #=> String # s.na # puts s.seq.class #=> Bio::Sequence::NA !!! # # However, if you know your sequence type, this method may be # constructively used after initialization, # # s = Bio::Sequence.new('atgc') # s.na # --- # *Returns*:: Bio::Sequence::NA def na @seq = NA.new(seq) @moltype = NA end # Transform the sequence wrapped in the current Bio::Sequence object # into a Bio::Sequence::NA object. This method will change the current # object. This method does not validate your choice, so be careful! # # s = Bio::Sequence.new('atgc') # puts s.seq.class #=> String # s.aa # puts s.seq.class #=> Bio::Sequence::AA !!! # # However, if you know your sequence type, this method may be # constructively used after initialization, # # s = Bio::Sequence.new('RRLE') # s.aa # --- # *Returns*:: Bio::Sequence::AA def aa @seq = AA.new(seq) @moltype = AA end # Create a new Bio::Sequence object from a formatted string # (GenBank, EMBL, fasta format, etc.) # # s = Bio::Sequence.input(str) # --- # *Arguments*: # * (required) _str_: string # * (optional) _format_: format specification (class or nil) # *Returns*:: Bio::Sequence object def self.input(str, format = nil) if format then klass = format else klass = Bio::FlatFile::AutoDetect.default.autodetect(str) end obj = klass.new(str) obj.to_biosequence end # alias of Bio::Sequence.input def self.read(str, format = nil) input(str, format) end # accession numbers of the sequence # # *Returns*:: Array of String def accessions [ primary_accession, secondary_accessions ].flatten.compact end # Normally, users should not call this method directly. # Use Bio::*#to_biosequence (e.g. Bio::GenBank#to_biosequence). # # Creates a new Bio::Sequence object from database data with an # adapter module. def self.adapter(source_data, adapter_module) biosequence = self.new(nil) biosequence.instance_eval { remove_instance_variable(:@seq) @source_data = source_data } biosequence.extend(adapter_module) biosequence end end # Sequence end # Bio